Phi29 DNA polymerase mutant with improved thermal stability and use thereof in sequencing
20210355459 · 2021-11-18
Inventors
- Zhougang ZHANG (Shenzhen, Guangdong, CN)
- Huanhuan LIU (Shenzhen, Guangdong, CN)
- Yue ZHENG (Shenzhen, Guangdong, CN)
- Yujun ZHOU (Shenzhen, Guangdong, CN)
- Jun XIA (Shenzhen, Guangdong, CN)
- Yuliang DONG (Shenzhen, Guangdong, CN)
- Chongjun XU (Shenzhen, Guangdong, CN)
- Wenwei ZHANG (Shenzhen, Guangdong, CN)
Cpc classification
C12N9/1252
CHEMISTRY; METALLURGY
International classification
Abstract
Provided are a Phi29 DNA polymerase mutant with improved thermal stability and an use thereof in sequencing. The phi29 DNA polymerase mutant is represented by A) or B) below: the DNA polymerase mutant represented by the A) is a protein having DNA polymerase activity that is obtained by modifying at least one amino acid residue(s) in the following six sites in a phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, 515-th, and 474-th sites; the DNA polymerase mutant represented by the B) is a protein having DNA polymerase activity that is derived from the A) by adding a tag sequence to a terminal of the amino acid sequence of the protein represented by the A).
Claims
1. A protein, represented by A) or B) below: the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying at least one amino acid residue(s) in the following 6 sites in a phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, 515-th, and 474-th sites, wherein the rest amino acid residues are not changed; and the protein represented by the B) is a protein having DNA polymerase activity that is derived from the A) by adding a tag sequence to a terminal of the amino acid sequence of the protein represented by the A).
2. The protein according to claim 1, wherein: the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in at least 2 or at least 3 or at least 4 or at least 5 or all of the following 6 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, 515-th, and 474-th sites, wherein the rest amino acid residues are not changed.
3. The protein according to claim 1, wherein: the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in all of the following 5 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, and 515-th sites, wherein the rest amino acid residues are not changed.
4. The protein according to claim 1, wherein: the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in all of the following 3 sites in the phi29 DNA polymerase amino acid sequence: the 224-th, 515-th and 474-th sites, wherein the rest amino acid residues are not changed.
5. The protein according to claim 1, wherein: the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in all of the following 4 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th and 515-th sites, wherein the rest amino acid residues are not changed.
6. The protein according to claim 1, wherein: the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in the following 4 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 224-th, and 515-th sites, wherein the rest amino acid residues are not changed.
7. The protein according to claim 1, wherein: the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in the following 2 sites in the phi29 DNA polymerase amino acid sequence: the 224-th and 474-th sites, wherein the rest amino acid residues are not changed.
8. The protein according to claim 1, wherein: the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in the following 2 sites in the phi29 DNA polymerase amino acid sequence: the 217-th and 224-th sites, wherein the rest amino acid residues are not changed.
9. The protein according to claim 1, wherein the modification is amino acid substitution.
10. The protein according to claim 9, wherein: the amino acid substitutions in 6 sites of the 97-th, 123-th, 217-th, 224-th, 515-th and 474-th sites are respectively as follows: a methionine in the 97-th site is substituted with an alanine or a histidine or a lysine or a threonine; a leucine in the 123-th site is substituted with a lysine or a phenylalanine or an isoleucine or a histidine; a glycine in the 217-th site is substituted with a glutamic acid; a tyrosine in the 224-th site is substituted with a lysine; an isoleucine in the 474-th site is substituted with a lysine; and a glutamic acid in the 515-th site is substituted with a proline or a glycine.
11. The protein according to claim 10, wherein: the protein represented by the A) is a protein having DNA polymerase activity that is obtained by mutating the amino acid residue from M into K in the 97-th site, from L into H in the 123-th site, from E into Pin the 515-th site, from Y into K in the 224-th site, and from G into K in the 217-th site of the phi29 DNA polymerase amino acid sequence, wherein the rest amino acid residues are not changed.
12. The protein according to claim 10, wherein: the protein represented by the A) is a protein that is obtained by mutating the amino acid residue from Y into K in the 224-th site, from I into K in the 474-th site, and from E into P in the 515-th site of the phi29 DNA polymerase amino acid sequence.
13. The protein according to claim 10, wherein: the protein represented by the A) is a protein that is obtained by mutating the amino acid residue from M into T in the 97-th site, from L into H in the 123-th site, and from E into P in the 515-th site of the phi29 DNA polymerase amino acid sequence.
14. The protein according to claim 1, wherein: the phi29 DNA polymerase amino acid sequence is any one of the followings: (I) a protein shown in SEQ ID NO: 2 of a sequence listing; (II) a protein having more than 90% identity with the protein shown in SEQ ID NO: 2 of the sequence listing and derived from a Bacillus subtilis protein; and (III) a protein having more than 95% identity with the protein shown in SEQ ID NO: 2 of the sequence listing and derived from a Bacillus subtilis protein.
15. The protein according to claim 1, wherein: the stability of the protein is higher than that of the phi29 DNA polymerase.
16. The protein according to claim 15, wherein: the stability is thermal stability.
17. A nucleic acid molecule for encoding the protein according to claim 1.
18. An expression cassette, a recombinant vector, recombinant bacteria or a transgenic cell line comprising the nucleic acid molecule according to claim 17.
19. (canceled)
20. (canceled)
21. A method for improving stability of a phi29 DNA polymerase, comprising the following steps: modifying at least one amino acid residue(s) in the following 6 sites of the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, 515-th and 474-th sites, in the modification modes according to claim 1, wherein the rest amino acid residues are not changed, to obtain a protein having DNA polymerase activity.
22. The method according to claim 1, wherein: the stability is thermal stability.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0074]
[0075]
[0076]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0077] The following embodiments are convenient for understanding the disclosure better, but do not limit the disclosure. Unless otherwise specified, experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, test materials used in the following embodiments are all purchased from conventional biochemical reagent stores. Quantitative tests in the following embodiments are all set to three times of repeated experiments, and results are averaged. For each solution or buffer in the following embodiments, unless otherwise specified, solvents are all water.
[0078] pET28a(+) vector: Novagen Company.
[0079] Escherichia coli BL21 (DE3): TIANGEN, CB105-02.
