Herpesvirus with Modified Glycoprotein B

20210353696 · 2021-11-18

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention is directed to a recombinant herpesvirus comprising a heterologous polypeptide ligand capable of binding to a target molecule and fused to or inserted into glycoprotein B at specific sites. The herpesvirus may comprise more than one ligand, and the additional ligand(s) may be comprised by a modified glycoprotein D and/or modified glycoprotein H. This allows the herpesvirus to target a cell for therapeutic purposes, and a cell for virus production. The present invention further comprises a pharmaceutical composition comprising the herpesvirus, the herpesvirus for use in the treatment of a tumor, infection, degenerative disorder or senescence-associated disease, a nucleic acid and a vector coding for the gB, a polypeptide comprising the gB, and a cell comprising the herpesvirus, nucleic acid, vector or polypeptide. Moreover, a method for infecting a cell with the herpesvirus or for producing the herpesvirus is disclosed.

Claims

1-21. (canceled)

22. A recombinant herpesvirus comprising a heterologous polypeptide ligand capable of binding to a target molecule and inserted into glycoprotein B (gB) present in the envelope of the and capable of binding herpesvirus, wherein the ligand has a length less than 274 amino acids and is inserted at any amino acid within the amino-terminal region spanning from amino acids 31 to 77, amino acids 88 to 184, or amino acids 409 to 545 of gB according to SEQ ID NO: 1, or within a corresponding region of a homologous gB.

23. The herpesvirus of claim 22, wherein the herpesvirus has the capability of binding to a cell expressing or binding the target molecule, fusing with the cell membrane, entering the cell, or killing the cell.

24. The herpesvirus according to claim 22, wherein the target molecule is present on a diseased cell or on a cell present in cell culture.

25. The herpesvirus according to claim 24, wherein the target molecule present on a diseased cell is a tumor-associated receptor selected from the group consisting of: a member of the EGF receptor family, HER2, EGFR, EGFRIII, or EGFR3 (ERBB3), EGFRvIII, or MET, FAP, PSMA, CXCR4, CEA, CADC, Mucins, Folate-binding protein, GD2, VEGF receptors 1 and 2, CD20, CD30, CD33, CD52, CD55, the integrin family, IGF1R, the Ephrin receptor family, the protein-tyrosine kinase (TK) family, RANKL, TRAILR1, TRAILR2, IL13Ralpha, UPAR, Tenascin, a member of the immune checkpoint family regulators, PD-1, PD-L1, CTL-A4, TIM-3, LAG3, or IDO, tumor-associated glycoprotein 72, ganglioside GM2, A33, Lewis Y antigen, and MUC1; or wherein the target molecule present on a cell present in cell culture is an artificial molecule, an antibody, an antibody derivative or an antibody mimetic, or a single-chain antibody (scFv).

26. The herpesvirus according to claim 22, wherein the ligand is a natural polypeptide or an artificial polypeptide.

27. The herpesvirus according to claim 22, wherein a) the target molecule is HER2, b) the target molecule comprises the amino acid sequence of SEQ ID NO: 41, or c) the ligand comprises the amino acid sequence of SEQ ID NO: 37.

28. The herpesvirus according to claim 22, further comprising one or more ligands, wherein the one or more ligands are fused to or inserted into gB; or wherein the gB comprises a ligand capable of binding to a target molecule present on a cell present in cell culture and a ligand capable of binding to a target molecule present on a diseased cell.

29. The herpesvirus according to claim 22, wherein the herpesvirus comprises a modified gD and/or a modified gH.

30. The herpesvirus according to claim 29, wherein the gD is modified to have a deletion of a) amino acids 30 to 38 of gD or a subset thereof, b) a deletion of amino acid 30 or amino acid 38, or c) a deletion of amino acid 30 and amino acid 38, with regard to mature gD according to SEQ ID NO: 62 or a corresponding region of a homologous gD.

31. The herpesvirus according to claim 29, wherein a heterologous polypeptide ligand is inserted into gD instead of a) amino acids 30 to 38 or a subset thereof, b) amino acid 30 or amino acid 38, or c) amino acid 38 and amino acid 30 is deleted, with regard to mature gD according to SEQ ID NO: 62 or a corresponding region of a homologous gD.

32. The herpesvirus according to claim 22, wherein the herpesvirus encodes one or more molecules that stimulate(s) the host immune response against a cell.

33. A pharmaceutical composition comprising the herpesvirus according to claim 22 and a pharmaceutically acceptable carrier.

34. A nucleic acid molecule comprising a nucleic acid coding for the gB of the herpesvirus according to claim 22, having inserted the ligand, or a vector comprising said nucleic acid molecule, or a polypeptide comprising said gB, having inserted the ligand, or a cell comprising said herpesvirus, said nucleic acid molecule, said vector, or said polypeptide.

35. The herpesvirus according to claim 24, wherein the diseased cell is a tumor cell, an infected cell, a degenerative disorder-associated cell, or a senescent cell.

36. The herpesvirus according to claim 24, wherein the cultured cell is a Vero cell, a 293 cell, a 293T cell, a HEp-2 cell, a HeLa cell, a BHK cell, or a RS cell.

37. The herpesvirus according to claim 35, wherein the tumor cell is a breast cancer cell, ovary cancer cell, stomach cancer cell, lung cancer cell, head and neck cancer cell, osteosarcoma cell, glioblastoma multiforme cell, or salivary gland tumor cell.

38. The herpesvirus according to claim 25, wherein the scFv is capable of binding to a part of the GCN4 yeast transcription factor.

39. The herpesvirus according to claim 22, wherein the ligand is capable of binding to a part of the GCN4 yeast transcription factor.

40. The herpesvirus according to claim 29, wherein the gB comprises a ligand capable of binding to a target molecule present on a cell present in cell culture and the modified gD and/or the modified gH comprises a ligand capable of binding to a target molecule present on a diseased cell.

41. The pharmaceutical composition of claim 33, further comprising one or more molecules that stimulate the host immune response against a cell.

Description

FIGURES

[0111] FIG. 1: Genome arrangements of recombinants R-BP901, R-BP903, R-BP909, R-313, R-315, R-317 and R-319. (A-G) The HSV-1 genome is represented as a line bracketed by internal repeats (IR). The Lox-P-bracketed BAC sequence and eGFP fluorescent marker are inserted in the intergenic region U.sub.L3-U.sub.L4. (A) R-BP903 carries the insertion of scFv-HER2, with a downstream 12 Ser-Gly linker, between AA 43-44 of gB. (B) R-BP909 is the same as R-BP903, but, in addition carries the deletion of AA 6-38 from mature gD for detargeting purpose. (C) R-BP901 carries the insertion of scFv-HER2, with a Ser-Gly linkers, between AA 81-82 of gB. (D) R-313 carries the insertion of GCN4 peptide, with one upstream and one downstream Ser-Gly linker, between AA 43-44 of immature gB and the scFv-HER2, with a downstream Ser-Gly, 11 amino acid long linker, in place of AA 6-38 of mature gD. E) R-315 carries the insertion of GCN4 peptide, with one upstream and one downstream Ser-Gly linker, between AA 81-82 of immature gB and the scFv-HER2, with a downstream Ser-Gly, 11 amino acid long linker, in place of AA 6-38 of mature gD. F) R-317 carries the insertion of GCN4 peptide, with one upstream and one downstream Ser-Gly linker, between AA 76-77 of immature gB and the scFv-HER2, with a downstream Ser-Gly, 11 amino acid long linker, in place of AA 6-38 of mature gD. G) R-319 carries the insertion of GCN4 peptide, with one upstream and one downstream Ser-Gly linker, between AA 95-96 of immature gB and the scFv-HER2, with a downstream Ser-Gly, 11 amino acid long linker, in place of AA 6-38 of mature gD.

[0112] FIG. 2: R-BP901 and R-BP909 express the chimeric scFv-gB glycoprotein. Lysates of SK-OV-3 cells infected with R-BP901, R-BP909 or R-LM5, at an input multiplicity of infection of 3 PFU/cell were subjected to PAGE. gB was detected by immunoblot with MAb H1817. Numbers on the left represent the migration position of the 250 K, 130 K and 95 K MW markers.

[0113] FIG. 3: Infection of J cells expressing single receptors with recombinants R-BP901, R-BP903 and R-BP909. J cells express no receptor for wt-HSV. J-HER2, J-Nectin1, J-HVEM only express the indicated receptor. The indicated cells were infected with R-BP903, R-BP909 and R-BP901 and monitored for green fluorescence microscopy 24 h post infection. (A) R-BP903 infected J-HER2 cells, as well as J-Nectin and J-HVEM, as expected given that this recombinant encodes a wt-gD. This virus is retargeted to HER2 and retains the natural tropism. (B) R-BP909 infects cells that express HER2 as the sole receptor (J-HER2) and fails to infect J-Nectin and J-HVEM, as a consequence of gD deletion of AA 6-38. R-BP909 is retargeted to HER2 and detargeted from HSV-1 gD natural receptors. (C) R-BP901 fails to infect J-HER2; this virus is not retargeted to HER2.

[0114] FIG. 4: R-BP909 specifically infects HER2′ cancer cells. The indicated HER2.sup.− and HER2′ cancer cell lines were infected with R-BP909 and R-BP903. Pictures were taken 24 h after infection at fluorescence microscope. R-BP909 infects the HER2-positive cancers cells and fails to infect the HER2-negative cancer cells. R-BP903 infects cells irrespective of the expression of HER2, in agreement with the lack of detargeting.

