RECOMBINANT RSV LIVE VACCINE STRAIN AND PRODUCTION METHOD THEREFOR

Abstract

The present invention provides a gene recombinant respiratory syncytial virus (RSV) in which genes encoding the envelope proteins of an RSV are rearranged, wherein in the RSV, a gene encoding the fusion protein (F protein) derived from a heterologous virus belonging to the family Paramyxoviridae or the family Pneumoviridae is inserted between the genes respectively encoding the glycoprotein (G protein) and the F protein of the RSV, or the gene encoding the F protein of the RSV is substituted with a gene encoding the F protein of a heterologous virus belonging to the family Paramyxoviridae or the family Pneumoviridae. The recombinant RSV of the present invention can be used as an RSV vaccine strain, and can be used as a vaccine due to having excellent stability and safety.

Claims

1. A recombinant respiratory syncytial virus (RSV) in which genes encoding the envelope proteins of RSV are rearranged, wherein a gene encoding the F protein derived from a heterologous virus belonging to the family Paramyxoviridae or the family Pneumoviridae is inserted between the genes encoding the glycoprotein (G protein) and the fusion protein (F protein) of RSV, or a gene encoding the F protein of RSV is substituted with a gene encoding the F protein derived from a heterologous virus belonging to the family Paramyxoviridae or the family Pneumoviridae.

2. The recombinant respiratory syncytial virus (RSV) according to claim 1, wherein the heterologous virus belonging to the family Paramyxoviridae or the family Pneumoviridae is one or more virus selected from a group consisting of the genera Aquaparamyxovirus, Avulavirus, Ferlavirus, Henipavirus, Morbillivirus, Respirovirus, Rubulavirus, Metapneumovirus and Orthopneumovirus.

3. The recombinant respiratory syncytial virus (RSV) according to claim 1, wherein the heterologous virus is one or more virus selected from a group consisting of measles virus and Newcastle disease virus.

4. The recombinant respiratory syncytial virus (RSV) according to claim 1, wherein the recombinant respiratory syncytial virus (RSV) is one in which the genes encoding the envelope proteins of the wild-type human RSV A virus strain of SEQ ID NO 1 are rearranged.

5. A method for producing an attenuated recombinant RSV by expressing a first expression vector comprising a polynucleotide encoding a recombinant RSV antigenome and a second expression vector comprising a polynucleotide encoding one or more protein selected from a group consisting of N, P, L and M2-1 proteins, wherein the polynucleotide encoding a recombinant RSV antigenome comprises a polynucleotide encoding a domain of a protein derived from a heterogeneous virus wholly or partially.

6. The method according to claim 5, wherein the polynucleotide encoding a recombinant RSV antigenome comprised in the first expression vector is any one selected from SEQ ID NOS 4-7.

7. The method according to claim 6, wherein the polynucleotide selected from SEQ ID NOS 4-7 is a cDNA.

8. The method according to claim 5, wherein the first expression vector comprises the polynucleotide encoding a recombinant RSV antigenome in a pCC1 plasmid.

9. The method according to claim 5, wherein the protein derived from a heterogeneous virus of the polynucleotide encoding a recombinant RSV antigenome is an F protein.

10. A recombinant RSV expression vector, comprising the genes encoding the glycoprotein (G protein) and the fusion protein (F protein) of RSV, wherein a gene encoding the F protein derived from a heterologous virus belonging to the family Paramyxoviridae or the family Pneumoviridae is inserted between the genes encoding the G protein and the F protein, or comprising a recombinant RSV gene in which a gene encoding the F protein derived from a heterologous virus belonging to the family Paramyxoviridae or the family Pneumoviridae is substituted instead of a gene encoding the fusion protein (F protein) of RSV.

11. The recombinant RSV expression vector according to claim 10, wherein the recombinant RSV gene is any one selected from SEQ ID NOS 4-7.

12. The recombinant RSV expression vector according to claim 10, wherein the recombinant RSV expression vector comprises a T7 promoter, a hammerhead ribozyme, a recombinant RSV gene, a hepatitis delta virus ribozyme and a T7 terminator in sequence.

