CARGO LOADED EXTRACELLULAR VESICLES
20210355492 · 2021-11-18
Assignee
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
A61K48/0025
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
C12N2310/3231
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
A61K31/7105
HUMAN NECESSITIES
C12N15/88
CHEMISTRY; METALLURGY
C12N2310/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The application relates to extracellular vesicles derived from red blood cells and particularly, although not exclusively, extracellular vesicles derived from red blood cells containing a cargo. The cargo may comprise small molecules, proteins, nucleic acids or components of the CRISPR/Cas9 gene editing system. The extracellular vesicles derived from red blood cells may be used in the treatment of medical disorders such as a genetic disorder, inflammatory disease, cancer, autoimmune disorder, cardiovascular disease or a gastrointestinal disease. Also provided is a method for loading the cargo into the extracellular vesicles derived from red blood cells by electroporation.
Claims
1. An extracellular vesicle derived from a red blood cell and containing an exogenous cargo.
2. The extracellular vesicle according to claim 1 wherein the cargo is a nucleic acid, peptide, protein or small molecule.
3. The extracellular vesicle according to claim 1 or claim 2 wherein the cargo is a nucleic acid selected from the group consisting of an antisense oligonucleotide, a messenger RNA, a long RNA, a siRNA, a miRNA, a gRNA or a plasmid.
4. The extracellular vesicle according to claim 3, wherein the nucleic acid comprises one or more modifications, non-naturally occurring elements or non-naturally occurring nucleic acids.
5. The extracellular vesicle according to claim 4, wherein the one or more modifications, non-naturally occurring elements or non-naturally occurring nucleic acids is selected from a 2′-O-methyl analog, a 3′ phosphorothioate internucleotide linkage or other locked nucleic acid (LNA), an ARCA cap, a chemically modified nucleic acids or nucleotides or a 3′ or 5′ modification such as capping.
6. The extracellular vesicle according to claim 5 wherein the non-naturally occurring nucleotide is selected from a 2′-position sugar modification, 2′-O-methylation, 2′-Fluoro modification, 2′NH2 modification, 5-position pyrimidine modification, 8-position purine modification, a modification at an exocyclic amine, substitution of 4-thiouridine, substitution of 5-bromo, or 5-iodo-uracil, or a backbone modification.
7. An extracellular vesicle according to claim 1 wherein the cargo comprises one or more components of a CRISPR×/Cas9 gene editing system.
8. An extracellular vesicle according to claim 7 wherein the cargo is a nuclease, or an mRNA or plasmid encoding a nuclease.
9. The extracellular vesicle according to claim 7 wherein the cargo comprises a gRNA.
10. An extracellular vesicle according to claim 1 comprising an antisense nucleic acid.
11. A composition comprising one or more extracellular vesicles according to any one of claims 1-10.
12. An extracellular vesicle or composition according to any one of the preceding claims, for use in a method of treatment.
13. A method of treatment, the method comprising administering an extracellular vesicle according to claim 1 to a patient in need of treatment.
14. Use of an extracellular vesicle or composition according to any one of claims 1-11 in the manufacture of a medicament for the treatment of a disease or disorder.
15. Use of an extracellular vesicle or composition according to any one of claims 1-11 in the manufacture of a medicament for the treatment of a disease or disorder.
16. The extracellular vesicle or composition for use, method of treatment or use according to any one of claims 10-12 wherein the method of treatment involves administration of an extracellular vesicle or composition according to any one of claims 1-9 to a subject with a genetic disorder, inflammatory disease, cancer, autoimmune disorder, cardiovascular disease or a gastrointestinal disease.
17. The extracellular vesicle or composition for use, method of treatment or use according to claim 13 wherein the subject has cancer, the cancer optionally selected from leukemia, lymphoma, myeloma, breast cancer, lung cancer, liver cancer, colorectal cancer, nasopharyngeal cancer, kidney cancer or glioma.
18. A method comprising: a. providing a sample of red blood cells, wherein said sample is free from leukocytes; b. contacting the sample of red blood cells with a vesicle inducing agent; c. separating extracellular vesicles from red blood cells; and d. collecting the extracellular vesicles. e. optionally electroporating the extracellular vesicles in the presence of an exogenous cargo.
19. A method comprising electroporating an extracellular vesicle derived from a red blood cell in the presence of an exogenous cargo.
20. A composition comprising extracellular vesicles obtained by the method according to claim 18 or claim 10.
Description
SUMMARY OF THE FIGURES
[0046] Embodiments and experiments illustrating the principles of the invention will now be discussed with reference to the accompanying figures in which:
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
DETAILED DESCRIPTION OF THE INVENTION
[0075] Aspects and embodiments of the present invention will now be discussed with reference to the accompanying figures. Further aspects and embodiments will be apparent to those skilled in the art. All documents mentioned in this text are incorporated herein by reference.
Extracellular Vesicles
[0076] The term “extracellular vesicle” as used herein refers to a small vesicle-like structure released from a cell into the extracellular environment.
[0077] Extracellular vesicles (EVs) are substantially spherical fragments of plasma membrane or endosomal membrane between 50 and 1000 nm in diameter. Extracellular vesicles are released from various cell types under both pathological and physiological conditions. Extracellular vesicles have a membrane. The membrane may be a double layer membrane (i.e. a lipid bilayer). The membrane may originate from the plasma membrane. Accordingly, the membrane of the extracellular vesicle may have a similar composition to the cell from which it is derived. In some aspects disclosed herein, the extracellular vesicles are substantially transparent.
[0078] The term extracellular vesicles encompasses exosomes, microvesicles, membrane microparticles, ectosomes, blebs and apoptotic bodies. Extracellular vesicles may be produced via outward budding and fission. The production may be a natural process, or a chemically induced or enhanced process. In some aspects disclosed herein, the extracellular vesicle is a microvesicle produced via chemical induction.
[0079] Extracellular vesicles may be classified as exosomes, microvesicles or apoptotic bodies, based on their size and origin of formation. Microvesicles are a particularly preferred class of extracellular vesicle according to the invention disclosed herein. Preferably, the extracellular vesicles of the invention have been shed from the plasma membrane, and do not originate from the endosomal system.
[0080] Extracellular vesicles disclosed herein may be derived from various cells, such as red blood cells, white blood cells, cancer cells, stem cells, dendritic cells, macrophages and the like. In a preferred example, the extracellular vesicles are derived from a red blood cell.
[0081] Microvesicles or microparticles arise through direct outward budding and fission of the plasma membrane. Microvesicles are typically larger than exosomes, having diameters ranging from 100-500 nm. In some cases, a composition of microvesicles comprises microvesicles with diameters ranging from 50-1000 nm, from 101-1000 nm, from 101-750 nm, from 101-500 nm, or from 100-300 nm, or from 101-300 nm. Preferably, the diameters are from 100-300 nm.
[0082] For example, the extracellular vesicle compositions disclosed herein may be substantially uniform in size. They may have a mean diameter of about 100 nm, about 110 nm, about 120 nm, about 130 nm, about 140 nm, about 150 nm, about 160 nm, about 170 nm, about 180 nm, about 190 nm or about 200 nm. In some cases, the mean diameter is about 140 nm and a polydispersity index (PDI) of between 0.05 and 0.09, between 0.06 and 0.08, or around 0.07.
[0083] Exosomes range from around 30 to around 100 nm. They are observed in a variety of cultured cells including lymphocytes, dendritic cells, cytotoxic T cells, mast cells, neurons, oligodendrocytes, Schwann cells, and intestinal epithelial cells. Exosomes originate from the endosomal network that locates in within mutivesicular bodies, large sacs in the cytoplasm. These sacs fuse to the plasma membrane, before being released into extracellular environment.
[0084] Apoptotic bodies or blebs are the largest extracellular vesicle, ranging from 1-5 μm. Nucleated cells undergoing apoptosis pass through several stages, beginning with condensation of the nuclear chromatin, membrane blebbing and finally release of EVs including apoptotic bodies.
[0085] Preferably, the extracellular vesicles are derived from human cells, or cells of human origin. The extracellular vesicles of the invention may have been induced from cells contacted with a vesicle inducing agent. The vesicle inducing agent may be calcium ionophore, lysophosphatidic acid (LPA), or phorbol-12-myristat-13-acetate (PMA).
Red Blood Cell Extracellular Vesicles (RBC-EVs)
[0086] In certain aspects disclosed herein, the extracellular vesicles are derived from red blood cells. Red blood cells are a good source of EVs for a number of reasons. Because red blood cells are enucleated, RBC-EVs contain less nucleic acid than EVs from other sources. RBC-EVs do not contain endogenous DNA. RBC-EVs may contain miRNA or other RNAs. RBC-EVs are free from oncogenic substances such as oncogenic DNA or DNA mutations.
[0087] RBC-EVs may comprise haemoglobin and/or stomatin and/or flotillin-2. They may be red in colour. Typically RBC-EVs exhibit a domed (concave) surface, or “cup shape” under transmission electron microscopes. The RBC-EV may be characterised by having cell surface CD235a. RBC-EVs according to the invention may be about 100 to about 300 nm in diameter. In some cases, a composition of RBC-EVs comprises RBC-EVs with diameters ranging from 50-1000 nm, from 50-750 nm, from 50-500 nm, from 50-300 nm, from 101-1000 nm, from 101-750 nm, from 101-500 nm, or from 100-300 nm, or from 101-300 nm. Preferably, the diameters are from 100-300 nm. A population of RBC-EVs will comprise RBC-EVs with a range of different diameters, the median diameter of RBC-EVs within a RBC-EV sample can range from 50-1000 nm, from 50-750 nm, from 50-500 nm, from 50-300 nm, from 101-1000 nm, from 101-750 nm, from 101-500 nm, or from 100-300 nm, or from 101-300 nm. Preferably, the median diameter is between 100-300 nm.
[0088] Preferably, the RBC-EVs are derived from a human or animal blood sample or red blood cells derived from primary cells or immobilized red blood cell lines. The blood cells may be type matched to the patient to be treated, and thus the blood cells may be Group A, Group B, Group AB, Group O or Blood Group Oh. Preferably the blood is Group O. The blood may be rhesus positive or rhesus negative. In some cases, the blood is Group O and/or rhesus negative, such as Type O−. The blood may have been determined to be free from disease or disorder, such as free from HIV, sickle cell anaemia, malaria. However, any blood type may be used. In some cases, the RBC-EVs are autologous and derived from a blood sample obtained from the patient to be treated. In some cases, the RBC-EVs are allogenic and not derived from a blood sample obtained from the patient to be treated.
[0089] RBC-EVs may be isolated from a sample of red blood cells. Protocols for obtaining EVs from red blood cells are known in the art, for example in Danesh et al. (2014) Blood. 2014 Jan 30; 123(5): 687-696. Methods useful for obtaining EVs may include the step of providing or obtaining a sample comprising red blood cells, inducing the red blood cells to produce extracellular vesicles, and isolating the extracellular vesicles. The sample may be a whole blood sample. Preferably, cells other than red blood cells have been removed from the sample, such that the cellular component of the sample is red blood cells. Preferably, the red blood cell sample is completely or substantially leukocyte free.
