Extracellular matrix-producing composition using MAST4 gene and preparation method therefor

11180573 · 2021-11-23

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a composition for producing an extracellular matrix from a eukaryotic cell, the composition comprising a polypeptide or compound capable of specifically binding to a microtubule associated serine/threonine kinase family member 4 (MAST4) protein or a fragment thereof or a polynucleotide, polypeptide or compound capable of specifically binding to a nucleic acid coding for the MAST4 protein or a fragment thereof, and a composition for promoting chondrogenesis, comprising the same composition.

Claims

1. A method of producing extracellular matrix from eukaryotic cells, comprising contacting the eukaryotic cells with a composition comprising a compound capable of specifically binding to a nucleic acid encoding Microtubule Associated Serine/Threonine Kinase Family Member 4 (MAST4) protein or a fragment thereof and inhibits expression or activity of the MAST4 protein, wherein the compound capable of specifically binding to the nucleic acid encoding the MAST4 protein or the fragment thereof is CRISPR-Cas comprising guide RNA specific to the nucleic acid encoding the MAST4 protein or the fragment thereof, wherein the eukaryotic cells are chondrocytes, fibroblasts or mesenchymal stem cells.

2. The method of claim 1, wherein the nucleic acid encodes the MAST4 protein of any one amino acid sequence of SEQ ID NOS: 1 to 7 and 15, or the nucleic acid encoding the MAST4 protein comprises any one polynucleotide sequence of SEQ ID NOS: 8 to 14 and 16.

3. The method of claim 1, wherein the guide RNA is a dual RNA comprising CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA) specific to the nucleic acid encoding the MAST4 protein or the fragment thereof, or a single strand guide RNA comprising parts of the crRNA and the tracrRNA and hybridizing with the nucleic acid encoding the MAST4 protein or the fragment thereof.

4. The method of claim 1, wherein the eukaryotic cells are chondrocytes or mesenchymal stem cells.

5. The method of claim 1, wherein the composition promotes or induces chondrogenesis of the eukaryotic cells.

6. The method of claim 1, further comprising contacting the eukaryotic cells with TGF-β1.

7. The method of claim 1, further comprising contacting the eukaryotic cells with a chondrogenic inducer.

8. A method of preventing, treating, or improving a joint disease, the method comprising administering to a subject in need thereof at or near a joint in need thereof where cartilage is desired to be formed, eukaryotic cells in which expression or activity of Microtubule Associated Serine/Threonine Kinase Family Member 4 (MAST4) protein is inhibited, wherein the eukaryotic cells are chondrocytes, fibroblasts or mesenchymal stem cells.

9. The method of claim 8, wherein the MAST4 protein has an amino acid sequence of SEQ ID NOS: 1 to 7 or 15, or the nucleic acid encoding the MAST4 protein comprises any one polynucleotide sequence of SEQ ID NOS: 8 to 14 and 16.

10. The method of claim 8, wherein the eukaryotic cells are chondrocytes.

11. The method of claim 8, wherein the eukaryotic cells are mesenchymal stem cells.

12. The method of claim 8, further comprising administering TGF-β1.

13. The method of claim 8, further comprising administering a chondrogenic inducer.

14. A method of preventing, treating, or improving a joint disease, the method comprising (i) gene editing Microtubule Associated Serine/Threonine Kinase Family Member 4 (MAST4) in a eukaryotic cell, such that MAST4 protein expression or activity is inhibited; and (ii) administering to a subject in need thereof at or near a joint in need thereof where cartilage is desired to be formed, the eukaryotic cells obtained thereby.

15. The method of claim 14, wherein the eukaryotic cells are mesenchymal stem cells, fibroblast cells or chondrocytes.

16. The method of claim 15, wherein the eukaryotic cells are mesenchymal stem cells.

17. The method of claim 14, further comprising administering TGF-β1.

18. The method of claim 14, further comprising administering a chondrogenic inducer.

19. The method of claim 14, wherein the gene editing is carried out by binding a CRISPR-Cas comprising guide RNA specific to the nucleic acid encoding the MAST4 protein or the fragment thereof to the nucleic acid encoding the MAST4 protein or the fragment thereof.

20. The method of claim 19, wherein the guide RNA is a dual RNA comprising CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA) specific to the nucleic acid encoding the MAST4 protein or the fragment thereof, or a single strand guide RNA comprising parts of the crRNA and the tracrRNA and hybridizing with the nucleic acid encoding the MAST4 protein or the fragment thereof.

21. The method of claim 1, which is carried out in vitro.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 illustrates a method of preparing MAST4 knockout mice using a CRISPR/Cas9 system;

(2) FIG. 2A shows RT-PCR results of examining changes in expression levels of respective genes in MAST4 knockout mouse type A and B, and FIG. 2B shows protein expression patterns in MAST4 knockout mice;

(3) FIG. 3 shows identification of MAST4 knockout in C3H10T1/2 cells in which MAST4 was knocked out using the CRISPR/Cas9 system;

(4) FIG. 4 shows RT-PCR results of examining changes in expression levels of respective genes in C3H10T1/2 cells in which MAST4 was knocked out using the CRISPR/Cas9 system;

(5) FIG. 5 shows RT-PCR results of examining changes in expression levels of respective genes in a micromass culture to confirm chondrogenesis;

(6) FIG. 6 shows alcian blue staining results of examining a difference in cartilage differentiation in C3H10T1/2 cells in which MAST4 was knocked out using the CRISPR/Cas9 system;

(7) FIG. 7 shows sequence information of target genes used to knockout MAST4 of human cells;

(8) FIG. 8A shows human chondrocytes in which MAST4 was knocked out using siRNA, and FIG. 8B shows expression levels of extracellular matrix factors in human chondrocytes in which MAST4 was knocked out using the CRISPR/Cas9 system;

(9) FIG. 9 shows changes in the expression level of MAST4 after treatment of human primary chondrocytes with TGF-β1, and expression levels of extracellular matrix factors thereby; and

(10) FIG. 10 shows chondrogenesis and regeneration effects in the tibia of the MAST4 knockout mouse.