[0080] Storage buffer: 10 mM Tris-HCI, 100 mM KCI, 1 mM DTT, 0.1 mM EDTA, 0.5% (v/v) Tween20, 0.5% (v/v) NP-40, 50% (v/v) Glycerol, and pH 7. 4@25° C.
[0081] 141 RCA Primer in the following embodiments: TCCTAAGACCGCTTGGCCTCCGACT (SEQ ID NO:3).
[0082] 141 Ad ssDNA in the following embodiments: self-made by BGI, a single-stranded loop library of a certain size range, without a fixed sequence (a random library formed by four nucleotides A/T/C/G, and a main band length is 200-300 bp).
[0083] In the following embodiments, a DNA molecule shown in SEQ ID NO: 1 of a sequence listing is an encoding gene of a wild-type Phi29 DNA polymerase, and it expresses a protein shown in SEQ ID NO: 2 of the sequence listing, namely the wild-type Phi29 DNA polymerase (represented by WT).
Embodiment 1: Preparation of Phi29 DNA Polymerase Mutant
[0084] A Phi29 DNA polymerase mutant is obtained by mutating at least one of the 97-th, 123-th, 217-th, 224-th, 474-th, and 515-th sites in an amino acid sequence of a wild-type Phi29 DNA polymerase. Specifically, a single-site mutation form is shown in Table 1, and a multi-site combination mutation form is shown in Table 2.
[0085] I. Construction of a Recombinant Vector for Expressing Phi29 DNA Polymerase Mutant
[0086] 1. Recombinant Vector for Expressing Phi29 DNA Polymerase Single-Site Mutant
[0087] A DNA molecule shown in SEQ ID NO: 2 of a sequence listing is inserted between Ndel and BamHl restriction sites of a pET28a(+) vector (
[0088] The recombinant vector WT is served as an original vector, each primer pair shown in Table 1 is used to introduce a site mutation, and each recombinant vector for expressing the Phi29 DNA polymerase mutant is obtained.
[0089] The above method of introducing the site mutation by using each primer pair shown in Table 1 is as follows.
[0090] The recombinant vector WT is tested as a template, in a site-directed mutation PCR reaction system (25 pl) containing the following components: 2.5 μl 10× Pfu Reaction Buffer with Mg.sup.2+, 2 μl dNTP Mix (2.5 mM each), 25 ng pET28a-Phi29 plasmid, 0.5 μl Pfu DNA Polymerase, mutation primers of mutation sites (Table 1) are respectively added, and PCR amplification is performed.
[0091] PCR conditions are as follows: 95° C. 3 min, 19 cycle for [95° C. 30s, 53° C. 30s, 68° C. 8 min], 68° C. 10 min, 4° C. forever. After the reaction product is digested with Dpnl, it is transformed into DH5a competent cells, spread out on a kanamycin-resistant LB plate, and then it is incubated overnight in an incubator at 37° C., a monoclonal plasmid is picked out for sequencing, to verify whether a specific amino acid site is successfully mutated.
TABLE-US-00001 TABLE 1 Single-site mutation primers Phi29 DNA polymerase mutant Forward primer Reverse primer M97H CACCATTATTAGCCGCCATGGCCAGT CAATCATATACCACTGGCCATGGCGGCT GGTA TATGATTG (SEQ ID NO: 4) AATA ATGGTG (SEQ ID NO: 5) M97A CACCATTATTAGCCGCGCGGGCCAGT CAATCATATACCACTGGCCCGCGCGGC GGTA TATGATTG (SEQ ID NO: 6) TAATA ATGGTG (SEQ ID NO: 7) M97K CACCATTATTAGCCGCAAAGGCCAGT CAATCATATACCACTGGCCTTTGCGGCT GGTA TATGATTG (SEQ ID NO: 8) AATA ATGGTG (SEQ ID NO: 9) L123K CCGTGATCTATGATAGCAAAAAGAAAC CGGAAACGGCAGTTTCTTTTTGCTATCA TGC CGTTTCCG (SEQ ID NO: 10) TAGA TCACGG (SEQ ID NO: 11) L123F CCGTGATCTATGATAGCTTTAAGAAAC CGGAAACGGCAGTTTCTTAAAGCTATCA TGC CGTTTCCG (SEQ ID NO: 12) TAGA TCACGG (SEQ ID NO: 13) L123I CCGTGATCTATGATAGCATTAAGAAAC CGGAAACGGCAGTTTCTTAATGCTATCA TGC CGTTTCCG (SEQ ID NO: 14) TAGA TCACGG (SEQ ID NO: 15) L123H CCGTGATCTATGATAGCCATAAGAAAC CGGAAACGGCAGTTTCTTATGGCTATCA TGC CGTTTCCG (SEQ ID NO: 16) TAGA TCACGG (SEQ ID NO: 17) E515P GGATGGCAAACTGGTTCCGGGCAGC CATCCGGGCTGCCCGGAACCAGTTTGC CCGGA TG (SEQ ID NO: 18) CATCC (SEQ ID NO: 19) Phi29-192 GATAAAGAAGTGCGCAAAGCGTATCG GCCACCGCGATACGCTTTGCGCACTTC (Y224K) CGGT GGC (SEQ ID NO: 20) TTTATC (SEQ ID NO: 21) Phi29-103 GACCCTGAGCCTGGAACTGGATAAAG GCACTTCTTTATCCAGTTCCAGGCTCAG (G217E) AAGT GC (SEQ ID NO: 22) GGTC (SEQ ID NO: 23) phi29-85 GATGTGATCAAAGATTTTGTGGACCC GTTTTTTCGGGTCCACAAAATCTTTGAT (I474K) GAAA AAAC (SEQ ID NO: 24) CACA TC (SEQ ID NO: 25)
[0092] Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97H is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “ATG” into “CAT”. The mutated DNA molecule encodes the mutant. M97H. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97H is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into H.
[0093] Compared with the recombinant vector WI, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97A is only that the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO. 1 of the sequence listing are mutated from “ATG” into “GCG”. The mutated DNA molecule encodes, the mutant M97A Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97A is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into A.
[0094] Compared with the recombinant vector WI, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97K is only that the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “ATG” into “AAA”. The mutated DNA molecule encodes the mutant M97K. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97K is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into K.
[0095] Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant L123K is only that: the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “CTG” into “AAA”. The mutated DNA molecule encodes the mutant L123K. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant L123K is only that the amino acid residue in the 123-th site of the wild-type Phi29 DNA polymerase amino acid, sequence is mutated from L into K.