[0090] The red blood cells in the sample may be concentrated, or partitioned from other components of a whole blood sample, such as white blood cells. Red blood cells may be concentrated by centrifugation. The sample may be subjected to leukocyte reduction.
[0091] The sample comprising red blood cells may comprise substantially only red blood cells. Extracellular vesicles may be induced from the red blood cells by contacting the red blood cells with a vesicle inducing agent. The vesicle inducing agent may be calcium ionophore, lysophosphatidic acid (LPA), or phorbol-12-myristat-13-acetate (PMA).
[0092] RBC-EVs may be isolated by centrifugation (with or without ultracentrifugation), precipitation, filtration processes such as tangential flow filtration, or size exclusion chromatography. In this way, RBC-EVs may be separated from RBCs and other components of the mixture.
[0093] Extracellular vesicles may be obtained from red blood cells by a method comprising: obtaining a sample of red blood cells; contacting the red blood cells with a vesicle inducing agent; and isolating the induced extracellular vesicles.
[0094] The red blood cells may be separated from a whole blood sample containing white blood cells and plasma by low speed centrifugation and using leukodepletion filters. In some cases, the red blood cell sample contains no other cell types, such as white blood cells. In other words, the red blood cell sample consists substantially of red blood cells. The red blood cell sample may additionally comprise plasma, serum, buffer or another carrier. The red blood cells may be diluted in buffer such as PBS prior to contacting with the vesicle inducing agent. The vesicle inducing agent may be calcium ionophore, lysophosphatidic acid (LPA) or phorbol-12-myristat-13-acetate (PMA). The vesicle inducing agent may be about 10 nM calcium ionophore. The red blood cells may be contacted with the vesicle inducing agent overnight, or for at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12 or more than 12 hours. The mixture may be subjected to low speed centrifugation to remove RBCs, cell debris, or other non-RBC-EVs matter and/or passing the supernatant through an about 0.45 um syringe filter. RBC-EVs may be concentrated by ultracentrifugation, such as centrifugation at around 100,000×g. The RBC-EVs may be concentrated by ultracentrifugation for at least 10 minutes, at least 20 minutes, at least 30 minutes, at least 40 minutes, at least 50 minutes or at least one hour. The concentrated RBC-EVs may be suspended in cold PBS. They may be layered on a 60% sucrose cushion. The sucrose cushion may comprise frozen 60% sucrose. The RBC-EVs layered on the sucrose cushion may be subject to ultracentrugation at 100,000×g for at least one hour, at least 2 hours, at least 3 hours, at least 4 hours, at least 5 hours, at least 6 hours, at least 7 hours, at least 8 hours, at least 9 hours, at least 10 hours, at least 11 hours, at least 12 hours, at least 13 hours, at least 14 hours, at least 15 hours, at least 16 hours, at least 17 hours, at least 18 hours or more. Preferably, the RBC-EVs layered on the sucrose cushion may be subject to ultracentrugation at 100,000×g for about 16 hours. The red layer above the sucrose cushion is then collected, thereby obtaining RBC-EVs. The obtained RBC-EVs may be subject to further processing, such as washing, and optionally loading.
Purification of Extracellular Vesicles From Red Blood Cells
[0095] In certain aspects disclosed herein, the extracellular vesicles are derived from red blood cells. Red blood cells are a good source of EVs for a number of reasons. Because red blood cells are enucleated, RBC-EVs contain less nucleic acid than EVs from other sources. RBC-EVs do not contain endogenous DNA.
[0096] RBC-EVs may contain miRNA or other RNAs. RBC-EVs are free from oncogenic substances such as oncogenic DNA or DNA mutations.
[0097] RBC-EVs may comprise haemoglobin and/or stomatin and/or flotillin-2. They may be red in colour. Typically RBC-EVs exhibit a domed (concave) surface, or “cup shape” under transmission electron microscopes. The RBC-EV may be characterised by having cell surface CD235a. RBC-EVs according to the invention may be about 100 to about 300 nm in diameter. In some cases, a composition of RBC-EVs comprises RBC-EVs with diameters ranging from 50-1000 nm, from 50-750 nm, from 50-500 nm, from 50-300 nm, from 101-1000 nm, from 101-750 nm, from 101-500 nm, or from 100-300 nm, or from 101-300 nm. Preferably, the diameters are from 100-300 nm. A population of RBC-EVs will comprise RBC-EVs with a range of different diameters, the median diameter of RBC-EVs within a RBC-EV sample can range from 50-1000 nm, from 50-750 nm, from 50-500 nm, from 50-300 nm, from 101-1000 nm, from 101-750 nm, from 101-500 nm, or from 100-300 nm, or from 101-300 nm. Preferably, the median diameter is between 100-300 nm.
[0098] Preferably, the RBC-EVs are derived from a human or animal blood sample or red blood cells derived from primary cells or immobilized red blood cell lines. The blood cells may be type matched to the patient to be treated, and thus the blood cells may be Group A, Group B, Group AB, Group O or Blood Group Oh. Preferably the blood is Group O. The blood may be rhesus positive or rhesus negative. In some cases, the blood is Group O and/or rhesus negative, such as Type O−. The blood may have been determined to be free from disease or disorder, such as free from HIV, sickle cell anaemia, malaria. However, any blood type may be used. In some cases, the RBC-EVs are autologous and derived from a blood sample obtained from the patient to be treated. In some cases, the RBC-EVs are allogenic and not derived from a blood sample obtained from the patient to be treated.
[0099] RBC-EVs may be isolated from a sample of red blood cells. Protocols for obtaining EVs from red blood cells are known in the art, for example in Danesh et al. (2014) Blood. 2014 Jan 30; 123(5): 687-696. Methods useful for obtaining EVs may include the step of providing or obtaining a sample comprising red blood cells, inducing the red blood cells to produce extracellular vesicles, and isolating the extracellular vesicles. The sample may be a whole blood sample. Preferably, cells other than red blood cells have been removed from the sample, such that the cellular component of the sample is red blood cells.
[0100] The red blood cells in the sample may be concentrated, or partitioned from other components of a whole blood sample, such as white blood cells. Red blood cells may be concentrated by centrifugation. The sample may be subjected to leukocyte reduction.
[0101] The sample comprising red blood cells may comprise substantially only red blood cells. Extracellular vesicles may be induced from the red blood cells by contacting the red blood cells with a vesicle inducing agent. The vesicle inducing agent may be calcium ionophore, lysophosphatidic acid (LPA), or phorbol-12-myristat-13-acetate (PMA).
[0102] RBC-EVs may be isolated by centrifugation (with or without ultracentrifugation), precipitation, filtration processes such as tangential flow filtration, or size exclusion chromatography. In this way, RBC-EVs may be separated from RBCs and other components of the mixture.
[0103] Extracellular vesicles may be obtained from red blood cells by a method comprising: obtaining a sample of red blood cells; contacting the red blood cells with a vesicle inducing agent; and isolating the induced extracellular vesicles.
[0104] The red blood cells may be separated from a whole blood sample containing white blood cells and plasma by low speed centrifugation and using leukodepletion filters. In some cases, the red blood cell sample contains no other cell types, such as white blood cells. In other words, the red blood cell sample consists substantially of red blood cells. The red blood cells may be diluted in buffer such as PBS prior to contacting with the vesicle inducing agent. The vesicle inducing agent may be calcium ionophore, lysophosphatidic acid (LPA) or phorbol-12-myristat-13-acetate (PMA). The vesicle inducing agent may be about 10 nM calcium ionophore. The red blood cells may be contacted with the vesicle inducing agent overnight, or for at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12 or more than 12 hours. The mixture may be subjected to low speed centrifugation to remove RBCs, cell debris, or other non-RBC-EVs matter and/or passing the supernatant through an about 0.45 um syringe filter. RBC-EVs may be concentrated by ultracentrifugation, such as centrifugation at around 100,000×g. The RBC-EVs may be concentrated by ultracentrifugation for at least 10 minutes, at least 20 minutes, at least 30 minutes, at least 40 minutes, at least 50 minutes or at least one hour. The concentrated RBC-EVs may be suspended in cold PBS. They may be layered on a 60% sucrose cushion. The sucrose cushion may comprise frozen 60% sucrose. The RBC-EVs layered on the sucrose cushion may be subject to ultracentrugation at 100,000×g for at least one hour, at least 2 hours, at least 3 hours, at least 4 hours, at least 5 hours, at least 6 hours, at least 7 hours, at least 8 hours, at least 9 hours, at least 10 hours, at least 11 hours, at least 12 hours, at least 13 hours, at least 14 hours, at least 15 hours, at least 16 hours, at least 17 hours, at least 18 hours or more. Preferably, the RBC-EVs layered on the sucrose cushion may be subject to ultracentrugation at 100,000×g for about 16 hours. The red layer above the sucrose cushion is then collected, thereby obtaining RBC-EVs. The obtained RBC-EVs may be subject to further processing, such as washing, tagging, and optionally loading.
Carqo
[0105] Extracellular vesicles disclosed herein may be loaded with, or contain, a cargo. The cargo, also referred to as the load, may be a nucleic acid, peptide, protein, small molecule, sugar or lipid. The cargo may be a non-naturally occurring or synthetic molecule. The cargo may be a therapeutic molecule, such as a therapeutic oligonucleotide, peptide, small molecule, sugar or lipid. In some cases, the cargo is not a therapeutic molecule, for example a detectable moiety or visualization agent. The cargo may exert a therapeutic effect in the target cell after being delivered to that target cell. For example, the cargo may be a nucleic acid which is expressed in the target cell. It may act to inhibit or enhance the expression of a particular gene or protein of interest. For example, the protein or nucleic acid may be used to edit a target gene for gene silencing or modification.
[0106] Preferably, the cargo is an exogenous molecule, sometimes referred to as a “non-endogenous substance”. In other words, the cargo is a molecule that does not naturally occur in the extracellular vesicle, or the cell from which it is derived. Such a cargo is preferably loaded into the extracellular vesicles after the vesicles have formed, rather than loaded or produced by the cell, such that it is also contained within the extracellular vesicles.
[0107] In some cases, the cargo may be a nucleic acid. The cargo may be RNA or DNA. The nucleic acid may be single stranded or double stranded. The cargo may be an RNA. The RNA may be a therapeutic RNA. The RNA may be a small interfering RNA (siRNA), a messenger RNA (mRNA), a guide RNA (gRNA), a circular RNA, a microRNA (miRNA), a piwiRNA (piRNA), a transfer RNA (tRNA), or a long noncoding RNA (IncRNA) produced by chemical synthesis or in vitro transcription. In some cases, the cargo is an antisense oligonucleotide, for example, having a sequence that is complementary to an endogenous nucleic acid sequence such as a transcription factor, miRNA or other endogenous mRNA.
[0108] The cargo may be encode a molecule of interest. For example, the cargo may be an mRNA that encodes Cas9 or another nuclease.