MODE OF DISCLOSURE

(11) Hereinafter, the present disclosure will be described in more detail with reference to embodiments. However, these embodiments are for illustrative purposes only, and the scope of the present disclosure is not intended to be limited by these embodiments.

Example 1

Confirmation of Increased Expression of Cartilage Component in MAST4 Knockout Mouse

1-1. Preparation of MAST4 Knockout Mouse Using CRISPR/Cas9 System

(12) To examine whether an extracellular matrix as a cartilage component was increased by suppressing MAST4 expression, MAST4 knockout mice were prepared using a CRISPR/Cas9 system.

(13) In detail, to prepare CRISPR knockout mice, pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene, #42230), donated by Dr. Feng Zhang (Cong et al., 2013), was used as a plasmid capable of expressing Cas9 mRNA and guide RNA. Since MAST4 is a large protein of 7 kb or more, it was designed such that the gene editing was allowed to target two parts, exon 1 and exon 15. A guide RNA sequence targeting exon 1 of MAST4 is 5′-GGAAACTCTGTCGGAGGAAGGGG-3′ (SEQ ID NO:88) and a sequence targeting exon 15 is 5′-GGCACAAAGAGTCCCGCCAGAGG-3′ (SEQ ID NO:89). The guide RNA sequence was used to prepare oligomers as in MAST4 CRISPR oligomers of the following Table in accordance with the manufacturer's protocol (http://crispr.mit.edu/, Zhang Feng Lab), and each oligomer was inserted into a px330 plasmid to clone two plasmids targeting exon 1 and exon 15, respectively.

(14) TABLE-US-00001 TABLE 1 MAST4 exon 1 CRISPR F 5′-caccGGAAACTCTGTCGGAGGAA (SEQ ID NO: 18) G-3′ MAST4 exon 1 CRISPR R 5′-aaacCTTCCTCCGACAGAGTTTC (SEQ ID NO: 19) C-3′ MAST4 exon 15 CRISPR F 5′-caccGGCACAAAGAGTCCCGCCA (SEQ ID NO: 20) G-3′ MAST4 exon 15 CRISPR R 5′-aaacCTGGCGGGACTCTTTGTGC (SEQ ID NO: 21) C-3′

(15) To obtain embryos, 5 IU of pregnant mare serum gonadotrophin (PMSG; Prospec, cat. No. HOR-272) was administered to a C57BU6J female mouse 2 days before mating, and after 47 hours, 5 IU of humanchorionic gonadotrophin (hCG; Prospec, cat. HOR-250) was administered thereto . . . . Thereafter, the mouse was mated with C57BL/6J male mouse, and embryos were obtained from fallopian tubes. A microinjection mixture including 5 ng/μl of the prepared plasmid and 10 ng of ssDNA donor was injected into the pronuclei of the embryos at a one-cell-stage with reference to an existing standard protocol (Gordon and Ruddle, 1981). The injected one-cell-embryos were transferred to pseudopregnant ICR mice.

(16) Phenotypic analysis of born mice was performed for exon 1 and exon 15. Finally, two types of MAST4 knockout mice were obtained. Information about the two types of MAST4 knockout mice, type A and type B are shown as in FIG. 1 and the following Table 2 (5′.fwdarw.3′).

(17) TABLE-US-00002 TABLE 2 Type A MAST4 KO ATGGGGGAGAAAGTTTCCGAGGCGCCTGAGCCCGT (71 bp deletion in exon 1) GCCCCGGGGCTGCAGCGGACACGGCGCCCGGACCC (SEQ ID NO: 22) TAGTCTCTTCGGCGGCAGCCGTGTCCTCGGAGGGCG CTTCCTCAGCGGAGTCATCCTCTGGCTCGGAAACTCT GTCGGAGGAAGGGGAGCCCAGCCGCTTCTCCTGCA GGTCGCAGCCGCCGCGGCCGCCGGGCGGCGCCCT GGGAACCCGGCTACCCGCCGCGTGGGCTCCCGCGC GCGTGGCTCTGGAGCGTGGAGTCCCTACCCTGCCG CTGCCGCACCCGGGAGGAGCGGTGCTGCCGGTGCC CCAGGTCAGCAGCGCATCCCAAGAGGAGCAGGATGA AGAG Type B MAST4 KO ATGGGGGAGAAAGTTTCCGAGGCGCCTGAGCCCGT (90 bp deletion in exon 1) GCCCCGGGGCTGCAGCGGACACGGCGCCCGGACCC (SEQ ID NO: 23) TAGTCTCTTCGGCGGCAGCCGTGTCCTCGGAGGGCG CTTCCTCAGCGGAGTCATCCTCTGGCTCGGAAACTCT GTCGGAGGAAGGGGAGCCCAGCCGCTTCTCCTGCA GGTCGCAGCCGCCGCGGCCGCCGGGCGGCGCCCT GGGAACCCGGCTACCCGCCGCGTGGGCTCCCGCGC GCGTGGCTCTGGAGCGTGGAGTCCCTACCCTGCCG CTGCCGCACCCGGGAGGAGCGGTGCTGCCGGTGCC CCAGGTCAGCAGCGCATCCCAAGAGGAGCAGGATGA AGAG type A MAST4 KO GGCAGTCTACTTTGTTCGGCACAAAGAGTCCCGCCA (3 bp deletion in exon 15) GAGGTTTGCCATGAAGAAGATCAA (SEQ ID NO: 24) CAAGCAGAACCTCATCCTTCGGAACCAGATCCAGCA GGCCTTCGTGGAGCGAGACATCCT GACTTTCGCAGAGAACCCCTTTGTGGTCAGCATGTAT TGCTCCTTTGAAACGAGGCGTCA CTTATGCATGGTCATGGAGTATGTAGAAG type B MAST4 KO GGCAGTCTACTTTGTTCGGCACAAAGAGTCCCGCCA (13 bp deletion in exon 15) GAGGTTTGCCATGAAGAAGATCAA (SEQ ID NO: 25) CAAGCAGAACCTCATCCTTCGGAACCAGATCCAGCA GGCCTTCGTGGAGCGAGACATCCT GACTTTCGCAGAGAACCCCTTTGTGGTCAGCATGTAT TGCTCCTTTGAAACGAGGCGTCA CTTATGCATGGTCATGGAGTATGTAGAAG