13. The recombinant RSV expression vector according to claim 10, wherein the heterologous virus belonging to the family Paramyxoviridae or the family Pneumoviridae is one or more selected from a group consisting of measles virus and Newcastle disease virus.

14. An attenuated RSV live vaccine composition, comprising: the recombinant respiratory syncytial virus (RSV) according to claim 1; and a pharmaceutically acceptable carrier.

15. A bivalent vaccine composition for preventing infection of respiratory syncytial virus (RSV); and one of measles virus (MV) and Newcastle disease virus (NDV) comprising: the recombinant respiratory syncytial virus (RSV) according to claim 1; and a pharmaceutically acceptable carrier.

16. (canceled)

Description

DESCRIPTION OF DRAWINGS

[0059] FIG. 1 is a schematic diagram of the RSV genome.

[0060] FIG. 2 schematically shows the cleavage of the F protein region of the RSV genome (arrows indicate the cleavage sites) and the substitution with an F protein of a heterogeneous virus (e.g., NDV).

[0061] FIG. 3 schematically shows the addition of an F protein of a heterogeneous virus (e.g., MV) between the G protein and the F protein of the RSV genome.

[0062] FIG. 4 shows the cleavage of the MluI and ApaI sites from the backbone of SEQ ID NO 3 and insertion of an F protein derived from a foreign virus. In the final construct {circle around (3)}, G GE indicates the gene end region of the G protein, F GS indicates the gene starting region of the F protein, and F GE indicates the gene end region of the F protein. The F protein of MV or NDV is inserted, but the T and C domains of the F protein are those of RSV.

[0063] FIG. 5 shows the cleavage of the MluI and MluI sites from the backbone of SEQ ID NO 3 and insertion of an F protein derived from a foreign virus. The MluI and MluI cleavage sites are located between the G protein and the F protein of RSV. In the final construct {circle around (3)}, G GE indicates the gene end region of the G protein, F GS indicates the gene starting region of the F protein, and F GE indicates the gene end region of the F protein. The F protein of MV or NDVF is inserted, but the T and C domains of the F protein are those of RSV.

[0064] FIG. 6 schematically shows the cloning of the cDNA of the recombinant RSV of the present disclosure virus into a vector.

[0065] FIG. 7 shows the attenuation of recombinant RSV strains for different cells (HEp2 cells, Vero cells and MRCS cells) through comparison of proliferation rate and proliferation titer. The proliferation rate and titer were decreased for the vaccine strains as compared to the wild-type RSV.

[0066] FIG. 8 shows the attenuation of recombinant RSV strains in mouse through comparison of proliferation rate and proliferation titer. The proliferation rate and titer were decreased for the vaccine strains as compared to the wild-type RSV.

[0067] FIG. 9 shows the stability of recombinant RSV strains depending on temperature. The recombinant RSV strains showed improved thermal stability as compared to the wild-type RSV at all the temperatures of 4° C., 37° C. and 60° C.

[0068] FIG. 10 shows a result of investigating total antibody titer and neutralizing antibody titer in a mouse immunity test of recombinant RSV. Sufficient antigen specificity and neutralizing antibodies were induced in all groups except Mock. However, the formalin-inactivated wild-type virus G7 showed relatively very low total antibody titer and neutralizing antibody titer. The RSV backbone was denoted as wtRSVA_TH10654, RSV backbone-MV F substitution as cRSVA_MVF_S, RSV backbone-NDV F substitution as cRSVA_NDVF_S, RSV backbone-MV F insertion as cRSVA_MVF_A, and RSV backbone-NDV F insertion as cRSVA_NDVF_A.

[0069] In FIG. 10, Mock was denoted as G1, WtRSVA as G2, cRSVA_MVF_S as G3, cRSVA_NDVF_S as G4, cRSVA_MVF_A as G5, cRSVA_NDVF_A as G6, and FIwtRSVA as G7.

[0070] FIG. 11 shows a result of measuring defensive power after immunization with recombinant RSV by challenging with wild-type RSV. Sufficient protective immunity was induced in all groups except Mock. However, the formalin-inactivated wild-type virus G7 exhibited slightly insufficient protective immunity.

[0071] FIG. 12 shows a test result of immunogenicity and neutralizing antibody titer for NDV.