[0115] FIG. 5: Characterization of R-BP909 entry pathways in J-HER2 (A) and SK-OV-3 (B) cells. The indicated viruses were preincubated with HD1, 52S, H126 MAb and then allowed to infect J-HER2 or SK-OV-3 cells. When indicated, cells were pretreated with trastuzumab or control IgGs. Infection was quantified 24h later by means of flow cytometry. (A) R-BP909 infection of J-HER2 cells is almost abolished by trastuzumab, and by MAb H126 to gB. (B) R-BP909 infection of SK-OV-3 cells is inhibited by trastuzumab and by MAb H126 to gB, 52S to gH, but not by MAb HD1 to gD. R-LM113, a recombinant retargeted to HER2 through insertion of scFv to HER2 in gD, behaved similarly to R-BP909.

[0116] FIG. 6: Growth curves of R-BP909, and of the control recombinants R-VG809 (retargeted to HER2 through gH) and R-LM113 (retargeted to HER2 through gD). SK-OV-3 cells were infected with the indicated recombinants at an input multiplicity of infection of 0.1 PFU/cell and harvested at the indicated times (h) after infection. Progeny virus was titrated in SK-OV-3 cells. Growth curves indicate that R-BP909 replicated in a similar way to R-VG809, about one log less than R-LM113.

[0117] FIG. 7: Killing ability of R-BP909 and R-VG809 for SK-OV-3 and MDA-MB-453 cells infected, and lack of killing ability for HER2.sup.− cancer cells. The HER2-positive SK-OV-3 and MDA-MB-453 cells, and the HER2.sup.− MDA-MB-231 cancer cells were infected with the indicated viruses at 2 PFU/cell (0.1 PFU/cell for MDA-MD-231 cells), respectively. Viability was quantified by AlamarBlue assay. R-BP909 killed the SK-OV-3 and MDA-MB-453 cells with similar efficiency to R-VG809. Both viruses failed to kill the HER2.sup.− negative MDA-MD-231 cancer cells, consistent with their inability to infect these cells.

[0118] FIG. 8: Pattern of infection of the recombinants R-313, R-315, R-317 and R-319. wt-Vero, Vero-GCN4R, SK-OV-3, parental J and J cells that express receptors for wt-HSV J-HVEM and J-Nectin were infected with the indicated viruses and monitored for green fluorescence microscopy 24 h post infection. R-313, R-315, R-317 and R-319 infect cells that express HER2 (both human and simian) and GCN4 as receptors and fails to infect through Nectin and HVEM, as a consequence of gD deletion of AA 6-38. All the engineered viruses are retargeted to HER2 and GCN4 and detargeted from HSV-1 gD natural receptors. Inhibition of infection in HER2-positive cell lines exposed to Trastuzumab (alias Herceptin) confirms that R-313, R-315, R-317 and R-319 employ the HER2 as the portal of entry in these cells.

[0119] FIG. 9: Growth curves of R-313, R-315, R-317, R-319 and of the control recombinants R-LM113 (retargeted to HER-2 through gD) and R-LM5 (wt for HSV glycoproteins and with other genomic modifications present in R-313, R-315, R-317, R-319 and R-LM113). Vero-GCN4R and SK-OV-3 cells were infected with the indicated recombinants at an input multiplicity of infection of 0.1 PFU/cell (as titrated in the respective cell lines) and harvested at the indicated times (h) after infection. Progeny virus was titrated in SK-OV-3 cells.

[0120] FIG. 10: Plating efficiency of R-313, R-315, R-317, R-319 and of the control recombinants R-LM113 and R-LM5 in different cell lines. Replicate aliquots of the recombinant viruses were plated onto Vero-GCN4R, wt-Vero and SK-OV-3. At 3 days after infection, plaques were scored under the fluorescence microscope.

[0121] FIG. 11: Relative plaque size of R-313, R-315, R-317 and R-319 in different cell lines. A) Replicate aliquots of R-313, R-315, R-317, R-319, R-LM113 and R-LM5 were plated in Vero-GCN4R, wt-Vero and SK-OV-3. Pictures of plaques were taken at the fluorescence microscope 3 days after infection. Representative plaques are shown. B) Quantification of plaque areas is shown pxE2.

[0122] FIG. 12: Schematic drawing of the chimeric scFv to GCN4—Nectin receptor. The receptor presents N-terminal leader peptide and HA tag sequence, followed by the scFv to GCN4, placed between two short linker, GA and GSGA linker. The second part of the molecule corresponds to human Nectin-1 (PVRL1) residues Met143 to Val517 comprising the Nectin-1 extracellular domains 2 and 3, the TM segment and the intracellular cytoplasmic tail.

[0123] FIG. 13: Stability of Vero-GCN4 positive cells. The expression of the scFv GCN4-Nectin receptor was analysed by FACS by means of Mab to HA tag. Diagrams show the percentage positive cells from Vero GCN4 clone 11.2 cells at passages 10, 15, 30, 40. Result: the expression of the artificial receptor remained stable after 40 consecutive passages.

[0124] FIG. 14: Genome arrangement of the recombinant R-321. The HSV-1 genome is represented as a line bracketed by internal repeats (IR). The Lox-P-bracketed BAC sequence and eGFP fluorescent marker are inserted in the intergenic region U.sub.L3-U.sub.L4. R-321, carries the deletion of AA 30 and 38 of mature gD and the insertion of scFv-HER2 after AA 37 of gD. R-321 carries the insertion of GCN4 peptide, with one upstream and one downstream Ser-Gly linker, between AA 43-44 of immature gB.

[0125] FIG. 15: Pattern of infection of the recombinant R-321. wt-Vero, Vero-GCN4R, SK-OV-3, parental J and J cells that express receptors for wt-HSV J-HVEM and J-Nectin were infected with the indicated viruses and monitored for green fluorescence microscopy 24 h post infection. R-321 infects cells that express HER2 (both human and simian) and GCN4 as receptors and fails to infect through Nectin and HVEM, as a consequence of gD deletion of AA 30 and 38. R-321 is retargeted to HER2 and GCN4 and detargeted from HSV-1 gD natural receptors. Inhibition of infection in HER2-positive cell lines exposed to Trastuzumab (alias Herceptin) confirms that R-321 employs the HER2 as the portal of entry in these cells.

[0126] FIG. 16: Growth curves of R-321 and of the control recombinants R-LM113 (retargeted to HER-2 through gD) and R-LM5 (wt for HSV glycoproteins and with other genomic modifications present in R-321). Vero-GCN4R and SK-OV-3 cells were infected with the indicated recombinants at an input multiplicity of infection of 0.1 PFU/cell (as titrated in the correspondent cell lines) and harvested at the indicated times (h) after infection. Progeny virus was titrated in SK-OV-3 cells.

SEQUENCES

[0127] SEQ ID NO: 1: amino acid sequence of HSV-1 gB wild type, precursor (Human herpesvirus 1 strain F, GenBank accession number: GU734771.1; gB encoded by positions 52996 to 55710).

[0128] SEQ ID NO: 2: amino acid sequence of the precursor of gB (SEQ ID NO: 1) having inserted the trastuzumab scFv between amino acids 43 and 44, as encoded by constructs R-BP903 and R-BP909. Linker SSGGGSGSGGSG (SEQ ID NO: 30) is introduced between the C-terminal amino acid sequence of the scFV insert and amino acid 44 of gB.

[0129] SEQ ID NO: 3: amino acid sequence of the precursor of gB (SEQ ID NO: 1) having inserted the trastuzumab scFv between amino acids 81 and 82, as encoded by construct R-BP901. Linker HSSGGGSG (SEQ ID NO: 29) is introduced between amino acid 81 of gB and the N-terminal amino acid sequence of the scFV insert. Linker SSGGGSGSGGSG (SEQ ID NO: 30) is introduced between the C-terminal amino acid sequence of the scFV insert and amino acid 82 of gB.

[0130] SEQ ID NO: 4: amino acid sequence of HSV-1 gD wild type, precursor (Human herpesvirus 1 strain F, GenBank accession ID: GU734771.1; gD encoded by positions 138281 to 139465).

[0131] SEQ ID NO: 5: amino acid sequence of HSV-1 gD wild type, precursor (SEQ ID NO: 4), with deletion of amino acids 6 to 38 of mature gD, as encoded by R-BP909.

[0132] SEQ ID NO: 6: amino acid sequence of HSV-1 deleted gD (SEQ ID NO: 5), having inserted the trastuzumab scFv between amino acids 30 and 64, as encoded by construct R-LM113. Amino acids EN were introduced to insert a restriction site for easiness of engineering and screening.

[0133] SEQ ID NO: 7: Trastuzumab scFv cassette bracketed by Ser-Gly linkers, present in plasmid named pSG-scFvHER2-SG, as in R-BP901, encoding the insert in SEQ ID NO: 3.

[0134] SEQ ID NO: 8: amino acid sequence encoded by SEQ ID NO: 7; amino acids 1 to 8 are the upstream Ser-Gly linker (SEQ ID NO: 29), amino acids 9 to 116 are the V.sub.L region, amino acids 117 to 136 is the linker that connects the V.sub.L and V.sub.H regions (SEQ ID NO: 31), amino acids 137 to 255 encode the V.sub.H region, amino acids 256 to 267 encode the downstream 12 Ser-Gly linker (SEQ ID NO: 30).

[0135] SEQ ID NO: 9: The Trastuzumab scFv cassette, present in plasmid named p-SG-scFvHER2-SG, but lacking the 8 residues long upstream Ser-Gly linker in R-BP903 and R-BP909, encoding the insert in SEQ ID NO: 2.