[0096] Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant L123F is only that: the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “CTG” into “TTT”. The mutated DNA molecule encodes, the mutant L123F. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant L123F is only that the amino acid residue in the 123-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from L into F.
[0097] Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant L123I is only that: the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “CTG” into “ATT”. The mutated DNA molecule encodes the mutant L123I. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant L 123I is only that the amino acid residue in the 123-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from L into I.
[0098] Compared with the recombinant vector WT, a different from a recombinant vector for expressing a Phi29 DNA polymerase mutant L123H is only that: the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO 1 of the sequence listing are mutated from “CTG” into “CAT”. The mutated DNA molecule encodes the mutant L123H. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant L123H is only that the amino acid residue in the 123-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from L into H.
[0099] Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant E515P is only that: the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “GAA” into “CCG”. The mutated DNA molecule encodes the mutant E515P. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant E515P is only that the amino acid residue in the 515-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from E into P.
[0100] Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant Y224K is only that: the 670-672-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “TAT” into “AAA”. The mutated DNA molecule encodes the mutant Y224K. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant Y224K is only that the amino acid residue in the 224-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from Y into K.
[0101] Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant G217E is only that: the 649-651-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “GGC” into “GAA”. The mutated DNA molecule encodes the mutant G217E. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant G217E is only that the amino acid residue in the 217-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from G into E.
[0102] Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant 1474K is only that: the 1420-1422-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “ATT” into “TTT”, The mutated DNA molecule encodes the mutant I474K. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant 1474K is only that the amino acid residue in the 474-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from I into K.
[0103] 2. Construction of Recombinant Vector for Expressing Phi29 DNA Polymerase Multi-Site Mutant
[0104] The recombinant vector WT is served as an original vector, each primer pair shown in. Table 1 is used to introduce a site mutation successively, to obtain each recombinant vector for expressing a Phi29 DNA polymerase mutant. A specific mutation form is shown in Table 2:
TABLE-US-00002 TABLE 2 Phi29 DNA polymerase Phi29 DNA polymerase mutant number mutant name phi29-337 M97K-L123H-E515P-Y224K-G217E phi29-414 M97T-L123K-E515P phi29-456 M97K-L123H-E515P Phi29-464 Y224K-I474K-E515P phi29-458 M97K-L123H-E515P-G217E phi29-459 M97K-L123H-E515P-Y224K Phi29-463 Y224K-I474K Phi29-335 Y224K-G217E
[0105] Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97K-L123H-E515P-Y224K-G217E is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO 1 of the sequence listing are mutated from “ATG” into “AAA”, the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “CTG” into “CAT” the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “GAA” into “COG”, the 670-672-th nucleotides of the DNA molecule shown in SEQ ID NO 1 of the sequence listing are mutated from “TAT” into “AAA”, the 649-651-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “GGC” into “GAA”. The mutated DNA molecule encodes the mutant M97K-L123H-E515P-Y224K-G217E. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97K-L123H-E515P-Y224K-G217E is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into K, and the 123-th site is mutated from L into H, the 515-th site is mutated from E into P, the 224-th site is mutated from Y into K, and the 217-th site is mutated from G into E.
[0106] Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97T-L123K-E515P is only that the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “ATG” into “ACC”, the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “CTG” into “AAA”, the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “GAA” into “CCG”. The mutated DNA molecule encodes the mutant M97T-L123K-E515P. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97T-L123K-E515P is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into T, and the 123-th site is mutated from L into K, and the 515-th site is mutated from E into P.
[0107] Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97K-L123H-E515P is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “ATG” into “AAA”, the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “CTG” into “CAT”, the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “GAA” into “CCG”. The mutated DNA molecule encodes the mutant M97T-L123H-E515P. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97K-L123H-E515P is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into T, and the 123-th site is mutated from L into H, and the 515-th site is mutated from E to P.
[0108] Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant Y224K-I474K-E515P is only that: the 670-672-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “TAT” into “AAA”, the 1420-1422-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “ATT” into “TTT”, the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “GAA” into “CCG”. The mutated DNA molecule encodes the mutant Y224K-I474K-E515P. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant Y224K-I474K-E515P is only that the amino acid residue in the 224-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from Y into K, and the 474-th site is mutated from I into K, and the 515-th site is mutated from E into P.
[0109] Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97K-L123H-E515P-G217E is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “ATG” into “AAA”, the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “CTG” into “CAT”, the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “GAA” into “CCG”, and the 649-651-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “GGC” to “GAA”. The mutated DNA molecule encodes the mutant M97K-L123H-E515P-G217E. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97K-L123H-E515P-G217E is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into K, the amino acid residue in the 123-th site is mutated from L into H, and the 515-th site is mutated from E into P, and the 217-th site is mutated from G into E.
[0110] Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97K-L123H-E515P-Y224K is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “ATG” into “AAA”, the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “CTG” into “CAT”, the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “GAA” into “CCG”, and the 670-672-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “TAT” into “AAA”. The mutated DNA molecule encodes the mutant M97K-L123H-E515P-G217E. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97K-L123H-E515P-G217E is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into K, the amino acid residue in the 123-th site is mutated from L into H, and the 515-th site is mutated from E into P, and the 224-th site is mutated from Y into K.
[0111] Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant Y224K-1474K is only that: the 670-672-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “TAT” into “AAA”, the 1420-1422-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from “ATT” into “TTT”. The mutated DNA molecule encodes the mutant Y224K-1474K. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant Y224K-I474K is only that the amino acid residue in the 224-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from Y into K, and the amino acid residue in the 474-th site is mutated from I into K.
[0112] II. Construction of Recombinant Bacteria for Expressing Phi29 DNA Polymerase Mutant
[0113] The recombinant vector INT and each recombinant vector for expressing the Phi29 DNA polymerase mutant constructed in step I are respectively introduced into Escherichia coli BL21 (DE3), to obtain recombinant bacteria for expressing the wild-type Phi29 DNA polymerase and each recombinant bacterium for expressing the Phi29 DNA polymerase mutant.
[0114] III. Induced Expression of Recombinant Bacteria
[0115] The recombinant bacteria for expressing the wild-type Phi29 DNA polymerase and each recombinant bacterium for expressing the Phi29 DNA polymerase mutant obtained in step II are taken, and sequentially induced and purified, to obtain the wild-type Phi29 DNA polymerase fused with an His.sub.6 tag at an N-terminal and each Phi29 DNA polymerase mutant fused with an His.sub.6 tag at an N-terminal.
