4/91 IBV vaccine with heterologous spike protein

Abstract

The present invention relates i.a. to a 4/91 IBV (infectious bronchitis virus) encoding for a heterologous S (spike) protein or fragment thereof. Further, the present invention relates to an immunogenic composition comprising said 4/91 IBV encoding for a heterologous S (spike) protein or fragment thereof. Furthermore, the present invention relates to methods for immunizing a subject comprising administering to such subject the immunogenic composition of the present invention. Moreover, the present invention relates to methods of treating or preventing clinical signs caused by IBV in a subject of need, the method comprising administering to the subject a therapeutically effective amount of an immunogenic composition according to the present invention.

Claims

1. A genetically engineered 4/91 infectious bronchitis virus (IBV) encoding for a heterologous IBV spike protein (S protein) or fragment thereof, wherein the heterologous IBV S protein or fragment thereof comprises an amino acid sequence having at least 90% sequence identity to at least one of SEQ ID NOs: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17.

2. The 4/91 IBV of claim 1, wherein the heterologous IBV S protein or fragment thereof is from an IBV with a genotype or serotype selected from: Arkansas, Brazil, California, Connecticut, Delaware, Dutch, Florida, Georgia, Gray, Holte, Iowa, Italy, JMK, LDT3, Maine, Massachusetts, Pennsylvania, PL84084, Qu, QX, Q1, SE 17, and Variant 2.

3. The 4/91 IBV of claim 1, wherein the heterologous IBV S protein or fragment thereof is from an IBV with a genotype or serotype selected from: Massachusetts, QX, Q1, Arkansas, Variant 2, and Brazil.

4. The 4/91 IBV of claim 1, wherein the heterologous IBV S protein or fragment thereof comprises 500 amino acids.

5. The 4/91 IBV of claim 1, wherein the genetically engineered 4/91 IBV is attenuated.

6. A method for immunizing a subject, comprising: administering to the subject an immunogenic composition comprising a genetically engineered 4/91 IBV encoding for a heterologous IBV S protein or fragment thereof, wherein the heterologous IBV S protein or fragment thereof comprises an amino acid sequence having at least 90% sequence identity to at least one of SEQ ID NOs: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17.

7. The method of claim 6, wherein a protective immune response effective to reduce or eliminate subsequent IBV-infection clinical signs in the subject, relative to a non-vaccinated control subject of the same species, is elicited by administration of the immunogenic composition.

8. The method of claim 6, wherein a protective immune response effective to reduce ciliostasis risk in the subject, relative to a non-vaccinated control subject of the same species, is elicited by administration of the immunogenic composition.

9. The method of claim 6, wherein the subject is a poultry.

10. The method of claim 6, wherein the method is effective to prevent or reduce ciliostasis, rales, egg drop, kidney lesions, watery diarrhea, weight loss, viral load, and/or viral shedding in the subject relative to a non-vaccinated control subject of the same species if the subject is subsequently infected with IBV.

11. An immunogenic composition comprising a genetically engineered 4/91 IBV encoding for a heterologous IBV S protein or fragment thereof in a pharmaceutically-acceptable carrier, wherein the heterologous IBV S protein or fragment thereof comprises an amino acid sequence having at least 90% sequence identity to at least one of SEQ ID NOs: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17.

12. The immunogenic composition of claim 11, wherein the heterologous IBV S protein or fragment thereof is from an IBV with a genotype or serotype selected from: Arkansas, Brazil, California, Connecticut, Delaware, Dutch, Florida, Georgia, Gray, Holte, Iowa, Italy, JMK, LDT3, Maine, Massachusetts, Pennsylvania, PL84084, Qu, QX, Q1, SE 17, and Variant 2.

13. The immunogenic composition of claim 11, wherein the heterologous IBV S protein or fragment thereof is from an IBV with a genotype or serotype selected from: Massachusetts, QX, Q1, Arkansas, Variant 2, and Brazil.

14. The immunogenic composition of claim 11, wherein the heterologous IBV S protein or fragment thereof comprises 500 amino acids.