[0136] SEQ ID NO: 10: amino acid sequence encoded by SEQ ID NO: 9; amino acids 1 to 108 are the V.sub.L region, amino acids 109 to 128 is the linker that connects the V.sub.L and V.sub.H regions (SEQ ID NO: 31), amino acids 129 to 247 encode the V.sub.H region, amino acids 248 to 259 encode the downstream 12 Ser-Gly linker (SEQ ID NO: 30).

SEQ ID NO: 11: gB43GalKfor
SEQ ID NO: 12: gB43GalKrev
SEQ ID NO: 13: gB43_sc4D5_for
SEQ ID NO: 14: gB43_sc4D5_rev
SEQ ID NO: 15: gB81fGALK
SEQ ID NO: 16: gB81GALKrev
SEQ ID NO: 17: gB81sc4D5f
SEQ ID NO: 18: gB81SGr
SEQ ID NO: 19: scFv4D5_358_r
SEQ ID NO: 20: scFv4D5_315_f
SEQ ID NO: 21: gD5_galK_f
SEQ ID NO: 22: gD39_galK_r
SEQ ID NO: 23: gD_aa5_39_f
SEQ ID NO: 24: gD_aa5_39_r
SEQ ID NO: 25: galK_129_f
SEQ ID NO: 26: galK_417_r
SEQ ID NO: 27: gB_ext_for
SEQ ID NO: 28: gB_431_rev
SEQ ID NO: 29: 8 Ser-Gly linker
SEQ ID NO: 30: 12 Ser-Gly linker
SEQ ID NO: 31: Linker connecting V.sub.L and V.sub.H regions
SEQ ID NO: 32: Trastuzumab scFv

SEQ ID NO: 33: GCN4gB_43_44_fB

SEQ ID NO: 34: GCN4gB_43_44_rB

[0137] SEQ ID NO: 35: amino acid sequence of the precursor of gB (SEQ ID NO: 1) having inserted the GCN4 peptide between amino acids 43 and 44, as encoded by the construct R-313. The GCN4 peptide is flanked by a Ser-Gly linker.
SEQ ID NO: 36: nucleotide sequence encoding GCN4 peptide with upstream and downstream linkers for recombination into gB
SEQ ID NO: 37: GCN4 peptide
SEQ ID NO: 38: GCN4 epitope
SEQ ID NO: 39: amino acid sequence of scFv to GCN4 peptide
SEQ ID NO: 40: nucleotide sequence encoding scFv-GCN4-Nectin1 chimera
SEQ ID NO: 41: amino acid sequence encoded by SEQ ID NO: 40; amino acid sequence of the scFv capable of binding to the GCN4 peptide comprising an N-terminal leader peptide, an HA tag sequence, a short GA linker, the scFv sequence from amino acids 33 to 275, a short GSGA linker, and human Nectin-1 (PVRL1) residues Met143 to Val517
SEQ ID NO: 42: Genbank accession number AJ585687.1 (gene encoding the GCN4 yeast transcription factor
SEQ ID NO: 43: amino acid sequence of the GCN4 yeast transcription factor UniProtKB—P03069 (GCN_YEAST)
SEQ ID NO: 44: gB_76_galK_for
SEQ ID NO: 45: gB_76_galK_rev
SEQ ID NO: 46: gB_76_GCN4_for
SEQ ID NO: 47: gB_76_GCN4_rev
SEQ ID NO: 48: amino acid sequence of the precursor of gB (SEQ ID NO: 1) having inserted the GCN4 peptide between amino acids 76 and 77, as encoded by the construct R-317. The GCN4 peptide is flanked by a Ser-Gly linker.
SEQ ID NO: 49: gB_81_GCN4_for
SEQ ID NO: 50: gB_81_GCN4_rev
SEQ ID NO: 51: amino acid sequence of the precursor of gB (SEQ ID NO: 1) having inserted the GCN4 peptide between amino acids 81 and 82, as encoded by the construct R-315. The GCN4 peptide is flanked by a Ser-Gly linker.
SEQ ID NO: 52: gB_95_galK_for
SEQ ID NO: 53: gB_95_galK_rev
SEQ ID NO: 54: gB_95_GCN4_for
SEQ ID NO: 55: gB_95_GCN4_rev
SEQ ID NO: 56: amino acid sequence of the precursor of gB (SEQ ID NO: 1) having inserted the GCN4 peptide between amino acids 95 and 96, as encoded by the construct R-319. The GCN4 peptide is flanked by a Ser-Gly linker.
SEQ ID NO: 57: gD5_galK_f
SEQ ID NO: 58: scFv galK_rev
SEQ ID NO: 59: gDdeI30_38 for
SEQ ID NO: 60: gDdeI30_38 rev
SEQ ID NO: 61: amino acid sequence of the precursor of gD (SEQ ID NO: 4) having deleted amino acids 30 and 38 and inserted the trastuzumab scFv after amino acid 37 with regard to mature gD, as encoded by the construct R-321.
SEQ ID NO: 62: amino acid sequence of HSV-1 gD wild type, mature form (Human herpesvirus 1 strain F, GenBank accession ID: GU734771.1).

EXAMPLES

Example 1: Construction of HSV Recombinants Expressing Genetically Modified

[0138] gBs carrying a single chain antibody (scFv) directed to HER2 (scFv-HER2) (R-BP901, R-BP903, R-BP909), without or with deletion in the gD HSV gene, and encoding eGFP as reporter gene, or carrying the GCN4 peptide (R-313).

[0139] A) R-BP903: insertion of scFv-HER2 between AA (amino acid) 43 and 44 of HSV gB.

[0140] The inventors engineered R-BP903—this clone has also the name R-903—(FIG. 1A) by insertion of the sequence encoding the trastuzumab scFv between AA 43 and 44 of immature gB, corresponding to AA 13 and 14 of mature gB, after cleavage of the signal sequence, which encompasses AA 1-30. The starting genome was the BAC LM55, which carries LOX-P-bracketed pBeloBAC11 and eGFP sequences inserted between UL3 and UL4 of HSV-1 genome (Menotti et al., 2008). The engineering was performed by means of galK recombineering. Briefly, the galK cassette with homology arms to gB was amplified by means of primers gB43GalKfor GGTGGCGTCGGCGGCTCCGAGTTCCCCCGGCACGCCTGGGGTCGCGGCCG CGCCTGTTGACAATTAATCATCGGCA (SEQ ID NO: 11) and gB43GalKrev GGCCAGGGGCGGGCGGCGCCGGAGTGGCAGGTCCCCCGTTCGCCGCCTG GGTTCAGCACTGTCCTGCTCCTT (SEQ ID NO: 12) using pGalK as template. This cassette was electroporated in SW102 bacteria carrying LM55 BAC. The recombinant clones carrying the galK cassette were selected on plates containing M63 medium (15 mM (NH.sub.4).sub.2SO.sub.4, 100 mM KH.sub.2PO.sub.4, 1.8 μg FeSO.sub.4.H.sub.2O, adjusted to pH7) supplemented with 1 mg/L D-biotin, 0.2% galactose, 45 mg/L L-leucine, 1 mM MgSO.sub.4.H.sub.2O and 12 μg/ml chloramphenicol. In order to exclude galK false positive bacterial colonies, they were streaked also on MacConkey agar base plates supplemented with 1% galactose and 12 μg/ml chloramphenicol and checked by colony PCR with primer galK_129_f ACAATCTCTGTTTGCCAACGCATTTGG (SEQ ID NO: 25) and galK_417_r CATTGCCGCTGATCACCATGTCCACGC (SEQ ID NO: 26). Next, the trastuzumab scFv cassette with the downstream Ser-Gly linker described below (SEQ ID NO: 9; encoding SEQ ID NO: 10) and bracketed by homology arms to gB was generated through the annealing and extension of primers gB43_sc4D5_for GGTGGCGTCGGCGGCTCCGAGTTCCCCCGGCACGCCTGGGGTCGCGGCCG CGTCCGATATCCAGATGACCCAGTCCCCG (SEQ ID NO: 13) and gB43_sc4D5_rev GGCCAGGGGCGGGCGGCGCCGGAGTGGCAGGTCCCCCGTTCGCCGCCTG GGTACCGGATCCACCGGAACCAGAGCC (SEQ ID NO: 14). The recombinant genome encodes for the chimeric gB, which carries the scFv to HER2 and one downstream Ser-Gly linker, with sequence SSGGGSGSGGSG (SEQ ID NO: 30), and one linker between VL and VH region with the sequence SDMPMADPNRFRGKNLVFHS (SEQ ID NO: 31). The recombinant clones carrying the excision of the galK cassette and the insertion of the sequence of choice, scFv-HER2, were selected on plates containing M63 medium (see above) supplemented with 1 mg/L D-biotin, 0.2% deoxy-2-galactose, 0.2% glycerol, 45 mg/L L-leucine, 1 mM MgSO.sub.4.H.sub.2O and 12 μg/ml chloramphenicol. Bacterial colonies were also checked for the presence of sequence of choice by means of colony PCR with primers gB_ext_for GAGCGCCCCCGACGGCTGTATCG (SEQ ID NO: 27) and gB_431_rev TTGAAGACCACCGCGATGCCCT (SEQ ID NO: 28).

