DENDRIMER-BIOADHESIVE POLYMER HYDROGEL NANOGLUE AND USE THEREOF
20210353823 · 2021-11-18
Inventors
- Kannan Rangaramanujam (Highland, MD)
- Walter Stark (Longboat Key, FL, US)
- Siva Pramodh Kambhampati (Baltimore, MD)
- Uri Soiberman (Baltimore, MD, US)
- Samuel YIU (Baltimore, MD, US)
- Abdul-Elah Abad Al-Towerki (Baltimore, MD, US)
Cpc classification
C08J2305/08
CHEMISTRY; METALLURGY
A61K9/06
HUMAN NECESSITIES
A61P17/02
HUMAN NECESSITIES
C08L5/08
CHEMISTRY; METALLURGY
A61K47/61
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K47/58
HUMAN NECESSITIES
A61K47/6903
HUMAN NECESSITIES
C08J2300/202
CHEMISTRY; METALLURGY
A61L2400/12
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
C08L5/08
CHEMISTRY; METALLURGY
B82Y30/00
PERFORMING OPERATIONS; TRANSPORTING
A61K31/573
HUMAN NECESSITIES
International classification
A61K31/573
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
A61K9/06
HUMAN NECESSITIES
A61L24/00
HUMAN NECESSITIES
Abstract
A nanoglue is formed with one or more bioadhesive polymers, one or more dendrimers, and optionally one or more therapeutic, prophylactic, or diagnostic agents. The bioadhesive polymers and dendrimers are modified with functional groups to permit crosslinking upon one or more stimuli, e.g., ultraviolet irradiation, and form hydrogel in situ at tissue sites. In the repair of corneal wounds, the nanoglue leads to improved rate of healing with less scarring and less inflammation, compared to non-treated cornea or ones treated with sutures. Therapeutic agents can be covalently conjugated to the precursor components and be delivered to specific eye compartments, providing a more efficacious treatment formulation of ocular disorders than delivering drugs in their free forms. Methods of making and using the hydrogel and hydrogel precursor compositions are also provided.
Claims
1. A nanoglue comprising dendrimer, and bioadhesive polymers, wherein the dendrimer molecules and the bioadhesive polymers are crosslinkable to each other upon exposure to one or more external stimuli or one or more physiological conditions within tissue.
2. The nanoglue of claim 1, wherein the composition further comprises therapeutic, prophylactic, or diagnostic agent and optionally, wherein the therapeutic, prophylactic, or diagnostic agent is conjugated to or complexed with dendrimer.
3. (canceled)
4. The nanoglue of claim 2 comprising agent selected from the group consisting of anti-inflammatory drugs, anti-infective agents, anti-glaucoma agents, agents that lower intraocular pressure (TOP), anti-angiogenesis agents, growth factors, and growth factors.
5. The nanoglue of claim 2 comprising a diagnostic agent selected from the group consisting of paramagnetic molecules, fluorescent compounds, magnetic molecules, radionuclides, x-ray imaging agents, and contrast media.
6. The nanoglue of claim 3, comprising a therapeutic agent selected from the group consisting of dexamethasone, betamethasone, triamcinolone, prednisone, prednisolone, metlivlprednisolone, cortisone, hydrocortisone, and non-steroidal antiinflammatory drugs (NSAIDS).
7. The nanoglue of claim 1, wherein the dendrimers are generation 2-6 poly(amidoamine) (PAMAM) dendrimers optionally terminated with one or more functional groups selected from the group consisting of hydroxyl, amino, carboxyl, alkoxysilyl, thiol, pyridyl, vinyl, methacryloyl, and cyclic unsaturated hydrocarbon.
8. The nanoglue of claim 1, comprising generation 4, 5 or 6 PAMAM dendrimer terminated with one or more hydroxyl groups.
9. The nanoglue of claim 1, comprising bioadhesive polymer selected from the group consisting of hyaluronic acid, chitosan, alginate, agarose, carboxymethyl cellulose, hydroxymethylcellulose, methylcellulose, cellulose, polyalkylene oxide, po!y(acrylie acid), polyihvdroxyethyl methaciylate), poly(vinyl pyrrolidone), poly(vinyl alcohol), pullulan, and derivatives thereof.
10. The nanoglue of claim 1, comprising hyaluronic acid or derivatives thereof.
11. The nanoglue of claim 1, wherein the dendrimer or bioadhesive polymer are crosslinkable by stimuli selected from the group consisting of light irradiation, pH change, salt concentration change, and temperature change.
12. The nanoglue of claim 11, wherein the dendrimer or bioadhesive polymer are crosslinkable by ultraviolet light irradiation.
13. A method of sealing tissue or delivery a therapeutic, prophylactic or diagnostic agent to an individual in need thereof, comprising administering to the tissue of the individual in need thereof the nanoglue of claim 1, and crosslinking the dendrimer and/or bioadhesive polymer.
14. The method of claim 14 wherein the nanoglue is administered by injection.
15. The method of claim 13, wherein the nanoglue is administered to the surface or compartment of an eye (subconjunctival, intracameral, supra-choroidal, topical, intravitreal and subretinal), or adjacent tissue.
16. The method of claim 12, wherein the nanoglue is administered to a wound in an amount effective to seal the wound.
17. The method of claim 12 wherein the nanoglue is administered to seal dura, lung membrane, peritoneum, gastrointestinal, endothelium, or burned tissue.
18. The method of claim 12 wherein the nanoglue is administered to a tissue surface to form a barrier.
19. The method of claim 12 wherein the nanoglue is administered subconjunctivally as a gel for sustained treatment of ocular/corneal inflammation.
20. The method of claim 19 for the treatment of alkali/acid burns, dry eye, corneal inflammation, corneal infections, iritis, or uveitis.
21. A kit comprising a dosage unit of the nanoglue of claim 1.
22. The kit of claim 21 wherein the dosage unit comprises a container for dry components and a container for liquid components, which mixed together form the nanoglue.
23. The kit of claim 21 wherein the dosage unit is a dropper bottle or a dual barrel syringe with mixing tip or an applicator.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
[0033] The term “therapeutic agent” refers to an agent that can be administered to prevent or treat one or more symptoms of a disease or disorder. These may be a nucleic acid, a nucleic acid analog, a small molecule, a peptidomimetic, a protein, peptide, carbohydrate or sugar, lipid, or surfactant, or a combination thereof.
[0034] The term “diagnostic agent”, as used herein, generally refers to an agent that can be administered to reveal, pinpoint, and define the localization of a pathological process.
[0035] The term “prophylactic agent”, as used herein, generally refers to an agent that can be administered to prevent disease or to prevent certain conditions like pregnancy.
[0036] The phrase “pharmaceutically acceptable” refers to compositions, polymers and other materials and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. The phrase “pharmaceutically acceptable carrier” refers to pharmaceutically acceptable materials, compositions or vehicles, such as a liquid or solid filler, diluent, solvent or encapsulating material involved in carrying or transporting any subject composition, from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of a subject composition and not injurious to the patient.
[0037] The phrase “therapeutically effective amount” refers to an amount of the therapeutic agent that produces some desired effect at a reasonable benefit/risk ratio applicable to any medical treatment. The effective amount may vary depending on such factors as the disease or condition being treated, the particular targeted constructs being administered, the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art may empirically determine the effective amount of a particular compound without necessitating undue experimentation. A prophylactic agent refers to an agent that may prevent a disorder, disease or condition. Examples include vaccines which prevent infection and birth control pills that prevent pregnancy.
[0038] The term “treating” refers to preventing or alleviating one or more symptoms of a disease, disorder or condition. Treating the disease or condition includes ameliorating at least one symptom of the particular disease or condition, even if the underlying pathophysiology is not affected, such as treating the pain of a subject by administration of an analgesic agent even though such agent does not treat the cause of the pain.
[0039] The term “biocompatible” as used herein, generally refers to materials that are, along with any metabolites or degradation products thereof, generally non-toxic to the recipient, and do not cause any significant adverse effects to the recipient. Generally speaking, biocompatible materials are materials which do not elicit a significant inflammatory or immune response when administered to a patient.
[0040] The term “biodegradable” as used herein, generally refers to a material that will degrade or erode under physiologic conditions to smaller units or chemical species that are capable of being metabolized, eliminated, or excreted by the subject. The degradation time is a function of composition and morphology. Degradation times can be from hours to years.
[0041] The term “seal”, as used herein, means to substantially cover a rough surface, a cavity, or a gap in the substrate (e.g., a tissue) or coat on top of the tissue surface, and optionally to form a covalent or non-covalent bond at the contact surface. “Seal” may also refer to the barrier effect of preventing the migration or transport of certain gas, liquid, solute, macromolecules, or bacteria.
[0042] The term “dendrimer”, as used herein, includes, but is not limited to, a molecular architecture with an interior core, interior layers (or “generations”) of repeating units regularly attached to this initiator core, and an exterior surface of terminal groups attached to the outermost generation.
[0043] The term “bioadhesive polymer”, as used herein, refers to a natural or synthetic polymer that can adhere to a biological substrate. The adhesion of polymers to tissues may be achieved by (i) physical or mechanical bonds, (ii) primary or covalent chemical bonds, and/or (iii) secondary chemical bonds (i.e., ionic).
[0044] The term “crosslink”, as used herein, means the formation of covalent linkages between a precursor molecule containing nucleophilic groups and a precursor molecules containing electrophilic group resulting in an increase in the molecular weight of the material. “Crosslink” may also refer to the formation of non-covalent linkages, such as ionic bonds, or combinations of covalent and non-covalent bonds.
[0045] The term “photocrosslink”, as used herein, means to cause vinyl or other unsaturated bonds to break and form cross-links by the application of radiant energy.
[0046] The term “external stimulus”, as used herein, evokes a specific functional reaction, which is not intrinsic, such as a physical, chemical, biological, mechanical, and irradiation stimuli.