15. The immunogenic composition of claim 11, wherein the 4/91 IBV is attenuated.

16. The immunogenic composition of claim 11, wherein the immunogenic composition is a vaccine.

17. The immunogenic composition of claim 11, wherein the immunogenic composition is part of a kit.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1. In ovo replication kinetics for CR88 rIBV H52 S in comparison to recombinant wild type viruses CR88 and H52. Data points represent the mean of 5 samples per time point. Error bars indicate the standard deviation.

(2) FIG. 2. Summary of ciliostasis scoring. The sum of the 10 individual scores for the 10 rings of one animal is calculated and is represented by one dot in the graph. Maximum ciliostasis corresponds to a score of 40, while absence of ciliostasis is represented by a score of 0. Mean and significance are calculated using GraphPad Prism and an ordinary one-way ANOVA test (p<0.0001).

(3) FIG. 3. Summary of RT-qPCR results of kidney tissues. Each individual bird is indicated by one data point.

(4) FIG. 4. Summary of ciliostasis scoring. The sum of the 10 individual scores for the 10 rings of one animal is calculated and is represented by one dot in the graph. Maximum ciliostasis corresponds to a score of 40, while absence of ciliostasis is represented by a score of 0. Mean and significance are calculated using GraphPad Prism and an ordinary one-way ANOVA test (p<0.0001).

SEQUENCES OVERVIEW

(5) SEQ ID NO:1 CR88 genome

(6) SEQ ID NO:2: CR88 IBV spike (S) protein.

(7) SEQ ID NO:3: CR88 IBV Nucleocapsid (N) protein.

(8) SEQ ID NO:4: CR88 IBV Envelope (E) protein.

(9) SEQ ID NO:5: CR88 IBV Membrane glycoprotein (M) protein.

(10) SEQ ID NO:6 and 7: Heterologous S protein or fragment from genotype or serotype Massachusetts.

(11) SEQ ID NO:8 and 9: Heterologous S protein or fragment thereof from genotype or serotype QX.

(12) SEQ ID NO:10 and 11: Heterologous S protein or fragment thereof from genotype or serotype Q1.

(13) SEQ ID NO:12 and 13: Heterologous S protein or fragment thereof from genotype or serotype Arkansas.

(14) SEQ ID NO:14 and 15: Heterologous S protein or fragment thereof from genotype or serotype Variant 2.

(15) SEQ ID NO:16 and 17: Heterologous S protein or fragment thereof from genotype or serotype Brazil.

(16) SEQ ID NO:18: pUC57-s CR88 mIBV.

(17) SEQ ID NO:19: IBV H52 Spike nucleic acid coding sequence

(18) SEQ ID NO:20: IBV CR88 Spike nucleic acid coding sequence

(19) SEQ ID NO:21 pUC57-s CR88 rIBV donor plasmid.

(20) SEQ ID NO:22: pUC57-s CR88 rIBV H52 S donor plasmid.

(21) SEQ ID NO:23 to SEQ ID NO:52 Primer.

(22) SEQ ID NO:53 KF377577 (4/91 IBV nucleotide sequence)

(23) SEQ ID NO:54 AGY56140 (4/91 IBV Spike protein amino acid sequence)

(24) SEQ ID NO:55 EU914938 (4/91 IBV Spike protein amino acid sequence)

(25) SEQ ID NO:56 KM067900 (4/91 IBV Spike protein amino acid sequence)

(26) SEQ ID NO:57 EU780081 (4/91 IBV Spike protein amino acid sequence)

(27) SEQ ID NO:58 AGY56143 (4/91 IBV E protein amino acid sequence)

(28) SEQ ID NO:59 AGY56144 (4/91 IBV M protein amino acid sequence)

(29) SEQ ID NO:60 AF093793 (4/91 IBV Spike protein amino acid sequence)

(30) SEQ ID NO:61 Primer

EXAMPLES

(31) The following examples are set forth below to illustrate specific embodiments of the present invention. These examples are merely illustrative and are understood not to limit the scope or the underlying principles of the present invention.