(18) Bases to be deleted in Table 2 are shown in bold.

1-2. RNA-Sequencing for Confirmation of Change of Cartilage Component Expression in MAST4 Knockout Mouse

(19) To examine changes in the extracellular matrix as a cartilage component in MAST4 knockout mice prepared in Example 1-1, RNA-sequencing was performed for respective genes.

(20) In detail, 1 day-old-MAST4 knockout mice prepared in Example 1-1, hetero-type mice, and wild-type mice were sacrificed, and then their tibia was excised. Each of the excised tibias was placed in a dish containing DEPC-PBS on ice, and cartilage and bone in the tibia were separated using a needle under a dissecting microscope. The tissues separated from each group was immersed in 500 μl of TRIzol (purchased from Invitrogen), which were then used as samples. RNA was extracted according to a method well known in the art, and quantified using a nanodrop (Thermo scientific).

(21) RNA-sequencing was performed by Theragen Etex. In detail, mRNA was isolated from 2 μg of total RNA extracted from the mouse of each group using oligo(dT). After fragmentation of the mRNA, single-stranded cDNA was synthesized through random hexamer priming. This single-strand cDNA was used as a template to synthesize a second strand, thereby synthesizing a double-stranded cDNA. To prepare blunt-ends, end repair was performed, and to ligate an adapter, A-tailing and adapter ligation were performed. Thereafter, cDNA library was amplified by polymerase chain reaction (PCR). A concentration and size of the final product were examined using 2100 BioAnalyzer. The produced library was finally quantified using a KAPA library quantification kit, and then sequence interpretation was performed using Hiseq2500. To remove low-quality sequences from the interpreted sequences, filtering was performed such that reads containing 10% or more of bases marked as ′N's in the sequence information or reads containing 40% or more of bases less than Q20 were removed, and reads whose average quality is Q20 or less were also removed. The whole filtering process was performed using the in-house program. The filtered sequences were aligned to a reference genome sequence (hg19) of the corresponding species using STAR v2.4.0b (Dobin et al, 2013).

(22) Expression level was measured using Cufflinks v2.1.1 (Trapnell C. et al, 2010), and the calculated expression values were expressed as fragments read per kilobase of exon per million fragments mapped (FPKM). Ensemble 72 was used as a genetic information database, and a non-coding gene region was removed with expression-mask option. To increase measurement accuracy of the expression levels, multi-read-correction and frag-bias-correct options were additionally used, and all other options were set to default values.

(23) To examine genes which were changed by MAST4 knockout, expression values of the samples of each group, which were obtained through Cufflinks, were used. Genes, of which expression values were twice or more, as compared with those of wild-type MAST4, and which had a significance of P value <0.01, were selected, and the expression values of the selected genes and their differences are listed in Table 3.

(24) As a result, it was confirmed that expression of many genes associated with extracellular matrix as a cartilage component was increased as in the following Table 3. However, in all of the two types of MAST4 knockout mice, reduced expression of mmp8 and mmp9 which are extracellular matrix-degrading enzymes was observed.