[0116] The wild-type Phi29 DNA polymerase fused with the His.sub.6 tag at the N-terminal and each Phi29 DNA polymerase mutant fused with the His.sub.6 tag at the N-terminal are successively named as a wild-type Phi29 DNA polymerase with the His.sub.6 tag, a Phi29 DNA polymerase mutant M97H with the His.sub.6 tag, a Phi29 DNA polymerase mutant M97A with the His.sub.6 tag, a Phi29 DNA polymerase mutant M97K with the His.sub.6 tag, a Phi29 DNA polymerase mutant L123K with the His.sub.6 tag, a Phi29 DNA polymerase mutant L123F with the His.sub.6 tag, a Phi29 DNA polymerase mutant L123I with the His.sub.6 tag, a Phi29 DNA polymerase mutant L123H with the His.sub.6 tag, a Phi29 DNA polymerase mutant E515P with the His.sub.6 tag, a Phi29 DNA polymerase mutant E515G with the His.sub.6 tag, a Phi29 DNA polymerase mutant Y224K with the His.sub.6 tag, a Phi29 DNA polymerase mutant G217E with the His.sub.6 tag, a Phi29 DNA polymerase mutant 1474K with the His.sub.6 tag, a Phi29 DNA polymerase mutant M97K-L123H-E515P-Y224K-G217E with the His.sub.6 tag, a Phi29 DNA polymerase mutant M97T-L123K-E515P with the His.sub.6 tag, a Phi29 DNA polymerase mutant Y224K-1474K-E515P with the His.sub.6 tag, a Phi29 DNA polymerase mutant M97K-L123H-E515P-G217E with the His.sub.6 tag, a Phi29 DNA polymerase mutant M97K-L123H-E515P-Y224K with the His.sub.6 tag, a Phi29 DNA polymerase mutant Y224K-1474K with the His.sub.6 tag, and a Phi29 DNA polymerase mutant Y224K-G217E with the His.sub.6 tag.
[0117] 1. Specific steps of induction are as follows:
[0118] (1) Live bacteria
[0119] The recombinant bacteria are seeded into 3 ml of a liquid LB medium containing Kana resistance, and cultured overnight.
[0120] (2) Transfer
[0121] After the step (1) is completed, the above bacterial solution is transferred to 2 ml of the liquid LB medium containing the Kana resistance according to a 1/100 volume, and shake-cultured at 37° C. and 220 rpm until OD.sub.600nm=0.6 (in a practical application, OD.sub.600nm=0.4−0.8 is acceptable).
[0122] (3) Induction
[0123] After the step (2) is completed, IPTG with a final concentration of 0.5 mM is added to a system, and shake-cultured at 16° C. and 220 rpm for 12 h.
[0124] (4) Bacteria collection
[0125] After the step (3) is completed, it is centrifuged at 4° C. and 8000 rpm for 5 min, and bacteria are collected.
[0126] 2. An AKTA Pure purification system of GE Company is used for purification, and specific steps are as follows:
[0127] (1) The bacteria obtained in the step 1 are taken, shaken and uniformly mixed with resuspension buffer (20 mM Tris-HCI, 500 mM NaCI, 20 mM Imidazole, 5% Glycerol, and pH 7.9 @25° C.), it is ultrasonically crushed on ice, and then centrifuged at 4° C. and 12000 rpm for 30 min, and supernatant is collected.
[0128] (2) The supernatant obtained in the step (1) is taken, and a nickel column affinity chromatography (HisTrap FF 5 ml pre-packed column) is used for purification. Specific steps are as follows: firstly it is equilibrated with 10 column volumes of Buffer A; then a sample is loaded; then it is rinsed with 20 column volumes of the Buffer A; then it is eluted with 15 column volumes of eluent and post-column solution with a target protein is collected (the eluent is formed by Buffer A and Buffer B, and in an elution process, a volume fraction of the Buffer B is linearly increased from 0% to 100%, and correspondingly a volume fraction of the Buffer A is linearly decreased 100% to 0%).
[0129] Buffer A: 20 mM Tris-HCI, 500 mM NaCI, 20 mM Imidazole, 5% (vlv) Glycerol; pH 7.9@ 25° C.
[0130] Buffer B: 20 mM Tris-HCI, 500 mM NaCI, 500 mM Imidazole, 5% (vlv) Glycerol; pH7.9@ 25° C.
[0131] (3) The post-column solution obtained in the step (2) is taken, and a strong anion column chromatography (HiTrap Q HP 5 ml pre-packed column) is used for purification. Specific steps are as follows: firstly it is equilibrated with 10 column volumes of mixed buffer formed by Buffer A with a volume fraction of 59% and Buffer B with a volume fraction of 41%; then a sample is loaded; and after a protein peak appears, flow-through solution is collected (collection is performed after a UV detection value raises to 20 mAu, and the collection is stopped after the UV detection value drops to 50 mAu).
[0132] Buffer A: 20 mM Tris-HCI, 150 mM NaCI, 5% (v/v) Glycerol, pH7.5@ 25° C.
[0133] Buffer B: 20 mM Tris-HCI, 1 M NaCI, 5% (v/v) Glycerol, pH7.5@ 25° C.
[0134] (4) The flow-through solution obtained in the step (3) is taken, and a cation exchange chromatography (HiTrap SP HP pre-packed column) is used for purification, to obtain protein sample solution of which a purity is greater than 95%. Specific steps are as follows: firstly it is equilibrated with 10 column volumes of Buffer A; then a sample is loaded; then it is rinsed with 15 column volumes of the Buffer A; then it is eluted with 10 column volumes of eluent (the eluent is formed by Buffer A and Buffer B, and in an elution process, a volume fraction of the Buffer B is linearly increased from 0% to 50%, and correspondingly a volume fraction of the Buffer A is linearly decreased 100% to 50%) and post-column solution with a target protein is collected (collection is performed after a UV detection value raises to 50 mAu, and the collection is stopped after the UV detection value drops to 100 mAu).
[0135] Buffer A: 20 mM Tris-HCI, 150 mM NaCI, 5% (v/v) Glycerol, pH7.5@ 25° C.
[0136] Buffer B: 20 mM Tris-HCI, 1 M NaCI, 5% (vlv) Glycerol, pH7.5@ 25° C.