[0141] B) R-BP909 (FIG. 1B): deletion of AA 6-38 from mature gD of R-BP903. R-BP909—this clone has also the name R-909—is identical to R-BP903 and, in addition, it carries the deletion of the sequence corresponding to AA 6-38 in gD. The starting material was the R-BP903 BAC genome. To generate the AA 6-38 deletion in gD, galK cassette flanked by homology arms to gD was amplified with primers gD5_galK_f TTGTCGTCATAGTGGGCCTCCATGGGGTCCGCGGCAAATATGCCTTGGCGC CTGTTGACAATTAATCATCGGCA (SEQ ID NO: 21) and gD39_galK_r ATCGGGAGGCTGGGGGGCTGGAACGGGTCCGGTAGGCCCGCCTGGATGTG TCAGCACTGTCCTGCTCCTT (SEQ ID NO: 22). Next, the inventors replaced galK sequence with a synthetic double-stranded oligonucleotide made of gD_aa5_39 f TTGTCGTCATAGTGGGCCTCCATGGGGTCCGCGGCAAATATGCCTTGGCGCA CATCCAGGCGGGCCTACCGGACCCGTTCCAGCCCCCCAGCCTCCCGAT (SEQ ID NO: 23) and of gD_aa5_39 r ATCGGGAGGCTGGGGGGCTGGAACGGGTCCGGTAGGCCCGCCTGGATGTG CGCCAAGGCATATTTGCCGCGGACCCCATGGAGGCCCACTATGACGACAA (SEQ ID NO: 24).

[0142] C) R-BP901—this clone has also the name R-901—(FIG. 1C): insertion of scFv-HER2 between aa 81 and 82 of HSV gB.

[0143] The procedure was the same as described above to engineer the scFv-HER2 in gB of R-BP903, with the following differences. First, the galK cassette was amplified by means of primers gB81fGALK

[0144] CGGGGGACACGAAACCGAAGAAGAACAAAAAACCGAAAAACCCACCGCCGC CGCCTGTTGACAATTAATCATCGGCA (SEQ ID NO: 15) and gB81GALKrev CGCAGGGTGGCGTGGCCCGCGGCGACGGTCGCGTTGTCGCCGGCGGGGC GTCAGCACTGTCCTGCTCCTT (SEQ ID NO: 16). Next, the trastuzumab scFv cassette bracketed by the Ser-Gly linkers described below and by homology arms to gB was amplified as two separate fragments, named fragment #1 and fragment #2, from pSG-ScFvHER2-SG. pSG-ScFvHER2-SG carries a trastuzumab scFv cassette bracketed by Ser-Gly linkers (SEQ ID NO: 7, encoding SEQ ID NO: 8). Fragment #1 was amplified by means of primers gB81sc4D5f CGGGGGACACGAAACCGAAGAAGAACAAAAAACCGAAAAACCCACCGCC GC CGCATAGTAGTGGCGGTGGCTCTGGATCCG (SEQ ID NO: 17) and scFv4D5_358_r GGAAACGGTTCGGATCAGCCATCGG (SEQ ID NO: 19), using p-SG-ScFv-HER2-SG as template. Fragment #2 was amplified by means of primers gB81SGr CGCAGGGTGGCGTGGCCCGCGGCGACGGTCGCGTTGTCGCCGGCGGGGC GACCGGATCCACCGGAACCAGAGCC (SEQ ID NO: 18) and scFv4D5_315_f GGAGATCAAATCGGATATGCCGATGG (SEQ ID NO: 20) using pSG-ScFvHER2-SG as template. Fragments #1 and #2 were annealed and extended to generate the scFv-HER2 cassette, bracketed by the Ser-Gly linkers and the homology arms to gB. The recombinant genome carries the scFv to HER2 bracketed by an upstream Ser-Gly linker, with sequence HSSGGGSG (SEQ ID NO: 29), and a downstream Ser-Gly linker, with sequence SSGGGSGSGGSG (SEQ ID NO: 30). The linker between VL and VH is SDMPMADPNRFRGKNLVFHS (SEQ ID NO: 31).

[0145] D) R-313: insertion of GCN4 peptide between AA 43 and 44 of HSV gB in HSV recombinant already expressing a scFv-HER2 in the deletion of AA 6-38 in gD.

[0146] The inventors engineered R-313 (FIG. 1D) by insertion of the sequence encoding the GCN4 peptide between AA 43 and 44 of immature gB, corresponding to AA 13 and 14 of mature gB after cleavage of the signal sequence, which encompasses AA 1-30. The starting genome was the BAC LM113, which carries scFv-HER2 in place of AA 6 to 38 of gD, LOX-P-bracketed pBeloBAC11 and eGFP sequences inserted between U.sub.L3 and U.sub.L4 of HSV-1 genome (Menotti et al., 2008). The engineering was performed by means of galK recombineering. Briefly, in order to insert the GCN4 peptide in gB, the galK cassette with homology arms to gB was amplified by means of primers gB43GalKfor GGTGGCGTCGGCGGCTCCGAGTTCCCCCGGCACGCCTGGGGTCGCGGCCG CGCCTGTTGACAATTAATCATCGGCA (SEQ ID NO: 11) and gB43GalKrev GGCCAGGGGCGGGCGGCGCCGGAGTGGCAGGTCCCCCGTTCGCCGCCTG GGTTCAGCACTGTCCTGCTCCTT (SEQ ID NO: 12) using pGalK as template. This cassette was electroporated in SW102 bacteria carrying the BAC LM 113 BG. The recombinant clones carrying the galK cassette were selected on plates containing M63 medium (15 mM (NH.sub.4).sub.2SO.sub.4, 100 mM KH.sub.2PO.sub.4, 1.8 μg FeSO.sub.4.H.sub.2O, adjusted to pH7) supplemented with 1 mg/L D-biotin, 0.2% galactose, 45 mg/L L-leucine, 1 mM MgSO.sub.4.7H.sub.2O and 12 μg/ml chloramphenicol. In order to exclude galK false positive bacterial colonies, they were streaked also on MacConkey agar base plates supplemented with 1% galactose and 12 μg/ml chloramphenicol and checked by colony PCR with primer galK_129_f ACAATCTCTGTTTGCCAACGCATTTGG (SEQ ID NO: 25) and galK_417_r CATTGCCGCTGATCACCATGTCCACGC (SEQ ID NO: 26). Next, the GCN4 peptide cassette (SEQ ID NO: 36, encoding SEQ ID NO: 37) with the downstream and upstream Ser-Gly linkers and bracketed by homology arms to gB was generated through the annealing and extension of primers GCN4gB_43_44_fB GGTGGCGTCGGCGGCTCCGAGTTCCCCCGGCACGCCTGGGGTCGCGGCCG CGGGATCCAAGAACTACCACCTGGAGAACGAGGTGGCCAGACTGAAGAAGC TGGTGGGCAGC (SEQ ID NO: 33) and GCN4gB_43_44_rB GGCCAGGGGCGGGCGGCGCCGGAGTGGCAGGTCCCCCGTTCGCCGCCTG GGTGCTGCCCACCAGCTTCTTCAGTCTGGCCACCTCGTTCTCCAGGTGGTAG TTCTTGGATCC (SEQ ID NO: 34) which introduce a silent restriction site for the BamHI endonuclease, useful for screening of colonies by means of restriction analysis. The recombinant genome encodes the chimeric gB (SEQ ID NO: 35), which carries the GCN4 peptide including one downstream and one upstream Ser-Gly linker with the sequence GS. The recombinant clones carrying the excision of the galK cassette and the insertion of the sequence of choice, GCN4 peptide, were selected on plates containing M63 medium (see above) supplemented with 1 mg/L D-biotin, 0.2% deoxy-2-galactose, 0.2% glycerol, 45 mg/L L-leucine, 1 mM MgSO4.7H.sub.2O and 12 μg/ml chloramphenicol. Bacterial colonies were checked for the presence of sequence of choice by means of colony PCR with primers gB_ext_for GAGCGCCCCCGACGGCTGTATCG (SEQ ID NO: 27) and gB_431_rev TTGAAGACCACCGCGATGCCCT (SEQ ID NO: 28).

[0147] To reconstitute the recombinant virus R-BP909, 500 ng of recombinant BAC DNA was transfected into the gD-complementing cell line named R6 (rabbit skin cell line expressing wt-gD under the control of the HSV late UL26.5 promoter (Zhou et al., 2000) by means of Lipofectamine 2000 (Life Technologies), and then grown in SK-OV-3 cells. Virus growth was monitored by green fluorescence. The structure of the recombinants was verified by sequencing the entire gB and also gD and gH ORFs for R-BP909, the scFv HER2 and the insertion site in gB of R-BP903 and R-BP901. Virus stocks were generated and titrated in SK-OV-3 cells.

[0148] To reconstitute the recombinant viruses R-BP901, R-BP903, R-313, 500 ng of recombinant BAC DNA was transfected into SK-OV-3 cells by means of Lipofectamine 2000 (Life Technologies). Virus growth was monitored by green fluorescence. The R-313 virus was passaged six times in SK-OV-3, frozen/thaw to lyse the SK-OV-3 cells and subsequently growth in Vero-GCN4 cells. Virus stocks were generated in Vero-GCN4 and titrated in Vero-GCN4, wt-Vero and SK-OV-3 cells. The structure of the recombinant R-313 was verified by sequencing the GCN4 and the insertion site in gB.

Example 2: Verification of Expression of the Chimeric scFv-HER2-gB of R-BP901 and R-BP909

[0149] SK-OV-3 cells were infected at an input multiplicity of infection of 3 PFU/cell with R-BP901, R-BP909, and with R-LMS, for comparison, and harvested 72 h after infection. Cell lysates were subjected to polyacrylamide gel electrophoresis, transferred to PVDF membranes and immunoblotted with monoclonal antibody (H1817) to gB. FIG. 2 shows that the chimeric scFv-HER2-gB from R-BP901 and R-BP909 migrated with a slower electrophoretic mobility than wt-gB from R-LM5, and an apparent Mr of 130 KDaltons. Arrows point to the migration position of chimeric and wt gB. figures to the left indicate the migration position of molecular weight markers, expressed in kDaltons.