(25) TABLE-US-00003 TABLE 3 Fold Fold induction induction in A KO in B KO ENSMUSG00000030607 Acan aggrecan [Source:MGI Symbol;Acc:MGI:99602] 4.65 5.79 ENSMUSG00000031375 Bgn biglycan [Source:MGI Symbol;Acc:MGI:88158] 2.38 2.26 ENSMUSG00000039084 Chad chondroadherin [Source:MGI Symbol;Acc:MGI:1096866] 5.90 7.79 ENSMUSG00000042254 Cilp cartilage intermediate layer protein, nucleotide pyrophosphohydrolase 2.41 1.79 [Source:MGI Symbol;Acc:MGI:2444507] ENSMUSG00000022483 Col2a1 collagen, type II, alpha 1 [Source:MGI Symbol;Acc:MGI:88452] 4.13 17.41 ENSMUSG00000026043 Col3a1 collagen, type III, alpha 1 [Source:MGI Symbol;Acc:MGI:88453] 1.47 1.18 ENSMUSG00000031502 Col4a1 collagen, type IV, alpha 1[Source:MGI Symbol;Acc:MGI:88454] 1.57 1.51 ENSMUSG00000031503 Col4a2 collagen, type IV, alpha 2 [Source:MGI Symbol;Acc:MGI:88455] 1.57 1.27 ENSMUSG00000067158 Col4a4 collagen, type IV, alpha 4 [Source:MGI Symbol;Acc:MGI:104687] 1.26 7.41 ENSMUSG00000031274 Col4a5 collagen, type IV, alpha 5 [Source:MGI Symbol;Acc:MGI:88456] 1.33 1.23 ENSMUSG00000031273 Col4a6 collagen, type IV, alpha 6 [Source:MGI Symbol;Acc:MGI:2152695] 2.90 3.33 ENSMUSG00000026837 Col5a1 collagen, type V, alpha 1 [Source:MGI Symbol;Acc:MGI:88457] 1.11 1.44 ENSMUSG00000026042 Col5a2 collagen, type V, alpha 2 [Source:MGI Symbol;Acc:MGI:88458] 1.17 1.37 ENSMUSG00000001119 Col6a1 collagen, type VI, alpha 1 [Source:MGI Symbol;Acc:MGI:88459] 2.04 1.96 ENSMUSG00000020241 Col6a2 collagen, type VI, alpha 2 [Source:MGI Symbol;Acc:MGI:88460] 1.75 1.89 ENSMUSG00000048126 Col6a3 collagen, type VI, alpha 3 [Source:MGI Symbol;Acc:MGI:88461] 2.28 2.20 ENSMUSG00000056174 Col8a2 collagen, type VIII, alpha 2 [Source:MGI Symbol;Acc:MGI:88464] 1.44 2.33 ENSMUSG00000026147 Col9a1 collagen, type IX, alpha 1 [Source:MGI Symbol;Acc:MGI:88465] 4.47 12.86 ENSMUSG00000028626 Col9a2 collagen, type IX, alpha 2 [Source:MGI Symbol;Acc:MGI:88466] 2.38 14.16 ENSMUSG00000027570 Col9a3 collagen, type IX, alpha 3 [Source:MGI Symbol;Acc:MGI:894686] 2.81 17.87 ENSMUSG00000027966 Col11a1 collagen, type XI, alpha 1 [Source:MGI Symbol;Acc:MGI:88446] 2.44 3.10 ENSMUSG00000024330 Col11a2 collagen, type XI, alpha 2 [Source:MGI Symbol;Acc:MGI:88447] 2.06 7.45 ENSMUSG00000032332 Col12a1 collagen, type XII, alpha 1 [Source:MGI Symbol;Acc:MGI:88448] 1.93 1.72 ENSMUSG00000022371 Col14a1 collagen, type XIV, alpha 1 [Source:MGI Symbol;Acc:MGI:1341272] 1.83 1.60 ENSMUSG00000028339 Col15a1 collagen, type XV, alpha 1 [Source:MGI Symbol;Acc:MGI:88449] 2.16 2.54 ENSMUSG00000040690 Col16a1 collagen, type XVI, alpha 1 [Source:MGI Symbol;Acc:MGI:1095396] 1.73 1.66 ENSMUSG00000028197 Col24a1 collagen, type XXIV, alpha 1 [Source:MGI Symbol;Acc:MGI:1918605] 1.48 1.65 ENSMUSG00000045672 Col27a1 collagen, type XXVII, alpha 1 [Source:MGI Symbol;Acc:MGI:2672118] 1.83 2.37 ENSMUSG00000031849 Comp cartilage oligomeric matrix protein [Source:MGI Symbol;Acc:MGI:88469] 3.86 6.56 ENSMUSG00000006369 Fbln1 fibulin 1 [Source:MGI Symbol;Acc:MGI:95487] 1.54 1.15 ENSMUSG00000027386 Fbln7 fibulin 7 [Source:MGI Symbol;Acc:MGI;1917620] 2.90 5.36 ENSMUSG00000041559 Fmod fibromodulin [Source:MGI Symbol;Acc:MGI:1328364] 4.03 4.15 ENSMUSG00000026193 Fn1 fibronectin 1 [Source:MGI Symbol;Acc:MGI:95566] 1.62 1.34 ENSMUSG00000021613 Hapln1 hyaluronan and proteoglycan link protein 1 [Source:MGI Symbol;Acc:MGI:1337006] 1.71 6.49 ENSMUSG00000030606 Hapln3 hyaluronan and proteoglycan link protein 3 [Source:MGI Symbol;Acc:MGI:1914916] 2.87 7.01 ENSMUSG00000022025 Lect1 leukocyte cell derived chemotaxin 1 [Source:MGI Symbol;Acc:MGI:1341171] 3.90 14.35 ENSMUSG00000040533 Matn1 matrilin 1, cartilage matrix protein [Source:MGI Symbol;Acc:MGI:106591] 11.31 19.74 ENSMUSG00000020583 Matn3 matrilin 3 [Source:MGI Symbol;Acc:MGI:1328350] 4.54 16.44 ENSMUSG00000016995 Matn4 matrilin 4 [Source:MGI Symbol;Acc:MGI:1328314] 2.61 5.29 ENSMUSG00000041577 Prelp proline arginine-rich end leucine-rich repeat [Source:MGI Symbol;Acc:MGI:2151110] 2.32 2.66 ENSMUSG00000017009 Sdc4 syndecan 4 [Source:MGI Symbol;Acc:MGI:1349164] 1.63 2.09 ENSMUSG00000086596 Susd5 sushi domain containing 5 [Source:MGI Symbol;Acc:MGI:2685972] 3.90 8.99 ENSMUSG00000026668 Ucma upper zone of growth plate and cartilage matrix associated 6.85 21.57 [Source:MGI Symbol;Acc:MGI:1915777] ENSMUSG00000005800 Mmp8 matrix metallopeptidase 8 [Source:MGI Symbol;Acc:MGI:1202395] 0.44 0.11 ENSMUSG00000017737 Mmp9 matrix metallopeptidase 9 [Source:MGI Symbol;Acc:MGI:97011] 0.08 0.34