[0047] “Polymeric network”, as used herein, refers to the product of a process in which substantially all of the monomers, oligomers, or polymers are bound by intermolecular covalent linkages through their available functional groups to form a macromolecule.
[0048] “Physiological”, as used herein, refers to conditions found in living vertebrates. In particular, physiological conditions refer to the conditions in the human body such as temperature, pH, aqueous medium, etc. “Physiological temperatures”, as used herein, refers to a temperature range of between 35° C. to 42° C., preferably around 37° C.
[0049] “Crosslink density”, as used herein, refers to the average molecular weight between two crosslinks (M.sub.c) of the respective molecules.
[0050] “Swelling”, as used herein, refers to the increase in volume and mass due to the uptake of water by the biomaterial. The terms” water-uptake” and “swelling” are used synonymously.
[0051] “Gel point” or “gelation” as used herein refers to the point where the viscous modulus and complex modulus cross each other and viscosity increases. Thus the gel point is the stage at which a liquid begins to take on the semisolid characteristics of a gel.
[0052] “In situ formation” as generally used herein refers to the ability of mixtures of precursor molecules which are substantially not crosslinked prior to and at the time of injection, but form covalent linkages, non-covalent linkages, or a combination, with each other at a physiological condition or upon trigger by external stimuli at the site of injection in the body.
[0053] “Equilibrium state”, as used herein, refers to the state in which a hydrogel undergoes no mass increase or loss when stored under constant conditions in water.
[0054] “Functionalize”, as used herein, means to modify in a manner that results in the attachment of a functional group or moiety. For example, a molecule may be functionalized by the introduction of a molecule which makes the molecule a strong nucleophile or strong electrophile. For example, a molecule, such as hyaluronic acid, may be functionalized to become a thiol, amine, acrylate, or quinone.
[0055] As used herein, the term “active agent” or “biologically active agent” are used interchangeably herein to refer to a chemical or biological compound that induces a desired pharmacological and/or physiological effect, which may be prophylactic, therapeutic or diagnostic. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of active agents, including, but not limited to, salts, esters, amides, prodrugs, active metabolites, and analogs.
II. Nanoglues
[0056] The nanoglue adheres to moist tissues, permits controlled placement, and allows for rapid curing to seal the wound. The nanoglue may be used for the delivery of therapeutic, prophylactic and/or diagnostic agents and thereby be useful to treat underlying disorders and accelerate wound healing.
[0057] A. Hydrogel Sealant or its Precursors
[0058] Two main components are included: bioadhesive polymers that provide strength and flexibility and are biocompatible to integrate with wounded tissues and accelerate wound healing, and dendrimers that anchor with bioadhesive polymers to provide a high density of crosslinking points and thereby a desired mechanical strength.
[0059] In a preferred embodiment, the precursor components are modified with vinyl or other unsaturated groups and nucleophilic groups, independently, to allow for photo-crosslinking and formation of hydrogel in situ.
[0060] i. Dendrimers
[0061] In preferred embodiments, the dendrimers and non-toxic and have numerous surface groups enabling modification with multiple photo-crosslinkable groups for high crosslinking densities at low concentrations and potential conjugation with active agents.
[0062] Dendrimers suitable for use include, but are not limited to, polyamidoamine (PAMAM), polypropylamine (POPAM), polyethylenimine, polylysine, polyester, iptycene, aliphatic poly(ether), and/or aromatic polyether dendrimers. Each dendrimer of the dendrimer complex may be same or of similar or different chemical nature than the other dendrimers (e.g., the first dendrimer may include a PAMAM dendrimer, while the second dendrimer may be a POPAM dendrimer). In some embodiments, the first or second dendrimer may further include an additional agent such as a multiarm PEG polymer including a polyethylene glycol having at least two branches bearing sulfhydryl or thiopyridine terminal groups. Other PEG polymers bearing other terminal groups such as succinimidyl or maleimide terminations can be used. The PEG polymers in the molecular weight 10 kDa to 80 kDa can be used. Complexes can be formed of one or more dendrimers.
[0063] Examples of dendrimers include, but are not limited to, poly(amidoamine) (PAMAM), polyester, polylysine, and polypropylenimine (PPI). The PAMAM dendrimers may contain different cores, with amidoamine building blocks, and can have carboxylic, amine and hydroxyl terminations of any generation including, but not limited to, generation 1 PAMAM dendrimers, generation 2 PAMAM dendrimers, generation 3 PAMAM dendrimers, generation 4 PAMAM dendrimers, generation 5 PAMAM dendrimers, generation 6 PAMAM dendrimers, generation 7 PAMAM dendrimers, generation 8 PAMAM dendrimers, generation 9 PAMAM dendrimers, or generation 10 PAMAM dendrimers. In the preferred embodiment, the dendrimers are soluble in the formulation and are generation (“G”) 4, 5 or 6 dendrimers.
[0064] As used herein, the term “PAMAM dendrimer” means poly(amidoamine) dendrimer, which may contain different cores, with amidoamine building blocks. The method for making them is known to those of skill in the art and generally involves a two-step iterative reaction sequence that produces concentric shells (generations) of dendritic β-alanine units around a central initiator core. This PAMAM core-shell architecture grows linearly in diameter as a function of added shells (generations) and the surface groups amplify exponentially at each generation according to dendritic-branching mathematics. They are available in generations G0-10 with 5 different core types and 10 functional surface groups. The dendrimer-branched polymer may consist of polyamidoamine (PAMAM), polyglycerol, polyester, polyether, polylysine, or polyethylene glycol (PEG), polypeptide dendrimers. The dendrimers may have hydroxyl groups attached to their functional surface groups.
[0065] In some embodiments, the dendrimers are in nanoparticle form and are described in detail in international patent publication Nos. WO2009/046446, PCT/US2015/028386, PCT/US2015/045112, PCT/US2015/045104, and U.S. Pat. No. 8,889,101.
[0066] ii. Bioadhesive Polymers
[0067] Bioadhesive polymers include natural or synthetic polymers that adhere to biological tissues. As used herein, bioadhesive polymers adhere through covalent bonding, non-covalent interactions (e.g., hydrogen bond), and/or physical entanglement with tissue substrates.
[0068] In some specific embodiments, bioadhesive polymers refer to mucoadhesive polymers for adhesion in tissues in the respiratory, nasal, cervicovaginal, gastrointestinal, rectal, visual and auditory systems.
[0069] 1. Hyaluronic Acid (HA)
[0070] HA is a naturally occurring, immunoneutral glycosaminoglycan of the extracellular matrix that plays an important role in development, wound healing, and inflammation. Its viscoelastic properties and long ocular surface residence time have rendered it suited for use in several tissue repairing practices, including ophthalmic use to protect the corneal endothelium. HA is also identified to be a ligand for CD44 (Zhu S N, et al., Br J Ophthalmol., 81(1):80-4 (1997)), a transmembrane cell surface adhesion molecule.
[0071] In a preferred embodiment, HA crosslinked by dendrimer molecules forms the hydrogel sealant for tissue repair. HA has a wide range of molecular weights; and in some embodiments, HA of 15-20 kDa is selected. To crosslink, HA is first modified chemically at one or more of the three functional groups: the glucuronic acid carboxylic acid, the primary and secondary hydroxyl groups, and the N-acetyl group (following deamidation). Most prominently, carboxylates have been modified by carbodiimide-mediated reactions, esterification, and amidation; hydroxyls have been modified by etherification, divinylsulfone crosslinking, esterification, and bis-epoxide crosslinking. Detailed reviews on chemical modification of HA can be seen in Kuo J W, Prestwich G D, in Materials of Biological Origin—Materials Analysis and Implant Uses, Comprehensive Biomaterials, Elsevier (2010).
[0072] 2. Other Bioadhesive Polymers
[0073] Bioadhesive polymers that can be incorporated include synthetic and natural polymers. Preferred bioadhesive polymers have exposed carboxylic groups. These include natural polymers such as alginates and celluloses and synthetically modified celluloses including alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, and nitrocelluloses, such as carboxymethylcellulose, hydroxymethylcellulose and methylcellulose. Synthetic polymers that can be used include polyesters such as poly(hydroxyesters) like polylactide-co-glycolide, polylactide, and polyglycolide, polyorthoesters, polyanhydrides, polyhydroxyalkanoates such as poly3hydroxybutyrate, poly4hydroxybutyrate and copolymers thereof, and non-biodegradable polymers such as acrylates and methacrylates, copolymers and derivatives thereof, poly(vinyl alcohols), polyamides, and polycarbonates. Blends and copolymers made include polyalkylenes, polyalkylene glycols, polyalkylene oxides, polyalkylene terephthalates, polyvinyl ethers, polyvinyl esters, polyvinyl halides, polyvinylpyrrolidone, polyglycolides, polysiloxanes, polyurethanes and copolymers thereof. All polymers are commercially available.
[0074] iii. Modifications to Permit Stimuli-Responsive Gelation
[0075] Dendrimers and bioadhesive polymers are modified with crosslinking moieties to enable stimuli-responsive gelation. In preferred embodiments, the dendrimers and the bioadhesive polymers are chemically modified to contain photo-crosslinkable groups (e.g., thiol groups and vinyl groups; thiol groups and maleimide groups; amine groups and aldehyde groups; amine groups and carboxylate groups; methacrylate groups; and acrylate groups).
[0076] In some embodiments, one or more methacrylate or acrylate group is modified onto both dendrimers and bioadhesive polymers, or onto one species while the other species is modified with a thiol group. These modifications permit photo-crosslink to cure precursor materials and form the nanoglue.