[0109] In the cell, the antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule. The antisense nucleic acids interfere with the translation of the mRNA, since the cell will not translate an mRNA that is double-stranded. The use of antisense methods to inhibit the in vitro translation of genes is well known in the art (see e.g. Marcus-Sakura, Anal. Biochem. 1988, 172:289). Further, antisense molecules which bind directly to the DNA may be used. Antisense nucleic acids may be single or double stranded nucleic acids. Non-limiting examples of antisense nucleic acids include siRNAs (including their derivatives or pre-cursors, such as nucleotide analogs), short hairpin RNAs (shRNA), micro RNAs (miRNA), saRNAs (small activating RNAs) and small nucleolar RNAs (snoRNA) or certain of their derivatives or pre-cursors. Antisense nucleic acid molecules may stimulate RNA interference (RNAi).
[0110] Thus, an antisense nucleic acid cargo may interfere with transcription of target genes, interfere with translation of target mRNA and/or promote degradation of target mRNA. In some cases, an antisense nucleic acid is capable of inducing a reduction in expression of the target gene.
[0111] A “siRNA,” “small interfering RNA,” “small RNA,” or “RNAi” as provided herein, refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to reduce or inhibit expression of a gene or target gene when expressed in the same cell as the gene or target gene. The complementary portions of the nucleic acid that hybridize to form the double stranded molecule typically have substantial or complete identity. In one embodiment, a siRNA or RNAi is a nucleic acid that has substantial or complete identity to a target gene and forms a double stranded siRNA. In embodiments, the siRNA inhibits gene expression by interacting with a complementary cellular mRNA thereby interfering with the expression of the complementary mRNA. Typically, the nucleic acid is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the double stranded siRNA is 15-50 nucleotides in length, and the double stranded siRNA is about 15-50 base pairs in length). In some embodiments, the length is 20-30 base nucleotides, preferably about 20-25 or about 24-29 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
[0112] RNAi and siRNA are described in, for example, Dana et al., Int J Biomed Sci. 2017; 13(2): 48-57, herein incorporated by reference in its entirety. An antisense nucleic acid molecule may contain double-stranded RNA (dsRNA) or partially double-stranded RNA that is complementary to a target nucleic acid sequence, for example FHR-4. A double-stranded RNA molecule is formed by the complementary pairing between a first RNA portion and a second RNA portion within the molecule. The length of an RNA sequence (i.e. one portion) is generally less than 30 nucleotides in length (e.g. 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 or fewer nucleotides). In some embodiments, the length of an RNA sequence is 18 to 24 nucleotides in length. In some siRNA molecules, the complementary first and second portions of the RNA molecule form the “stem” of a hairpin structure. The two portions can be joined by a linking sequence, which may form the “loop” in the hairpin structure. The linking sequence may vary in length and may be, for example, 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides in length. Suitable linking sequences are known in the art.
[0113] Suitable siRNA molecules for use in the methods of the present invention may be designed by schemes known in the art, see for example Elbashire et al., Nature, 2001 411:494-8; Amarzguioui et al., Biochem. Biophys. Res. Commun. 2004 316(4):1050-8; and Reynolds et al., Nat. Biotech. 2004, 22(3):326-30. Details for making siRNA molecules can be found in the websites of several commercial vendors such as Ambion, Dharmacon, GenScript, Invitrogen and OligoEngine. The sequence of any potential siRNA candidate generally can be checked for any possible matches to other nucleic acid sequences or polymorphisms of nucleic acid sequence using the BLAST alignment program (see the National Library of Medicine internet website). Typically, a number of siRNAs are generated and screened to obtain an effective drug candidate, see, U.S. Pat. No. 7,078,196. siRNAs can be expressed from a vector and/or produced chemically or synthetically. Synthetic RNAi can be obtained from commercial sources, for example, Invitrogen (Carlsbad, Calif.). RNAi vectors can also be obtained from commercial sources, for example, Invitrogen.
[0114] The nucleic acid molecule may be a miRNA. The term “miRNA” is used in accordance with its plain ordinary meaning and refers to a small non-coding RNA molecule capable of post-transcriptionally regulating gene expression. In one embodiment, a miRNA is a nucleic acid that has substantial or complete identity to a target gene. In some embodiments, the miRNA inhibits gene expression by interacting with a complementary cellular mRNA thereby interfering with the expression of the complementary mRNA. Typically, the miRNA is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the miRNA is 15-50 nucleotides in length, and the miRNA is about 15-50 base pairs in length)In some cases, the nucleic acid is synthetic or recombinant.
[0115] The nucleic acid disclosed herein may comprise one or more modifications, or non-naturally occurring elements or nucleic acids. In preferred aspects, the nucleic acid comprises a 2′-O-methyl analog. In some cases, the nucleic acid includes a 3′ phosphorothioate internucleotide linkage or other locked nucleic acid (LNA). In some cases, the nucleic acid comprises an ARCA cap. Other chemically modified nucleic acids or nucleotides may be used, for example, 2′-position sugar modifications, 2′-O-methylation, 2′-Fluoro modifications, 2′NH.sub.2 modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo, or 5-iodo-uracil, backbone modifications, methylations, unusual base-pairing combinations such as isocytidine and isoguanidine and the like. Modifications can also include 3′ and 5′ modifications such as capping. For example, the nucleic acid may be PEGylated.
[0116] Nucleic acids useful in the methods of the invention include antisense oligonucleotides, mRNA, siRNAs or gRNAs that target oncogenic miRNAs (also known as oncomiRs) or transcription factors. The cargo may be a ribozyme or aptamer. In some cases, the nucleic acid is a plasmid.
[0117] The nucleic acid molecule may be an aptamer. The term “aptamer” as used herein refers to oligonucleotides (e.g. short oligonucleotides or deoxyribonucleotides), that bind (e.g. with high affinity and specificity) to proteins, peptides, and small molecules. Aptamers typically have defined secondary or tertiary structure owing to their propensity to form complementary base pairs and, thus, are often able to fold into diverse and intricate molecular structures. The three-dimensional structures are essential for aptamer binding affinity and specificity, and specific three-dimensional interactions drives the formation of aptamer-target complexes. Aptamers can be selected in vitro from very large libraries of randomized sequences by the process of systemic evolution of ligands by exponential enrichment (SELEX as described in Ellington AD, Szostak JW, Nature 1990, 346:818-822; Tuerk C, Gold L. Science 1990, 249:505-510) or by developing SOMAmers (slow off-rate modified aptamers) (Gold L et al. (2010) Aptamer-based multiplexed proteomic technology for biomarker discovery. PLoS ONE 5(12):e15004).
[0118] In certain aspects described herein, the cargo is an antisense oligonucleotide (ASO). The antisense oligonucleotide may be complementary to a miRNA or mRNA. The antisense oligonucleotide comprises at least a portion which is complementary in sequence to a target mRNA sequence. The antisense oligonucleotide may bind to, and thereby inhibit, the target sequence. For example, the antisense oligonucleotide may inhibit the translation process of the target sequence. The miRNA may be a miRNA associated with cancer (Oncomir). The miRNA may be miR-125b. The ASO may comprise or consist of the sequence 5′-UCACAAGUUAGGGUCUCAGGGA-3′.
[0119] In some aspects, the cargo is one or more components of a gene editing system. For example, a CRISPR/Cas9 gene editing system. For example, the cargo may include a nucleic acid which recognises a particular target sequence. The cargo may be a gRNA. Such gRNAs may be useful in CRISPR/Cas9 gene editing. The cargo may be a Cas9 mRNA or a plasmid encoding Cas9. Other gene editing molecules may be used as cargo, such as zinc finger nucleases (ZFNs) or Transcription activator-like effector nucleases (TALENs). The cargo may comprise a sequence engineered to target a particular nucleic acid sequence in a target cell. The gene editing molecule may specifically target a miRNA. For example, the gene editing molecule may be a gRNA that targets miR-125b. the gRNA may comprise or consist of the sequence 5′-CCUCACAAGUUAGGGUCUCA-3′.
[0120] In some embodiments the methods employ target gene editing using site-specific nucleases (SSNs). Gene editing using SSNs is reviewed e.g. in Eid and Mahfouz, Exp Mol Med. 2016 Oct; 48(10): e265, which is hereby incorporated by reference in its entirety. Enzymes capable of creating site-specific double strand breaks (DSBs) can be engineered to introduce DSBs to target nucleic acid sequence(s) of interest. DSBs may be repaired by either error-prone non-homologous end-joining (NHEJ), in which the two ends of the break are rejoined, often with insertion or deletion of nucleotides. Alternatively DSBs may be repaired by highly homology-directed repair (HDR), in which a DNA template with ends homologous to the break site is supplied and introduced at the site of the DSB.
[0121] SSNs capable of being engineered to generate target nucleic acid sequence-specific DSBs include ZFNs, TALENs and clustered regularly interspaced palindromic repeats/CRISPR-associated-9 (CRISPR/Cas9) systems.
[0122] ZFN systems are reviewed e.g. in Umov et al., Nat Rev Genet. (2010) 11(9):636-46, which is hereby incorporated by reference in its entirety. ZFNs comprise a programmable Zinc Finger DNA-binding domain and a DNA-cleaving domain (e.g. a Fokl endonuclease domain). The DNA-binding domain may be identified by screening a Zince Finger array capable of binding to the target nucleic acid sequence.
[0123] TALEN systems are reviewed e.g. in Mahfouz et al., Plant Biotechnol J. (2014) 12(8):1006-14, which is hereby incorporated by reference in its entirety. TALENs comprise a programmable DNA-binding TALE domain and a DNA-cleaving domain (e.g. a Fokl endonuclease domain). TALEs comprise repeat domains consisting of repeats of 33-39 amino acids, which are identical except for two residues at positions 12 and 13 of each repeat which are repeat variable di-residues (RVDs). Each RVD determines binding of the repeat to a nucleotide in the target DNA sequence according to the following relationship: “HD” binds to C, “NI” binds to A, “NG” binds to T and “NN” or “NK” binds to G (Moscou and Bogdanove, Science (2009) 326(5959):1501.).
[0124] CRISPR is an abbreviation of Clustered Regularly Interspaced Short Palindromic Repeats. The term was first used at a time when the origin and function of these sequences were not known and they were assumed to be prokaryotic in origin. CRISPR are segments of DNA containing short, repetitive base sequences in a palindromic repeat (the sequence of nucleotides is the same in both directions). Each repetition is followed by short segments of spacer DNA from previous integration of foreign DNA from a virus or plasmid. Small clusters of CAS (CRISPR-associated) genes are located next to CRISPR sequences. RNA harboring the spacer sequence helps Cas (CRISPR-associated) proteins recognize and cut foreign pathogenic DNA. Other RNA-guided Cas proteins cut foreign RNA. A simple version of the CRISPR/Cas system, CRISPRiCas9, has been modified to edit genomes. By delivering the Cas9 nuclease and a synthetic guide RNA (gRNA) into a cell, the cell×'s genome can be cut at a desired location, allowing existing genes to be removed and/or new ones added. CRISPR-Cas systems fall into two classes. Class I systems use a complex of multiple Cas proteins to degrade foreign nucleic acids. Class 2 systems use a single large Cas protein for the same purpose. Class 1 is divided into types I, III, and IV; class 2 is divided into types H, V, and V×i CRISPR genome editing uses a type II CRISPR system.