[0072] FIG. 13 shows a test result of immunogenicity and neutralizing antibody titer for MV immunogenic.

[0073] In FIGS. 12 and 13, Mock was denoted as G1, WtRSVA as G2, cRSVA_MVF_S as G3, cRSVA_NDVF_S as G4, cRSVA_MVF_A as G5, cRSVA_NDVF_A as G6, and FIwtRSVA as G7.

MODE FOR DISCLOSURE

[0074] Hereinafter, the present disclosure is described in detail through examples, etc. to help understanding. However, the examples according to the present disclosure may be changed into various other forms and it should not be interpreted that the scope of the present disclosure is limited by the following examples. The examples of the present disclosure are provided such that the present disclosure is more completely described to those having average knowledge in the art.

[0075] 1. Preparation of Wild-Type RSV a Virus Strain

[0076] A wild-type RSV A virus strain having the following information was prepared described below. [0077] Definition: human respiratory syncytial virus strain RSVA/TH_10654/complete genome [0078] Accession No.: KU950464.1 [0079] Length: 15232 bp [0080] Host: Homo sapiens/female/12 weeks [0081] Collection date: 19 Feb. 2014 [0082] Country: USA [0083] Subtype: RSV A

[0084] The strain is represented by SEQ ID NO 1.

[0085] 2. Preparation of F Protein Donor Virus

[0086] Measles virus (MV) and Newcastle disease virus (NDV) were selected as F protein donors.

[0087] 3. Preparation of cDNA Encoding RSV Antigenome

[0088] A polynucleotide encoding the F protein of the RSV antigenome was constructed by inserting or substituting a polynucleotide encoding an F protein derived from a heterologous virus to backbone construct A described below.

[0089] (1) Designing of backbone construct A (SEQ ID NO 3)

[0090] The gene sequence was T7 promoter—hammerhead ribozyme—RSV antigenome—hepatitis delta virus ribozyme—T7 terminator.

[0091] A T7 promoter sequence (TAATACGACTCACTATAGG) was inserted to the 5′-end. After the T7 promoter sequence, a hammerhead ribozyme sequence (T TTTTTCGCGT CTGATGAGGC CGTTAGGCCG AAACTCCTCT CCGGAGTC) was inserted. After the hammerhead ribozyme sequence, a wild-type RSV antigenome sequence was inserted and the following mutation was induced.

[0092] An AscI restriction enzyme sequence was produced by inserting GCGCGCC between 77 nt and 78 nt on the basis of the antigenome sequence of wild-type RSV (Although the AscI restriction enzyme sequence was GGCGCGCC <8 bp>, only GCGCGCC <7 bp> was inserted beceause the 77 nt sequence was G.)

[0093] 1) CCTGCAGG (SbfI restriction enzyme sequence) was inserted between 1079 nt and 1080 nt.

[0094] 2) GGCCGGCC (FseI restriction enzyme sequence) was inserted between 4600 nt and 4601 nt.

[0095] 3) The base ATG(M) at 4800 nt and 4802 nt was substituted with ATT(I).

[0096] 4) ACGCGT (MluI restriction enzyme sequence) was inserted between 5639 nt and 5640 nt.

[0097] 5) GGGCCC (ApaI restriction enzyme sequence) was inserted between 7595 nt and 7596 nt.

[0098] 6) After the wild-type RSV antigenome sequence, a hepatitis delta virus ribozyme sequence (GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGC ATGGCGAATGGGAC) was inserted.

[0099] 7) After the hepatitis delta virus ribozyme sequence, a T7 terminator sequence (TAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG) was inserted.

[0100] 8) The ACGCGAAAAAATGCGTACAAC sequence was inserted at the 5′-end, and the GTTTTTGACACTTTTTTTCTCGT sequence was inserted at the 3′-end. The ACGCGAAAAAATGCGTACAAC inserted at the 5′-end was denoted as a 3′ leader, and the GTTTTTGACACTTTTTTTCTCGT inserted at the 3′-end was denoted as a 5′ trailer.

[0101] The designed gene (SEQ ID NO 3) was synthesized in vitro and then cloned into a pCC1 vector.

[0102] A point mutation (M48I) of the G protein sequence was introduced.