1-3. RT-PCR for Confirmation of Change of Cartilage Component Expression in MAST4 Knockout Mouse

(26) To more specifically examine changes in the extracellular matrix as a cartilage component in MAST4 knockout mice prepared in Example 1-1, a part of genes showing changes in the expression in the RNA sequencing results of Example 1-2 was selected and subjected to RT-PCR.

(27) In detail, RT-PCR was performed using a set of primers of the following Table 4 and AccuPower PCR premix (BIONEER, Korea) according to the manufacturer's instructions.

(28) TABLE-US-00004 TABLE 4 Product Name Type Sequence (5′.fwdarw.3′) size Acan Forward (custom character  26) GGTCACTGTTACCGCCACTT 430 Reverse (custom character  27) CCAGGGAGCTGATCTCGTAG Chad Forward (custom character  28) GCCAAGGACCTGCGCTGGCT 500 Reverse (custom character  29) GCTTTCTTGGACCTCTTGGT Col2a1 Forward (custom character  30) GCCAAGACCTGAAACTCTGC 494 Reverse (custom character  31) CTTGCCCCACTTACCAGTGT Col9a1 Forward (custom character  32) CGTGGATTTCCAGGCCGTGG 500 Reverse (custom character  33) TCGCTGTCCTTGATCACCAG Col11a1 Forward (custom character  34) GCTAGGTGTTCCTGGTCTGC 429 Reverse (custom character  35) CCACTTTCTCCAGCTGTTCC Comp Forward (custom character  36) AACGGCTCGCACTGCACCGA 400 Reverse (custom character  37) CCCGTTGCCGGCCCAGCCAA Fmod Forward (custom character  38) CCAGCAGTCCACCTACTACG 350 Reverse (custom character  39) TGCCTCAGCTTGGAGAAGAC Lect1 Forward (custom character  40) GTTTTGCTGGAGGAGAGAAG 520 Reverse (custom character  41) CAGTGGGTGTAGCTCCGCCT Matn1 Forward (custom character  42) GGCAAGACCTGCAATGTCTG 400 Reverse (custom character  43) TAGTCCTGGCTCCGGCCATC Matn3 Forward (custom character  44) CAGGACCAGGTGAATGAGGT 550 Reverse (custom character  45) ATCTGCATTCAGAGTGTAGC Matn4 Forward (custom character  46) AGCTCCCGCAGCGTGCGCCC 350 Reverse (custom character  47) ATGCCGCGGGCGCGCGCCTG Susd5 Forward (custom character  48) TCTCAGAATGGCTCTCAGGG 440 Reverse (custom character  49) TACCACTCCCCACAGCTGTT Ucma Forward (custom character  50) GGTCAACAGCTCCAGGAAAG 151 Reverse (custom character  51) TTTCTGGTGGCTAAGCAAGG Mmp8 Forward (custom character  52) TGATGGACCCAATGGAATCC 300 Reverse (custom character  53) GGGGTCACACGCTTTGGGTG Mmp9 Forward (custom character  54) GACGGGTATCCCTTCGACGG 422 Reverse (custom character  55) GTGGTGGCGCACCAGCGGTA Gapdh Forward (custom character  56) TGGCAAAGTGGAGATTGTTGCC 156 Reverse (custom character  57) AAGATGGTGATGGGCTTCCCG Hapln1 Forward (custom character  58) GGGCTGGACTGGTGCAATGC 280 Reverse (custom character  59) GCAAATATCTGGCCCACTTT Hapln3 Forward (custom character  60) TCCTTTGGGGACTACCAAGG 460 Reverse (custom character  61) CACCCGCCCCTTGAGGGCAG Prelp Forward (custom character  62) GCCCACAACATCCTGAGAAA 440 Reverse (custom character  63) AAGCACATCATGAGGTCCAG Fbln7 Forward (custom character  64) ACTGGGAACCGCTGTCAGCA 320 Reverse (custom character  65) ACATCCTCACAGCTCTTCCC Sdc4 Forward (custom character  66) AGGTCATCGACCCCCAGGAC 520 Reverse (custom character  67) AACTCATTGGTGGGGGCTTT Bgn Forward (custom character  68) AAGATCTCCAAGATCCATGA 270 Reverse (custom character  69) GCCTCTGAGATGCGCAGGTA

(29) As a result, results were consistent with the RNA sequencing results of Example 1-2, and it was confirmed that expression of genes associated with extracellular matrix as a cartilage component was increased (FIG. 2).