[0125] In some aspects, the EV is loaded with a CRISPR related cargo. In other words, the EV is useful in a method involving gene editing, such as therapeutic gene editing. In some cases, the EV is useful for in vitro gene editing.
[0126] The cargo may be a guide RNA. The guide RNA may comprise a CRIPSR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA). The crRNA contains a guide RNA that locates the correct section of host DNA along with a region that binds to tracrRNA forming an active complex. The tracrRNA binds to crRNA and forms the active complex. The gRNA combines both the tracrRNA and a crRNA, thereby encoding an active complex. The gRNA may comprise multiple crRNAs and tracrRNAs. The gRNA may be designed to bind to a sequence or gene of interest. The gRNA may target a gene for cleavage. Optionally, an optional section of DNA repair template is included. The repair template may be utilized in either non-homologous end joining (NHEJ) or homology directed repair (HDR).
[0127] The cargo may be a nuclease, such as a Cas9 nuclease. The nuclease is a protein whose active form is able to modify DNA. Nuclease variants are capable of single strand nicking, double strand break, DNA binding or other different functions. The nuclease recognises a DNA site, allowing for site specific DNA editing.
[0128] The gRNA and nuclease may be encoded on a plasmid. In other words, the EV cargo may comprise a plasmid that encodes both the gRNA and the nuclease. In some cases, an EV contains the gRNA and another EV contains or encodes the nuclease. In some cases, an EV contains a plasmid encoding the gRNA, and a plasmid encoding the nuclease. Thus, in some aspects, a composition is provided comprising EVs, wherein a portion of the EVs comprise or encode the nuclease such as Cas9, and a portion of the EVs comprise or encode the gRNA. In some cases, a composition containing EVs that comprise or encode the gRNA and a composition containing EVs that encode or contain the nuclease are co-administered. In some cases, the composition comprises EVS wherein the EVs contain an oligonucleotide that encodes both a gRNA and a nuclease.
[0129] CRISPR/Cas9 and related systems e.g. CRISPR×/Cpf1, CRISPR×/C2c1, CRISPR×/C2c2 and CRISPR×/C2c3 are reviewed e.g. in Nakade et al., Bioengineered (2017) 8(3):265-273, which is hereby incorporated by reference in its entirety. These systems comprise an endonuclease (e.g. Cas9, Cpf1 etc.) and the single-guide RNA (sgRNA) molecule. The sgRNA can be engineered to target endonuclease activity to nucleic acid sequences of interest.
[0130] In some cases, the nucleic acid encodes or targets one or more dedifferentiation factors, such as one or more nucleic acids encoding the “Yamanaka factors”, Oct4, Sox2, Klf4 and Myc.
[0131] In some cases, the cargo is a peptide or protein. It may be a recombinant peptide or protein. Suitable peptides or proteins include enzymes, such as gene editing enzymes such as Cas9, a ZFN, or a TALEN.
[0132] Suitable small molecules include cytotoxic reagents and kinase inhibitors. The small molecule may comprise a fluorescent probe and/or a metal. For example, the cargo may comprise a superparamagnetic particle such as an iron oxide particle. The cargo may be an ultra-small superparamagnetic iron oxide particle such as an iron oxide nanoparticle.
[0133] In some cases, the cargo is a detectable moiety such as a fluorescent dextran. The cargo may be radioactively labelled.
[0134] Cargo may be loaded into the extracellular vesicles by electroporation. Electroporation, or electropermeabilization, is a microbiology technique in which an electrical field is applied to cells in order to increase the permeability of the cell membrane, allowing chemicals, drugs, or DNA to be introduced into the cell. In other words, the extracellular vesicles may be induced or force to encapsulate the cargo by electroporation. As such, methods disclosed herein may involve a step of electroporating an extracellular vesicle in the presence of a cargo molecule, or electroporating a mixture of extracellular vesicles and cargo molecules.
[0135] In other methods disclosed herein, cargo is loaded into the extracellular vesicles by sonication, ultrasound, lipofection or hypotonic dialysis.
Loading Methodology
[0136] Methods suitable for loading cargo into the extracellular vesicles may require a temporary or semi-permanent increase in the permeability of the membrane of the extracellular vesicle. Suitable methods include electroporation, sonication, ultrasound, lipofection or hypotonic dialysis. In preferred methods disclosed herein, RBC-EVs are contacted with a cargo to form a mixture, and the mixture is treated to increase the permeability of the membrane of the extracellular vesicles. The mixture may be chilled prior to treatment. It may further involve one or more buffers, such as PBS.
[0137] In a preferred method, cargo is loaded into the extracellular vesicles by electroporation. Electroporation, or electropermeabilization, is a microbiology technique in which an electrical field is applied to cells in order to increase the permeability of the cell membrane, allowing chemicals, drugs, or DNA to be introduced into the cell. In other words, the extracellular vesicles may be induced or forced to encapsulate the cargo by electroporation. Electroporation works by passing thousands of volts across a distance of one to two millimeters of suspended cells in an electroporation cuvette (1.0-1.5 kV, 250-750V/cm). Generally, electroporation is a multi-step process, with several distinct phase. First, a short electrical pulse is applied. Typical parameters would be 300-400 mV for <1 ms across the membrane. Upon application of this potential the membrane charges like a capacitor through the migration of ions from the surrounding solution. Once the critical field is achieved there is a rapid localized rearrangement in lipid morphology, The resulting structure is believed to be a “pre-pore” since it is not electrically conductive but leads rapidly to the creation of a conductive pore. Evidence for the existence of such pre-pores comes mostly from the “flickering” of pores, which suggests a transition between conductive and insulating states. It has been suggested that these pre-pores are small (˜3 A) hydrophobic defects. If this theory is correct, then the transition to a conductive state could be explained by a rearrangement at the pore edge, in which the lipid heads fold over to create a hydrophilic interface. Finally, these conductive pores can either heal, resealing the bilayer or expand, eventually rupturing it. The resultant fate depends on whether the critical defect size was exceeded which in turn depends on the applied field, local mechanical stress and bilayer edge energy. The success of in vivo electroporation depends greatly on voltage, repetition, pulses, and duration. Methods disclosed herein may involve subjecting red blood cell derived extracellular vesicles to electroporation at between about 25 and 300 V, or between about 50 and 250V.
[0138] Alternatively, cargo may be loaded into the extracellular vesicles by sonication. Sonication is the act of applying sound energy to agitate particles in a sample, for various purposes such as the extraction of multiple compounds from plants, microalgae and seaweeds. Ultrasonic frequencies (>20 kHz) are usually used, leading to the process also being known as ultrasonication or ultra-sonication. Sonication may be applied using an ultrasonic bath or an ultrasonic probe, colloquially known as a sonicator.
[0139] In another method, cargo is loaded with ultrasound. Ultrasound has been shown to disrupt cell membranes, and thereby load cells with molecules. Sound waves with frequencies from 20 kHz up to several gigahertz may be applied to the RBC-EVs.
[0140] In yet another method, cargo may be loaded into RBC-EVs by lipofection. Lipofection (or liposome transfection) is a technique used to inject genetic material into a cell by means of liposomes, which are vesicles that can easily merge with the cell membrane since they are both made of a phospholipid bilayer.
Compositions
[0141] Disclosed herein are compositions comprising extracellular vesicles.
[0142] The compositions may comprise between 10.sup.6 to 10.sup.14 particles per ml. The compositions may comprise at least 10.sup.5 particles per ml, at least 10.sup.6 particles per ml, at least at least 10.sup.×7 particles per ml, at least 10.sup.8 particles per ml, at least 10.sup.9 particles per ml, at least 10.sup.10 particles per ml, at least 10.sup.11 particles per ml, at least 10.sup.12 particles per ml, at least 10.sup.13 particles per ml or at least 10.sup.14 particles per ml.
[0143] The composition may comprise extracellular vesicles have substantially homologous dimensions. For example, the extracellular vesicles may have diameters ranging from 100-500 nm. In some cases, a composition of microvesicles comprises microvesicles with diameters ranging from 50-1000 nm, from 101-1000 nm, from 101-750 nm, from 101-500 nm, or from 100-300 nm, or from 101-300 nm. Preferably, the diameters are from 100-300 nm. In some compositions, the mean diameter of the microvesicles is 100-300 nm, preferably 150-250 nm, preferably about 200 nm.
[0144] In some compositions, the extracellular vesicles contain a cargo. Although it is desirable in such compositions for the cargo to be encapsulated into substantially all of the extracellular vesicles in a composition, compositions disclosed herein may comprise extracellular vesicles in which at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 97% of the extracellular vesicles contain the cargo. Preferably, at least 85%, at least 90%, at least 95%, or at least 97% of the extracellular vesicles contain the cargo. In some cases, different extracellular vesicles within the composition contain different cargo. In some cases, the extracellular vesicles contain the same, or substantially the same, cargo molecule.
[0145] The composition may be a pharmaceutical composition. The composition may comprise one or more extracellular vesicle, and optionally a pharmaceutically acceptable carrier. Pharmaceutical compositions may be formulated for administration by a particular route of administration. For example, the pharmaceutical composition may be formulated for intravenous, intratumoral, intraperitoneal, intradermal, subcutaneous, intranasal or other administration route.
[0146] Compositions may comprise a buffer solution. Compositions may comprise a preservative compound. Compositions may comprise a pharmaceutically acceptable carrier.
Methods of Treatment and Uses of Extracellular Vesicles
[0147] Extracellular vesicles disclosed herein are useful in methods of treatment. In particular, the methods are useful for treating a subject suffering from a disorder associated with a target gene, the method comprising the step of administering an effective amount of a modified extracellular vesicle to said subject, wherein the modified extracellular vesicle comprises a binding molecule on its surface and encapsulates a non-endogenous substance for interacting with the target gene in a target cell. The non-endogenous substance may be a nucleic acid for said treatment.
[0148] The extracellular vesicles disclosed herein are particularly useful for the treatment of a genetic disorder, inflammatory disease, cancer, autoimmune disorder, cardiovascular disease or a gastrointestinal disease.
[0149] In some cases, the disorder is a genetic disorder selected from thalassemia, sickle cell anemia, or genetic metabolic disorder. In some cases, the extracellular vesicles are useful for treating a disorder of the liver, bone marrow, lung, spleen, brain, pancreas, stomach or intestine.
[0150] In certain aspects, the extracellular vesicles are useful for the treatment of cancer. Extracellular vesicles disclosed herein may be useful for inhibiting the growth or proliferation of cancerous cells. The cancer may be a liquid or blood cancer, such as leukemia, lymphoma or myeloma. In other cases, the cancer is a solid cancer, such as breast cancer, lung cancer, liver cancer, colorectal cancer, nasopharyngeal cancer, kidney cancer or glioma. In some cases, the cancer is located in the liver, bone marrow, lung, spleen, brain, pancreas, stomach or intestine.
[0151] The target cell depends on the disorder to be treated. For example, the target cell may be a breast cancer cell, a colorectal cancer cell, a lung cancer cell, a kidney cancer cell or the like. The cargo may be a nucleic acid for inhibiting or enhancing the expression of the target gene, or performing gene editing to silence the particular gene.