[0103] (2) Designing of Measles virus F-substituted construct B (SEQ ID NO 4)

[0104] On the basis of the backbone construct A, the F protein gene sequence was removed and a corresponding measles virus F gene sequence was inserted.

[0105] The antigenome data of the Edmonston strain (Moraten vaccine) (Accession No. AF266287.1), which is a measles virus strain, were used.

[0106] The F protein gene of the Edmonston strain antigenome corresponds to sequences 5449-7110. Among them, sequences 5449-6939 excluding the transmembrane region and cytoplasmic tail region sequences were used. As the transmembrane region and cytoplasmic tail region sequences, the sequences of the wild-type human respiratory syncytial virus strain RSVA/TH_10654 were used. As 5′ UTR and 3′ UTR, the UTR sequences of the F protein gene of the wild-type human respiratory syncytial virus strain RSVA/TH_10654 were used.

[0107] After cleaving the backbone construct A with MluI and ApaI restriction enzymes, the designed measles virus F gene was inserted.

[0108] (3) Designing of Newcastle disease virus F-substituted construct C (SEQ ID NO 5)

[0109] After removing the F protein gene sequence from the backbone construct A, the Newcastle disease virus F gene sequence corresponding thereto was inserted.

[0110] The antigenome data of the 1-2 strain (Accession No. AY935499), which is a Newcastle disease virus, were used.

[0111] The F protein gene of the 1-2 strain genome corresponds to sequences 4544-6205 sequence. Among them, sequences 4544-6043 excluding the transmembrane region and cytoplasmic tail region sequences were used. As the transmembrane region and cytoplasmic tail region sequences, the sequences of the wild-type human respiratory syncytial virus strain RSVA/TH_10654 were used. As 5′ UTR and 3′ UTR, the UTR sequences of the F protein gene of the wild-type human respiratory syncytial virus strain RSVA/TH_10654 were used.

[0112] After cleaving the backbone construct A with MluI and ApaI restriction enzymes, the Newcastle measles virus F gene was inserted.

[0113] As seen from FIG. 4, the constructs B and C recognize the restriction enzymes MluI/ApaI and amplify the inserts using primers 1 and 2. The primer 1 (forward) was 5′ ATAT ACGCGT gtattgttgcaaaaagccatg, and the primer 2 (reverse) was 5′ ATAT GGGCCC tgttttatataactataaaatagaa.

[0114] (4) Designing of Measles virus F-inserted construct D (SEQ ID NO 6)

[0115] The measles virus F gene sequence was inserted between the G protein and F protein genes of the backbone construct A.

[0116] The antigenome data of the Edmonston strain (Moraten vaccine) (Accession No. AF266287.1), which is a measles virus strain, were used.

[0117] The F protein gene of the Edmonston strain antigenome corresponds to sequences 5449-7110. Among them, sequences 5449-6939 excluding the transmembrane region and cytoplasmic tail region sequences were used. As the transmembrane region and cytoplasmic tail region sequences, the sequences of the wild-type human respiratory syncytial virus strain RSVA/TH_10654 were used. As 5′ UTR, the 5′ UTR sequence of the F protein gene of the wild-type human respiratory syncytial virus strain RSVA/TH_10654 was used. As 3′ UTR, the 3′ UTR sequence of the G protein gene of the wild-type human respiratory syncytial virus strain RSVA/TH_10654 was used.

[0118] After cleaving the backbone construct A with the MluI restriction enzyme, the designed measles virus F gene was inserted.

[0119] (5) Designing of Newcastle disease virus F-inserted construct E (SEQ ID NO 7)

[0120] The Newcastle disease virus F gene sequence was inserted between the G protein and F protein genes of the backbone construct A.

[0121] The gene data of the 1-2 strain (Accession No. AY935499.1), which is a Newcastle disease virus strain, were used.

[0122] The F protein gene of the I-2 strain genome corresponds to sequences 4544-6205 sequence. Among them, sequences 4544-6043 excluding the transmembrane region and cytoplasmic tail region sequences were used. As the transmembrane region and cytoplasmic tail region sequences, the sequences of the wild-type human respiratory syncytial virus strain RSVA/TH_10654 were used. As 5′ UTR, the 5′ UTR sequence of the F protein gene of the wild-type human respiratory syncytial virus strain RSVA/TH_10654 was used. As 3′ UTR, the 3′ UTR sequence of the G protein gene of the wild-type human respiratory syncytial virus strain RSVA/TH_10654 was used.