Example 1

Generation of Recombinant IBV CR88 in Which the Coding Sequence for the CR88 Spike is Replaced by the Coding Sequence for a Heterologous Spike or Spike Ectodomain

(32) Targeted RNA Recombination and Rescue of Recombinant IBV

(33) For the generation of recombinant IBV the method of targeted RNA recombination as described by van Beurden et al. (Virol J. 2017; 14(1):109) is applied. A murinized helper virus (mIBV) is generated to enable the targeted recombination of IBV in cell culture.

(34) Construction of an IBV CR88 Murinized Donor Plasmid

(35) To generate the CR88 murinized (m)IBV donor plasmid the donor sequence is synthesized by a commercial supplier: 497 bases of the 5′ UTR of the CR88 genome are fused to the 3′ part of the lab region (752 bases) and the first 72 bases coding for the CR88 IBV spike, followed by 3753 bases of the MHV spike ectodomain, continuing with the terminal 210 bases of the CR88 IBV spike and the following sequence until the 3′ end of the genome. In addition, a SacI restriction site and the sequence of the T7 promoter are added to the 5′ end of the donor region, as well as a 100× polyA sequence, followed by a Not I restriction site for linearization at the 3′ end. respectively. A silent A to C mutation at position 5634 of the assembled sequence is introduced to generate an XhoI restriction site. The synthesized sequence is inserted into pUC57-simple to yield the pUC57-s CR88 mIBV donor plasmid (SEQ ID NO:18).

(36) Rescue of CR88 mIBV

(37) CR88 mIBV is rescued in analogy to H52 mIBV (van Beurden et al. Virol J. 2017; 14(1):109) with some alterations: The virus allantoic fluid stock is concentrated via ultracentrifugation before isolation of the viral RNA for electroporation. 18 ml of viral allantoic fluid are centrifuged at 50,000×g for 2 hours through a 2 ml 20% Sucrose cushion in TNE (Tris, NaCl, EDTA) buffer. The supernatant is discarded and the pellet resuspended in 150 μl TNE buffer followed by RNA isolation with QIAamp viral RNA mini kit (Qiagen). Further, chicken embryo fibroblasts (CEFs) instead of BHK cells are used for electroporation (2 pulses 250V/300 μF, 10 sec break) and 1.25% DMSO is added to the electroporation mixture.

(38) Construction of an IBV CR88 Donor Plasmid in which the Coding Sequence for the CR88 Spike is Replaced by the Coding Sequence for a Heterologous Spike or Spike Ectodomain

(39) Exemplary the construction for the replacement of the CR88 spike by the H52 spike is described. The IBV H52 spike nucleic acid coding sequence (SEQ ID NO:19) is used as a template to replace the IBV CR88 spike nucleic acid coding sequence (SEQ ID NO:20) in the pUC57-s CR88 rIBV donor plasmid (generated as described above for the mIBV plasmid by keeping the complete CR88 Spike sequence (SEQ ID NO:21)). Bases 1657 to 5151 of SEQ ID NO:21 are replaced with the corresponding IBV H52 spike nucleic acid coding sequence (SEQ ID NO:19). This results in the pUC57-s CR88 rIBV H52 S donor plasmid (SEQ ID NO:22) in which the IBV H52 spike is encoded by bases 1657 to 5145. For this, the H52 spike nucleic acid coding sequence and the pUC57-s CR88 backbone sequence are amplified in two separate PCR reactions with Q5C) High-Fidelity DNA Polymerase (NEB; see table 1 for primers). The PCR products are purified by QIAquick gel extraction kit (QIiagen) and are subsequently used for Gibson assembly with the NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) according to the kit protocol to generate the pUC57-s CR88 rIBV H52 S donor plasmid (SEQ ID NO:22).