[0152] Extracellular vesicles and compositions described herein may be administered, or formulated for administration, by a number of routes, including but not limited to systemic, intratumoral, intraperitoneal, parenteral, intravenous, intra-arterial, intradermal, subcutaneous, intramuscular, oral and nasal. Preferably, the extracellular vesicles are administered by a route selected from intratumoral, intraperitoneal or intravenous. The medicaments and compositions may be formulated in fluid or solid form. Fluid formulations may be formulated for administration by injection to a selected region of the human or animal body.
[0153] The extracellular vesicle may comprise a therapeutic cargo. The therapeutic cargo may be a non-endogenous substance for interacting with a target gene in a target cell.
[0154] Administration is preferably in a “therapeutically effective amount”, this being sufficient to show benefit to the individual. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of the disease being treated. Prescription of treatment, e.g. decisions on dosage etc, is within the responsibility of general practitioners and other medical doctors, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington's Pharmaceutical Sciences, 20th Edition, 2000, pub. Lippincott, Williams & Wilkins.
[0155] Extracellular vesicles may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.
[0156] Extracellular vesicles loaded with a cargo as described herein may be used to deliver that cargo to a target cell. In some cases, the method is an in vitro method. In particularly preferred in vitro methods the cargo is a labelling molecule or a plasmid.
[0157] The subject to be treated may be any animal or human. The subject is preferably mammalian, more preferably human. The subject may be a non-human mammal, but is more preferably human. The subject may be male or female. The subject may be a patient. Therapeutic uses may be in humans or animals (veterinary use).
Protein Expression
[0158] Molecular biology techniques suitable for the producing peptides such as peptide, polypeptide or protein cargo according to the invention in cells are well known in the art, such as those set out in Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989.
[0159] The peptide may be expressed from a nucleotide sequence. The nucleotide sequence may be contained in a vector present in the cell, or may be incorporated into the genome of the cell.
[0160] A “vector” as used herein is an oligonucleotide molecule (DNA or RNA) used as a vehicle to transfer foreign genetic material into a cell. The vector may be an expression vector for expression of the foreign genetic material in the cell. Such vectors may include a promoter sequence operably linked to the nucleotide sequence encoding the gene sequence to be expressed. A vector may also include a termination codon and expression enhancers. Any suitable vectors, promoters, enhancers and termination codons known in the art may be used to express plant aspartic proteases from a vector according to the invention. Suitable vectors include plasmids, binary vectors, viral vectors and artificial chromosomes (e.g. yeast artificial chromosomes).
[0161] In this specification the term “operably linked” may include the situation where a selected nucleotide sequence and regulatory nucleotide sequence (e.g. promoter and/or enhancer) are covalently linked in such a way as to place the expression of the nucleotide sequence under the influence or control of the regulatory sequence (thereby forming an expression cassette). Thus a regulatory sequence is operably linked to the selected nucleotide sequence if the regulatory sequence is capable of effecting transcription of the nucleotide sequence. Where appropriate, the resulting transcript may then be translated into a desired protein or polypeptide.
[0162] Any cell suitable for the expression of polypeptides may be used for producing peptides according to the invention. The cell may be a prokaryote or eukaryote. Preferably the cell is a eukaryotic cell such as a yeast cell, a plant cell, insect cell or a mammalian cell. In some cases the cell is not a prokaryotic cell because some prokaryotic cells do not allow for the same post-translational modifications as eukaryotes.
[0163] In addition, very high expression levels are possible in eukaryotes and proteins can be easier to purify from eukaryotes using appropriate tags. Specific plasmids may also be utilised which enhance secretion of the protein into the media.
[0164] Methods of producing a peptide of interest may involve culture or fermentation of a eukaryotic cell modified to express the peptide. The culture or fermentation may be performed in a bioreactor provided with an appropriate supply of nutrients, air/oxygen and/or growth factors. Secreted proteins can be collected by partitioning culture media/fermentation broth from the cells, extracting the protein content, and separating individual proteins to isolate secreted aspartic protease. Culture, fermentation and separation techniques are well known to those of skill in the art.
[0165] Bioreactors include one or more vessels in which cells may be cultured. Culture in the bioreactor may occur continuously, with a continuous flow of reactants into, and a continuous flow of cultured cells from, the reactor. Alternatively, the culture may occur in batches. The bioreactor monitors and controls environmental conditions such as pH, oxygen, flow rates into and out of, and agitation within the vessel such that optimum conditions are provided for the cells being cultured.
[0166] Following culture of cells that express peptide of interest, that peptide is preferably isolated. Any suitable method for separating proteins from cell culture known in the art may be used. In order to isolate a protein of interest from a culture, it may be necessary to first separate the cultured cells from media containing the protein of interest. If the protein of interest is secreted from the cells, the cells may be separated from the culture media that contains the secreted protein by centrifugation. If the protein of interest collects within the cell, for example in the vacuole of the cell, it will be necessary to disrupt the cells prior to centrifugation, for example using sonification, rapid freeze-thaw or osmotic lysis. Centrifugation will produce a pellet containing the cultured cells, or cell debris of the cultured cells, and a supernatant containing culture medium and the protein of interest.
[0167] It may then be desirable to isolate the protein of interest from the supernatant or culture medium, which may contain other protein and non-protein components. A common approach to separating protein components from a supernatant or culture medium is by precipitation. Proteins of different solubilities are precipitated at different concentrations of precipitating agent such as ammonium sulfate. For example, at low concentrations of precipitating agent, water soluble proteins are extracted. Thus, by adding different increasing concentrations of precipitating agent, proteins of different solubilities may be distinguished. Dialysis may be subsequently used to remove ammonium sulfate from the separated proteins.
[0168] Other methods for distinguishing different proteins are known in the art, for example ion exchange chromatography and size chromatography. These may be used as an alternative to precipitation, or may be performed subsequently to precipitation.
[0169] Once the protein of interest has been isolated from culture it may be necessary to concentrate the protein. A number of methods for concentrating a protein of interest are known in the art, such as ultrafiltration or lyophilisation
[0170] The features disclosed in the foregoing description, or in the following claims, or in the accompanying drawings, expressed in their specific forms or in terms of a means for performing the disclosed function, or a method or process for obtaining the disclosed results, as appropriate, may, separately, or in any combination of such features, be utilised for realising the invention in diverse forms thereof.
[0171] While the invention has been described in conjunction with the exemplary embodiments described above, many equivalent modifications and variations will be apparent to those skilled in the art when given this disclosure. Accordingly, the exemplary embodiments of the invention set forth above are considered to be illustrative and not limiting. Various changes to the described embodiments may be made without departing from the spirit and scope of the invention.
[0172] For the avoidance of any doubt, any theoretical explanations provided herein are provided for the purposes of improving the understanding of a reader. The inventors do not wish to be bound by any of these theoretical explanations.
[0173] Any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.
[0174] Throughout this specification, including the claims which follow, unless the context requires otherwise, the word “comprise” and “include”, and variations such as “comprises”, “comprising”, and “including” will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
[0175] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent “about,” it will be understood that the particular value forms another embodiment. The term “about” in relation to a numerical value is optional and means for example +/−10%.
EXAMPLES
Example 1
RNA Druq Delivery Using Red Blood Cell Extracellular Vesicles and Methods Thereof
Purification and Characterization of RBCEVs
[0176] The inventors have devised a new strategy to purify large-scale amounts of EVs from RBCs at low cost. RBCs were obtained from group O blood of healthy donors and treated with calcium ionophore overnight. The purification of RBCEVs was optimized with sequential centrifugation steps including the removal of protein contamination using a 60% sucrose cushion that yielded a homogenous population of EVs with an average diameter of ˜140 nm and a poly-dispersity index ˜0.07, determined using a Nanosight particle analyzer and Zetasizer (
Delivery of ASOs to Leukemia Cells Using RBCEVs
[0177] RBCEVs were taken up by leukemia cells at high efficiencies with no observable toxicity. After 24 h of incubation with RBCEVs, Western blot analysis of leukemia MOLM13 cells showed a clear uptake of Hemoglobin A, which was absent in the untreated cells (
[0178] To improve estimate of RNA loading into electroporated RBCEVs, the inventors separated unbound ASOs from the electroporated RBCEVs using a 10% native gel and found that ˜76% of the ASOs migrated into the gel from the 8.25×1011 ASO electroporated RBCEV sample relative to the total 200 pmol ASOs (
[0179] The inventors consistently observed 70-80% uptake of FAM-labeled ASOs and Alexa Fluor® 647 labeled Dextran in leukemia MOLM13 cells after 24-hourtreatments with ˜12×1011 RBCEVs for 5×104 cells, which was the optimal dose (
Inhibition of miR-125b Using 125b-ASO-Loaded RBCEVs
[0180] The inventors further investigated the therapeutic potential of RBCEVs in delivering ASOs that antagonizes miR-125b, a well-known oncogenic microRNA in leukemia cells, prostate cancer, and breast cancer. In particular, miR-125b is an oncomiR in refractory cancers such as acute myeloid leukemia and chemoresistant breast tumors, both of which are difficult to treat. The inventors have shown that miR-125b promotes the survival of cancer cells by repressing multiple genes in the p53 tumor suppressor network. These studies suggested that miR-125b is a potential drug target for cancer treatment. However, no effective therapy has been developed to target miR-125b yet. Here, the inventors electroporated anti-miR-125b ASOs (125b-ASOs) into RBCEVs then quantified the loading of 125b-ASOs in the EVs and the delivery of the ASOs to MOLM13 cells (
[0181] RNase. To quantify the copy number of 125b-ASOs, the inventors generated a standard curve of the ASOs amplification using Taqman qRT-PCR (
[0182] With the uptake of 125b-ASOs, the level of miR-125b was suppressed by 80-95% in MOLM13 cells in a dose-dependent manner relative to U6b RNA quantified using Taqman qRT-PCR (
In vivo Distribution of RBCEVs in a Breast Cancer Model
[0183] We tested the uptake and distribution of RBCEVs in vivo using the xenograft model of breast cancer CA1 cells, known to be very aggressive and metastatic. Luciferaseexpressing CA1 a cells were implanted subcutaneously in the left and right flanks of female nude mice (
[0184] The biodistribution of RBCEV in vivo was also tested in NOD scid gamma (NSG) mouse (
Intratumoral Injection of 125b-ASO-Loaded RBCEVs Suppresses Breast Cancer
[0185] After validating the RBCEV platform's potential utility in vivo, the inventors used it to target miR-125b, which has not been tested for its role in breast tumorigenesis in vivo. The inventors delivered 125b-ASO-loaded RBCEVs into luciferase-labeled CA1 a tumors by intratumoral injections every 3 days (
Systemic Injection of 125b-ASO-Loaded RBCEVs Suppresses AML Progression
[0186] The inventors have shown that RBCEVs are robust vehicles that delivered 125b-ASOs readily to AML cells for effective inhibition of miR-125b function in vitro. To test the functional efficacy of 125b-ASO-loaded RBCEVs in vivo, the inventors sought to establish a xenograft model of AML in NSG mice. First, the inventors determined the distribution of RBCEVs in the circulation of these mice following systemic administration of the EVs (
[0187] Subsequently, the inventors generated AML xenografts by injecting luciferase-GFP labeled MOLM13 cells in the tail vein of busulfan-conditioned NSG mice (
Genome Editing Mediated by Cas9 mRNA and gRNA-Loaded RBCEVs
[0188] Furthermore, the inventors validated the RBCEV platform for gRNA-mediated genome editing with CRISPR-Cas9 (
[0189] Subsequently, the inventors designed a gRNA targeting the human mir-125b-2 locus with potential mutation site in the seed sequence of the miRNA (
[0190] To test if RBCEVs can also deliver DNA plasmids, the inventors electroporated two plasmids expressing Cas9 and GFP gRNA into RBCEVs and treated 293T-eGFP cells for a week. EGFP knockout was observed in only ˜10% cells (
RBCEVs in the Treatment of Lymphoma
[0191] The uptake of Bodipy-labeled RBCEVs by lymphoma B95-8 cells was studied by the inventors (Supplementary
Discussion
[0192] Taken together, the data demonstrates the use of RBCEVs as a versatile delivery system for therapeutic RNAs, including short RNAs such as ASOs and gRNAs, as well as long RNAs such as Cas9 mRNAs. ASOs and CRISPR-Cas9 can be designed and programmed to target any gene of interest, including undruggable targets such as oncomiRs and transcription factors, for therapeutic purposes. Previously, several research groups have illustrated the advantages of using EVs for RNA delivery, but their EVs were generated from fibroblasts and dendritic cells that are not as readily available from all subjects. EVs from whole plasma are more abundant and easier to obtain, but these EVs are derived from many cell types including nucleated cells, which still pose a risk for horizontal gene transfer.