Example 3: Infection of J Cells Expressing Single Receptors with Recombinants R-BP903, R-BP909 and R-BP901

[0150] It has previously been shown that the insertion of scFv-HER2 in gD confers to the recombinant virus R-LM113 the ability to enter cells through the HER2 receptor. To provide evidence that the insertion of scFV-HER2 at positions 43-44 or 81-82 of gB confers the ability to enter cells through the HER2 receptor, the inventors made use of cells that express HER2 as the sole receptor. The parental J cells express no receptor for gD, hence cannot activate gD, and are not infected by wt-HSV. J-HER2 cells transgenically express HER2 as the sole receptor. As controls, the inventors included J-Nectin and J-HVEM cells, which transgenically express Nectin-1 or HVEM as receptors and are infected by wt-HSV. The indicated cells were infected with R-BP903, R-BP909 and R-BP901 and monitored for green fluorescence microscopy 24h post infection.

[0151] As shown in FIG. 3A, R-BP903 infected J-HER2 cells. The infection of J-Nectin, J-HVEM was not surprising, inasmuch as R-BP903 encodes a wt-gD. This virus is retargeted to HER2 and retains the natural tropism.

[0152] The inventors engineered a recombinant carrying the scFv-HER2 in position 43-44 of gB and the deletion of portions of receptors' binding sites from gD. The two major receptors of gD are Nectin-1 and HVEM. The binding site of HVEM in gD maps to AA 1-32. The binding site of Nectin-1 in mature gD is more widespread and includes the Ig-folded core and portions located between AA 35-38, 199-201, 214-217, 219-221. The inventors deleted from R-BP903 mature gD the AA 6-38 region, i.e. the same region which was previously deleted from R-LM113, a HSV retargeted to HER2 by insertion of the scFv-HER2 between AA 5 and 39 of mature gD. The deletion removes the entire HVEM binding site and some residues implicated in the interaction with Nectin-1, including portions located between AA 35-38. Even though a few AA implicated in the interaction with Nectin-1 were deleted, R-LM113 was shown to be detargeted from both Nectin-1 and HVEM.

[0153] The recombinant virus named R-BP909 failed to infect not only J-HVEM cells, but also J-Nectin cells, and maintained the ability to infect efficiently J-HER2 cells (FIG. 3B). R-BP909 tropism is strikingly different from that of R-BP903 (compare FIG. 3A with FIG. 3B). The inventors conclude that R-BP909 infection via the HER2-retargeted gB does not require the binding sites for HVEM and for Nectin-1 in gD, and, consequently, the receptor-mediated gD activation. In summary, R-BP909 exhibits a fully redirected tropism, retargeted to the HER2 receptor via gB and detargeted from gD receptors.

[0154] The recombinant R-BP901 which carries the scFv HER2 between AA 81 and 82 of gB and has wt gD fails to infect J-HER2 cells; this virus is not retargeted to HER2 (FIG. 3C).

Example 4: Infection of HER2+ and HER2.SUP.− Cancer Cells

[0155] The SK-OV-3, BT-474, MDA-MB-453 HER2+ cancer cells, and the HER2.sup.− HeLa and MDA-MB-231 cancer cells, and the HER2.sup.− non-cancer HaCaT cells were infected at an input multiplicity of infection of 5 PFU/cell (as titrated in SK-OV-3) for 90 min at 37° C. with R-BP909 and R-BP903. Pictures were taken 24 h after infection at fluorescence microscope. R-BP909 infects the HER2-positive cancer cells and fails to infect the HER2-negative cells. R-BP903 infects cells irrespective of the expression of HER2, in agreement with the lack of detargeting (FIG. 4).

Example 5: Characterization of R-BP909 Entry Pathways in J-HER2 and SK-OV-3

[0156] To prove that entry of R-BP909 into J-HER2 cells occurs through HER2 as the cellular receptor, and to investigate the role of gD in the entry pathway of R-BP909 into SK-OV-3 cells, the inventors performed a series of blocking assays.

[0157] In addition, R-LM5, which carries a wt-gD and the other genomic modifications present in R-BP909 and R-LM113, namely the insertion of the BAC sequences and the insertion of the GFP marker, was employed as control. The inventors first confirmed that infection of R-BP909 occurs through the HER2 receptor. Replicate monolayers of J-HER2 cells, or SK-OV-3 cells in 12-well plates were preincubated with trastuzumab, the MAb to HER2 from which the scFv-HER2 was derived or with non-immune mouse IgG (28 μg/ml final concentration). After 1h at 37° C. of pre-incubation with antibodies, the cells were infected at an input multiplicity of infection of 5 PFU/cell (as titrated in SK-OV-3) with R-BP909 and R-LM113 or R-LM5, as comparison. R-BP909 infection of both cell types was almost abolished by trastuzumab, indicating that R-BP909 uses HER2 as portal of entry, and does not make use of an off-target pathway of entry. The finding that R-BP909 can make use of HER2 as receptor provides evidence that the tropism of HSV can be modified by engineering a heterologous ligand in gB. Furthermore, the infection of the gB-retargeted HSV R-BP909 into J-HER2 cells can take place in cells which lack a gD receptor, cannot be activated by its cognate receptors and cannot transmit the activation to gB. The inventors conclude that infection of R-BP909 does not necessitate a gD with functional receptor-binding sites. This validates the conclusion that the retargeted R-BP909 uses HER2 as the portal of entry in J-HER2 cells.

[0158] To elucidate the contribution of the essential glycoproteins, gD, gH/gL and as well as the portion of gB which was not modified by genetic engineering, virions were pre-incubated with MAbs to gD HD1 (1.5 ug/ml), MAbs to gB H126 (1:2000), MAb 52S to gH (ascites fluid 1:25) for 1h at 37° C. as indicated, and then allowed to adsorb to cells for 90 min. In the case of MAb HD1, the combination of HD1 plus trastuzumab (alia herceptin) was also tested. Viral inocula were then removed, and cells were overlaid with medium containing the indicated antibodies.

[0159] Infection was quantified by fluorescent activated cell sorter (FACS) (FIG. 5). MAb H126 to gB recognizes a linear epitope in Domain I of gB, with critical residue at Tyr.sub.303. MAb 52S to gH recognizes a continuous epitope, independent of gL, with critical residues at Ser.sub.536 and Ala.sub.537. R-BP909 infection of both SK-OV-3 and J-HER2 cells was abolished by MAb H126 (1:2000) (FIGS. 5A and B), indicating that a key functional domain in wt-gB was preserved in the chimera, and a role for gH/gL. MAb HD1 failed to inhibit R-BP909 and R-LM113 infection, consistent with previous findings (Gatta et al, 2015); the results support the conclusion that R-BP909 is retargeted to HER2 by means of gB, and detargeted from NectinI/HVEM in consequence of the AA 6-38 deletion in mature gD.

Example 6: Extent of Replication of Recombinants

[0160] The inventors compared the extent of replication of R-BP909 to that of the recombinants, R-LM113 and R-VG809 that are retargeted to HER2 through the insertion of scFv-HER2 in gD and gH, respectively. Replication was measured in SK-OV-3 cells, which express HER2 and Nectin-1/HVEM as receptors.

[0161] Cells were infected at an input multiplicity of infection of 0.1 PFU/cell for 90 min at 37° C.; unabsorbed virus was inactivated by means of an acidic wash (40 mM citric acid, 10 mM KCl, 135 mM NaCl [pH 3]). Replicate cultures were frozen at the indicated times (3, 24 and 48 h) after infection and the progeny was titrated in SK-OV-3. The results in FIG. 6 show that R-BP909 replicated to a similar extent to R-VG809, about one log less than R-LM113.

Example 7: Ability of R-BP909, and of R-VG809 for Comparison, to Kill HER2-Positive Cancer Cells, and Lack of Killing Ability for HER2.SUP.− Cancer Cells

[0162] The HER2-positive SK-OV-3 and MDA-MB-453 and the HER2-negative MDA-MB-231 cells were seeded in 96 well plates 8×10E3 cells/well, and exposed to the recombinant R-BP909, R-VG809 for comparison or mock-infected for 90 min at 37° C. The input multiplicity of infection (as titrated in the correspondent cell line) was 2 PFU/cell for the SK-OV-3 and MDA-MB-453 and of 0.1 PFU/cells for the MDA-231 cells. Alamar-Blue (10 μl/well Life Technologies) was added to the culture media at the indicated times after virus exposure and incubated for 4 h at 37° C. Plates were read at 560 and 600 nm with GloMax Discover System (Promega). For each time point, cell viability was expressed as the percentage of AlamarBlue reduction in infected versus uninfected cells, excluding for each samples the contribution of medium alone. Cytotoxicity caused by R-BP909 and R-VG809 in HER2-positive SK-OV-3 and MDA-MB-453 ranged from 70 to 90% at 7 days after infection. Both viruses failed to kill the HER2-negative MDA-MD-231 cancer cells, consistent with their inability to infect these cells (FIG. 7).

Example 8 Ability of R-313 to Replicate in Vero-GCN4 and in the Cancer Cell Line SK-OV-3

[0163] It has previously been shown that the insertion of scFv-HER2 in place of AA 6-38 of gD confers to the recombinant virus R-LM113 the retargeting to HER2 receptor and the detargeting from both Nectin-1 and HVEM. In the present invention the inventors provide evidence that R-BP909, which carries the scFv-HER2 between AA 43-44 of gB, exhibits a fully redirected tropism, retargeted to the HER2 receptor via gB.