1-4. Confirmation of Expression Level of Chondrocyte Marker in MAST4 Knockout Mouse

(30) To examine the effect of MAST4 knockout on chondrocytes, Col2a1 which is known as a chondrocyte marker was stained with fluorescence in the mouse tibia.

(31) In detail, the tibia tissue was obtained from the mouse model of Example 1-1, and fixed with 4% paraformaldehyde (PFA, Wako, Osaka, JAPAN) in 0.01 M phosphate buffer saline (PBS, pH 7.4) at 4° C. overnight. The tissue was decalcified with 10% EDTA, and embedded in paraffin (Leica Biosystems, MO, USA), and sectioned 6 mm in thickness. The sample slide was stained with hematoxylin and eosin, and the tissue section was incubated with a primary antibody at 4° C. overnight. The primary antibody targets Coll2a1 (Abcam, Cambridge, UK). After washing with PBS, the tissue section was sequentially incubated with AlexaFluor 488 (Invitrogen, CA, USA) at room temperature for 2 hours. Each image was obtained using a confocal microscope LSM700 (Carl Zeiss, Oberkochen, Germany), and a representative sample section was stained with freshly prepared Russell-Movatmodified pentachrome (American MasterTech, CA, USA).

(32) As a result, FIG. 10 is an enlargement of a specific area of the observed sample, where Col2a1 (fluorescent green zone/grey background zone) was significantly increased in the tibia of the MAST4 knockout mouse model. TOPRO-3 (areas marked by red dots/gray dots) shows staining of the nuclei of chondrocytes. Therefore, it was confirmed that chondrogenesis and cartilage regeneration may be promoted by MAST4 knockout.

Example 2

Confirmation of Increased Expression of Cartilage Component in MAST4 Knockout Cells

2-1. Preparation of MAST4 Knockout Cells Using CRISPR/Cas9 System

(33) To examine whether increased extracellular matrix in the MAST4 knockout mice is also reproduced in vitro, MAST4 knockout cells were prepared using the CRISPR/Cas9 system.

(34) In detail, C3H/10T1/2, Clone 8 (ATCCCCL-226™) which is a mouse-derived fibroblast cell and is able to differentiate into chondrocytes was purchased ((C3H10T1/2 cell) provided by prof. Seon-Yong Jeong's lab, Department of Medical Genetics, School of Medicine, Ajou University). To knockout the cells, lentiCRISPR v2 (Plasmid #52961), pVSVg (AddGene 8454), and psPAX2 (AddGene 12260) were purchased from Addgene, and oligomers of the following Table 5 were used to insert guide RNA targeting exon 1 of mouse MAST4 gene (ENSMUSG00000034751) into LentiCRISPR v2 plasmid according to the manufacturer's instructions (lentiCRISPRv2 and lentiGuide oligo cloning protocol), thereby preparing a plasmid expressing guide RNA and Cas9 enzyme at the same time (as a control group, a plasmid having no guideRNA and expressing only Cas9 was used).

(35) TABLE-US-00005 TABLE 5 Oligomer Sequence mMAST4 CRISPR exon 1 sgRNA F 5′-CACCGTACCCTGCCGCTGCCGCACC-3′ (SEQ ID NO: 70) mMAST4 CRISPR exon 1 sgRNA R 5′-AAACGGTGCGGCAGCGGCAGGGTAC-3′ (SEQ ID NO: 71) mouse MAST4 exon 1 (SEQ  5′- ID NO: 72) ATGGGGGAGAAAGTTTCCGAGGCGCCTG AGCCCGTGCCCCGGGGCTGCAGCGGACA CGGCGCCCGGACCCTAGTCTCTTCGGCG GCAGCCGTGTCCTCGGAGGGCGCTTCCT CAGCGGAGTCATCCTCTGGCTCGGAAACT CTGTCGGAGGAAGGGGAGCCCAGCCGCT TCTCCTGCAGGTCGCAGCCGCCGCGGCC GCCGGGCGGCGCCCTGGGAACCCGGCT ACCCGCCGCGTGGGCTCCCGCGCGCGT GGCTCTGGAGCGTGGAGTCCCTACCCTG CCGCTGCCGCACCCGGGAGGAGCGGTG CTGCCGGTGCCCCAGGTCAGCAGCGCAT CCCAAGAGGAGCAGGATGAAGAG-3′

(36) This method is a lentivirus-based CRISPR knockout method. To prepare a virus, the three plasmids prepared above (LentiCRISPR v2 (+guide RNA): guide RNA+Cas9 expressing plasmid, pVSVg: Virus envelop plasmid, psPAX2: Virus packaging plasmid) were transfected into 293T cells using a polyethyenimine (PEI) reagent. 18 hours later, the medium was replaced with a fresh medium, and only the medium was collected, and viruses were obtained using a 0.45 μm filter. The obtained viruses were transfected into a 6-well dish to which C3H10T/12 was seeded. 24 hours after treatment with 1 ml of virus+1 ml of DMEM/FBS+2 μl of polybren, the medium was replaced with fresh DMEM/FBS. 24 hours later, only infected cells were selected by treatment with puromycin, and subcultured to 40% confluency in a 10 cm dish. Since gene editing by CRISPR may randomly occur in cells, single colony selection was performed. Cells were seeded in 10 cm dishes such that 50 cells existed in each dish. When cells formed colonies over time, these colonies were defined as one clone, and genomic DNA was extracted from each clone. PCR was performed using primers specifically amplifying exon 1 (F: 5′.fwdarw.3′ CTGTGGTCCAACCTCTGTCA (SEQ ID NO:90), R: 5′.fwdarw.3′ ATCGGCTCAGTGACACTTCC (SEQ ID NO:91)). The amplified PCR products were analyzed by the sequencing company. As a result of sequencing analysis, cells in which gene editing by frameshift was identified were used in the experiment, together with control cells. The sequences targeted by the prepared guide RNA were are in bold in Table 5. As a result of sequencing the MAST4 knockout results, deletion of two nucleotides occurred in mouse MAST4 exon 1, indicating frameshift induction.