[0077] In another embodiment, dendrimers and bioadhesive polymers are modified to permit the clickable, thiol-ene or thiol-yne reactions, wherein one species is functionalized to terminate with a thiol group whereas the other species is modified with an alkene or alkyne functional group. For example, an alkene can be norbornene. Sometimes, these thiol-ene or thiol-yne reactions are facilitated by photo irradiation.
[0078] In yet other embodiments, crosslinking is achieved with thiol-maleimide, amine-aldehyde or amine carboxylate reactions, and the dendrimers and bioadhesive polymers are modified with relevant groups.
[0079] In photo-crosslink reactions, photo-initiators can be included. Photoinitiators are compounds that, under absorption of light, undergo a photoreaction, producing reactive species that are capable of initiating the crosslink of the unsaturated constituents. Exemplary photoinitiators include IRGACURE® compounds.
[0080] In some embodiments, the photo-crosslinked hydrogel is a transparent, flexible gel that is suited for ocular treatment.
[0081] B. Therapeutic, Prophylactic and Diagnostic Agents
[0082] The nanoglue may include one or more therapeutic, prophylactic, or diagnostic agents that are encapsulated, conjugated to the components of the hydrogel, or encapsulated in/conjugated to sustained release nanoparticle/microparticle formulations that are dispersed in the hydrogel precursor(s). In some embodiments, the agents can be modified with a succinate group via a reaction with succinic anhydride, which are later conjugated to dendrimers and/or bioadhesive polymers at their hydroxyl groups to permit ester linkage and hydrolysis-mediated, sustained release of the agents in tissue.
[0083] Representative therapeutic agents include, but are not limited to, anti-inflammatory drugs, including immunosuppressant agents and anti-allergenic agents, and antiinfectious agents. Some examples of anti-inflammatory drugs include steroids like triamcinolone acetonide, fluocinolone acetonide, prednisolone, dexamethasone, loteprendol, fluorometholone. Immune modulating drugs such as: cyclosporine, tacrolimus and rapamycin. Non steroidal anti inflammatory drug include ketorolac, nepafenac, and diclofenac. Antiinfectious agents include antiviral agents, antibacterial agents, antiparasitic agents, and anti-fungal agents. Exemplary antibiotics include moxifloxacin, ciprofloxacin, erythromycin, levofloxacin, cefazolin, vancomycin, tigecycline, gentamycin, tobramycin, ceftazidime, ofloxacin, gatifloxacin; antifungals: amphotericin, voriconazole, natamycin.
[0084] Active agents can include anti-glaucoma agents that lower intraocular pressure (IOP), anti-angiogenesis agents, growth factors, and combinations thereof. Examples of anti-glaucoma agents include prostaglandin analogs such as travoprost and latanoprost, prostamides such as bimatoprost; beta-adrenergic receptor antagonists such as timolol, betaxolol, levobetaxolol, and carteolol, alpha-2 adrenergic receptor agonists such as brimonidine and apraclonidine, carbonic anhydrase inhibitors such as brinzolamide, acetazolamine, and dorzolamide, miotics (i.e., parasympathomimetics) such as pilocarpine and ecothiopate), seretonergics, muscarinics, and dopaminergic agonists.
[0085] Representative anti-angiogenesis agents include, but are not limited to, antibodies to vascular endothelial growth factor (VEGF) such as bevacizumab (AVASTIN®) and rhuFAb V2 (ranibizumab, LUCENTIS®), and other anti-VEGF compounds including aflibercept (EYLEA®); MACUGEN® (pegaptanim sodium, anti-VEGF aptamer or EYE001) (Eyetech Pharmaceuticals); pigment epithelium derived factor(s) (PEDF); COX-2 inhibitors such as celecoxib (CELEBREX®) and rofecoxib (VIOXX®); interferon alpha; interleukin-12 (IL-12); thalidomide (THALOMID®) and derivatives thereof such as lenalidomide (REVLIMID®); squalamine; endostatin; angiostatin; ribozyme inhibitors such as ANGIOZYME® (Sirna Therapeutics); multifunctional antiangiogenic agents such as NEOVASTAT® (AE-941) (Aeterna Laboratories, Quebec City, Canada); receptor tyrosine kinase (RTK) inhibitors such as sunitinib (SUTENT®); tyrosine kinase inhibitors such as sorafenib (Nexavar®) and erlotinib (Tarceva®); antibodies to the epidermal grown factor receptor such as panitumumab (VECTIBIX®) and cetuximab (ERBITUX®), as well as other anti-angiogenesis agents known in the art.
[0086] In some cases, the active agent is a diagnostic agent imaging or otherwise assessing the eye. Examples of diagnostic agents include paramagnetic molecules, fluorescent compounds, magnetic molecules, and radionuclides, x-ray imaging agents, and contrast media.
[0087] The active agents may be present in their neutral form, or in the form of a pharmaceutically acceptable salt. In some cases, it may be desirable to prepare a formulation containing a salt of an active agent due to one or more of the salt's advantageous physical properties, such as enhanced stability or a desirable solubility or dissolution profile.
[0088] Generally, pharmaceutically acceptable salts can be prepared by reaction of the free acid or base forms of an active agent with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, non-aqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Pharmaceutically acceptable salts include salts of an active agent derived from inorganic acids, organic acids, alkali metal salts, and alkaline earth metal salts as well as salts formed by reaction of the drug with a suitable organic ligand (e.g., quaternary ammonium salts). Lists of suitable salts are found, for example, in Remington's Pharmaceutical Sciences, 20th ed., Lippincott Williams & Wilkins, Baltimore, Md., 2000, p. 704. Examples of ophthalmic drugs sometimes administered in the form of a pharmaceutically acceptable salt include timolol maleate, brimonidine tartrate, and sodium diclofenac.
[0089] In certain embodiments, the nanoglue contains one or more local anesthetics. Representative local anesthetics include tetracaine, lidocaine, amethocaine, proparacaine, lignocaine, and bupivacaine. In some cases, one or more additional agents, such as a hyaluronidase enzyme, is also added to the nanoglue to accelerate and improves dispersal of the local anesthetic.
[0090] C. Formulations
[0091] The nanoglue can be administered as a liquid, or in a solution with one or more pharmaceutically acceptable excipients in one or more pharmaceutically acceptable carrier. Representative excipients include solvents, diluents, pH modifying agents, preservatives, antioxidants, suspending agents, wetting agents, viscosity modifiers, tonicity agents, stabilizing agents, and combinations thereof. Suitable pharmaceutically acceptable excipients are preferably selected from materials which are generally recognized as safe (GRAS), and may be administered to an individual without causing undesirable biological side effects or unwanted interactions.
[0092] Pharmaceutical compositions may be for administration to the eye compartment to be treated (e.g., vitreous, subretinal space, subchoroidal space, the episclera, the conjunctiva, the subconjunctiva, the sclera, the anterior chamber, and the cornea and compartments therein, e.g., subepithelial, intrastromal, endothelial), or corneal surface, and can be formulated in unit dosage forms appropriate for each route of administration.
[0093] Pharmaceutical compositions for other uses include nanoglues formulated for sustained release of antibiotics for intrauterine and genital tract infections. The nanoglue can also be formulated for sealing of other types of injuries including sealing of dura, lung membrane, peritoneum, gastrointestinal, endothelium, and burns
[0094] A benefit of the nanoglue is the targeted biodistribution towards inflammation, as dendrimers can colocalize with macrophages at wound sites, providing targeted delivery for the treatment of macrophage-mediated diseases or disorders.
[0095] D. Kits
[0096] In some embodiments, the compositions are provided in a kit. Formulations are prepared using a pharmaceutically acceptable “carrier” composed of materials that are considered safe and effective and may be administered to an individual without causing undesirable biological side effects or unwanted interactions. Typically the nanoglue will be in a single dose unit, or in a kit with a first containing with liquid to rehydrate the dry components in a second component. These may include components for administration, such as a dropper or another applicator device such as a dual barrel syringe, for example.
III. Methods of Making the Composition
[0097] The method for making dendrimers is known to those of skill in the art and generally involves a two-step iterative reaction sequence that produces concentric shells (generations) of dendritic β-alanine units around a central initiator core. This PAMAM core-shell architecture grows linearly in diameter as a function of added shells (generations). Meanwhile, the surface groups amplify exponentially at each generation according to dendritic-branching mathematics. They are available in generations G0-10 with 5 different core types and 10 functional surface groups. The dendrimer-branched polymer may consist of polyamidoamine (PAMAM), polyester, polyether, polylysine, or polyethylene glycol (PEG), polypeptide dendrimers. Alternatively, dendrimers with various termination groups can be purchased from vendors such as Dendritech.
[0098] Modifications to dendrimers and/or bioadhesive polymers to allow for stimuli-triggered gelation are known with various functional groups. Thiolation of hyaluronic acid is described in the literature. Kafedjiiski K, et al., Int J Pharm, 343(1-2):48-58 (2007) reported the synthesis of thiolated hyaluronic acid by conjugating L-cysteine ethyl ester to the carboxyl (—COOH) groups of the hyaluronic acid using EDC-NHS coupling reaction in aqueous solvent. The resultant product was subjected to oxidation to form disulfide (—S—S—) bridges, which permits HA to form gels for drug delivery. As an alternative, free thiols on hyaluronic acid can be generated to allow for thio-ene click reactions. In this approach, since a reaction in the aqueous medium may result in disulfide formation, an inert condition for this modification reaction is preferred, which provides better control on the degree of substitution and avoids in-situ disulfide formation. Detailed procedures for this modification are explained in the Examples section.
[0099] Active agents can also be modified to permit covalent attachment and controlled release. Alternatively, active agents can be mixed with one or both of the precursor components, and are dispersed in the formed hydrogel.