(40) TABLE-US-00001 TABLE 1 Gibson assembly primers designed with the NEBuilder online tool by NEB and used to generate PCR products to assemble the pUC57-s CR88 rIBV H52 S donor plasmid (SEQ ID NO: 22). PCR Product Primer 1 CR88  tgattaaaagtcccacatcttttc backbone taatattattaattcttctttgg (SEQ ID NO: 23) ctcttaccagtaacttaccacact taattaaattaaagactaagtc (SEQ ID NO: 24) 2 H52 aagtgtggtaagttactggtaaga Spike gatgttggtaacacctcttttac (SEQ ID NO: 25) agaaaagatgtgggacttttaatc attaaacagactttttaggtctg (SEQ ID NO: 26)
Targeted RNA Recombination and Rescue of Recombinant IBV

(41) For the rescue of CR88 rIBV with heterologous spike or spike ectodomain, LR7 cells are infected with CR88 mIBV and electroporated with in vitro transcript, generated from the pUC57-s CR88 rIBV H52 S donor plasmid after NotI linearization. Subsequently, cells and supernatant are injected into 8-day old embryonated SPF chicken eggs (VALO BioMedia) which are incubated up to 9 days at 37.5° C. and 60% humidity. The allantoic fluid of eggs with dead embryos is harvested and used for an end-point dilution in 8-day old SPF eggs. Nucleic acids isolation of allantoic fluid samples of the limiting dilution is performed using the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) with the KingFisher™ Duo Prime Purification System (ThermoFisher). Nucleic acids are subsequently analyzed for the presence and relative quantity of rIBV via IBV specific RT-qPCR with a protocol adapted from Callison et al. (J Virol Methods. 2006; 138(1-2):60-5). Briefly, the same primers and probe are used and the thermoprofile is adapted for the use of TaqMan® Fast Virus 1-Step Master Mix (ThermoFisher) and the a StepOnePlus™ Real-Time PCR System (ThermoFisher). Afterwards, the positive-tested allantoic fluid of the egg inoculated with the highest dilution is used for propagation in 8-day old embryonated SPF chicken eggs. The allantoic fluid is diluted 1:100 in 1×PBS and 100 μl are injected per egg. Allantoic fluid is harvested 48 hours post inoculation, cleared from debris and stored at −80° C. and again analyzed by RT-qPCR to confirm stock quality.

(42) To confirm the correct insertion of the spike in the generated rIBV, viral nucleic acid is isolated with the QIAamp viral RNA mini kit followed by the SuperScript III One-Step RT-PCR using the primers listed in table 2, QIAquick PCR purification and subsequent Sanger sequencing performed by a commercial supplier.

(43) TABLE-US-00002 TABLE 2 PCR and sequencing primers to confirm the correct insertion and spike sequence in CR88 rIBV H52 S. Amplicon PCR Name Sequence Region Purpose [bp] 1 PO1565 caggattgtgcatggtggac 1 ab PCR + 2468 (SEQ ID NO: 27) Sequencing PO764 agaaaacctaaaggtcctgc S PCR + (SEQ ID NO: 28) Sequencing PO618 taaatggtgatcttgttt S Sequencing n/a (SEQ ID NO: 29) PO1410 tttgtatacgagagccatca S Sequencing (SEQ ID NO: 30) 2 PO1400 ttgccttcagtatgtttgtg S PCR + 2531 (SEQ ID NO: 31) Sequencing PO635 ctgcgacaagacctcctg M PCR + (SEQ ID NO: 32) Sequencing PO619 tgctgcttcctttaataag S Sequencing n/a (SEQ ID NO: 33) PO1183 cgctgttgtgacactctatg S Sequencing (SEQ ID NO: 34)
Generation and Characterization of CR88 Recombinant IBV in Which the Coding Sequence for the CR88 Spike or Spike Ectodomain is Replaced by the Coding Sequence for a Spike From Another IBV Genotype

(44) The same methods as described for the generation of CR88 rIBV H52 S are applied to generate and characterize CR88 recombinant IBV in which the CR88 spike coding sequence (bases 1657 to 5151 in SEQ ID NO:21) or CR88 spike ectodomain coding sequence (bases 1711 to 4941 in SEQ ID NO:21) is replaced with the coding sequences for the IBV spike or spike ectodomain of the serotypes and genotypes listed in Table 3.