[0137] (5) The target protein collected in the step (4) is taken and transferred to a dialysis bag, after dialysis in dialysis buffer overnight, protein solution in the dialysis bag is collected, and other reagents are added, to obtain target protein solution with a protein concentration of 1 mg/ml. The concentrations of other components in the target protein solution are as follows: 10 mM Tris-HCI (pH7.4@ 25° C.), 100 mM KCI, 1 mM DTT, 0.1 mM EDTA, 0.5%(v/v)NP-40, 0.5% (v/v) Tween20, 50% (vlv) Glycerol.
[0138] Dialysis buffer: 23.75 mM Tris-HCI (pH7.4@ 25° C.), 237.5 mM KCI, 2.375 mM DTT, 0.2375 mM EDTA, 5% (v/v) Glycerol.
Embodiment 2: Polymerization Activity Test of Wild-Type Phi29 DNA Polymerase and Mutant
[0139] The wild-type Phi29 DNA polymerase solution with the His.sub.6 tag and the Phi29 DNA polymerase mutant solution with the His.sub.6 tag prepared in Embodiment 1 are taken as enzyme solution to be tested.
[0140] 1. Each enzyme solution to be tested is diluted to 5000 times in a gradient by using storage buffer, adequately and uniformly mixed in a vortex shaker, and it is standing on ice for 5 min, to obtain each solution to be tested.
[0141] A pre-reaction system is uniformly mixed in a PCR tube, and placed in a PCR instrument, the following procedures are performed: 95° C. 1 min, 65° C. 1 min, 40° C. 1 min, and a hot lid temperature is set to 102° C.
[0142] Pre-reaction system (80.8 μl): 50 mM Tris-HCI (pH7.5), 4 mM DTT, 10 mM (NH.sub.4).sub.2SO.sub.4, 10 mM MgCl.sub.2, 50 nM dNTP Mixture, 2 pM 141 RCA Primer and 18 ng single-stranded circular DNA template 141 Ad ssDNA.
[0143] 2. After the step 1 is completed, the PCR tube is taken out and placed on ice while the temperature reaches 4° C. 1 μl of each solution to be tested is respectively added in a test group, and 1 μl of the storage buffer is added in a negative control group. Then, the vortex shaker is used to shake and mix uniformly, it is placed in the PCR instrument after being transitorily centrifuged for 5 s in a centrifuge, and the following procedures are performed: 30° C. 60 min, and a hot lid temperature is set to 65° C.
[0144] 3. After the step 2 is completed, 5 μL of 0.5 M EDTA solution is added to stop a reaction, and it is shaken and mixed uniformly.
[0145] 4. A Qubit ssDNAAssay Kit (Q10212, INVITROGEN) is used and operated according to instructions. A Qubit fluorometer 3.0 is used to detect a concentration of DNB (DNA Nano ball) in a reaction product.
[0146] Enzyme activity of enzyme solution to be tested=ΔDNB×5000÷37.Math.38.
[0147] Note: ΔDNB is a difference value between concentration average values of the reaction products in the systems after the reactions of the test group and the negative control group are terminated, 5000 is a dilution factor, and 37.38 is a slope of a functional relationship between the enzyme activity and the ΔDNB.
[0148] Enzyme activity results of some enzyme solution to be tested are shown in Table 3.
TABLE-US-00003 TABLE 3 Control Experimental Enzyme activity group group of prepared average average ΔDNB enzyme solution Polymerase value value (ng/μl) (U/μl) WT 0.46 0.96 0.51 67.6 E515P 0.37 0.73 0.37 49.3 L123K 0.4 0.77 0.37 50.1 M97A 0.4 0.75 0.36 48 G217E 0.42 0.97 0.55 73.8 Y224K 0.38 0.8 0.42 56.1 1474K 0.48 1.06 0.57 15.4
Embodiment 3: Thermal Stability Test of Wild-Type Phi29 DNA Polymerase and Mutant
[0149] 37° C. 10 min experiment:
[0150] The target protein solution (the wild-type Phi29 DNA polymerase solution with the His.sub.6 tag and the Phi29 DNA polymerase mutant solution with the His.sub.6 tag) prepared in Embodiment 1 is taken, and divided into two parts, and they are respectively treated as follows:
[0151] First part: it is placed in a metal bath preheated to 37° C. for 10 min, and centrifuged at 4° C. and 13000 rpm for 1 min, and supernatant is collected; and then, the supernatant is taken, and diluted to 1000 times of a volume with the storage buffer, and the vortex shaker is used to adequately mix uniformly, and then it is standing on ice for 5 min, to obtain solution 1 to be tested.
[0152] Second part: it is diluted to 5000 times of a volume with the storage buffer, and adequately mixed uniformly with the vortex shaker, and then it is standing on ice for 5 min, to obtain solution 2 to be tested.
[0153] It is performed according to the steps 1 to 4 of Embodiment 2.
[0154] Unheated enzyme activity (U1)=ΔDNB×5000÷37.Math.38; ΔDNB is a difference value between concentration average values of reaction products in the systems after the reactions of the test group (second part) and the negative control group are terminated;
[0155] Heated enzyme activity (U2)=ΔDNB×1000÷37.Math.38; ΔDNB is a difference value between concentration average values of reaction products in the systems after the reactions of the test group (first part) and the negative control group are terminated;
[0156] 5000 and 1000 are dilution factors respectively, and 37.38 is a slope of a functional relationship between the enzyme activity and the ΔDNB;
[0157] an enzyme activity loss ratio is calculated according to the activities of the unheated and heated enzyme solution,
[0158] Enzyme activity loss ratio (%)=(U1-U2)÷U1×100%;
[0159] U1 is the activity of the unheated enzyme solution, and U2 is the activity of the heated enzyme solution.
[0160] −20° C. experiment: a difference from the 37° C. 10 min experiment is only that the 10 min in the 37° C. metal bath is replaced with the 10 min in a refrigerator at −20° C.
[0161] The specific enzyme activity and the enzyme activity loss ratio of each mutant are shown in Table 4. Compared with the wild type (WT), the enzyme activity loss ratios of the mutants in examples are all improved to a certain extent; and a numeral value of the enzyme activity loss ratio is larger, the enzyme is more unstable, and the thermal stability is worse.