[0100] In photocrosslinking, the intensity of the irradiation, the exposure time, the amount of photoinitiator, and/or the concentration of the hydrogel precursor components can be adjusted to control how fast the precursor solutions are cured and to tailor the mechanical properties of the formed hydrogel. In preferred embodiments, a low intensity of UV irradiation allows for the gelation of precursor components within one minute, preferably with 30 seconds, which does not pose damages to the retinal cells.
IV. Methods of Using the Composition
[0101] The nanoglue can be used as a sealant for tissue wounds or surgical incisions, for injectable delivery of small molecules, micro/nanoparticles, DNA/siRNAs, etc. for treatment of diseases or disorders, and as instillation formulations for sustained and enhanced permeable delivery of agents to mucosal surfaces. In one embodiment, the hydrogel precursor solution is administered to tissue sites, and the stimuli-triggered gelation takes place in situ. Alternatively, a formed, injectable hydrogel is injected into tissue sites to form a depo. Different methods of applying the nanoglue is based on the kinetics of the chemical groups in the nanoglue, the sites of tissues, and the need of the practitioners.
[0102] A. Ocular Applications
[0103] Corneal Wound
[0104] The cornea of the eye serves an important role in refracting and focusing light rays necessary for clear vision. The cornea possesses the unique characteristics of an orderly arrangement of stromal collagen fibrils and a lack of blood vessels that result in transparency.
[0105] Corneal wounds arise from surgical procedures (e.g., transplants, incisions for cataract removal and intraocular lens implantation, laser-assisted in situ keratomileusis), infections (e.g., ulcers), and traumatic injury (e.g., lacerations, perforations).
[0106] In a preferred embodiment, the hydrogel formed from hyaluronic acid and dendrimers that crosslink upon UV irradiation is applied as a sealant for corneal wounds, where the precursors are applied to the corneal wound and are photo-cured in situ in a tailored manner.
[0107] B. Other Wounds or Surgical Incisions
[0108] In other embodiments, the nanoglue is used in sealing intra-amniotic ruptures or surgical incisions, sealing air leaks in both open and minimally invasive thoracic surgery, sealing vasculature at vascular reconstruction sites, sealing and reducing anastomotic leakage in gastrointestinal surgical procedures, and sealing wounds in cardiovascular surgery.
[0109] Compared with the currently available adhesives or sealants, i.e., fibrin, cyanoacrylates, gelatin/thrombin products, PEG polymer, and albumin/glutaraldehyde products, the nanoglue is advantageous with respect to biocompatibility, low toxicity, transparency, support for versatile modifications and drug conjugations, and tunability for gelling kinetics.
[0110] C. Disorders to be Treated
[0111] In addition to sealing tissues, the nanoglue can be used for local delivery of active agents. In the treatment of ocular diseases or disorders, topical antibiotics and steroids reduce the risk of infection and corneal scarring. However, the drugs are often cleared through tear secretions, which often leads to repeated dosing, elevated intraocular pressure, corneal irritation and toxicity, and potentially discoloration of cornea, (Gibson J M, et al., US Ophthalmic Review, 8.1:2-7 (2015); Mahaj an SH, Carbohydr Polym, May 20; 122:243-7 (2015)).
[0112] The nanoglue forms transparent flexible injectable gels that can be injected intravitreally for sustained release of drugs to treat a variety of posterior segment diseases, e.g., diabetic retinopathy, choroidal neovascularization (CNV), and age related macular degeneration (AMD). Further examples of eye disorders that may be treated include amoebic keratitis, fungal keratitis, bacterial keratitis, viral keratitis, onchorcercal keratitis, bacterial keratoconjunctivitis, viral keratoconjunctivitis, corneal dystrophic diseases, Fuchs' endothelial dystrophy, Sjogren's syndrome, Stevens-Johnson syndrome, autoimmune dry eye diseases, environmental dry eye diseases, corneal neovascularization diseases, post-corneal transplant rejection prophylaxis and treatment, autoimmune uveitis, infectious uveitis, anterior uveitis, posterior uveitis (including toxoplasmosis), pan-uveitis, an inflammatory disease of the vitreous or retina, endophthalmitis prophylaxis and treatment, macular edema, macular degeneration, age related macular degeneration, proliferative and non-proliferative diabetic retinopathy, hypertensive retinopathy, autoimmune disease of the retina, primary and metastatic intraocular melanoma, other intraocular metastatic tumors, open angle glaucoma, closed angle glaucoma, pigmentary glaucoma and combinations thereof.
[0113] The dendrimer-bioadhesive polymer nanoglue may provide sustained release of a therapeutic agent over a period of time. For example, after administration, the therapeutic agent can be released for at least 6 hours, at least 12 hours, at least 1 day, at least 2 days, at least 3 days, at least one week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 2 months, at least 3 months, at least 6 months, at least 9 months, at least 1 year or more.
[0114] Administration of the hydrogel or hydrogel precursors followed by photo irradiation-mediated curing causes less inflammation or increase in IOP over time than if other drug delivery systems are administered. A reduction relative to inflammation or increase in I|OP using sutures of inflammation or IOP can be observed after about 3 days post-administration, until 14 days post-administration or more. Inflammation or IOP is reduced over time, even with administration of conventional or previously available drug delivery systems. However, the reduction or avoidance of inflammation or IOP when using methods and compositions disclosed herein is persistent and more significant. The reduction or avoidance of inflammation or IOP can continue for at least about 3 days, at least about 14 days, at least about 20 days, or at least about 30 days post-administration.
[0115] The present invention will be further understood by reference to the following non-limiting examples.
Example 1. Preparation of Photocrosslinked, Dendrimer-Hyaluronic Acid Hydrogel with Covalently Attached Dendrimer-Drug Conjugates
[0116] Materials and Methods
[0117] Modification of Dendrimer with Methacrylate (D-MA)(Formulation 1)
[0118] The surface of PAMAM G2 and G4 hydroxyl dendrimers are modified with methacrylate groups thereby enabling photo crosslinking (Component 1). Photo crosslinkable dendrimers (G2, G3, G4 and G6) are synthesized by adopting and optimizing previously established lab procedures. Briefly, methacrylic acid was covalently conjugated to the surface groups of the dendrimer using PyBOP/DIEA coupling reaction and the resultant product was purified and dialyzed using water. The formation of the product (D-MA) was confirmed using .sup.1H NMR and HPLC (
[0119] Synthesis of Photo-Crosslinkable, Dendrimer-Drug Conjugate (Component 2)
[0120] Synthesized dendrimer dexamethasone conjugates with photocrosslinkable groups (MA-D-Dex) (G2-G6) were made that can enhance wound healing and prevent corneal scarring and neovascularization. The drugs are not restricted to triamcinolone acetonide, budesonide, fluocinolone acetonide, cyclosporine, rapamycin and etc (prednisolone, dexamethasone, loteprendol, fluorometholone, ketorolac, nepafenac, diclofenac, cyclosporine, tacrolimus) (
[0121] Synthesis of a Photocrosslinkable Dendrimer Anti-Biotic Component (Component 3)
[0122] Dendrimer moxifloxacin conjugates were synthesized with photocrosslinkable groups (MA-D-Mox) that can provide antibacterial barrier and avoids any chance of infection which often results in corneal inflammation, endothaplmities and corneal opacity. The antibiotics are not restricted to antibacterial-ciprofloxacin, erythromycin, levofloxacin, cefazolin, antiviral-vancomycin, gentamycin, tobramycin, ceftazidime, ofloxacin, gatifloxacin, amphotericin, voriconazole, natamycin, and antifungal agents (
[0123] Modification of Hyaluronic Acid with Methacrylate (HA-MA)(Component 4)
[0124] Hyaluronic acid-methacrylate (HA-MA) was synthesized using 2 step procedure. The first step is conversion of commercially available sodium hyluronate (Na-HA) to TBA salt (HA-TBA) and the 2.sup.nd step involves covalently modifying the hydroxyl groups on the hyaluronic acid with methacrylic acid using PyBOP/DIEA coupling reaction (
[0125] Photocrosslinkable hyaluronic acid was synthesized with high degree of methacrylation that enables better crosslinking with the dendrimer and provides flexibility without compromising the mechanical properties of the nanoglue. The polymers are not restricted to collagen, chondroitin sulfate, pullulan, chitosan, cyclodextrin, poly ethylene glycol (linear and star PEG), poly-L-Lysine, PLGA, PGA, Poly capro-lactone etc. (
[0126] Choosing Appropriate Ratios (D:HA):
[0127] We used different ratios of dendrimer and hyaluronic acid components (HA:D) (10:90), (30:70), (50:50), (70:30) and (90:10) to optimize the swelling, strength and stability of the glue. The stability and swelling studies were performed in simulated tear fluid (pH 7.0). We found that if we increase the HA content swelling properties increase and the stability reduces thereby the composition degrades at a faster rate. The nanoglue formulation with polymer ratios of (10:90) and (30:70) did not show significant swelling and were stable for a period of 20 days. From the stability studies, the appropriate composition was (30:70) as the nanoglue is flexible and stable (
[0128] Photocrosslink Formation of Nanoglue
[0129] D-MA, HA-SH, and D(-MA)-Dex or D(-MA)-Mox were premixed. An argon green laser (325 nm) was applied for 20-30 seconds.
[0130] Results
[0131]
Example 2. Optical and Mechanical Properties of Nanoglue Compared to Sutures in Ex Vivo Wounded Rabbit Eyeballs
[0132] Materials and Methods
[0133] Different types of corneal incisions were created on freshly enucleated mature rabbit eyeballs. We used different wound architecture and measured the burst pressure using custom designed manometer system with saline infusion. The nanoglue formulation with premixed formulations were applied on corneal incisions with different wound architecture and a argon green laser (325 nm) (for methacrylate system, formulation 1) or cobalt blue light (for thiol-ene click chemistry, formulation 2) was applied for 20-30 seconds resulting rapid photocrosslinked transparent ocular bandage that can withstand high intraocular pressures than compared to sutures. Briefly, a 3 mm linear incision was created in the central cornea resulting in a gaping wound. A tunnel incision was created. A 3-mm trephine central incision was created. The burst pressure with saline infusion was measured using a manometer system. Components for the formation of nanoglue (40% D-MA and 60% HA-MA) were premixed and applied on corneal incisions. An argon green laser (325 nm) was applied for 20-30 seconds.