(45) TABLE-US-00003 TABLE 3 Primers used for Gibson assembly of H52 rIBV donor plasmids with heterologous spikes or spike ectodomains. spike PCR product primer H52 S Ecto 1 CR88 tggccttggtatgtg SEQ ID NO: 6 backbone tgg (SEQ ID NO: 35) agcactacatagtgc atac (SEQ ID NO: 36) 2 H52 tctttggtatgcact S Ecto atgtagtgctgcttt gtatgactcgagttc (SEQ ID NO: 37) tggcaagccacacat accaaggccacttaa tataagttttgagta ttgaaagtttttc (SEQ ID NO: 38) QX S 1 CR88 tgattaaaagtccca SEQ ID NO: 7 backbone catcttttctaatat tattaattcttcttt gg (SEQ ID NO: 23) ctcttaccagtaact taccacacttaatta aattaaagactaagt c (SEQ ID NO: 24) 2 QX S aagtgtggtaagtta ctggtaagagatgtt ggtgaagtcactg (SEQ ID NO: 39) agaaaagatgtggga cttttaatcattaaa cagactttttaggtc tg (SEQ ID NO: 26) QX S Ecto 1 CR88 tggccttggtatgtg SEQ ID NO: 8 backbone tgg (SEQ ID NO: 35) agcactacatagtgc atac (SEQ ID NO: 36) 2 QX S tctttggtatgcact Ecto atgtagtgctaattt gtttgattctgataa taattatg (SEQ ID NO: 40) tggcaagccacacat accaaggccacttaa tataagttttaatta ttgaaagttcttc (SEQ ID NO: 41) Q1 S 1 CR88 tgattaaaagtccca SEQ ID NO: 9 backbone catcttttctaatat tattaattcttcttt gg (SEQ ID NO: 23) ctcttaccagtaact taccacacttaatta aattaaagactaagt c (SEQ ID NO: 24) 2 Q1 S aagtgtggtaagtta ctggtaagagatgtt ggggaagtcactg (SEQ ID NO: 42) agaaaagatgtggga cttttaatcattaaa cagactttttaggtc tg (SEQ ID NO: 26) Q1 S Ecto 1 CR88 tggccttggtatgtg SEQ ID NO: 10 backbone tgg (SEQ ID NO: 35) agcactacatagtgc atac (SEQ ID NO: 36) 2 Q1 S tctttggtatgcact Ecto atgtagtgctgcttt gtttgataataatga aac (SEQ ID NO: 43) tggcaagccacacat accaaggccatttaa tataagtcttgagta ttgaaag (SEQ ID NO: 44) Ark S 1 CR88 ggtaacttaacaata SEQ ID NO 11 backbone cagacctaaaaagtc tg (SEQ ID NO: 61) ctcttaccagtaact taccacacttaatta aattaaagactaagt c (SEQ ID NO: 24) 2 Ark S aagtgtggtaagtta ctggtaagagatgtt ggtgaagtcactg (SEQ ID NO: 39) gtctgtattgttaag ttaccacatcgttat c (SEQ ID NO: 45) Ark S Ecto 1 CR88 tggccttggtatgtg SEQ ID NO 12 backbone tgg (SEQ ID NO: 35) agcactacatagtgc atac (SEQ ID NO: 36) 2 Ark S tctttggtatgcact Ecto atgtagtgctaattt atatgacaacgaatc ttttg (SEQ ID NO: 46) tggcaagccacacat accaaggccacttaa tataagttttgagta ttgaaag (SEQ ID NO: 47) Variant 2 S 1 CR88 ggtaacttaacaata SEQ ID NO 13 backbone cagacctaaaaagtc tg  (SEQ ID NO: 61) ctcttaccagtaact taccacacttaatta aattaaagactaagt c (SEQ ID NO: 24) 2 Variant aagtgtggtaagtta 2 S ctggtaagagatgtt ggtgaagtcactg (SEQ ID NO: 39) gtctgtattgttaag ttaccacatcattat caaaag (SEQ ID NO: 48) Variant 2 S 1 CR88 tggccttggtatgtg Ecto backbone tgg SEQ ID NO 14 (SEQ ID NO: 35) agcactacatagtgc atac (SEQ ID NO: 36) 2 Variant tctttggtatgcact 2 S Ecto atgtagtgctgctct gtttgataataatca g (SEQ ID NO: 49) tggcaagccacacat accaaggccacttaa tataagttttaatta ttgaaagttcttc (SEQ ID NO: 41) Brazil S 1 CR88 tgattaaaagtccca SEQ ID NO 15 backbone catcttttctaatat tattaattcttcttt gg (SEQ ID NO: 23) ctcttaccagtaact taccacacttaatta aattaaagactaagt c (SEQ ID NO: 24) 2 Brazil S aagtgtggtaagtta ctggtaagagatgtt ggttcaacctctttt ac (SEQ ID NO: 50) agaaaagatgtggga cttttaatcattaaa cagactttttaggtc tg (SEQ ID NO: 26) Brazil 1 CR88 tggccttggtatgtg S Ecto backbone tgg SEQ ID NO 16 (SEQ ID NO: 35) agcactacatagtgc atac  (SEQ ID NO: 36) 2 Brazil tctttggtatgcact S Ecto atgtagtgcttcttt gtacaataatgatag ctatg (SEQ ID NO: 51) tggcaagccacacat accaaggccatttaa tataagtttttaaaa tagaaagtgtttc (SEQ ID NO: 52)