TABLE-US-00004 TABLE 4 Note Diluted Original Original enzyme enzyme Specific enzyme Heat Average solution solution enzyme Enzyme Enzyme solution treatment value ΔDNB activity activity activity activity concentration dilution Mutation site condition (ng/μl) (ng/μl) (U) (U/μl) (U/ug) loss ratio (mg/ml) factor Phi29-WT −20° C. 1.12 0.74 0.02 59.2 74 98.60% 0.8 3000 (Wild type) 37° C. 10 min 0.68 0.3 0.008 0.8 100 NC 0.38 Phi29-Enzymatics (Commercial enzyme of Enzymatics Company) −20° C. 1.04 0.57 0.015 76.7 63.9 85.40% 1.2 5000 37° C. 10 min 0.55 0.08 0.002 11.2 5000 NC 0.46 Phi29-337 −20° C. 1.87 1.41 0.038 18.8 104.6 7.80% 0.18 500 (M97K-L123H- 37° C. E515P-Y224K- 15 min 1.76 1.3 0.035 17.4 500 G217E) NC 0.46 Phi29-414 −20° C. 1.13 0.734 0.020 19.6 67.7 12.26% 0.29 1000 (M97T-L123K- 37° C. E515P) 10 min 1.04 0.644 0.017 17.2 1000 NC 0.396 Phi29-456 −20° C. 1.14 0.697 0.018 36.9 60.2 35.19% 0.613 2000 (M97K-L123H- 37° C. E515P) 10 min 2.25 1.807 0.048 23.9 500 NC 0.443 Phi29-464 −20° C. 2.05 1.633 0.027 53.72 57.15 63.67% 0.94 2000 (Y224K-I474K- 37° C. E515P) 10 min 2.79 2.373 0.039 19.51 500 NC 0.417 Phi29-36 −20° C. 1.46 1.04 0.017 51.5 51.5 70.20% 1 3000 (E515P) 37° C. 10 min 1.35 0.93 0.015 15.3 1000 NC 0.42 Phi29-458 −20° C. 0.936 0.583 0.016 31.2 31.2 70.97% 1 2000 (M97K-L123H- 37° C. E515P-G217E) 10 min 1.03 0.677 0.018 9.1 500 NC 0.353 Phi29-459 −20° C. 0.825 0.472 0.013 25.3 25.3 72.35% 1 2000 (M97K-L123H- 37° C. E515P-Y224K) 10 min 0.875 0.522 0.014 7.0 500 NC 0.353 Phi29-463 −20° C. 1.81 1.347 0.04 36.04 72.07 80.91% 0.5 1000 (Y224K-I474K) 37° C. 10 min 1.32 0.857 0.02 6.88 300 NC 0.463 Phi29-103 −20° C. 0.97 0.55 0.015 73.8 70.3 85.20% 1.05 5000 (G217E) 37° C. 10 min 0.5 0.08 0.002 10.9 5000 NC 0.42 Phi29-335 −20° C. 1.94 1.51 0.041 81 85.3 86.70% 0.95 2000 (Y224K-G217E) 37° C. 10 min 1.23 0.8 0.022 10.8 500 NC 0.43 Phi29-192 −20° C. 1.43 1.05 0.028 56.1 56.1 87.30% 1 2000 (Y224K) 37° C. 10 min 1.71 1.33 0.036 7.1 200 NC 0.38 Phi29-85 −20° C. 0.682 0.2205 0.027 29.5 36.9 88.66% 0.8 5000 (I474K) 37° C. 0.586 10 min 5 0.125 0.039 3.3 1000 NC 0.4615
[0162] In the above table, NC is a background value, and a blank is because there is no data calculation processing.
Embodiment 4: Genomic Amplification Coverage Detection
[0163] In order to detect a coverage to which a sample is extended before on-machine sequencing, a multiple PCR mode is used to amplify a multiple housekeeping gene in an MDA product.
[0164] A specific operating process is as follows: a NA12878 reference genome sample (Coriell Institute) is added to 200 μl of a PCR tube, a total volume is 4 μl, and if it is not enough, PBS is added to supplement to 4 μl. 3 μl of Buffer D2 (QIAGEN REPLI-g Single Cell Kit) is added to the PCR tube, a pipette tip should be attached to a tube wall, and is not inserted under a liquid surface, and centrifuging is performed without shaking. After being centrifuged, it is put on a PCR instrument at 65° C. for 10 min. After it is finished, it is placed on ice, 3 μl of neutralization buffer (QIAGEN REPLI-g Single Cell Kit) is added to the PCR tube, the pipette tip should be attached to the tube wall, and is not inserted under the liquid surface, the centrifuging is performed without shaking. 39 μl of MDA reaction buffer (10× phi29 Reaction Buffer 5 μl, 25 mM dNTP 2μl 1, mM N8Primer 2μl, 100× BSA 0.5 μl, 10% F68 0.05 μl, and H.sub.2O 29.75 μl) is added to the PCR tube, 1 μl of phi29-337, phi29-456, phi29-458, phi29-36, phi29-335, phi29-414, and phi29-464 prepared in Embodiment 1 and 1 μl of the Phi29 DNA polymerase carried by the QIAGEN REPLI-g Single Cell Kit are respectively added. The pipette tip should be attached to the tube wall, and is not inserted below the liquid surface, the centrifuging is performed without shaking. After being centrifuged, it is put on the PCR instrument at 30° C. for 8 h and 65° C. for 3 min. After a reaction is finished, the shaking and centrifuging are performed, and a concentration is measured with Qubit BR. After the concentration is measured, a multiple housekeeping gene PCR detection is performed. 50-200 ng of a DNA is taken, a negative control (N) and a positive control (P) should be set, the negative is water, the positive is a NA12878 reference genome without amplification, and an experimental group is set with 3 different samples. Multiple PCR primers and procedures are shown in Table 5 below:
TABLE-US-00005 TABLE 5 Multiple PCR primer and PCR reaction system Primer name Primer sequence 18-F GGCATCGCTTAGACTCTATGTG (SEQ ID NO: 26) 18-R CTGCCCTTGGCCTAACTAACCT (SEQ ID NO: 27) 12-F GTTCCTCAAGTAGCTCCACGAG (SEQ ID NO: 28) 12-R CGTTAGACTCTGGATCTGGCGT (SEQ ID NO: 29) 16-F CCAGCCAGTTCATGCGTCGGTG (SEQ ID NO: 30) 16-R CCTGACAACTCGCAAGTAGCAC (SEQ ID NO: 31) 17-F GCTCAATGGGGTACTTCAGGT (SEQ ID NO: 32) 17-R GTGGACTTACGTAAAAGGCCC (SEQ ID NO: 33) 19-F TGCTCTGTATGTGAAGATGCCA (SEQ ID NO: 34) 19R TTCCAGGTAAATCCAGCCCAGG (SEQ ID NO: 35) 3-F CAGCCAGTCGGCATCATCCAAC (SEQ ID NO: 36) 3-R GAAAGCCGGATTGCGGTAACAT (SEQ ID NO: 37) 8-F GGATAGCTCTGCCAGGGGAGAG (SEQ ID NO: 38) 8-R TCGTCGCAGTAGAAATACGGCT (SEQ ID NO: 39) 22-F AGATGTCAGGCACGTAGCTCAG (SEQ ID NO: 40) 22-R GGCACGTTGGCGTTTACGATGA (SEQ ID NO: 41) Reaction component Volume 10x PCR Buffer 3 μl dNTP (2.5 mM) 3.2 μl Primer Mix 3 μl DNA (50 ng/μl) 1 μl 100x BSA (NEB) 0.2 μl rTaq (5 U/μl) 0.4 μl ddH20 19.2 μl Total 30 μl
[0165] PCR procedure: 95° C. 5 min, 35 cycles ×[94° C. 30 s, 60° C. 50 s, 72° C. 1 min], 72° C. 5 min, 12° C. holder.