[0123] After cleaving the backbone construct A with the MluI restriction enzyme, the designed Newcastle disease virus F gene was inserted.

[0124] As seen from FIG. 5, the heterologous virus gene was inserted to the region recognized by the restriction enzyme MluI and the insert was amplified using primers 1 and 3. The primer 1 (forward) was 5′ ATAT ACGCGT gtattgttgcaaaaagccatg, and the primer 3 (reverse) was 5′ ATAT ACGCGT gclllltaatgacta tcagttactaaatgcaatat.

[0125] 4. Designing of Four Helper Genes

[0126] RSV is a negative-sense RNA virus. While producing the virus in vitro through reverse genetics, helper genes (genes encoding N, P, L and M2-1 proteins of RSV) necessary for gene synthesis were added together.

[0127] (1) The N protein gene clones the sequences 1119-2294 of the wild-type human respiratory syncytial virus strain RSVA/TH_10654 antigenome into a pCI neo vector using the restriction enzymes XhoI and MluI.

[0128] (2) The P protein gene clones the sequences 2326-3051 of the wild-type human respiratory syncytial virus strain RSVA/TH_10654 antigenome into a pCI neo vector using the restriction enzymes XhoI and MluI.

[0129] (3) The M2-1 protein gene clones the sequences 7647-8231 of the wild-type human respiratory syncytial virus strain RSVA/TH_10654 antigenome into a pCI neo vector using the restriction enzymes XhoI and MluI.

[0130] (4) The L protein gene clones the sequences 8539-15036 of the wild-type human respiratory syncytial virus strain RSVA/TH_10654 antigenome into a pCI neo vector using the restriction enzymes XhoI and MluI.

[0131] The N protein gene is represented by SEQ ID NO 8, the P protein gene by SEQ ID NO 9, the M2-1 protein gene by SEQ ID NO 10, and the L protein gene by SEQ ID NO 11.

[0132] 5. Virus Rescue

[0133] BHK cells were prepared on a 6-well plate at a concentration of 4×10.sup.5 cell/well.

[0134] Next day, after mixing six plasmids, i.e., 2 μg of a T7 polymerase expression vector, 2 μg of a full-length RSV antigenome vector and 1 μg of four helper gene vectors (N, P, M2-1 and L), with 10 μL of Lipofectamine 3000, and reacting for 10 minutes, the mixture was transfected to BHK cells. The mixture was added dropwise for uniform application to the cells and then shaken 2-3 times to ensure mixing.

[0135] After culturing the cells for 5 days in a CO.sub.2 incubator at 37° C., the culture was recovered and then transfected (1 mL each) to Vero cells (3×10.sup.5/well) on a freshly prepared 6-well plate. A virus solution was obtained by culturing again for 5 days. One recombinant wild-type RSV and four RSV vaccine strains were produced in this way.

[0136] This technology is an experimental method commonly used by researchers for RSV rescue and there is no special technical limitation. In this experiment, the literatures “BAC-Based Recovery of Recombinant Respiratory Syncytial Virus (RSV); Reverse Genetics of RNA Viruses, pp. 111-124” and “RNA Virus Reverse Genetics and Vaccine Design; Viruses, 2014, 6, 2531-2550” were referred to. After recovering the culture, the virus was detected through IFA, RT-PCR and gene sequencing.

[0137] {circle around (1)} RSV backbone strain: wtRSVA_TH10654 (wild-type control)

[0138] {circle around (2)} RSV backbone strain—MV F substitution: cRSVA_MVF_S (mutant virus)

[0139] {circle around (3)} RSV backbone strain—NDV F substitution: cRSVA_NDVF_S (mutant virus)

[0140] {circle around (4)} RSV backbone strain—MV F insertion: cRSVA_MVF_A (mutant virus)

[0141] {circle around (5)} RSV backbone strain—NDV F insertion: cRSVA_NDVF_A (mutant virus)

[0142] 6. In Vitro Attenuation Test

[0143] After infecting Vero cells, HEp2 cells and MRC-5 cells with 0.1 MOI of the five strains, the cells were cultured for 9 days. The virus culture was collected with 1-day intervals and viral titer was analyzed by q-PCR.