2-2. RT-PCR for Confirmation of Change of Cartilage Component Expression in MAST4 Knockout Cells

(37) To examine changes in the extracellular matrix as a cartilage component in MAST4 knockout mice prepared in Example 1-1, RT-PCR was performed for respective genes.

(38) 10 μl of a medium containing total 10.sup.5 cells was put in the center of 12 wells, and incubated for 2 hours. 1 ml of DMEM containing 10% FBS was added to each well. 24 hours later, cells were harvested, and RNA was extracted using an easy-BLUE™ Total RNA Extraction Kit (Intron, Cat 17061) according to the manufacturer's instructions. Next, cDNA was synthesized using M-MLV reverse transcriptase (Promega, M1705) according to the manufacturer's instructions. Primers used in RT-PCR are as described in Table 4.

(39) As a result, increased expression of extracellular matrix-associated genes was also found in MAST4 knockout cells, as consistent with the results of Example 1-2 and Example 1-3 (FIG. 4), indicating that the same results as in the MAST4 knockout mouse were also obtained in vitro.

Example 3

Micromass Culture of MAST4 Knockout Cells and Confirmation of Increased Cartilage Differentiation Activity

3-1. Micromass Culture of MAST4 Knockout Cells

(40) To evaluate chondrogenic ability of the MAST4 knockout cells of Example 2-2, micromass culture was performed.

(41) In detail, MAST4 knockout cells were prepared as in Example 2-1, and micromass culture was performed with reference to a known method (Differentiation and Mineralization of Murine Mesenchymal C3H10T1/2 Cells in Micromass Culture, 2010, Rani Roy). First, 10 μl of a medium containing total 10.sup.5 fibroblast cells were put in the center of each well of a 12-well plate, and incubated for 2 hours. 1 ml of DMEM containing 10% FBS was added to each well. Thereafter, 100 ng/ml, 500 ng/ml, or 1000 ng/ml of BMP2 was added to each culture depending on the purpose of cartilage induction, respectively. Thereafter, the medium was replaced with a fresh medium every three days.

3-2. Confirmation of Reproduction of Effects of Micromass-Cultured MAST4 Knockout Cells

(42) To examine whether production of extracellular matrix as a cartilage component was also increased in the MAST4 knockout cells cultured according to Example 3-1, as in the MAST4 knockout cells of Example 2-2, and finally, chondrogenic ability was increased therein, RT-PCR was performed.

(43) In detail, cells, which were cultured for 0 day, 3 days, and 6 days from the day when the cells were seeded in a plate for micromass culture, were harvested, respectively, and RNA was extracted therefrom on the same day. RT-PCR was performed for respective genes, as in Example 1-3, and whether or not production of the cartilage component was increased was examined.

(44) As a result, as consistent with the results observed in the MAST4 knockout cells of Example 2-2, expression of extracellular matrix components was increased, and at the same time, differentiation into chondrocytes began with aggrecan expression on day 3 after induction using BMP2, and as a result, it was confirmed that chondrogenic ability was increased (FIG. 5). In particular, when MAST4 was knock-outed, some genes (hapIn1) showed no significant difference in the expression on day 3, but all of the indicated extracellular matrix-associated genes showed overexpression on day 6. In contrast, in the control group, some proteins were less expressed or rather decreased on day 6 (e.g., Matn3, or Comp). The MAST4 knockout cells were found to be useful in the overexpression of all various extracellular matrices.

3-3. Confirmation of Chondrogenesis of Mass-Cultured MAST4 Knockout Cells

(45) With regard to the overexpression of the respective extracellular matrix-associated genes observed in Example 3-2, to examine whether or not the expression was actually increased at the level of isolated proteins, not at the gene expression level, alcian blue staining was performed.

(46) In detail, plates of cells corresponding to each date were washed twice with PBS and fixed for 15 minutes by adding 1 ml of 4% paraformaldehyde. Then, 1 ml of 1% alcian blue 8-GX (Sigma-Aldrich, A5268) dissolved in 0.1 N HCl (pH 1.0) was added and stained overnight. After washing twice with 500 μl of 0.1 N HCl, images were obtained.

(47) As a result, in the case of MAST4 knockout cells, chondrogenesis was increased from day 3, and extracellular matrix secretion was increased, and the degree was increased with increasing BMP2 concentration (FIG. 6).

Example 4

Confirmation of Effect of Suppression of MAST4 Expression in Human Cells

Example 4-1. Confirmation of Effect of Suppression of MAST4 Expression in Human Cells

(48) It was examined whether the results confirmed in the knockout mouse model and mouse cells were also induced in human cells.

(49) In detail, human primary chondrocytes (donated by College of Medicine, Inha University) were knocked-out by transient transfection with MAST4 siRNA(h) (sc-106201; Santa Cruz biotechnology) (FIG. 8A) or MAST4 expression was knocked-out by the CRISPR/Cas9 system. MAST4 siRNA was transfected using a Lipofectamine RNAiMAX transfection reagent of ThermoFisher SCIENCITFIC, and information of primers used herein is as described in the following Table 6. Preparation and treatment of the CRISPR/Cas9 system were performed in the same manner as in Example 1-1 with reference to GeneArt™ Precision gRNA Synthesis Kit (A29377) of ThermoScientific, and information of primers used herein is as described in the following Table 6.