(46) Primers for characterization and identification of the different spike sequences in the recombinant IBV are adapted to the respective spike sequence if necessary.

Example 2

In Ovo Replication Kinetics

(47) Eight Eight day-old embryonated chicken eggs are inoculated with 10.sup.2 50% embryo infectious dose (EID.sub.50) of the recombinant IBV and appropriate controls. Eggs are incubated at 37.5° C., 60% humidity and candled daily after 0, 8, 24, 34, 48 and 72 hours of incubation and embryo mortality is recorded. Five preselected eggs per sample and time point are removed and transferred to 4° C. for at least 2 hours. Subsequently, the allantoic fluid is harvested and stored at −80° C. For analysis, samples are thawed and diluted 1:10 in 1×PBS without Ca and Mg and nucleic acids are extracted with the QIAamp DNA Blood Mini kit (Qiagen) with addition of carrier RNA using the Hamilton Starlet pipet robot. Extracted nucleic acids are analyzed by RT-qPCR for the relative amount of IBV RNA with a protocol adapted from Callison et al. (J Virol Methods. 2006; 138(1-2):60-5). Briefly, the same primers and probe are used and the thermoprofile is adapted for the use of TaqMan® Fast Virus 1-Step Master Mix (ThermoFisher) and the ABI™ 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific). All nucleic acid samples are analyzed in triplicates using a 10-fold dilution series of IBV H52 as reference.

(48) Replication of CR88 rIBV H52 S in comparison to the recombinant wild type viruses CR88 and H52 is analyzed by injecting 8 day old SPF eggs with 100 EID.sub.50 at time point 0. Slightly different replication kinetics are observed at early time points. However, after 32 hours all viruses reach comparable ct values. All embryos are alive at 32 hours post inoculation, while at time point 48 hours post infection all remaining embryos for the wild type controls are dead. In contrast, 60 to 80% of the embryos infected with CR88 rIBV H52 S were still alive at time points 48 and 72 hours post inoculation. The replication of CR88 rIBV H52 S is considered equally efficient compared to the wild type viruses as all viruses reach the a plateau after 32 hours (see FIG. 1).

Example 3

Preparation of Vaccine and Challenge Virus

(49) To demonstrate the efficacy of the CR88 rIBV with heterologous spike or spike ectodomain in chickens, an aliquot of the virus stock is thawed and 10-fold diluted in 1×PBS to determine the 50% embryo infectious dose (EID.sub.50) by inoculation of 100 μl into five 8-day old embryonated chicken eggs per dilution. Eggs are incubated at 37.5° C., 60% humidity until 7 days post inoculation. Eggs with dead embryos after 24 hours are excluded from the experiment. All other eggs with dead embryos at 7 days post inoculation are considered positive. All eggs with living embryos are candled from the bottom at 7 days post inoculation to identify dwarfs, which are considered positive. The EID.sub.50/ml is calculated with the formula of Reed and Muench (Am J Epidemiol, 1938; 27(3):493-497). For vaccination the virus stock is diluted in 1×PBS to obtain a titer of 10.sup.43 EID.sub.50/ml (10.sup.3 EID.sub.50 per chicken in 50 μl).