[0164] The inventors further investigated whether gB is a suitable glycoprotein in order to retarget HSV by means of a short peptide, exemplified here by the epitope YHLENEVARLKK (SEQ ID NO: 38) of GCN4 yeast transcription factor with two flanking wt GCN4 residues and two GS linkers, herein named GCN4 peptide. The 20 amino acid peptide should confer to R-313 the ability to infect and replicate in the Vero-GCN4 cell line, expressing the artificial receptor made of the scFv to GCN4 (Zahnd et al., 2004) fused to extracellular domains 2, 3, TM and C-tail of Nectin-1.

[0165] To test the tropism of the R-313 the inventors made use of simian wt-Vero, Vero-GCN4, SK-OV-3 and of the previously described J cells expressing or not receptors for gD. The indicated cells were infected with R-313 and, where indicated, the cells were pretreated with Trastuzumab (alias Herceptin) (28 μg/ml final concentration). The infection was monitored by green fluorescence microscopy 24 h after infection.

[0166] As shown in FIG. 8, R-313 infected both untreated Vero-GCN4 and Vero-wt, but in the presence of Trastuzumab, only the infection in Vero-GCN4 was observed. This result indicates that R-313 was able to infect Vero-GCN4. In contrast to the infection with R-313 of wt-Vero cells, this infection was not inhibited by herceptin, indicating that it was indeed mediated by the GCN4 peptide inserted in gB. The infection with R-313 of wt-Vero cells occurs through the simian ortholog of HER2 present in Vero cells, as it is indeed inhibited by exposure of cells to herceptin.

[0167] The scFv-HER2 fused to gD still enabled infection of SK-OV-3 cells through HER2, as documented by inhibition by herceptin. The lack of infection of J, J-Nectin and J-HVEM confirmed the deretargeting profile already exhibited by R-LM113, due to the deletion of AA 6-38 of gD. Cumulatively this series of results indicates that R-313 has the ability to infect Vero-GCN4 cells through the GCN4 peptide fused in gB, and the SK-OV-3 cells through HER2 in gD.

Example 9: Extent of Replication of R-313 in Vero-GCN4 and in SK-OV-3 Cells

[0168] The inventors compared the extent of replication of R-313 to that of the recombinants R-LM113 and R-LM5 in Vero-GCN4 and in SK-OV-3 cells. Cells were infected at an input multiplicity of infection of 0.1 PFU/cell (as titrated in the correspondent cell line) for 90 min at 37° C.; unabsorbed virus was inactivated by means of an acidic wash (40 mM citric acid, 10 mM KCl, 135 mM NaCl [pH 3]). Replicate cultures were frozen at the indicated times (3, 24 and 48 h) after infection and the progeny was titrated in SK-OV-3. The results in FIG. 9 show that R-313 replicated in Vero-GCN4 to a higher extent than R-LM113, and to similar extent as R-LM5. R-313 can replicate in SK-OV-3 to a similar extent as R-LM113, and almost one log lower than R-LM5.

[0169] Cumulatively, the results show that R-313 is simultaneously retargeted through GCN4 and through HER2.

Example 10: Plating Efficiency of R-313 in Different Cell Lines

[0170] For plating efficiency experiments, the indicated cell monolayers were infected with replicate aliquots of serial dilutions (from 10.sup.−5 to 10.sup.−10) of R-313. After infection and removal of inoculum, medium containing agar was added to the plates and monolayers were incubated for 3 days at 37° C. to allow plaque formation. At 3th day plaques were scored under the fluorescence microscope. Figures indicate that the R-313 plating efficiency in SK-OV-3 is very similar to that in Vero-GCN4; both are slightly higher than that observed in wt-Vero cells, confirming that R-313 can make use alternatively of the GCN4 peptide engineered in gB and of the scFv-HER2 inserted in gD to enter Vero-GCN4 and SK-OV-3 cells, respectively. The plating efficiency of R-313 in J-HER2 cells could not be differentiated from that R-LM113 in the same cells, indicating that the insertion of the GCN4 peptide is not detrimental (FIG. 10).

Example 11: Relative Plaque Size of R-313 in Different Cell Lines

[0171] To perform a plaque size assay, 10-fold dilutions of R-313, R-LM113 and R-LM5 were plated onto Vero-GCN4, wt-Vero and SK-OV-3 monolayers. The infected monolayers were overlaid with medium containing agar. Three days later pictures were taken at the fluorescence microscope. Representative pictures show that in any cell line tested R-313 forms larger plaques than R-LM113. In turn, plaques formed by R-LM5 were even larger that those formed by R-313 (FIG. 11).

Example 12

[0172] A) R-315: insertion of GCN4 peptide between AA 81 and 82 of HSV gB in HSV recombinant already expressing a scFv-HER2 in the deletion of AA 6-38 in gD.

[0173] The procedure was the same as described above to engineer the GCN4 peptide in gB of R-313, with the following differences. First, the galK cassette was amplified by means of primers gB81fGALK

[0174] CGGGGGACACGAAACCGAAGAAGAACAAAAAACCGAAAAACCCACCGCC GC CGCCTGTTGACAATTAATCATCGGCA (SEQ ID NO: 15) and gB81GALKrev CGCAGGGTGGCGTGGCCCGCGGCGACGGTCGCGTTGTCGCCGGCGGGGC GTCAGCACTGTCCTGCTCCTT (SEQ ID NO: 16) using pGalK as template. Next, the GCN4 peptide cassette (SEQ ID NO: 36, encoding SEQ ID NO: 37) with the downstream and upstream Ser-Gly linkers and bracketed by homology arms to gB was generated through the annealing and extension of primers gB_81_GCN4_for CGGGGGACACGAAACCGAAGAAGAACAAAAAACCGAAAAACCCACCGCC GC CGGGATCCAAGAACTACCACCTGGAGAACGAGGTGGCCAGACTGAAGAAGC TGGTGGGCAGC (SEQ ID NO: 49) and gB_81_GCN4_rev CGCAGGGTGGCGTGGCCCGCGGCGACGGTCGCGTTGTCGCCGGCGGGGC GGCTGCCCACCAGCTTCTTCAGTCTGGCCACCTCGTTCTCCAGGTGGTAGTT CTTGGATCC (SEQ ID NO: 50) which introduce a silent restriction site for the BamHI endonuclease, useful for screening of colonies by means of restriction analysis. The recombinant genome encodes the chimeric gB (SEQ ID NO: 51), which carries the GCN4 peptide including one downstream and one upstream Ser-Gly linker with the sequence GS.

[0175] B) R-317: insertion of GCN4 peptide between AA 76 and 77 of HSV gB in HSV recombinant already expressing a scFv-HER2 in the deletion of AA 6-38 in gD.

[0176] The procedure was the same as described above to engineer the GCN4 peptide in gB of R-315, with the following differences. First, the galK cassette was amplified by means of primers gB_76_galK_for GGCCCCGCCCCAACGGGGGACACGAAACCGAAGAAGAACAAAAAACCGAAA CCTGTTGACAATTAATCATCGGCA (SEQ ID NO: 44) and gB_76_galK_rev CCCGCGGCGACGGTCGCGTTGTCGCCGGCGGGGCGCGGCGGCGGTGGGT TTCAGCACTGTCCTGCTCCTT (SEQ ID NO: 45) using pGalK as template. Next, the GCN4 peptide cassette (SEQ ID NO: 36, encoding SEQ ID NO: 37) with the downstream and upstream Ser-Gly linkers and bracketed by homology arms to gB was generated through the annealing and extension of primers gB_76_GCN4_for GGCCCCGCCCCAACGGGGGACACGAAACCGAAGAAGAACAAAAAACCGAAA GGATCCAAGAACTACCACCTGGAGAACGAGGTGGCCAGACTGAAGAAGCTG GTGGGCAGC (SEQ ID NO: 46) and gB_76_GCN4_rev CCCGCGGCGACGGTCGCGTTGTCGCCGGCGGGGCGCGGCGGCGGTGGGT TGCTGCCCACCAGCTTCTTCAGTCTGGCCACCTCGTTCTCCAGGTGGTAGTT CTTGGATCC (SEQ ID NO: 47) which introduce a silent restriction site for the BamHI endonuclease, useful for screening of colonies by means of restriction analysis. The recombinant genome encodes the chimeric gB (SEQ ID NO: 48), which carries the GCN4 peptide including one downstream and one upstream Ser-Gly linker with the sequence GS.

[0177] C) R-319: insertion of GCN4 peptide between AA 95 and 96 of HSV gB in HSV recombinant already expressing a scFv-HER2 in the deletion of AA 6-38 in gD.