[0134] Results
[0135] The components for the formation of nanoglue were rapidly cured, resulting in a transparent gel conforming to the shape of the wounds, avoiding leakage of the fluid. It is believed that the nanoglue strongly adhered to the cornea, especially compared to sutures.
Example 3. Optical and Mechanical Properties of Nanoglue Compared to Sutures in In Vivo Wounded Rat Cornea
[0136] Materials and Methods
[0137] In-vivo evaluation the rats were anesthetized with and pupils were dilated with tropicamide and 10% phenylephrine. A 2.75-mm keratome was used to create a full thickness central corneal incision. The blade was initially directed posteriorly, and after the penetration it was directed to the angle to avoid damaging the lens and its capsule. The incision was then either sutured (10-0 prolene or nylon) or glued with above mentioned nanoglue. Following the suturing/gluing, the corneal incision was confirmed to be closed with fluorescein and cobalt blue light.
[0138] Follow-up was performed 24, 72 hours, 7 days and 2 weeks following surgery. The rat corneas were imaged using optical coherence tomography (OCT) on day 7. The animals were clinically assessed for wound healing until day 14.
[0139] Results
[0140] Following the suturing/gluing with nanoglue, the corneal incision was confirmed to be closed with fluorescein and cobalt blue light using standard techniques. The anterior chambers were formed within 24 hrs. in both the nanoglue and suture treated groups.
[0141] The corneal sealed with nanoglue showed rapid healing and promising results than compared to sutures which resulted in inflammation, neovascularization and corneal irregularity. There was less corneal thickening around the incision. Both sutured and glued corneas demonstrated some degree of fibrosis that can be seen as hyper-reflectivity in the OCT scans (
[0142] Inflammation and neovascularization were more exclusively observed in sutured corneas at day 7. On day 7, the corneal laceration sutured with a single 10-0 suture had fibrosis and corneal edema, which was believed to show improper wound healing. The corneal laceration sealed with nanoglue had some fibrosis but less corneal edema; it also had excellent wound apposition.
[0143] In the nanoglue treated group, the gel sealed the wound till day 10 and the wound healed completely with no signs of infection or toxicity and inflammation.
[0144] On day 14, all the rats treated with nanoglue had complete resolution of the wounds with only minimal scarring, whereas the sutured corneas developed corneal neovascularization, inflammation and corneal irregularity (
[0145] Additionally, the sutured and glued eyes demonstrate a normal anterior segment architecture with a formed anterior chamber, similarly to the control eye. Aqueous chamber was formed within in 24 hrs both in the case of glue and sutures. Inflammation and neovascularization was demonstrated in sutured cornea at POD7. In the case of glue treated incisions. The glue appears to seal the wound till day 10 and the wound heals completely with no signs of infection or toxicity and inflammation (
Example 4. Preparation of Photocrosslinked, Dendrimer-Hyaluronic Acid Hydrogel with Entrapped Dendrimer-Drug Conjugates for Subconjunctival Injections for Treating Corneal Inflammation and Infections
[0146] Materials and Methods
[0147] Materials
[0148] Hydroxyl- and amine-functionalized ethylenediamine core generation four PAMAM dendrimers (G4-OH; diagnostic grade; 64 end-groups) were purchased from Dendritech Inc. (Midland, Mich., USA). Dexamethasone (Dex), succinic anhydride (SA), N,N′-diisopropylethylamine (DIEA), trifluoroacetic acid (TFA), anhydrous dimethylformamide (DMF), dimethylacetamide (DMA) and 4-Pentenoic acid(Kosher) were purchased from Sigma-Aldrich (St. Louis, Mo., USA). Hyaluronate thiol, MW 10k (10% degree of substitution) was purchased using custom synthesis service from creative PEGWorks (Chapel Hill, N.C., USA). (Benzotriazol-1-yloxy)tripyrrolidino-phosphonium hexafluorophosphate (PyBOP) was purchased from Bachem Americas Inc. (Torrance, Calif., USA). Cy5-mono-NHS ester was purchased from Amersham Biosciences-GE Healthcare (Pittsburgh, Pa., USA). ACS grade DMF, dichloromethane (DCM), diethylether, hexane, ethyl acetate, HPLC grade water, acetonitrile, and methanol were obtained from Fisher Scientific and used as received for dialysis, purification and column chromatography. Dialysis membrane (MW cut-off 1000 & 2000 Da) was obtained from Spectrum Laboratories Inc. (Rancho Dominguez, Calif., USA).
[0149] Modification of Dex with a Succinate
[0150] Dex (500 mg, 1.28 mmol) was dissolved in 10 mL of DMF/DMA (8:2) in a 50 mL round bottom flask (RBF) under nitrogen atmosphere and ice bath. Succinic anhydride (192 mg, 1.91 mmol) dissolved in 5 mL of DMF/DMA (8:2) and 0.25 mL of TEA were added to it and the reaction mixture was stirred at 0° C. for 3 h and then at room temperature for 48 h. Dexamethasone has three hydroxyl groups and the most reactive hydroxyl group is in 21-position. In order to avoid conjugation of linker to —OH groups at 11 and 17 positions of Dex, succinic anhydride of no more than 1.2 mole equivalents compared to dexamethasone was used in the reaction.
##STR00001##
[0151] The completion of the reaction was monitored by thin layer chromatography (TLC), performed on silica gel GF254 plates (Whatman, Piscataway, N.J.), using ethyl acetate/methanol (90:10) as mobile phase. The reaction solvent was evaporated under reduced pressure and the crude product was purified with column chromatography by passing through silica gel using ethyl acetate:methanol (99.5:0.5) as eluent to get Dex-21-succinate (535 mg, >90% yield). The obtained purified product was characterized by using .sup.1H NMR spectroscopy with DMSO-d.sub.6 as the solvent and tetramethylsilane (TMS) used as internal standard.
[0152] Synthesis of Dendrimer-Dex Conjugate
[0153] Dex-21-succinate (Dex-Linker, 255 mg, 0.541 mmol) was dissolved in anhydrous DMF (5 mL) in a 50 mL round bottomed flask under nitrogen at 0° C., to which PyBOP (703.9 mg, 1.35 mmol) dissolved in DMF (5 mL) and DIEA (300 μL) was added, and the reaction mixture was allowed to stir for 1 hour in an ice bath. PAMAM G4-OH (505 mg, 0.036 mmol) dissolved in anhydrous DMF (10 mL) was added drop wise to the reaction mixture above, and stirred for 48 hours under nitrogen. The mixture of solvents was evaporated at 25° C. under vacuum. The crude product was re-dissolved in DMF (20 mL) and subjected to dialysis in DMF (membrane MW cutoff=2 kDa) for 48 hours, where the solvent was changed at least 6 times. The obtained solution was evaporated under reduced pressure at room temperature and the resulted sticky viscous solution was precipitated using cold ether twice to remove traces of DMF. The resultant product was re-dissolved in methanol and co-evaporated under reduced pressure and subjected to high vacuum treatment for overnight, to produce an off-white semi-solid dendrimer-triamcinolone conjugate (D-Dex, 630 mg). The resultant semi solid product was dissolved in ice cold DI water and dialyzed against DI water (membrane MWCO=1 kDa) at 4° C. for 5 hours by changing the water every hour to remove traces of DMF and methanol. The resultant water layer was lyophilized to get fluffy white powder of D-Dex (600 mg).
##STR00002##
[0154] The D-Dex conjugates were characterized by .sup.1H NMR for drug loading and reverse-phase HPLC for purity.
[0155] Modification of Dendrimer with an -Ene- or -Nor-Group
[0156] We have also developed hydrogel formulations that can form flexible and injectable gels or corneal adhesive using photo-click thiol-ene chemistry. D-ENE or D-Nor were synthesized using single step coupling reactions between surface hydroxyl groups (—OH) of PAMAM dendrimers and the carboxylate moiety of 4-pentenoic acid or norborene acid. Using proton NMR, we estimated that approximately 28-29 molecules of 4-pentenoic acid were conjugated to one dendrimer molecule. The conjugates were readily soluble in water, PBS buffer and saline.
[0157] 4-pentenoic acid (ENE, 60.0 mg, 0.58 mmol) was dissolved in 3 mL of anhydrous DMF in a 50 mL RBF under nitrogen atmosphere at 0° C., to which PyBOP (560 mg, 0.88 mmol) dissolved in DMF (5 mL) and DIEA (300 μL) was added, and the reaction mixture was allowed to stir for 1 hour in an ice bath. G4-OH (550 mg, 0.04 mmol) was dissolved in 10 mL of anhydrous DMS and was added drop wise to the reaction mixture above, and stirred for 48 hours under nitrogen. The mixture of solvents was evaporated at 25° C. under vacuum. The crude product was re-dissolved in DMF (20 mL) and subjected to dialysis in DMF (membrane MW cutoff=1 kDa) for 24 hours, where the solvent was changed at least 4 times. The obtained solution was evaporated under reduced pressure at room temperature and the resulted sticky viscous solution was precipitated using cold ether twice to remove traces of DMF. The resultant product was dissolved in ice cold DI water and dialyzed against DI water (membrane MWCO=1 kDa) at 4° C. for 6 hours by changing the water every hour to remove traces of DMF The resultant water layer was lyophilized to get fluffy glassy-white powder of D-ENE (590 mg).
##STR00003##
[0158] The D-Dex conjugates were characterized by .sup.1H NMR for drug loading and reverse-phase HPLC for purity.