(50) The challenge viruses M41, QX, Q1, Ark, Variant 2 and Brazil are propagated in 10-day-old embryonated SPF eggs. 24 hours post inoculation the eggs are transferred to 4° C. for at least 2 hours. The allantoic fluid is harvested, aliquoted and stored at −80° C. The virus titer is determined as described above. The titer is set to 10.sup.43 to 10.sup.53 EID.sub.50/ml by dilution with 1×PBS (10.sup.3 to 10.sup.4 EID.sub.50 per chicken in 50 μl).

Example 4

Determination of Vaccine Efficacy

(51) Fertilized SPF eggs are incubated for 18 days in an egg setter at 99.7° F. and 50% humidity with 1 turn per hour. At day 18 of incubation the eggs are candled and fertile eggs are transferred to the hatcher and incubated at 99° F. and 70% humidity until hatch. Chicks without clinical signs or deformation are randomly distributed into respective treatment groups and transferred into separate isolators. At least two chicks serve as strict negative control (SNC) group, five chicks are enrolled in the challenge control (CC) group and at least 10 in groups which are vaccinated with the recombinant IBV with heterologous spike or spike ectodomain and and subsequently challenged. Animals are kept under housing conditions in compliance to local and national requirements for animal welfare recommendations. The light regime is adjusted to 16 hours light per day. Feed and water are provided ad libitum. After transfer to the isolator, chicks are vaccinated (1-day old) with 10.sup.3 EID.sub.50 per chicken via eye drop (total volume 50 μl, 25 μl per eye) while the SNC and CC groups remain untreated. At 21 days post vaccination chickens of the CC and vaccinated groups are challenged with 10.sup.3 to 10.sup.4 EID.sub.50 per chicken of the respective spike-homologous challenge strain (M41, QX, Q1, Ark, Variant 2 or Brazil) via eye drop (total volume 50 μl, 25 μl per eye). At 7 days post challenge all chickens are euthanized, choanal swabs are taken and kidneys are removed and stored in RNAlater Stabilization Solution (ThermoFisher) at 4° C. for IBV-specific RT-qPCR analysis. In addition, tracheas are removed and transferred into 50 ml tubes with warm cell culture medium. Afterwards, tracheas are cleaned from connective tissues and flushed with cell culture medium. The tracheas are cut into tracheal rings using the McIlwain tissue chopper set to 0.6-0.8 mm slice thickness. Per trachea three rings of the upper part, four rings of the middle part and three rings of the lower part are analyzed for ciliar beating by light microscopy and scored for ciliostasis (see table 4). A ring is recorded as normal if more than 50% of the internal ring shows vigorous ciliar movement (Score 2 and lower). A ring is recorded as positive for ciliostasis if less than 50% of the cilia are beating (Score 3 and 4).

(52) For IBV-specific RT-qPCR analysis kidney tissue pieces are warmed up to room temperature and transferred to separate 2 ml Precellys tubes, which are filled with medium and PBS, respectively. Kidneys are homogenized with the Precellys® tissue homogenizer (Bertin Instruments) for 1× 20 sec at 6800 rpm. Choanal swabs are eluted in 2 ml 1×PBS. Nucleic acids are isolated from 200 μl eluate and tissue homogenate respectively using the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) and the KingFisher™ Duo Prime Purification System (ThermoFisher). RT-qPCR is performed as described for the in ovo kinetics above, except for using a StepOnePlus™ Real-Time PCR System (ThermoFisher) for analysis in duplicates.

(53) TABLE-US-00004 TABLE 5 Scoring of ciliostasis in tracheal rings. Ciliar activity [%] Ciliostasis score 100 0 <100-75 1  <75-50 2  <50-25 3  <25-0 4

Example 5

Efficacy Of Recombinant IBV 4/91 Encoding a Heterologous Spike or Spike Ectodomain

(54) The objective of the studies is to demonstrate that vaccination with a recombinant IBV CR88 (4/91 genotype and serotype) encoding a heterologous spike or fragment thereof is able to confer protection against challenge with a spike-homologous challenge strain.