[0166] Results are shown in
Embodiment 5: Application effect of Wild-Type Phi29 DNA Polymerase and Phi29 DNA Polymerase Mutant in Single-Cell Whole Genome Sequencing
[0167] In order to test effects of a wild-type Phi29 DNA polymerase and a mutant in single-cell genome sequencing, library construction is performed respectively on products of a NA12878 trace gDNA (200pg) amplified by the wild-type Phi29 DNA polymerase and the Phi29 DNA polymerase mutant prepared in Embodiment 1, after that, high-depth sequencing is performed; at the same time, the same NA12878 trace gDNA (200 pg) amplified by a commercial Qiagen single-cell amplification kit is used for control.
[0168] Analysis and mutation detection analysis are performed on sequencing data, a NA12878 standard mutation data set is used to evaluate, and a difference between each mutant and the Qiagen kit is compared. Specific data analysis results are shown in Table 6 and Table 7.
[0169] It may be seen that the representation of the mutants Phi29-337, Phi29-456, Phi29-335, and Phi29-414 are comparable to that of the wild-type WT and the QIAGEN kit in mapping rate and coverage, but the representation of the wild-type WT is the worst in terms of duplication rate parameters, the mutants listed in the table are all slightly better than the wild type, herein the representation of the 337 mutant is best, and is comparable to the QIAGEN (REPLI-g Single Cell Kit) kit. At the same time, in aspects of mutation detection evaluation parameters snp_Precision, snp_Sensitivity, and snp_-measure, the representation of the 337 mutant is best, and slightly better than the QIAGEN kit, the wild-type WT and the 456, 335, 414 mutants are worse than the QIAGEN kit; and in aspects of parameters indel_Precision, indel_Sensitivity and indel_F-measure, the representation of the 337 mutant is also the best, and data is better than the QIAGEN kit.
TABLE-US-00006 TABLE 6 Sequencing data analysis of wild-type Phi29 and mutant in single-cell sequencing Mutant number QIAGEN Phi29-WT Phi29-36 Phi29-335 Phi29-337 ReadLength 100 100 100 100 100 Read_raw 1.12E+09 7.96E+08 1.07E+09 1.01 E+09 1.08E+09 Q30_clean 88.67% 87.09% 86% 87.67% 87.07% Depth_clean 28.48 19.96 28.95 25.56 28.47 Mapping rate 99.93% 99.85% 99.95% 99.91% 99.93% Duplicate rate 3.71% 5.07% 4.56% 4.85% 3.87% Coverage 98.01% 97.20% 94.52% 97.16% 98.33% Genome depth CV 1.01 2.21 1.36 1.7 1 GC depth CV 0.35 0.34 0.35 0.33 0.36 snp_Precision 0.9222 0.8993 0.9004 0.8747 0.9383 snp_Sensitivity 0.92 0.8621 0.8199 0.8466 0.9349 snp_F-measure 0.9211 0.8803 0.8582 0.8604 0.9366 indel_Precision 0.3466 0.1229 0.072 0.1405 0.7437 indel_Sensitivity 0.7249 0.5759 0.5076 0.5925 0.7819 indel_F-measure 0.469 0.2025 0.126 0.2271 0.7623
TABLE-US-00007 TABLE 7 Sequencing data analysis of wild-type Phi29 and mutant in single-cell sequencing Mutant number Phi29-414 Phi29-456 Phi29-458 ReadLength 100 100 100 Read_raw 1.14E+09 1.28E+09 1.25E+09 Q30_clean 87.90% 88.54% 88.02% Depth_clean 28.98 32.99 32.74 Mapping rate 99.91% 99.91% 99.96% Duplicate rate 4.67% 4.51% 4.31% Coverage 97.03% 97.60% 95.79% Genome depth CV 1.09 1.01 1.06 GC depth CV 0.35 0.35 0.36 snp_Precision 0.9183 0.9379 0.9335 snp_Sensitivity 0.8898 0.9165 0.8707 snp_F-measure 0.9038 0.9271 0.901 indel_Precision 0.1318 0.1327 0.075 indel_Sensitivity 0.6275 0.6667 0.5502 indel_F-measure 0.2179 0.2214 0.132 (Note: QIAGEN is a control of a commercial REPLI-g Single Cell Kit)
Embodiment 6: Detection of RCA Library Construction On-Machine Testing Effect
[0170] Synthesized with the thermal stability results in Table 4, the embodiment selects several mutants with improved thermal stability, and performs an on-machine test in a BGISEQ-500 sequencer, application effects of the different mutants in DNA sequencing are detected with reference to a standard of the BGISEQ-500 sequencer. Reagents used in the whole test are a complete set of a PE50V2.0 kit produced by the BGI, an E. coil Ad153 standard library produced by the BGI and a Qubit ssDNA Assay reagent produced by Invitrogen. The reagents used below are all included in the PE50V2.0 kit except the library and QubitssDNA Assay, and a PE50V2.0 reagent tank written below only refers to reagents used in the on-machine test.