[0159] Modification of Hyaluronic Acid with a Free Thiol Group
[0160] Sodium salt of HA (NaHA) was first converted to tetrabutylammonium salt (HA-TBA) to be able to solubilize in DMSO/DMF (20:80) for efficient thiolation reaction. To make HA-TBA, NaHA was dissolved in ultrapure water (UPH-DI H.sub.2O) at 2% (w/w) and the ion exchange was done by adding DOWEX 50W proton exchange resin (Sigma, Mo., USA) (3 g resin per 1 g NaHA) with vigorous stirring for 5 h. The resin was filtered off using WHATMAN filter paper and the filtrate was titrated to a pH of 7.4 with TBA-OH. The resulting solution was lyophilized at −80° C. to obtain off-white floppy solid, further the solid was dissolved in DI-H.sub.2O and subjected to water dialysis (membrane MWCO=2 kDa) to remove excess TBA-OH. The resultant water layer was again subjected to lyophilization and stored at −20° C. until used. The ion exchange was confirmed using .sup.1H NMR analysis.
[0161] HA-TBA (615 mg, 0.027 mmol) was dissolved in 10 mL of anhydrous DMSO at 50° C. in a 100 mL RBF under nitrogen atmosphere, to which DCC (640 mg, 3.01 mmol) and DMAP (137.5 mg, 1.12 mmol) dissolved in 20 mL of anhydrous DMF. A catalytic amount of hydroquinone was added to the reaction mixture to avoid formation of disulfides. 3-mercapto propionic acid (300 mg, 2.81 mmol) was dissolved in 10 ml of anhydrous DMF and added dropwise in to RBF and the reaction was stirred for 48 h under nitrogen atmosphere at room temperature. The reaction mixture was centrifuged in 50 mL centrifuge tubes to remove formed DCU and the solvent layer was dialyzed against DMF in 2KD MWCO dialysis tubing for 36 h under vacuum to remove unreacted compounds and soluble DCU. The obtained solution was evaporated under reduced pressure to obtain sticky semi-solid TBA-HA-SH which was dissolved in NaCl solution (0.5 g NaCl per 100 mL of H.sub.2O with catalytic amount of TECEP) and stirred for 20 mins and the solution was precipitated three times with cold acetone and then with cold ethanol five times to remove TECEP and excess salt. The resultant white sold was dissolved in DI H.sub.2O and immediately frozen in liquid nitrogen and lyophilized at −80° C. to obtain white power of HA-SH (370 mg).
##STR00004##
[0162] Alternative Modification of Hyaluronic Acid with a Free Thiol Group
[0163] Thiolated hyaluronic acid was synthesized with high degree of substitution as a thiol component for photoclick hydrogels. HA-SH was synthesized using a three-step process. In the first step the commercially available sodium salt of hyaluronic acid (HA) was converted to DMF/DMSO soluble tetrabutylammoninum (TBA) salt (HA-TBA) using the ion exchange method. In the second step, 3-(tritylthio)propionic acid was conjugated to the hydroxyl (—OH) groups of hyaluronic acid using a Steglich esterification reaction. We used trityl protected thiopropionic acid to avoid thioester and disulfide bonds formation. In the third step, we selectively de-protected the trityl group using 5% TFA in a DMF/DCM (1:5) mixture and in the presence of Et3 SiH to obtain a TBA-HA-SH intermediate. Then, TBA+ groups were fully exchanged using NaCl solution and the reaction mixture was washed with cold acetone and ethanol to remove the excess TBA, DTT and NaCl to yield hyaluronic acid bearing free —SH end groups.
##STR00005## ##STR00006##
[0164] Preparation of Formulation 2
[0165] The chemically crosslinked nanoglue formulation was formed by mixing HA-SH and D-Ene or D-Nor at a ratio of (50:50) with 0.005% photo initiator (Irgacure) using a dual barrel syringe and can be applied over the corneal incision. For curing a cobalt blue light or a flash light and be illuminated resulting in nanoglue photo crosslinking within 30 seconds (
HPLC Characterization of the Conjugates
[0166] The purity of the dendrimer conjugates was analyzed by HPLC (Waters Corporation, Milford, Mass.) equipped with a 1525 binary pump, a 2998 photodiode array (PDA) detector, a 2475 multi-wavelength fluorescence detector, and a 717 auto sampler (kept at 4° C.) interfaced with Empower software. The HPLC chromatograms were monitored at 205 (G4-OH) and 239 nm (Dex conjugated dendrimers) using PDA detector. The water/acetonitrile (0.1% w/w TFA) was freshly prepared, filtered, degassed, and used as mobile phase. A TSK gel ODS-80 Ts (250×4.6 mm, i.d., 5 μm) with TSK gel guard column were used for the study (Tosoh Bioscience LLC, Japan). A gradient flow was used with initial condition of 90:10 (H.sub.2O/ACN) gradually changing the ratios to 70:30 (H.sub.2O/ACN) until 20 min and then gradually increasing the acetonitrile percentage to 50% such that the ratios are 50:50 (H.sub.2O/ACN) at 30 min then again decreasing the acetonitrile to 30 percent such that the ratios are 70:30 (H.sub.2O/ACN) at 40 mins. The gradient was returned to initial conditions 90:10 (H.sub.2O/ACN) in 50 min with flow rate of 1 mL/min for all conjugates.
[0167] Photocrosslink Dendrimer-Hyaluronic Acid Hydrogel in a Syringe
[0168] Injectable dendrimer-hyaluronic acid gel was prepared via thiol-ene photopolymerization by using the dendrimer component (D-ENE) and the hyaluronic acid component (HA-SH) in the ratio of 1:2 respectively. Briefly, 2% solutions of individual components were prepared in PBS and were stored on ice until mixed. D-Dex and free Dex solutions were prepared by dissolving D-Dex and free Dex in PBS such that 10 μL of the solution contains 1.6 mg of Dex in the form of D-Dex or free Dex. For each injections 20 of HA-SH solution, 10 μL of D-ENE solution, 10 μL of D-Dex or free Dex solution and 5 μL of photo-initiator (Irgacure 2959 (Ciba, Basel, Switzerland), 5 mg/mL in DMSO) were mixed in 0.5 mL eppendorf tubes. The hazy mixture solution was loaded in to 0.5 cc insulin syringe and placed under UV light for 5 min. In this formulation D-Dex or free Dex are physically entrapped in the injectable gel.
[0169] Results
[0170] Generation four hydroxyl terminated PAMAM dendrimer (G4-OH) was used due to its low toxicity profile and near neutral surface charge, enabling non-specific retention and interactions in the tissue. A succinic acid spacer was used between the dendrimer and the conjugated drug, since the ester linkage enabled better drug release (Kambhampati S P, et al., Eur J Pharm Biopharm, September; 95(Pt B):239-49 (2015)).
[0171] The structures after modifications or conjugations were confirmed with .sup.1H NMR spectra for the following reactions:
[0172] (i) Dex-Linker was characterized by peaks at 1.34, 1.36 and 1.87 ppm corresponding to —CH.sub.2 protons of linker, and a peak at 12.22 ppm corresponding to carboxylic acid confirming the formation of Dex-Linker;
[0173] (ii) Dendrimer-Dex (D-Dex) was characterized by three peaks at 0.80, 0.88 and 1.49 ppm representing methyl protons (—CH.sub.3) of Dex, a new peak at 4.02 ppm corresponding to modified methylene protons (—CH.sub.2) of dendrimer, and peaks between 5.0 and 7.4 ppm corresponding to aromatic protons of Dex; based on the proton integration from NMR, approximately 7-8 molecules of Dex were conjugated to one dendrimer molecule. The conjugates were readily soluble in water, PBS buffer, and saline;
[0174] (iii) Dendrimer-ene (D-Ene) was characterized by new multiplet peaks around 4.97, 5.05, 5.80 ppm corresponding to H.sub.2C═ and ═CHC alkene protons of 4-pentenoic acid, and a new peak at 4.02 ppm which corresponds to modified methylene protons (—CH.sub.2) of dendrimer. Based on the proton integration, approximately 15 molecules of 4-pentenoic acid were conjugated to one dendrimer molecule. The conjugates were readily soluble in water, PBS buffer, and saline; and
[0175] (iv) HA-TBA salt was characterized by a new multiplet peak between 0.85 to 0.87 ppm corresponding methyl (—CH.sub.3) protons of TBA and two new peaks from 1.23 to 1.59 ppm corresponding to methylene (—CH.sub.2) protons of TBA. Thiolated HA was characterized by the absence of the characteristic peaks of TBA.
[0176] Reverse phase HPLC confirmed the purity of the Dex-linker and the Dendrimer-Dex (D-Dex) conjugate. The hydrophobic free Dex eluted at 22.4 min, whereas the Dex-linker eluted at 27.6 min (with no trace at 37.1 min). At similar HPLC conditions, a broad peak at 32.8 min was observed for D-Dex conjugate (monitored at 240 nm), which was different from that for the starting dendrimer (retention time 15 min). The conjugate was largely pure, as no ‘characteristic’ peaks related to free Dex or Dex-linker was observed. The broad peak of D-Dex conjugate can be attributed to the high loading (˜8 molecules per dendrimer), resulting in some non-polar characteristics.
[0177]
Example 5: Rheological Properties and Morphology of Injectable Hydrogels
[0178] The formation of gel and crosslinking kinetics were assessed using time sweep measurements. Before UV irradiation (till ˜60 s) and until 40 seconds after irradiation, the solution had a low viscosity (
[0179] SEM imaging was used to assess the surface morphology of the injectable gels with and without D-Dex. The HMDS dehydrated gels showed uniformly dense structures with striations in both conditions (with and without D-Dex) (
Example 6. In Vitro Release of Dex from Dendrimer-Dex (D-Dex) Conjugate and Dendrimer-Hyaluronic Acid Hydrogel
[0180] Materials and Methods
[0181] The D-Dex conjugate was prepared and characterized as described in Example 4. A succinic acid spacer was used between the dendrimer and the conjugated drug, and the ester linkage enabled release of the drug from the D-Dex conjugate.