[0144] As shown in FIG. 7, it was confirmed that the mutant viral vaccine strains were attenuated, with decreased proliferation rate and proliferation titer as compared to the wild-type virus. Through this, it can be seen that the recombinant viruses can be used as live vaccine strains. In the figure, DPI stands for days post-infection.

[0145] 7. In Vivo Attenuation Test

[0146] The five strains of viruses were administered to BALB/c mouse at concentrations of 10.sup.1-10.sup.7 pfu/mouse via the IN route. Viremia was detected by q-PCR in the blood on days 1-7, which confirms attenuation.

[0147] The result is shown in FIG. 8. As can be seen from FIG. 8, it was confirmed that the viruses were attenuated after being vaccinated in vivo as compared to the wild-type RSV A virus. Through this, it was confirmed that the recombinant RSVs can be used as new virus strains.

[0148] 8. Virus Stability Test

[0149] The viability of the five strains of viruses with time was investigated at 60° C., 37° C. and 4° C. Live viral titer in the sample was analyzed through plaque assay using HEp2 cells. As a result, it was confirmed that the stability of the mutant viruses was improved over the wild type under all temperature conditions. The stability of isolated RSV is decreased greatly. However, as can be seen from FIG. 9, the recombinant RSVs exhibited superior stability as compared to the wild-type virus strain at high temperature, human body temperature and low temperature.

[0150] 9. Immunogenicity Test

[0151] Mouse IM was immunized twice with each of Mock, wtRSVA, cRSVA_MVF_S, cRSVA_NDVF_S, cRSVA_MVF_A and cRSVA_NDVF_A at a concentration of 1×10.sup.5 pfu/mouse. 2 weeks later, after isolating mouse serum, total antibody titer and neutralizing antibody titer were measured by ELISA and plaque reduction neutralization test. The result is shown in FIG. 10. It was confirmed that RSV antigen-specific IgG antibodies and viral infection-neutralizing antibodies were produced sufficiently in all groups except Mock. Mock was denoted as G1, WtRSVA as G2, cRSVA_MVF_S as G3, cRSVA_NDVF_S as G4, cRSVA_MVF_A as G5, cRSVA_NDVF_A as G6, and FIwtRSVA as G7. It can be seen that the recombinant RSV strains produced antibodies at similar levels to the wild-type RSV, and shoed much higher antibody titers as compared to the inactivated G7. From the result of FIG. 10, it was confirmed that the recombinant RSV strains can be used as excellent virus strains because they exhibit superior stability while producing antibodies at similar levels to the wild-type virus.

[0152] 10. Immunization Test

[0153] Mouse IM was immunized twice with each of the five strains of viruses at a concentration of 10.sup.5 pfu/mouse with a 2-week interval. 2 weeks after the immunization, the wild-type RSV was challenged into the nasal cavity of the mouse at a concentration of 2×10.sup.6 pfu/mouse. On days 1-12, viremia in blood was detected by q-PCR and the change in body weight was measured. The result is shown in FIG. 11. It was confirmed that viral infection was inhibited effectively in all the immunized groups. In particular, the level of inhibition of infection was similar to that of the wild-type virus strain, and the viral infection in blood was remarkably lower as compared to the inactivated virus strain.

[0154] 11. Immunogenicity Test for MV and NDV

[0155] Total antibody titer and neutralizing antibody titer for NDV and MV antigens were measured in a manner similar to 9 by using the same serum. For measurement of total antibody titer, ELISA was conducted after coating with each of MV and DNV antigens. For measurement of neutralizing antibody titer, the concentrations that inhibits MV and NDV infections were measured by plaque inhibition assay. As shown in FIG. 12 and FIG. 13, enough antigen-specific antibody titer and virus neutralizing antibody titer were attained only for the groups having the F antigens of MV and NDV. In contrast, the groups to which the heterogeneous F was not inserted did not produce the antibodies for each antigen and neutralizing antibodies were not induced either.