[0193] The RBCEV platform has several features that are more suitable for clinical applications. First, blood units are readily available from existing blood banks and even from the patients' own blood for allogeneic and autologous transfusion, respectively. A large number of RBCs (˜1012 cells/L) are available in each blood unit. Hence, there is no need to expand the cells in culture and risk any accrual of mutations in vitro, and no cGMP-qualified media or supplements are required. Second, large-scale amounts (1013-1014) of EVs can be purified from RBCs, after the treatment with calcium ionophore, thus providing a scalable strategy to obtain EVs. Third, RBCEVs are safe, as the enucleated RBCs are homogeneously devoid of DNA, unlike EVs from nucleated cell types which pose potential risks for horizontal gene transfer and unlike plasma EVs that are heterogeneous with unpredictable contents. For allogeneic treatments of cancer, RBCEVs are safer than plasma EVs, since cancer cells and immune cells are known to release a large amount of cancer promoting EVs into the circulation of cancer patients.
[0194] Moreover, RBCEVs are nontoxic, unlike the synthetic transfection reagents. RNAs are stable in RBCEVs and fully functional in recipient cells as shown by our in vitro and in vivo data for liquid and solid cancers. RBCEVs are likely to be non immunogenic, via matching of the blood types, unlike lentiviruses, adenoviruses, adeno-associated viruses, nanoparticles, and most synthetic transfection reagents. And the inventors have also shown that RBCEVs deliver RNAs to cells at a higher efficiency than two commonly used transfection reagents. The inventors are able to deliver not only short RNAs but also long mRNAs in RBCEVs. RBCEVs were successfully used to target a specific oncomiR gene, not only via steric blocking, but also via CRISPR-Cas9 genome editing, which has not been shown hitherto. RBCEVs from group O− Rh negative blood are ideal for universal treatments. Finally, the fact that RBCEVs can be frozen and thawed many cycles without affecting their integrity and efficacy, suggests that they can be developed into stable pharmaceutical products in future. Further development of RBCEVs coated with cancer-targeting peptides or antibodies could potentially deliver therapeutic RNAs to cancer cells specifically, and reduce adverse side effects in normal tissues.
[0195] The experimental data obtained by the inventors show that RBCVs can be used to treat diseases in the liver, bone marrow, lung, spleen, stomach and intestine. Further, RBCEVs can be used in the treatment of cancers, including lung cancer, liver cancer, colorectal cancer, nasopharyngeal cancer, glioma, leukemia (
Methods
Cell Culture
[0196] Acute myeloid leukemia MOLM13 and NOMO1 cells were originally from DSMZ Collection of Microorganisms and Cell Cultures (Braunschweig, Germany). Breast cancer MCF10CA1a (CA1a) cells were purchased from Karmanos Cancer Institute (Wayne State University, USA). HEK-293T cells were obtained from the American Type Culture Collection (ATCC, USA). MCF10CA1a cells with luciferase label were generated in our previous study. 293T-eGFP cells, generated from ATCC HEK-293T cells, were a gift from Dr. Albert Cheng (Jackson Lab, USA). MOLM13 and NOMO1 cells stably expressing eGFP were generated by an infection with pCAG-eGFP lentivirus generated in HEK-293T cells cotransfected with packaging plasmids using Lipofectamin™ 2000 (plasmids from Addgene, USA) and sorted using flow cytometry. Leukemia and breast cancer cell lines were maintained in RPM11640 or DMEM (ThermoFisher Scientific) respectively with 10% fetal bovine serum (Biosera, USA) and 1% penicillin/streptomycin (ThermoFisher Scientific, USA). All the cells used for the experiments were tested negative for mycoplasma contamination using PCR. Briefly, 100 μl supernatants were collected from 80-100% confluent cultures and heated at 95° C. for 5 min. Mycoplasma DNA was amplified using Taq polymerase (a gift from the Xia lab, Xiamen University) and a mycoplasma-specific primer mixture (sequences provided below) in 35 cycles: 94° C. 15 s, 56° C. 15 s, 72° C. 30 s; and visualized using 1% agarose gel. In parallel, mycoplasma was also tested using the Mycofluor mycoplasma detection kit (ThermoFisher Scientific) according to the manufacturer's protocol. MOLM13, NOMO1, CA1a, and 293T cells were authenticated by their original vendors. The inventors also confirmed the identity of these cell lines and their fluorescent/luciferase derivatives using a 16-loci multiplex short tandem repeat analysis according to ATCC standards, provided by an authentication service by Guangzhou IGE Biotechnology (China).
EV Purification From RBCs
[0197] Group O blood samples were obtained by Red Cross from healthy donors in Hong Kong with informed consents. All experiments with human blood samples were performed according to the guidelines and the approval of the City University of Hong Kong Human Subjects Ethics committee. RBCs were separated from plasma and white blood cells by using centrifugation and leukodepletion filters (Terumo Japan). Isolated RBCs were diluted in PBS and treated with 10 mM calcium ionophore (Sigma Aldrich) overnight. To purify EVs, RBCs and cell debris were removed by centrifugation at 600×g for 20 min, 1600×g for 15 min, 3260×g for 15 min, and 10,000×g for 30 min at 4° C. The supernatants were passed through 0.45 μm-syringe filters. EVs were concentrated by using ultracentrifugation with a TY70Ti rotor (Beckman Coulter, USA) at 100,000×g for 70 min at 4° C. EVs were resuspended in cold PBS. For labeling, half of the EVs were mixed with 20 pM PKH26 (Sigma Aldrich, USA) or 1 pM DiR (ThermoFisher Scientific) or 42.62 μM Vivo-Track-680 (Perkin Elmer). Labeled or unlabeled EVs were layered above 2 ml frozen 60% sucrose cushion and centrifuged at 100,000×g for 16 h at 4° C. using a SW41Ti rotor (Beckman Coulter) with reduced braking speed. The red layer of EVs (above the sucrose) was collected and washed once (unlabeled EVs) or twice (labeled EVs) with cold PBS using ultracentrifugation in a SW41Ti rotor (Beckman Coulter) at 100,000×g for 70 min at 4° C. All ultracentrifugation experiments were performed with a Beckman XE-90 ultracentrifuge (Beckman Coulter). Purified RBCEVs were stored at −80° C.
EV Characterization
[0198] The concentration and size distribution of EVs were quantified using a NanoSight Tracking Analysis NS300 system (Malvern, UK). Zeta potential and polydispersity index were determined using a Zetasizer Nano(Malvern). For transmission electron microscopy analysis of EVs, EVs were fixed on copper grids (200 mesh, coated with formvar carbon film) by adding equal amount of 4% paraformaldehyde. After washing with PBS, 4% uranyl acetate was added for chemical staining of EVs and images were captured using a Tecnai 12 BioTWIN transmission electron microscope (FEI/Philips, USA).
Oligonucleotide Sequences and Modifications
[0199] Anti-miR-125b ASOs (5′-UCACAAGUUAGGGUCUCAGGGA-3) and negative control ASOs (5′-CAGUACUUUUGUGUAGUACAA-3) were synthesized with 2′ Omethyl modification at every ribonucleotide by Shanghai Genepharma (Shanghai, China) or by Integrated DNA Technology (Singapore). Anti-miR 125b gRNA (5′-CCUCACAAGUUAGGGUCUCA-Synthego Scaffold-3′) and anti-GFP gRNA: (5′-GGGCACGGGCAGCUUGCCGG-Synthego Scaffold-3) were synthesized with 2′-O-methyl analogs and 3′ phosphorothioate internucleotide linkages at the first three 5′ and 3′ terminal RNA residues by Synthego (USA).
EV Electroporation
[0200] Electroporation of RBCEVs were performed using a Gene Pulser Xcell electroporator (BioRad), exponential program at a fixed capacitance of 100 μF with 0.4 cm cuvettes. For optimization, 8.25 to 16.5×1011 RBCEVs were diluted in OptiMEM (ThermoFisher Scientific) and mixed with 4 μg Dextran conjugated with Alexa Fluor® 647 (AF647, ThermoFisher Scientific) to a total volume of 200 μl. An aliquot of 100 μl EV mixture was added to each cuvette and incubate on ice for 10 min. Electroporation was tested at different voltages: 50-250V. For ASOs delivery, ˜4-16×1011 RBCEVs were electroporated with 400 pmol scrambled negative control (NC) or anti-miR 125b ASOs at 250 V. For genome editing, 12.4×1011 RBCEVs (or MOLM13 cells) were electroporated with 6 pmol CleanCap™ Cas9 mRNA (Trilink) and 50 pmol anti-GFP gRNA or 80 pmol anti-mir-125b gRNA at 400 V. Aggregates of RBCEVs formed during electroporation were dissolved by vigorous pipetting. To quantify the electroporation efficiency, 8.25×1011 Dextran-AF647 electroporated EVs were incubated overnight with 5 μg latex beads (ThermoFisher Scientific) and analyzed for AF647 using flow cytometry.