[0182] The release of Dex from the D-Dex conjugate was characterized in simulated vitreous humor [Hanks balanced salt solution with 0.03% sodium hyaluronate (Lifecore biomedical, MN, USA) and 0.1% TritonX (Sigma, Mo., USA)] as a stabilizer and surfactant to reduce released Dex settling. A concentration of 3 mg/mL was maintained in water bath at 37° C. equipped with shaker. At appropriate time points, 2004, of solution was withdrawn from the incubation mixture, frozen in liquid nitrogen and lyophilized. To this lyophilized powder, 4004, of 50:50 (DCM:EtOAc) was added and sonicated for 10 min and centrifuged at 10,000 rpm for 5 min at 4° C. The supernatant was collected and the solvent was evaporated by nitrogen flush and reconstituted with 2004, of 50:50 H.sub.2O:ACN and subjected to HPLC analysis. The percent of released Dex from D-Dex was quantified using the calibration graph.
[0183] Swelling and degradation of injectable gel were assessed in physiological relevant fluids such as phosphate buffer saline (PBS 1×, pH 7.4) and citrate buffer (pH 5). For stability studies, gel pellets with known amounts of D-Dex or free Dex were made using the circular crevice in the caps of the 2 mL eppendorf tubes (diameter=8.0 mm and thickness 4 mm). The pre-weighed pellets (n=3, for each group) were placed in a 12-well plate containing 1 mL of buffer and incubated at 37° C. At discrete time points the pellets were carefully lifted using a spatula and the excess moisture blotted out using kimwipes and weighed. The swelling ratio was calculated using the equation (W.sub.c/W.sub.i)×100, where W.sub.c is the current swollen weight and W.sub.i is the initial weight of the gel. The degradation rate was calculated using the equation ((W.sub.is−W.sub.cd)/W.sub.is)×100, where Ws is the initial swollen weight and Mica is the cured decreased weight.
[0184] The release of D-Dex and free Dex from the injectable gel was analyzed by incubating the gel pellets in 8 mL scintillation vial containing 5 mL of SAH solution. At particular time points 100 μL of samples were withdrawn and analyzed using HPLC. The percent of released free Dex from D-Dex was quantified using the calibration graph.
[0185] Results
[0186] The results are shown in
[0187]
[0188]
Example 7. In Vivo Biodistribution in Rat Cornea of Dendrimer Molecules Entrapped in the Dendrimer-Hyaluronic Acid Crosslinked Gel
[0189] Materials and Methods
[0190] Tagging Dendrimer Molecules with a Fluorescent Label
[0191] Fluorescently labeled G4-OH dendrimer was synthesized and characterized as described in Lesniak W G, et al., Mol Pharm., 10(12):4560-4571 (2013). Briefly, generation four hydroxyl-terminated PAMAM dendrimer (D) was modified with reactive amine surface end groups, which was further reacted with N-hydroxysuccinimide monoester Cy5 dye to generate the D-Cy5 conjugate.
[0192] Corneal Alkali Burn Model
[0193] All procedures involving animals conformed with the IACUC research guidelines by the Association for Research in Vision and Ophthalmology Statement for the use of Animals in Ophthalmic and Vision Research and Johns Hopkins University. A total of 57 Lewis rats (7 to 8 weeks of age) were obtained from Harlan Laboratories Inc. (Frederick, Md.). All animals weighed between 150 and 200 g, and they were housed at constant temperature (20±1° C.) and humidity (50±5%). They were fed standard rat chow and had access to water ad libitum. All procedures and tests were performed under general anesthesia with intramuscular injection of ketamine 0.9% (Bio-niche Pharma, Lake Forest, Ill., USA)/xylazine 0.1% (Phoenix Pharmaceuticals, St. Joseph, Mo., USA) and topical proparacaine 0.5% (Sandoz, Holzkirchen, Germany). Corneal alkali burn was generated by applying 0.5N NaOH on cornea. Briefly, sample discs SS-033 0.5 cm in diameter (WESCOR, Logan, Utah, USA) were cut in to 4 quadrants. The quadrant was soaked in 0.5N NaOH for 10 seconds and then placed on central cornea for 15 s. The burn area and the conjunctival sac were immediately irrigated with 30 mL of BSS solution using an eyedrop bottle.
[0194] Administering to Rat Eyes
[0195] D-Cy5 was dissolved in PBS (250 μg D-Cy5 in 10 uL) and integrated into 40 μl of an injectable gel system as described in example 4 and were loaded in to 0.5 mL 30 G insulin syringes, followed by UV light exposure for 3 mins until gel was formed. The D-Cy5 gels were injected into subconjunctiva, forming blebs. Seven days post injection of D-Cy5, the rats were euthanized using a lethal dose of sodium pentobarbital (Lundbeck, Deerfield, Ill., USA) and the eyes were collected.
[0196] Immunohistochemical Analysis
[0197] The eyes were enucleated and were washed in ice cold PBS for 5 mins. The eyeballs were fixed in 4% PFA in 5% sucrose solution for 5 hours and then subjected to treatment with sucrose gradient. The eye balls were frozen in a 20% Sucrose/optimum cutting temperature (OCT) in a 1:2 ratio, respectively, using dry ice in isopentane. Cryoblocks were stored at −80° C. until 20-μm sections were cut using cryostat (microm, Walldorf, Germany). Four sections from each cryoblock were used for image analysis. The sections were incubated in rabbit anti-ionized calcium binding adapter 1 molecule (Iba-1; Wako Chemicals, Richmond, Va., USA), which is a macrophage cell marker; and then a goat anti-rabbit-Cy3 secondary antibody (Life Technologies, Grand Island, N.Y., USA) and isolectin AF488 (Thermo Fisher, Mass.) for stroma and blood vessels were applied. The corneal and iris part of the sections were analyzed using a confocal microscope (model 710 unit; Carl Zeiss, Inc., Thornwood, N.Y., USA). Excitation and emission wavelengths and laser settings were identical for all tissues. Z-stacks of sections were taken and collapsed to give an image through the depth of the whole section.
[0198] Results
[0199] Iba-1 was used as a marker for corneal macrophages. In a normal eye, Iba-1+ cells were found in minimal amounts in the central cornea region (
Example 8: In Vivo Subconjunctival Treatment with Dendrimer-Hyaluronic Acid Gel Delivering Dendrimer-Dexamethasone (D-Dex) Following Corneal Alkali Burn in Rats
[0200] Materials and Methods
[0201] Corneal alkali burn was performed on rats as described in Example 7.
[0202] Administering Gel Treatments
[0203] After alkali burn, the animals were randomized for treatment in one of the following three groups: (i) Dendrimer-Dexamethasone conjugates entrapped in injectable, dendrimer-hyaluronic acid photocrosslinked gel with a minimal amount of free dexamethasone (D-Dex group, n=10), (ii) free dexamethasone in injectable, dendrimer-hyaluronic acid photocrosslinked gel (free-dex group, n=10), and (iii) no drug, only injectable, dendrimer-hyaluronic acid photocrosslinked gel, n=10. Both D-Dex and free-Dex groups were treated with equivalent Dex basis present in both D-Dex and free Dex formulations (1.6 mg of Dex/eye). Given that the D-Dex conjugates did not release enough dexamethasone in the first few days after its administration, a decision was made to augment it with a bolus of 5% of the total dose of free dexamethasone per dose (i.e.: 1.6 mg dexamethasone conjugated to the dendrimer gel and an additional dose of 0.16 mg of free dexamethasone). The free dexamethasone group received a total of 1.6 mg of free dexamethasone. It is unlikely that the small additional dose of the free drug in the dendrimer group (0.16 mg) had a therapeutic effect beyond the first few hours after injection. All forms of drugs were incorporated into injectable gel formulations (it is the same gel formulation as of example 4). The gel components are premixed and loaded in to the syringe and crosslinked to form gel using UV exposure. At the time of injection the components are in the form of gel) and injected subconjunctivally using 30-gauge, 0.5 cc insulin syringes. The total volume administered did not exceed 40 μL.
[0204] Clinical and Molecular-Level Evaluations
[0205] Animals were assessed at baseline and at the following post-exposure time points: 24 hours, 72 hours, and 7 days. A subset of the animals was also followed up to 14 days.
[0206] The central corneal thickness (CCT) and stromal structure analysis were done using anterior chamber optical coherence tomography (OCT) (Bioptigen Envisu R-class OCT, Bioptigen, N.C., USA).
[0207] Changes in intraocular pressure (TOP) were measured using a handheld tonometer (Icare LAB tonometer, Icare, Finland). The settings R for rat were chosen and three individual measurements of IOP were made for each eye for accuracy.
[0208] Corneal opacity was scored by grading the degree of transparency as previously reported by Larkin D F, et al., Clin Exp Immunol., 107:381-391 (1997). The estimated area of neovascularization (NV) was assessed by estimating the radial penetration of the neovascular vessels and their extent in degrees, and by assuming a mean corneal diameter of 2.5 mm, so that the maximal area of NV was no more than 2.52n mm.sup.2 (=19.63 mm.sup.2).
[0209] For immunohistochemical analysis, the corneas (n=3, for each group) were washed in cold PBS and processed as described in Example 7, Immunohistochemical analysis. Stained sections were imaged under confocal microscope. The corneal macrophages in the central cornea were counted manually.