(50) For high transfection efficiency, siRNA transfection was performed by a reverse transfection technique in which cell planting and transfection are performed at the same time, and a transfection reagent was Lipofectamine RNAiMAX transfection reagent of ThermoFisher SCIENCITFIC. In detail, 15 nM of MAST4 siRNA and 4.5 μl of Lipofectamine RNAiMax were mixed in 40 μl of Gibco™ Opti-MEM™, and incubated for 15 minutes. Thereafter, human primary chondrocytes of 1.5×10.sup.5 cell/well were plated together with 2 ml of a medium (FBS 10%) containing no gentamicin in a 6-well plate (Coll coated plate), and the siRNA mixture was added thereto. 72 hours later, the cells were harvested and RNA was isolated. Human primary chondrocytes were cultured in a collagen I-coated flask (175, Col I Straight Vent 356487, Corning) under conditions of DMEM (17-205-CVR Corning), FBS Qualified (USA origin 500 mL 26140-079, Gibco), L-glutamine (200 mM) (100× 25030-081, Gibco), and gentamicin (5 ug/ml) (10 mL 15700-060, Thermofisher).

(51) Knockout was performed by targeting 20 nt on the genome of MAST4 (target sequences are marked in bold), and specifically, #1 and #3 target Exon5, and #2 targets Exon 8. #1 and #3 were prepared in the reverse direction, and #2 was prepared in the forward direction. The human MAST4 gene used in the preparation of CRISPR/Cas9 system was with reference to MAST4 ENSG00000069020 (http://asia.ensembl.org/). Information of targeted Exon sequences and NGG PAM sequences (grey box) on which CRISPR deletion occurred are shown in detail in FIG. 7.

(52) TABLE-US-00006 TABLE 6 hMAST4 CR#1 F 5′-TAATACGACTCACTATAG (SEQ ID NO: 73) GAGTGTGGTCGAGGCAATGC-3′ hMAST4 CR#1 R 5′-TTCTAGCTCTAAAAC (SEQ ID NO: 74) GCATTGCCTCGACCACACTC-3′ hMAST4 CR#2 F 5′-TAATACGACTCACTATAG (SEQ ID NO: 75) GTAACTCGTCTGGTGTTGGT-3′ hMAST4 CR#2 R 5′-TTCTAGCTCTAAAAC (SEQ ID NO: 76) ACCAACACCAGACGAGTTAC-3′ hMAST4 CR#3 F 5′-TAATACGACTCACTATAG (SEQ ID NO: 77) AGCAACCGGAAAAGCTTAAT-3′ hMAST4 CR#3 R 5′-TTCTAGCTCTAAAAC (SEQ ID NO: 78) ATTAAGCTTTTCCGGTTGCT-3′ HumanAcanRT Forward 5′-gaatcaactgctgcagacca-3′ (336) (SEQ ID NO: 82) HumanAcan RT Reverse 5′-gtgccagatcatcaccacac-3′ (336) (SEQ ID NO: 83) HumanCol9a1RT Forward 5′-CGTGGATTTCCAGGCCGTGG-3′ (467) (SEQ ID NO: 84) HumanCol9a1RT Reverse 5′-TCGCTGTCCTTGATCACCAG-3′ (467) (SEQ ID NO: 85) HumanGapdhRT Forward 5′-TGGCAAAGTGGAGATTGTTGCC-3′ (156) (SEQ ID NO: 86) HumanGapdhRT Reverse 5′-AAGATGGTGATGGGCTTCCCG-3′ (156) (SEQ ID NO: 87)

(53) As a result, as shown in FIG. 8A, when MAST4 siRNA was transfected, MAST4 expression was decreased, and at this time, expression of extracellular matrix factors such as Acan was increased. Further, as shown in FIG. 8B, when MAST4 was knocked out, expression of extracellular matrix factors such as Acan and Co19a1 was increased. These results are the same as those demonstrated in the previous mouse models and mouse cells. Therefore, with regard to other extracellular matrix factors and chondrogenic effects, the same results as those demonstrated in the mouse may be also obtained by suppressing MAST4 expression in human cells.

Example 4-2. Suppression of MAST4 Expression by TGF-β1 in Human Cells and Confirmation of Effect Thereof

(54) It was examined whether suppression of MAST4 expression as confirmed in Example 4-1 was induced by TGF-β1 and expression of extracellular matrix factors was affected thereby.

(55) In detail, the human primary chondrocytes of Example 4-1 were treated with TGF-β1, and an expression level thereof was measured by RT-PCR as in Examples 1-2 and 1-3 and Western blotting.

(56) As a result, as shown in FIG. 9, when TGF-β1 (5 ng/ml) was treated for 24 hours, 48 hours, or 72 hours, respectively, MAST4 expression was suppressed, and as a result, expression of extracellular matrix factors was increased. When co-treatment with TGF-β1 (5 ng/ml) and TEW-7197 which is a TGF-β1 inhibitor was performed (FIG. 9B), Acan expression increased by TGF-β1 was suppressed and the inhibitory effect on MAST4 expression was also decreased, as compared with single treatment with TGF-β1.