RNA Loading Efficiency and Stability in Electroporated RBCEVs
[0201] To quantify the amount of unbound ASOs, 200 pmol unlabeled or FAM labeled NCASOs were loaded with or without 8.25×1011 RBCEVs, with or without electroporation, into 10% Tris-acetate-EDTA (TBE) native gel, separated at 150 V for 30 min and visualized using SYBR-Gold staining for 30 min at room temperature (Thermo-Fisher Scientific) or using FAM fluorescence, respectively with the Gel Doc™ EZ Documentation system (Bio Rad, USA). The experiment was repeated three times independently. The SYBR Gold bands of the ASOs were quantified using imageJ (NIH, USA) and normalized to the background. Full images of the gels are provided in
EV Separation Using Top-Down Sucrose Density Gradients
[0202] A total of 3.7×1012 FAM ASOs-loaded EVs were mixed with 1 ml of 10% HEPES/sucrose solution. An 11 ml of linear sucrose gradient (60-10%) was loaded into a 12.5 ml-open top SW41 ultracentrifuge tube (Beckman Coulter). The EV suspension was layered on top of the sucrose layer and ultracentrifuged at 150,000×g for 16 h at 4° C. A total of 12 fractions were collected from the sucrose gradient into a black well plate and analyzed using the Synergy™ H1 Microplate Reader. The concentration of EVs in each fraction was determined using the NanoSight as described above. The density of sucrose in each fraction was measured using a refractometer (VastOcean, China).
Treatment of Cancer Cells With RBCEVs in vitro
[0203] We performed quality control of RBCEVs for every batch of purification using a Nanosight particle analyzer. Samples with unusually low concentration or strange aggregates were discarded. Cells in culture were routinely examined for signs of contamination or changes in morphology and growth. To test the EV uptake, 50,000 MOLM13, CA1a or NOMO1 cells were incubated with 200 μl of ˜4-16×1011 unelectroporated or electroporated EVs and 300 μl growth medium per well in 24-well plates for 24 h. Untreated controls were kept in the same medium with 200 μl untreated Opti-MEM. For assays that required longer incubation time, the medium was replaced with fresh growth medium after 24 h. For comparison, MOLM13 cells were transfected with 4 μg Dextran-AF647 or 800 nM FAM-labeled NC-ASOs in Lipofectamin™ 3000 (ThermoFisher Scientific) or INTERFERin® (PolyPlus Transfection, France) according to the manufacturers' protocols. To test the effect of heparin on the uptake, MOLM13 cells were pretreated with 20 μg/ml of heparin sodium salt (Aladdin, China) for 10 min then incubated overnight with 12.4×1011 of unlabeled or PKH26-labeled RBCEVs in the presence or absence of 20 μg/ml of heparin sodium salt. The uptake of RBCEVs and Dextran or FAM ASOs were analyzed using flow cytometry or immunostaining.
Flow Cytometry Analysis
[0204] Flow cytometry of latex beads or cells in FACS buffer (PBS containing 0.5% fetal bovine serum) was performed using a CytoFLEX-S cytometer (Beckman Coulter) or SH800Z cytometer (Sony Biotechnology, USA) and analyzed using Flowjo V7 or V10 (Flowjo, USA). GFP-positive MOLM13 or NOMO1 cells were selected using a Sony SH800Z cell sorter in sterile condition. The beads or cells were initially gated based on FSC-A and SSC-A to exclude the debris and dead cells (low FSC-A) as shown in
Western Blot Analysis
[0205] Total cell lysates were extracted from EVs or cells (cells from 3 wells of 24-well plates were combined for each condition) by incubating with RIPA buffer supplemented with protease inhibitors (Biotool). A total of 30 or 35 μg of protein lysates were separated on 10% polyacrylamide gels and transferred to a Nitrocellulose membrane (GE Healthcare). PM5100 ExcelBand™ 3-color high range protein ladder (SmoBio, Taiwan) was loaded at two sides of the samples. Membranes were cut horizontally into two to four pieces based on the ladder, blocked with 5% non-fat milk in Tris buffered saline containing 0.1% Tween-20 (TBST) for 1 h at room temperature and incubated with primary antibodies overnight at 4° C.: mouse anti-Alix (clone 3A9, Cat # SC-53538, Santa Cruz, dilution 1:500), mouse anti-Tsg101 (clone C-2, Cat # SC-7964, Santa Cruz, dilution 1:500), rabbit anti-Hemoglobin α (clone H-80, SC-21005, Santa Cruz, dilution 1:1000), mouse anti-Calnexin (clone AF18, SC-23954, Santa Cruz, dilution 1:500), mouse anti-Stomatin (clone E-5, SC-376869, Santa Cruz, dilution 1:1000), rabbit anti-GAPDH (clone FL-335, Cat # SC-25778, Santa Cruz, dilution 1:1000), mouse anti-Cas9 antibody (clone 7A9, Cat # 844301, BioLegend, dilution 1:250), and mouse anti-tubulin (clone DM1A, Cat # Ab7291, Abcam, dilution 1:1000). The blot was washed three times with TBST then incubated then with HRP-conjugated anti-mouse and anti-rabbit secondary antibodies (Cat # 715-035-150 and 711-035-152, Jackson ImmunoResearch, dilution 1:10,000,) for 1 h at room temperature. The blot was imaged using an Azure Biosystems gel documentation system. Full images of the blots are provided in
RNA Extraction and qRT-PCR
[0206] Total RNA was extracted from cells or tissues using Trizol (ThermoFisher) according to the manufacturer's manuals. RNA samples were quantified and qualified using NanoDrop analysis (ThermoFisher) and 1% agorose gels. Those with sufficient concentration (>30 ng/μl), purity (A260/280>1.7) and integrity (clear 28 and 18s rRNA bands) were converted to cDNA using a high capacity cDNA reverse transcription kit (ThermoFisher) following the manufacturer's protocol. The levels of miR-125a and miR-125b were quantified using Taqman® miRNA assays (ThermoFisher), normalized to the expression of U6b snRNA, or using the miRCURY™ LNA™ Universal RT microRNA PCR (Qiagen, Germany), normalized to the expression of miR-103a. Anti-miR-125b ASOs was quantified using a Taqman® miRNA assay (ID #007655_mat), normalized to the expression of U6b snRNA or its copy number was calculated based on a standard curve of ASOs threshold cycle (Ct) values vs. the concentration of the ASOs in a serial dilution from 0.001 to 1000 pM. qRT-PCR analysis of mRNAs was performed using Ssofast™ Evagreen (SYBR Green) qPCR master mix (Bio-Rad), normalized to the expression of GAPDH, or 18s rRNA, or ACTB. All qPCR reactions were performed by using a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad).
Sequencing the mir-125b Gene
[0207] To identify the genome editing events generated by mir-125b targeting gRNA and Cas9 mRNA-loaded RBCEVs, DNA were extracted from the EV treated MOLM13 cells using Trizol followed by phenol-chloroform and ethanol precipitation. The primary hsa-mir-125b-2 sequence (383 nucleotides) was amplified using a pair of gene-specific primers (sequences provided below) and Q5® Hot Start high-fidelity master mix (New England Biolabs) in 30 cycles: 98° C. 10 s, 64° C. 30 s, 72° C. 45 s, and a final extension of 72° C. for 2 min. The PCR product was reamplified using the same primers with sequencing tags. High-through sequencing was performed by NovoGene Sequencing company (Hong Kong) using the HiSeq paired-end platform (Illumina, USA).
TABLE-US-00001 Primer sequences GAPDH Forward: GGAGCGAGATCCCTCCAAAAT GAPDH Reverse: GGCTGTTGTCATACTTCTCATGG 18s RNA Forward: GTAACCCGTTGAACCCCATT 18s RNA Reverse: CCATCCAATCGGTAGTAGCG BAK1 Forward: TGGTCACCTTACCTCTGCAA BAK1 Reverse: TCATAGCGTCGGTTGATGTC SP-Cas9 Forward: AAGGGACAGAAGAACAGCCG SP-Cas9 Reverse: ATATCCCGCCCATTCTGCAG mir-125b Forward: AATGGTCGTCGTGATTACTCA mir-125b Reverse: TTTTGGGGATGGGTCATGGT ACTB Forward: TCCCTGGAGAAGAGCTACGA ACTB Reverse: AGGAAGGAAGGGTGGAAGAG Mycoplasma-1 Forward: CGCCTGAGTAGTACGTTCGC Mycoplasma-2 Forward: CGCCTGAGTAGTACGTACGC Mycoplasma-3 Forward: TGCCTGAGTAGTACATTCGC Mycoplasma-4 Forward: TGCCTGGGTAGTACATTCGC Mycoplasma-5 Forward: CGCCTGGGTAGTACATTCGC Mycoplasma-6 Forward: CGCCTGAGTAGTATGCTCGC Mycoplasma-1 Reverse: GCGGTGTGTACAAGACCCGA Mycoplasma-2 Reverse: GCGGTGTGTACAAAACCCGA Mycoplasma-3 Reverse: GCGGTGTGTACAAACCCCGA
[0208] All primers were synthesized by Beijing Genomics Institute (China).
Quantification of Cell Viability
[0209] For flow cytometry analysis, leukemia cells were stained with Propidium iodide (PI) for 15 min at room temperature, washed with FACS buffer and analyzed using a CytoFLEX-S cytometer as described above. For a plate assay, 50,000 CA1a cells were seeded per well in 24-well plates and treated with ASO-electroporated RBCEVs. After 3 days, the cells were washed once with PBS, and incubated with 0.5% crystal violet staining solution (Sigma Aldrich). Plates were then washed three times in a stream of tap water and air dried. Afterwards, 500 μl of 50% acetic acid was added into each well and the optical density was measured at 570 nm using the Biotek micro-plate reader.
Animal Experiments
[0210] All mouse experiments were performed according to experimental protocols approved by the Animal Ethics Committees at City University of Hong Kong and the Department of Health, Hong Kong SAR, complied with the government legislations including the Animals (Control of Experiments) Ordinance (Cap. 340) and the Prevention of Cruelty to Animals Ordinance (Cap.169). Nude mice (strain NU/J 002019) and NSG mice (NOD.CgPrkdc<scid>ll2rg <tm1Wjl>/SzJ 005557) were purchased from the Jackson Laboratory (USA) and bred in our facilities. Mice of similar ages were labeled with numbers on their ear tags or tails using permanent markers and randomized into control and treatment groups without any bias on parents, weight, size, or gender (except for the breast cancer experiments that were performed in female mice only). Most of the imaging and histopathology experiments were done in a blinded fashion as the researchers who performed the data collection were different from those who performed the treatments. The data was recorded based on the mouse numbers, not by their treatment groups. Mice that became pregnant or died accidentally due to anesthesia during the experiments were excluded. False positives or negatives due to other technical issues such as unsuccessful injections were also excluded.
Determination of EV Uptake and Biodistribution in vivo
[0211] A total of 5×106 CA1a cells in 50 pl PBS were mixed with an equal volume of cold Matrigel (Corning) and injected subcutaneously in the left and right flanks of 6-weekold female nude mice. After 1 week, when the tumors approach 7 mm in diameter, each mouse was injected with 16.5×1011 PKH26-labeled RBCEVs intratumorally in the left flank. The mice were subsequently fed with alfalfa-free diet (LabDiet, USA) to reduce autofluorescence in the digestive system. PKH26 fluorescence was measured every day using the IVIS Lumina III system (Caliper Life Sciences, USA). On day 3, mice were killed and the tumors were excised and imaged for PKH26. Frozen sections of the tumors were stained with DAPI and observed under a LSM-880 NLO confocal laser scanning microscope (Zeiss, Germany). Similarly, the CA1a tumor (7 mm) bearing mice were injected i.p. with 16.5×1011 PKH26 or DiR-labeled RBCEVs or the supernatant of the last wash after EV labeling. Images of DiR EV injected mice were captured at 24 h post-treatment using the IVIS Lumina III. Tumors, livers, hearts, lungs, spleens, kidneys, stomach, and intestines were also obtained from i.p. DiR/PKH26-EV-injected mice for IVIS imaging and histopathology analysis.