[0210] For cytokine expression analysis, the corneas (n=10, for each group) were snap frozen in liquid nitrogen and homogenized carefully into tissue powder using pre-cooled (in liquid nitrogen) porcelain mortar and pestles. The total RNA was purified with TRIzol reagent (Life Technologies, Grand Island, N.Y.) following the manufacturer's instruction. 3 μg of total RNA was reverse-transcribed to cDNA using High-capacity cDNA Reverse Transcription System (Life Technologies) according to the manufacturer's instructions. qRT-PCR was performed with fast SYBR Green Master Mix (Life Technologies) by a StepOnePlus Real-Time PCR System (Life Technologies). Rat GAPDH was used to normalize the expression levels of target gene and calculated by the comparative cycle threshold Ct method (2{circumflex over ( )}-(ΔΔCt)).
[0211] Results
[0212] Central corneal thickness (CCT): There were no baseline differences in CCT between the groups (D-Dex vs. free-Dex: p=0.4; D-Dex vs. positive controls: p=0.67; free-Dex vs. positive controls: p=0.69). CCT was increased in all groups at POD 1 and 3 (see
[0213] Intraocular pressure: As demonstrated in
[0214] Estimated area of neovascularization: Neovascular vessels appeared in all groups no earlier than POD3. As shown in
[0215] Corneal opacity score: Median opacity scores were all zero at baseline for all studied groups. The corneas lost their transparency as soon as POD1, however, the positive control group never recovered, as shown in
[0216] Immunohistochemistry and confocal microscopy: Immunohistochemistry and high resolution imaging using confocal microscopy was used at POD 7 and 14 in order to qualitatively assess the number of macrophages present in the central cornea. This measure provided an additional indirect estimate of the ability of the different treatments to decrease tissue inflammation. As previously explained in the biodistribution section, alkali burns cause structural damage and macrophage infiltration of the cornea.
[0217] The positive control group, that was treated with a placebo gel showed accumulation of macrophages in the central cornea at POD7, similar to what was seen in corneas exposed to alkali burn that had not been given any steroid treatment whatsoever. A persistent Iba-1 positive infiltrate (macrophages) was observed at POD 14 in these positive controls. We also observed some improvement in central corneal architecture that can be attributed to the natural healing process in rat model (
[0218] Evaluation of inflammatory cytokine production using RT-PCR:
[0219] Conclusions: Corneal inflammation is an important pathological event implicated to play a crucial role in many diseases progressing to their advance stages by disrupting normal corneal homeostasis. Topical steroids are beneficial in reducing leukocyte/macrophage recruitment but required to be dosed frequently which may result in corneal toxicity and melting (M. D. Wagoner, Chemical injuries of the eye: current concepts in pathophysiology and therapy, Survey of ophthalmology 41(4) (1997) 275-313; S. Den, et al., Efficacy of early systemic betamethasone or cyclosporin A after corneal alkali injury via inflammatory cytokine reduction, Acta Ophthalmologica Scandinavica 82(2) (2004) 195-199; P. C. Donshik, et al., Effect of topical corticosteroids on ulceration in alkali-burned corneas, Archives of Ophthalmology 96(11) (1978) 2117-2120). As shown in the present invention, therapies aimed at targeting the very cells responsible for inflammation and delivering steroids in a sustained manner, which can be administered at the time of surgery are a viable option. In the present invention, we used mild rat alkali burn injury as a model for corneal inflammation. The intrinsic targeting ability of PAMAM G4 hydroxyl dendrimers to localize in activated corneal macrophages is utilized to develop a sustained, targeted and intracellular delivery of dexamethasone to attenuate corneal inflammation. The D-Dex conjugate with a payload of ˜20% was highly soluble in aqueous solutions. The conjugates demonstrated improved anti-inflammatory activity (˜1.6 fold at 10-fold lower concentration than that of free dexamethasone) in LPS activated macrophages in vitro.
[0220] To extend and sustain the bioavailability of D-Dex, we developed an injectable gel system based on dendrimer and hyaluronic acid, crosslinked thiol-ene click photo chemistry. The gel formulations possess viscoelastic properties, are easily injectable and provide a sustained release of D-Dex. The dendrimers released from the injectable gel after subconjunctival administration targets and co-localizes in activated macrophages in central cornea with alkali burn. A single subconjunctival injection of D-Dex incorporated gel lead to prolonged efficacy for a period of 2 weeks. The D-Dex gel treatment demonstrated better outcomes such as reduced central corneal thickness, improved corneal clarity with no signs of elevation of intraocular pressure. The pharmacodynamics effect of D-Dex gel treatment attenuating corneal inflammation was demonstrated by significant reduction in macrophage infiltration in to central cornea and suppressed pro-inflammatory cytokines production compared to free drug.
[0221] The compositions and methods of the present invention disclosed herein support the concept that dendrimers are effective treatment vehicles in inflammatory disorders of the cornea. The compositions and methods of the present invention are also unique in the route of administration for the dendrimer-gel formulation-subconjunctival. This route is clinically accessible, does not necessitate an expensive resource such as an operating room, and the potential space can allow the administration of a relatively large volume of a drug. The delivery of a drug reservoir frees the patient of the need for repeat instillation of a topical drop and may improve compliance and outcome. Despite of the recent development of depot drugs for the posterior segment of the eye, to date there is no commercially available drug specifically designed to provide long standing drug delivery to the cornea. The system depicted in the present invention is specifically designed to deliver drugs to the anterior segment of the eye and has been shown to be efficacious in treating corneal inflammation.
List of Tables:
[0222]
TABLE-US-00001 TABLE 1 corneal opacity grading Opacity grade Degree of transparency 0 Transparent 1 Minimal loss of transparency 2 Iris vessels visible 3 Pupil outline visible 4 Pupil outline obscured
Table 1: Corneal Opacity Scores.
[0223] The degree of corneal transparency as a measure of efficacy after administration of subconjutival D-Dex, Free Dex or placebo. The grading measures were adopted from Larkin et al. (Identification and characterization of cells infiltrating the graft and aqueous humour in rat corneal allograft rejection, Clinical & Experimental Immunology 107(2) (1997) 381-391).
TABLE-US-00002 TABLE 2 Primer sequences Primer Segment Sequence GAPDH Forward GCAAGAGAGAGGCCCTCA (Glyceraldehyde (5′-3′) (SEQ ID NO: 1) 3-phosphate Reverse TGTGAGGGAGATGCTCAGTG dehydrogenase) (3′-5′) (SEQ ID NO: 2) TNF-α Forward TCAGTTCCATGGCCCAGAC (Tumor (5′-3′) (SEQ ID NO: 3) necrosis Reverse GTTGTCTTTGAGATCCATGCCATT factor-α) (3′-5′) (SEQ ID NO: 4) IL-1β Forward CACCTCTCAAGCAGAGCACAG (Interleukin- (5′-3′) (SEQ ID NO: 5) 1β) Reverse GGGTTCCATGGTGAAGTCAAC (3′-5′) (SEQ ID NO: 6) IL-6 Forward AAAGAGTTGTGCAATGGCAATTCT (Interleukin-6) (5′-3′) (SEQ ID NO: 7) Reverse CAGTGCATCATCGCTGTTCATACA (3′-5′) (SEQ ID NO: 8) MCP-1 Forward CTATGCAGGTCTCTGTCACGCTTC (monocyte (5′-3′) (SEQ ID NO: 9) chemoattractant Reverse CAGCCGACTCATTGGGATCA protein -1) (3′-5′) (SEQ ID NO: 10) VEGF Forward GGCTTTACTGCTGTACCTCC (Vascular (5′-3′) (SEQ ID NO: 11) endothelial Reverse CAAATGCTTTCTCCGCTCT growth (3′-5′) (SEQ ID NO: 12) factor)
TABLE-US-00003 TABLE 3 Summary of clinical outcomes Outcome measure Group Baseline POD1 POD3 POD7 POD14 CCT (μm) D-Dex 122.08 ± 28.17 288.58 ± 72.27 307.46 ± 128.98 165.54 ± 68.64 174.9 ± 115.15 Free-Dex 142.86 ± 8.68 304.95 ± 87.23 357.71 ± 115.58 229.57 ± 91.54 226.57 ± 63.67 Positive 132.8 ± 20.09 291.9 ± 38.67 370.3 ± 92.10 250.6 ± 79.37 286.83 ± 156.57 controls Opacity D-Dex 0 (0) 2 (3) 2.5 (2) 1 (1) 0 (0) score Free-Dex 0 (0) 3 (3) 3.5 (1) 1 (1) 1 (2) Positive 0 (0) 3 (3) 4 (1) 2.5 (1) 2.5 (3) controls Estimated D-Dex 0 ± 0 0± 2.5 ± 1.57 2.21 ± 2.53 3.43 ± 4.2 area of NV Free-Dex 0 ± 0 0 ± 0 3.32 ± 1.65 3.8 ± 2.89 43.32 ± 5.46 (mm.sup.2) Positive 0 ± 0 0 ± 0 4.03 ± 1.02 7.74 ± 3.02 8.29 ± 5.4 controls IOP D-Dex 10.29 ± 1.73 10.63 ± 2.02 10.00 ± 0.98 11.33 ± 3.03 10.90 ± 2.08 (mmHg) Free-Dex 11.36 ± 1.84 10.73 ± 2.07 12.14 ± 2.93 14.45 ± 2.32 19.38 ± 3.89 Positive 11.23 ± 1.54 11.59 ± 2.97 11.91 ± 6.02 16.77 ± 5.31 17.50 ± 6.32 controls
Table 3: Summary of Clinical Outcomes after Subconjutival Treatment of D-Dex, Free-Dex and Placebo (Positive Control) Gels.
[0224] All results are displayed as mean±standard deviation except for the opacity scores that are displayed as median (inter-quartile range). POD—post operative day; CCT—central corneal thickness; NV—neovascularization; TOP—intraocular pressure.