[0178] The procedure was the same as described above to engineer the GCN4 peptide in gB of R-317, with the following differences. First, the galK cassette was amplified by means of primers gB_95_galK_for CGCCGCCGCGCCCCGCCGGCGACAACGCGACCGTCGCCGCGGGCCACGC CCCTGTTGACAATTAATCATCGGCA (SEQ ID NO: 52) and gB3_95_galK_rev GTTTGCATCGGTGTTCTCCGCCTTGATGTCCCGCAGGTGCTCGCGCAGGGTT CAGCACTGTCCTGCTCCTT (SEQ ID NO: 53) using pGalK as template. Next, the GCN4 peptide cassette (SEQ ID NO: 36, encoding SEQ ID NO: 37) with the downstream and upstream Ser-Gly linkers and bracketed by homology arms to gB was generated through the annealing and extension of primers gB_95_GCN4_for CGCCGCCGCGCCCCGCCGGCGACAACGCGACCGTCGCCGCGGGCCACGC CGGATCCAAGAACTACCACCTGGAGAACGAGGTGGCCAGACTGAAGAAGCT GGTGGGCAGC (SEQ ID NO: 54) and gB3_95_GCN4_rev GTTTGCATCGGTGTTCTCCGCCTTGATGTCCCGCAGGTGCTCGCGCAGGGT GCTGCCCACCAGCTTCTTCAGTCTGGCCACCTCGTTCTCCAGGTGGTAGTTC TTGGATCC (SEQ ID NO: 55) which introduce a silent restriction site for the BamHI endonuclease, useful for screening of colonies by means of restriction analysis. The recombinant genome encodes the chimeric gB (SEQ ID NO: 56), which carries the GCN4 peptide including one downstream and one upstream Ser-Gly linker with the sequence GS.

[0179] To reconstitute the recombinant virus R-BP909, 500 ng of recombinant BAC DNA was transfected into the gD-complementing cell line named R6 (rabbit skin cell line expressing wt-gD under the control of the HSV late UL26.5 promoter (Zhou et al., 2000) by means of Lipofectamine 2000 (Life Technologies), and then grown in SK-OV-3 cells. Virus growth was monitored by green fluorescence. The structure of the recombinants was verified by sequencing the entire gB and also gD and gH ORFs for R-BP909, the scFv HER2 and the insertion site in gB of R-BP903 and R-BP901. We identified for gB of the recombinant virus R-909 one mutation (Y276S), not present in the engineered BAC-DNA. Virus stocks were generated and titrated in SK-OV-3 cells.

[0180] To reconstitute the recombinant viruses R-BP901, R-BP903, R-313, R-315, R-317 and R-319 500 ng of recombinant BAC DNA was transfected into SK-OV-3 cells by means of Lipofectamine 2000 (Life Technologies). Virus growth was monitored by green fluorescence. The R-313 virus was passaged six times in SK-OV-3, frozen/thawed to lyse the SK-OV-3 cells and subsequently growth in Vero-GCN4R cells. Virus stocks were generated in Vero-GCN4R and titrated in Vero-GCN4R, wt-Vero and SK-OV-3 cells. The genome of the recombinant R-313, R-315, R-317 and R-319 was partially verified by sequencing the entire gB.

Example 13: Ability of R-313, R-315, R-317 and R-319 to Replicate in Vero-GCN4R and in the Cancer Cell Line SK-OV-3

[0181] It has previously been shown that the insertion of scFv-HER2 in place of AA 6-38 of gD confers to the recombinant virus R-LM113 the retargeting to HER2 receptor and the detargeting from both Nectin-1 and HVEM. In the present invention the inventors provide evidence that R-BP909, which carries the scFv-HER2 between AA 43-44 of gB, exhibits a fully redirected tropism, retargeted to the HER2 receptor via gB.

[0182] The inventors further investigated whether gB is a suitable glycoprotein in order to retarget HSV by means of a short peptide, exemplified here by the epitope YHLENEVARLKK (SEQ ID NO: 38) of GCN4 yeast transcription factor with two flanking wt GCN4 residues and two GS linkers, herein named GCN4 peptide. The 20 amino acid peptide should confer to R-313, R-315, R-317 and R-319 the ability to infect and replicate in the Vero-GCN4R cell line, expressing the artificial receptor made of the scFv to GCN4 (Zahnd et al., 2004) fused to extracellular domains 2, 3, TM and C-tail of Nectin-1.

[0183] To test the tropism of the R-313, R-315, R-317 and R-319, the inventors made use of simian wt-Vero, Vero-GCN4R, SK-OV-3 and of the previously described J cells expressing or not receptors for gD. The indicated cells were infected with the indicated recombinant and, where indicated, the cells were pretreated with Trastuzumab (alias Herceptin) (28 μg/ml final concentration). The infection was monitored by green fluorescence microscopy 24 h after infection.

[0184] As shown in FIG. 8, R-313 (panel A), R-315 (panel B), R-317 (panel C) and R-319 (panel D) infected both untreated Vero-GCN4R and Vero-wt, but in the presence of Trastuzumab (alias Herceptin), only the infection in Vero-GCN4R was observed. This result indicates that all the recombinant viruses that carry the insertion of GCN4 peptide in different position of gB were able to infect Vero-GCN4R. In contrast to the infection of wt-Vero cells, the infection of Vero-GCN4R, was not inhibited by Herceptin, indicating that it was indeed mediated by the GCN4 peptide inserted in gB. The infection with R-313, R-315, R-317 and R-319 of wt-Vero cells occurs through the simian ortholog of HER2 present in Vero cells, as it is indeed inhibited by exposure of cells to Herceptin.

[0185] The scFv-HER2 inserted in gD still enabled infection of SK-OV-3 cells through HER2, as documented by inhibition by Herceptin. The lack of infection of J, J-Nectin and J-HVEM confirmed the deretargeting profile already exhibited by R-LM113, due to the deletion of AA 6-38 of gD. Cumulatively this series of results indicates that R-313, R-315, R-317 and R-319 have the ability to infect Vero-GCN4R cells through the GCN4 peptide inserted in gB, and the SK-OV-3 cells through HER2 in gD.

Example 14: Extent of Replication of R-313, R-315, R-317 and R-319 in Vero-GCN4R and in SK-OV-3 Cells

[0186] The inventors compared the extent of replication of R-313, R-315, R-317, R-319 to that of the recombinants R-LM113 and R-LM5 in SK-OV-3 cells (FIG. 9 A) and in Vero-GCN4R (FIG. 9 B). Cells were infected at an input multiplicity of infection of 0.1 PFU/cell (as titrated in the correspondent cell line) for 90 min at 37° C.; unabsorbed virus was inactivated by means of an acidic wash (40 mM citric acid, 10 mM KCl, 135 mM NaCl [pH 3]). Replicate cultures were frozen at the indicated times (24 and 48 h) after infection and the progeny was titrated in SK-OV-3. It can be seen from FIG. 9 A that R-315 and R-317 grew to similar titers as R-LM5 and R-LM113 in SK-OV-3 cells. In contrast, R-313 and R-319 grew about one-two log less than R-315 and R-317. The results in FIG. 9 B show that R-313, R-315 and R-317 replicated in Vero-GCN4R to a similar extent as R-LM113, and one log lower than R-LM5. In turn, R-319 grew about one-two log less than R-315, R-317 and R-319.

[0187] Cumulatively, the results show that R-313, R-315, R-317 and R-319 are simultaneously retargeted through GCN4 and through HER2.

Example 15: Plating Efficiency of R-313, R-315, R-317 and R-319 in Different Cell Lines

[0188] The inventors compared the ability of R-313, R-315, R-317 and R-319 to form plaques in different cell lines, with respect to the number (FIG. 10). Replicate aliquots of R-LM5, R-LM113, R-313, R-315, R-317 and R-319, containing a same amount of virus (50 PFU), as titrated in SK-OV-3 cells, were plated on wt-Vero, Vero-GCN4R and SK-OV-3. The infected monolayers were overlaid with medium containing agar and the number of plaques was scored 3 days later.

[0189] The results of the experiment indicate that the plating efficiency of all recombinant virus carrying the GCN4 peptide insertion in gB (R-313, R-315, R-317 and R-319), but not of the control viruses, was higher on Vero-GCN4R cells in comparison to wt-Vero. All the gB-recombinants exhibited similar plating efficiency in Vero-GCN4R and in SK-OV-3 cells.

Example 16: Relative Plaque Size of R-313, R-315, R-317 and R-319 in Different Cell Lines

[0190] To perform a plaque size assay, 10-fold dilutions of R-313, R-315, R-317 and R-319 were plated onto Vero-GCN4R, wt-Vero and SK-OV-3 monolayers. The infected monolayers were overlaid with medium containing agar. Three days later pictures were taken at the fluorescence microscope. Representative pictures show that in any cell line tested R-313, R-315, R-317 and R-319 form larger plaques than R-LM113. Plaques formed by R-LM5 were even larger (FIG. 11). For plaque size determinations (FIG. 11 B), pictures of 5 plaques were taken for each virus. Plaque areas (pxE2) were measured with Nis Elements-Imaging Software (Nikon). Each result represents average areas ±SD.

Example 17: R-321: Reintroduction of AA 6-29 and 31-37 of gD in HSV Recombinant Already Expressing a scFv-HER2 in the Deletion of AA 6-38 in gD and GCN4 Peptide Between AA 43 and 44 of gB

[0191] First, the galK cassette was amplified by means of primers gD5_galK_f TTGTCGTCATAGTGGGCCTCCATGGGGTCCGCGGCAAATATGCCTTGGCGC CTGTTGACAATTAATCATCGGCA (SEQ ID NO: 57) and scFv galK_rev GAGGCGGACAGGGAGCTCGGGGACTGGGTCATCTGGATATCGGAATTCTCT CAGCACTGTCCTGCTCCTT (SEQ ID NO: 58) using pGalK as template. The galK cassette was inserted in R-313 backbone by means of galK recombineering. Next, the oligo that comprises AA 6-29 and 31-37 of gD was generated through the annealing and extension of primers gDdeI30_38 for TTGTCGTCATAGTGGGCCTCCATGGGGTCCGCGGCAAATATGCCTTGGCGG ATGCCTCTCTCAAGATGGCCGACCCCAATCGCTTTCGCGGCAAAGACCTTCC GGTCC (SEQ ID NO: 59) and gDdeI30_38 rev GAGGCGGACAGGGAGCTCGGGGACTGGGTCATCTGGATATCGGAATTCTCC ACGCGCCGGACCCCCGGAGGGGTCAGCTGGTCCAGGACCGGAAGGTCTTT GCCGCGA (SEQ ID NO: 60). The recombinant genome encodes the chimeric gD (SEQ ID NO: 61), which carries the deletion of AA 30 and 38 of gD and the insertion of scFv-HER2 after AA 37 of gD. SEQ ID NO: 35 shows the chimeric gB having inserted the GCN4 peptide between amino acids 43 and 44. The structure of the recombinant BAC was verified by sequencing the upstream and downstream the region 6-37 of gD.