[0212] To determine the biodistribution of RBCEVs in NSG mice, 3.3×1012 DiR-labeled RBCEVs or the supernatant of the last EV wash were injected twice with 24h interval in 6-8-week-old NSG mice (Jackson Lab). Thereafter, the mice were killed and the organs were collected for DiR fluorescence imaging using the IVIS Lumina III system. Whole body and tissue fluorescence images were acquired and analyzed using Living Image® software (Caliper Life Sciences). The background and autofluorescence were defined using the untreated or supernatant negative controls and subtracted from the images using Image-Math function.
[0213] To determine the uptake of RBCEVs by cells in the bone marrow, 3.3×1012 VVTlabeled RBCEVs or the supernatant of the last EV wash were injected twice with 24 h intervals in 6-8-week-old NSG mice (4 mice/group). 24 h after the second injection, the mice were killed and their bone marrow was collected by flushing FACS buffer through the crushed bones with a syringe and G25 needle. The cells were filtered through a 70 μm strainer, centrifuged at 1500 rpm for 5 min, resuspended in FACS buffer and analyzed for VVT fluorescence (APC-Cy5.5 channel) using the Sony SH800Z cytometer as described above.
Stability of RBCEVs in the Circulation
[0214] A total of 3.3×1012 PKH26-labeled EVs were injected i.v. into the tail veins of 6-week NSG mice (Jackson Lab). The mice were killed immediately or 3, 6, and 12 h after the injection. The blood was collected from the heart into the EDTA tubes and centrifuged at 800×g for 5 min. The supernatant was diluted with 10 ml cold PBS and centrifuged at 10,000×g for 15 min and passed through a 0.45 μm filter to remove the debris. Afterwards, the EVs were ultracentrifuged at 100,000×g for 90 min at 4° C. Purified EVs were resuspended in 175 μl PBS and incubated with 2.5 μg of latex beads at 37° C. for 30 min, followed by an overnight incubation at 4° C. EVbound latex beads were washed with 1 ml FACS buffer at 4000×g for 10 min and PKH26 fluorescence was analyzed using the CytoFLEX-S cytometer (Beckman).
In vivo Delivery of ASOs to Breast Tumors
[0215] A total of 5×105 luciferase-labeled CA1a cells were mixed with equal volume of matrigel and injected into the flanks of 6-week-old female nude mice. After 24 h, each mouse was injected with 8.25×1012 NC/125b-ASO-loaded (n=8 mice) or 400 pmol unbound NC/125b-ASOs (n=6 mice) subcutaneously in the flank at the same site where the tumor cells were injected. Intratumoral injections of the ASOelectroporated EVs were repeated every 3 days until day 42. Bioluminescent images of the whole body were taken every 6 days using the IVIS Lumina III system following i.p. injection of 150 mg/kg D-luciferin (Caliper Life Sciences). All bioluminescent images were acquired and analyzed using Living Image® 4.5. software in a blinded manner (Caliper Life Sciences). On day 44, the mice were killed and the tumors were excised. Half of each tumor was homogenized in Trizol for RNA extraction and qRT-PCR of miR-125b, except the RNA samples from a few tumors that did not meet the quality controls (as described above). The other half of the tumor and the lung was fixed for histopathology analysis as described below.
In vivo Delivery of ASOs to Leukemia Engrafted Mice
[0216] NSG mice of 7-8-week-old were injected i.p. with 20 mg/kg Busulfan (Santa Cruz). After 24 h, 5×105 luciferase and GFP labeled MOLM13 cells were injected into the tail vein of the busulfan-conditioned mice. A week later, bioluminescence was measured using the IVIS Lumina III. Mice with successful engraftment of leukemia cells (shown by bioluminescent signals in the bone marrow) were treated with 3.3×1012 ASO-loaded EVs i.p. every other day for 9 days (5 doses in total). Luminescence images of whole body were taken every 3 days using the IVIS Lumina III system following i.p. injection of 150 mg/kg D-luciferin in a blinded manner (Caliper Life Sciences). After 9 days of treatment, the mice were killed. Bone marrow were collected and analyzed for GFP-positive cells using FACS. Briefly the cells were collected from the femur or tibiae of killed mice by flushing FACS buffer through the crushed bones with a syringe and G25 needle. The cells were filtered through a 70 μm strainer, centrifuged at 1500 rpm for 5 min, resuspended in 0.5 ml RBC lysate buffer (0.8% NH4Cl and 0.1 mM EDTA in water buffered with KHCO3 to achieve a final pH of 7.2-7.6) and incubated on ice for 5 min. The buffer was neutralized with 5 ml DMEM containing 10% FBS. The cells were centrifuged again, washed once with PBS and resuspended in 200 pl FACS buffer. 0.5 pl Cytox blue (ThermoFisher Scientific) was added for identification of dead cells. The spleen and liver were collected in Trizol or formalin for RNA extraction and histopathology analysis, respectively. The RNA samples were used for qRT-PCR of miR-125b, except those that did not meet the quality controls (as described above).
Histopathology
[0217] Tumors and other tissues from the mice were fixed in 10% buffered formalin (ThermoFisher Scientific) overnight at room temperature, dehydrated sequentially in 70, 95, and 100% alcohol at 37° C., cleared in three baths of xylene (ThermoFisher Scientific) and impregnated in three baths of paraffin wax (ThermoFisher Scientific) each for 1 h and 30 min at 37 and 62° C., respectively. Paraffin blocks were cut at 5 μm using a microtome (MICROM model: HM330). Sections were dried in a 37° C. incubator before staining. Sections were dewaxed in two baths of xylene, then immersed in two baths of absolute alcohol and one bath of 70% alcohol, each for 10 min. Sections were rehydrated in water and stained with Gill's haematoxylin (Surgipath) for 15 min. After washing with water, stained sections were differentiated in 0.3% acid alcohol, washed in water again and blued in 2% sodium bicarbonate solution. Microscopic examination is essential to check distinct nuclei staining with clean cytoplasm and background. Sections were then stained with 0.5% Eosin for 2 min. After a quick wash in water to remove excess Eosin (Merck), sections were dehydrated in 95% and absolute alcohol. Sections were then cleared in xylene and mounted with a synthetic mountant (Shandon).
Immunostaining
[0218] MOLM13 cells were fixed with 4% paraformaldehyde (Sigma Aldrich) and adhered to glass slides using cytospin at 400 rpm for 3 min. The cells were blocked with 5% normal donkey serum (Jackson Immuno Research), permeabilized with 0.2% Triton X-100, and incubated overnight with a mouse anti-HA antibody (Clone F-7, Cat #7392, Cell Signaling Technology, 1:250 dilution) at 4° C., washed three times with PBS and incubated with Alexa Fluor® 488 donkey anti-mouse secondary antibody (Jackson Immuno Research) for 1 h at room temperature. The cells were finally stained with Hoechst (Sigma Aldrich) for 5 min at room temperature and washed three times with PBS. In the EV uptake experiment (
Statistical Analysis
[0219] Student's t-tests, calculated using Microsoft Excel, were used to compute the significance between the treated samples and the controls; the test type was set to one-tail distribution and two-sample equal variance. The Mann-Whitney test (onetail), computed using GraphPad Prism 6, was employed to calculate the significance where the data did not follow a normal distribution. One-way ANOVA, calculated using GraphPad Prism 6, was used for analysis of data involving multiple groups of treatments. All P-value<0.05 were considered significant. In all graphs, data are presented as mean±standard error of the mean (SEM). For quantification, each experiment was usually repeated three times with RBCEVs from three donors or with cells from three cell passages. Mouse experiments were performed with groups of 3 to 8 mice. The minimum sample size of 3 was determined using G*Power analysis for one-tail t-test comparing the mean difference of two independent groups with effect size d=5; α err prob=0.05 and power=0.95.
REFERENCES
[0220] A number of publications are cited above in order to more fully describe and disclose the invention and the state of the art to which the invention pertains. Full citations for these references are provided below. The entirety of each of these references is incorporated herein. [0221] 1. Pitt, J. M., Kroemer, G. & Zitvogel, L. Extracellular vesicles: masters of intercellular communication and potential clinical interventions. J. Clin. Invest. 126, 1139-1143 (2016). [0222] 2. Kamerkar, S. et al. Exosomes facilitate therapeutic targeting of oncogenic KRAS in pancreatic cancer. Nature 546, 498-503 (2017). [0223] 3. Syn, N. L., Wang, L., Chow, E. K.-H., Lim, C. T. & Goh, B.-C. Exosomes in Cancer Nanomedicine and Immunotherapy: Prospects and Challenges. Trends Biotechnol. (2017). doi:10.1016/j.tibtech×.2017.03.004 [0224] 4. Usman, W. et al. Efficient RNA drug delivery using red blood cell extracellular vesicles. Nature Communications In press, (2018). [0225] 5. Vader, P., Breakefield, X. O. & Wood, M. J. A. Extracellular vesicles: emerging targets for cancer therapy. Trends in Molecular Medicine 20, 385-393 (2014). [0226] 6. Kooijmans, S. A. A., Gitz-Francois, J. J. J. M., Schiffelers, R. M. & Vader, P. Recombinant phosphatidylserine-binding nanobodies for targeting of extracellular vesicles to tumor cells: a plug-and-play approach. Nanoscale 10, 2413-2426 (2018). [0227] 7. Shi, J. et al. Engineered red blood cells as carriers for systemic delivery of a wide array of functional probes. Proc. Natl. Acad. Sci. U.S.A. 111, 10131-10136 (2014). [0228] 8. Pishesha, N. et al. Engineered erythrocytes covalently linked to antigenic peptides can protect against autoimmune disease. Proc. Natl. Acad. Sci. U.S.A. 114, 3157-3162 (2017). [0229] 9. Fridy, P. C. et al. A robust pipeline for rapid production of versatile nanobody repertoires. Nat Methods 11, 1253-1260 (2014). [0230] 10. Rodriguez, P. L. et al. Minimal ‘Self’ Peptides That Inhibit Phagocytic Clearance and Enhance Delivery of Nanoparticles. Science 339, 971-975 (2013). [0231] 11. Li, Z. et al. Identification and characterization of a novel peptide ligand of epidermal growth factor receptor for targeted delivery of therapeutics. FASEB J. 19, 1978-1985 (2005). [0232] 12. Yang, R. et al. Engineering a Catalytically Efficient Recombinant Protein Ligase. J. Am. Chem. Soc. 139, 5351-5358 (2017).
[0233] For standard molecular biology techniques, see Sambrook, J., Russel, D. W. Molecular Cloning, A Laboratory Manual. 3 ed. 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press