(55) It is analyzed if the recombinant IBV CR88 (4/91 genotype) encoding the spike ectodomain of IBV H52 (Mass genotype) is able to confer protection against challenge with a virulent M41 strain (Mass genotype), considered as homologous challenge for the encoded IBV H52 spike and as heterologous challenge considering the IBV CR88 backbone. All chickens are observed daily for clinical signs. No clinical signs are recorded after vaccination or challenge. Back titrations for the vaccination with CR88 rIBV H52 S and the H52 rIBV wild type at 1-day of age determine a titer of 10.sup.4.38 EID.sub.50/ml and 10.sup.45 EID.sub.50/ml, respectively (target 10.sup.43 EID.sub.50/ml) as well as 10.sup.4.32 EID.sub.50/ml (target 10.sup.43 EID.sub.50/ml) for the M41 challenge virus applied at 21 days post vaccination. Ciliostasis is scored as described above and results are depicted in and summarized in table 5.

(56) TABLE-US-00005 TABLE 5 Summary of ciliostasis scoring for protection at 28 days post vaccination and 7 days post challenge. The mean ciliostasis score per group is calculated by adding up the sum score of the individual chickens per group and dividing the group sum by the number of animals (highest possible score 40, lowest possible score 0). An animal is considered not affected if not fewer than 9 out of 10 rings show normal ciliar activity. Group Vaccine Challenge Mean Ciliostasis Score Not affected [%] 1 — — 3.0 100 2 — M41 40.0 0 3 H52 M41 8.9 93 4 CR88 rIBV H52 S M41 8.6 93
All animals of the strict negative control show normal ciliar movement while all animals of the challenge control group are positive for ciliostasis. In contrast, 93% of the animals vaccinated with CR88 rIBV H52 S or H52 rIBV wild type are protected. In addition, the viral load in the kidneys of animals vaccinated with CR88 rIBV H52 S is reduced compared to the animals of the challenge control (FIG. 3).

(57) Further, it is analyzed if the recombinant IBV CR88 encoding the spike of IBV QX is able to confer protection against challenge with a virulent D388 QX strain, considered as homologous challenge for the encoded IBV QX spike and as heterologous challenge considering the IBV CR88 backbone. All chickens are observed daily for clinical signs. No clinical signs are recorded after vaccination or challenge. Back titrations for the vaccination with CR88 rIBV QX S and the QX vaccine at 1-day of age determine titers that exceeded 10.sup.5 EID.sub.50/ml (target 10.sup.43 EID.sub.50/ml) as well as 10.sup.4.83 EID.sub.50/ml (target 10.sup.43 EID.sub.50/ml) for the D388 QX challenge virus applied at 21 days post vaccination, respectively. Ciliostasis is scored as described above and results are depicted in and summarized in Table 6 Summary of ciliostasis scoring for protection at 28 days post vaccination and 7 days post challenge. The mean ciliostasis score per group is calculated by adding up the sum score of the individual chickens per group and dividing the group sum by the number of animals (highest possible score 40, lowest possible score 0).

(58) TABLE-US-00006 TABLE 6 Summary of ciliostasis scoring for protection at 28 days post vaccination and 7 days post challenge. The mean ciliostasis score per group is calculated by adding up the sum score of the individual chickens per group and dividing the group sum by the number of animals (highest possible score 40, lowest possible score 0). An animal is considered not affected if not fewer than 9 out of 10 rings show normal ciliar activity. Group Vaccine Challenge Mean Ciliostasis Score Not affected [%] 1 — — 0 100 2 — D388 QX 38.4 0 3 QX vaccine D388 QX 3.5 100 3 CR88 rIBV QX S D388 QX 8.9 100
All animals of the strict negative control show normal ciliar movement while all animals of the challenge control group are positive for ciliostasis. In contrast, 100% of the animals vaccinated with CR88 rIBV QX S or the QX vaccine are protected.
Similar results are obtained with the other CR88 rIBV with heterologous spikes or spike ectodomains.
The results highlight the suitability of IBV H52 as a potent backbone for the generation of recombinant IBV with heterologous spike and show excellent results, in particular, when compared to prior art data for the IBV Beaudette backbone.