[0192] To reconstitute the recombinant virus R-321, 500 ng of recombinant BAC DNA was transfected into SK-OV-3 cells by means of Lipofectamine 2000 (Life Technologies). Virus growth was monitored by green fluorescence. The R-321 virus was passaged six times in SK-OV-3, frozen/thaw to lyse the SK-OV-3 cells and subsequently growth in Vero-GCN4R cells.

Example 18: R-321 is Retargeted from HSV-1 Natural Receptors

[0193] It has previously been shown that the insertion of scFv-HER2 in place of AA 6-38 of gD confers to the recombinant virus R-LM113 the retargeting to HER2 receptor and the detargeting from both Nectin-1 and HVEM. In the present invention the inventors provide evidence that R-321, which carries the deletion of only AA 30 and 38 of gD and the insertion of scFv-HER2 after AA 37 of gD, exhibits a fully de-targeted profile, since it loss the ability to infect trough HSV-1 natural receptors. Moreover, R-321 carries the GCN4 peptide between AA 43 and 44 of gB, like R-313.

[0194] To test the tropism of the R-321, inventors made use of simian wt-Vero, Vero-GCN4R, SK-OV-3 and of the previously described J cells expressing or not receptors for gD. The indicated cells were infected with R-321 and, where indicated, the cells were pretreated with Trastuzumab (alias Herceptin) (28 μg/ml final concentration). The infection was monitored by green fluorescence microscopy 24 h after infection.

[0195] The lack of infection of J, J-Nectin and J-HVEM (FIG. 15) indicates that R-321 is de-targeted from HSV-1 natural receptors, due to the deletion of AA 30 and 38 of gD. The scFv-HER2 fused to gD enabled infection of SK-OV-3 cells through HER2, as documented by inhibition by Herceptin. As shown in FIG. 15, R-321 infected both untreated Vero-GCN4R and Vero-wt, but in the presence of Trastuzumab (alias Herceptin), only the infection in Vero-GCN4R was observed. This result indicates that R-321 is able to infect Vero-GCN4R, as R-313. In contrast to the infection of wt-Vero cells, the infection of Vero-GCN4R, was not inhibited by Herceptin, indicating that it was indeed mediated by the GCN4 peptide inserted in gB. The infection with R-321 occurs through the simian ortholog of HER2 present in Vero cells, as it is indeed inhibited by exposure of cells to Herceptin.

[0196] Cumulatively, the results show that R-321 is simultaneously retargeted through GCN4 and through HER2 and de-targeted from HSV natural receptor as a consequence of deletion of aa 30 and 38 in gD.

Example 19: Extent of Replication of R-321 in Vero-GCN4R and in SK-OV-3 Cells

[0197] The inventors compared the extent of replication of R-321 to that of the recombinants R-LM113 and R-LM5 in SK-OV-3 cells (FIG. 16 A) and in Vero-GCN4R (FIG. 16 B). Cells were infected at an input multiplicity of infection of 0.1 PFU/cell (as titrated in the correspondent cell line) for 90 min at 37° C.; unabsorbed virus was inactivated by means of an acidic wash (40 mM citric acid, 10 mM KCl, 135 mM NaCl [pH 3]). Replicate cultures were frozen at the indicated times (24 and 48 h) after infection and the progeny was titrated in SK-OV-3. It can be seen from FIG. 16 A that R-321 grew to similar titers as R-LM5 and R-LM113 in SK-OV-3 cells. The results in FIG. 16 B show that R-321 replicated in Vero-GCN4R one log higher than R-LM113, and to similar extent than R-LM5.

Example 20: Vero-GCN4 Cell Line

[0198] The Vero GCN4 cell line expresses an artificial chimeric receptor, made of an scFv to the GCN4 peptide (Zahnd et al., 2004), with the sequence optimized for human codon usage as reported in SEQ ID NO: 39, fused to Nectin-1. The GCN4 peptide is part of the Saccharomyces cerevisiae transcription factor GCN4, whose partial mRNA sequence is reported in SEQ ID NO 42. More in detail, an N-terminal leader peptide and HA tag sequence is present like in the pDISPLAY (Invitrogen) vector. This should ensure efficient and proper processing of the leader peptide. After the HA tag, a short GA linker is present upstream of the scFv. The amino acid sequence of the scFv to GCN4 is reported in SEQ ID NO: 39. C-terminal to the scFv a short GSGA linker is present. The rest of the molecule corresponds to human Nectin-1 (PVRL1) residues Met143 to Val517 comprising the Nectin-1 extracellular domains 2 and 3, the TM segment and the intracellular cytoplasmic tail (FIG. 12). The chimera was synthesized in vitro by Gene Art, and cloned into pcDNA3.1—Hygro_(+), resulting in plasmid scFv GCN4_Nectin1 chimera, whose insert has the nucleotide sequence identified by SEQ ID NO: 40, encoding the amino acid sequence of the scFv-GCN4 nectin1 chimera SEQ ID NO: 41.

[0199] The DNA from plasmid scFv GCN4_Nectin1 chimera was transfected into Vero cells (ATCC CCL-81™) by means of Lipofectamine 2000. Vero cells expressing the artificial receptor to the GCN4 peptide were selected by means of Hygromycin (200 μg/ml), and subsequently sorted by means of magnetic beads (Miltenyi), in combination with MAb to HA tag. The sorted cells were subjected to single cell cloning in 96 well (0.5 cell/well).

[0200] Single clones were analysed by FACS for detection of expression of the scFv to the GCN4 peptide by means of MAb to HA tag. The selected clone was 11.2. We ascertained that during serial passages of the Vero-GCN4 cell line, the expression of the artificial receptor remained stable after 40 consecutive passages (FIG. 13).

REFERENCES

[0201] Abstract #P-28, 9.sup.th International conference on Oncolytic virus Therapeutics, Boston 2015 [0202] Arndt K. and Fin G. R., PNAS 1986, 83, 8516-8520 [0203] Backovic M. et al., PNAS, 2009, 106, 2880-2885; [0204] Burke H. G. and Heldwein E. E., Plos Pathogens, 2015, 11(11), e1005300, doi: 10.1371/joumal.ppat.1005300 [0205] Castoldi R. et al., Oncogene, 2013, 32, 5593-601 [0206] Castoldi R. et al., Protein Eng Des Sel, 2012, 25, 551-9 [0207] Douglas J. T. et al., Nat Biotechnol, 1999, 17, 470-475 [0208] Florence G. et al., Virology: A Laboratory Manual, 1992, ISBN-13: 978-0121447304 [0209] Gallagher J. R. et al., PLOS Pathogens, 2014, 10, e1004373, 1-16 [0210] Gatta V. et al., PLOS Pathogens, 2015, DOI: 10.1371/journal.ppat.1004907 [0211] Heldwein E. E et al., Science, 2006, 313, 217-220 [0212] Hope I. A and Struhl K., EMBO J, 1987, 6, 2781-2784 [0213] Josan J. S. et al., Bioconjug Chem, 2011, 22, 1270-1278; [0214] Karlin S. and Altschul S. F., PNAS, 1990, 87, 2264-2268 [0215] Karlin S. and Altschul S. F., PNAS, 1993, 90, 5873-5877 [0216] Lin E. and Spear P. G., PNAS, 2007, 104, 13140-13145 [0217] Liu B. L. et al., Gene Ther, 2003, 10, 292-303 [0218] Morgan A. A. and Rubistein E., PLoS One, 2013, 8(1), e53785. doi: 10.1371/journal.pone.0053785. Epub 2013 Jan. 25. PMID: 23372670 [0219] Menotti L, et al., J Virol, 2008, 82, 10153-10161; doi: 10.1128/JVI.01133-08. Epub 2008 Aug. 6. [0220] Nakamura T. et al., Nat Biotechnol, 2005, 23, 209-214. Epub 2005 Jan. 30 [0221] Needleman S. B. and Wunsch C. D., J Mol Biol, 1970, 48, 443-453 [0222] Pearson W. R. and Lipman D. J., PNAS, 1988, 85, 2444-2448 [0223] Peterson R. B. and Goyal S. M., Comp Immunol Microbiol Infect Dis. 1988, 11, 93-98 [0224] Potel C. et al., Journal of Virological Methods, 2002, 105, 13-23 [0225] Sandri-Goldin R. M. et al., Alpha Herpesviruses: Molecular and Cellular Biology, Caister Academic Press, 2006 [0226] Shallal H. M. et al., Bioconjug Chem, 2014, 25, 393-405 [0227] Smith T. F. and Waterman M. S., Add APL Math, 1981, 2, 482-489 [0228] Xu L. et al., PNAS, 2012, 109, 21295-21300 [0229] Zahnd C. et al., J Biol Chem 2004; 279, 18870-18877 [0230] Zhou, G. et al., J Virol, 2000, 74, 11782-11791