[0171] 1. DNB Preparation
[0172] DNB preparation buffer, a standard library, DNB polymerase mixed solution and DNB polymerase mixed solution II are taken out from a refrigerator at −20° C. and melted on an ice box, after being completely dissolved, they are placed on a vortex shaker, shaken and continuously mixed uniformly for 5 s, and transiently centrifuged in a handheld centrifuge for 3 s, then it is placed on the ice box for later use. Molecular-grade water and DNB stop buffer are taken out from a refrigerator at 4° C., and placed on the ice box for later use. In a labeled eight-connected tube, 20 μl of the DNB preparation buffer and 6 ng of the ssDNA (E. coli standard substance library) are successively added, and supplemented to 40 μl with Nuclease Free Water. The eight-connected tube is placed in the vortex shaker and continuously mixed uniformly for 5 s, and transiently centrifuged for 3 s in the handheld centrifuge. The above eight-connected tube is placed in the PCR instrument, and reaction conditions are set or checked: 95° C. 1 min, 65° C. 1 min, 40° C. 1 min, and 4° C. for maintaining (a hot lid temperature is set to 103° C.). After a reaction is completed, the PCR eight-connected tube is taken, and placed on the ice box. After a lid temperature of the eight-connected tube drops to a room temperature, it is placed in the handheld centrifuge and transiently centrifuged for 3 s, and immediately placed on the ice box. Each of the following components is successively added into the eight-connected tube: 40 μl of reaction solution in the eight-connected tube after denaturation, 40 μl of the DNB polymerase mixed solution, and 4 pl of the DNB polymerase mixed solution II. The eight-connected tube is placed in the vortex shaker and continuously mixed uniformly for 5 s, and transiently centrifuged for 3 s in the handheld centrifuge. It is immediately placed in the PCR instrument or a water bath kettle to start a reaction. Reaction conditions are set or checked: 30° C. 20min, and 4° C. for maintaining (a hot lid does not need to be installed). While the above RCA reaction is completed, the eight-connected tube is taken and placed on the ice box, and 20 pl of the DNB stop buffer is immediately added. A pipette with a 100 μl wide-mouth pipette tip is used to slowly blow and mix uniformly for 5-8 times (one-suction and one-blow are counted as 1 time). After being mixed uniformly, it is stored at 4° C. for later use. A Qubit ssDNA Assay Kit and a Qubit Fluorometer instrument are used to measure a concentration of the above DNB preparation product. While the concentration is 8ng/μl-40ng/μl, it is judged to be qualified, and it is reserved for a subsequent experiment.
[0173] 2. DNB Loading
[0174] After the DNB is prepared, the DNB needs to be loaded on a chip, namely DNB loading.
[0175] A sample loading reagent plate V2.1 is taken and placed at a room temperature for melting, shaken and mixed uniformly. After being transiently centrifuged, it is placed on the ice box for later use. DNB loading buffer II is taken, and shaken uniformly. After being transiently centrifuged, it is placed on the ice box for later use. Firstly, the chip and the sample loading reagent plate V2.1 are placed on BGIDL-50. Secondly, 35 pl of the DNB loading buffer II is taken and added to a PCR tube containing 100 μl of the DNB, and a wide-mouth sucker is used to gently mix uniformly for 15 times. Then, the above mixed solution is placed in a designated DNB placement area of a loading system, a DNB loading program (Sample load 2.0) is selected, and loading is started. Finally, after the loading is completed, it is incubated at the room temperature for 30 min, and then stored at 2-8° C. for later use.
[0176] 3. On-Machine Test
[0177] For the wild-type phi29 polymerase or mutant to be tested, an on-machine sequencing test is performed on the BGISEQ-500 sequencer, one chip and one BGISEQ-500RS high-throughput sequencing reagent tank (PE50V2.0) are used. Before the on-machine test, a sequencing reagent tank II, dNTPs mixed solution (V3.0) and dNTPs mixed solution II (V2.0) are firstly thawed and melted, and placed in a refrigerator or ice box at 4° C. for later use; a sequencing enzyme is shaken and mixed uniformly, and placed on the ice box for later use. Firstly, a No. 5 well reagent is prepared, namely 1 ml of a pipette is used to pipette 1150 pl of the DNA polymerase mixed solution for adding to a No. 5 well and pipette 1150 μl of the dNTPs mixed solution (V3.0) for adding to the No. 5 well, and the pipette is used to blow and mix uniformly for 10-15 times. Secondly, a No. 6 well reagent is prepared, namely 1 ml of the pipette is used to pipette 890 μl of the DNA polymerase mixed solution for adding to a No. 6 well and pipette 890 μl of the dNTPs mixed solution II (V2.0) for adding to the No. 6 well, and the pipette is used to blow and mix uniformly for 10-15 times. Then, a No. 14 well reagent is prepared, namely 5 ml of a pipette is used to pipette all No. 14 well reagents, 2.8 ml of the No. 14 well reagent is taken and mixed uniformly with 400 μl of the phi29 polymerase mutant, and added to a No. 14 well. The prepared reagent tanks are assembled. Finally, the on-machine test is performed, namely the sequencer is started and washing is performed, the reagent tank is put into a designated position of the sequencer, and actual preloading is performed in an operating order. After the preloading is finished, the chip prepared in the above step (2) is installed, and related sequencing information is written, namely the sequencing is started. After the end, the chip, the reagent tanks and a washing instrument are taken out. One cycle is tested in the embodiment.
[0178] 4. Data Analysis
[0179] After the sequencing is finished, an analysis report is downloaded, a previously specified standard is compared, and the performance of the phi29 DNA polymerase mutant is judged.
[0180] Each of comparison parameters is explained as follows: Effective Spots Rates (ESR), and basecall information content (Bic) may be used as a DNB ratio of basecalling; fit (crosstalk fit score) reflects a crosstalk situation, after correction, the intensity distribution of each base is more concentrated, a fit value thereof is higher; a Signal to Noise Ratio (SNR) takes the calculation of a single DNB SNR as an example, base A (max intensity) is served as a signal, CGT is a background, and a variance of the CGT intensity is a noise; Rho Intensity (RHO) is an intensity value of corrected intensity removing normalization, and it is intuitively interpreted as an intensity value of the original intensity of dye after correction.
[0181] Results are shown in
INDUSTRIAL APPLICATION
[0182] On the basis of the disclosure, the mutants with the good effects may be further screened through performing saturation mutations on the amino acids in the mutation sites of the disclosure; or on the basis of the mutants of the disclosure, and other amino acids except the amino acid sites contained in the disclosure are mutated, to obtain a similar effect. The disclosure may also be applied in the technical fields including food detection, virus detection, RNA detection, single-cell sequencing and the like, and it may also be used to develop third and fourth generation sequencer technologies.