MUTANT OF LYCOPENE EPSILON CYCLASE (LCYE) GENE CRUCIAL IN WHEAT CAROTENOID SYNTHESIS PATHWAY AND USE THEREOF
20210355477 · 2021-11-18
Inventors
- Shengnan Zhai (Shandong, CN)
- Jianjun Liu (Shandong, CN)
- Haosheng Li (Shandong, CN)
- Jianmin Song (Shandong, CN)
- Aifeng Liu (Shandong, CN)
- Xinyou Cao (Shandong, CN)
- Dungong Cheng (Shandong, CN)
- Zhendong Zhao (Shandong, CN)
- Cheng LIU (Shandong, CN)
- Jun Guo (Shandong, CN)
- Ran Han (Shandong, CN)
- Yan Zi (Shandong, CN)
- Faji Li (Shandong, CN)
- Xiaolu Wang (Shandong, CN)
Cpc classification
C12N15/8243
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure discloses a mutant of a lycopene epsilon cyclase (Lcye) gene crucial in a wheat carotenoid synthesis pathway and use thereof. The present disclosure provides the following proteins: (1) a protein obtained by substituting serine at position 253 of an Lcye-D1 protein with phenylalanine; (2) a derived protein that is obtained by subjecting the protein in (1) to substitution and/or deletion and/or addition of one or more amino acid residues and has the same ability as the protein in (1); (3) a protein that has a homology of more than 99%, more than 95%, more than 90%, more than 85%, or more than 80% with the amino acid sequence defined in any one of (1) and (2) and has the same function as the amino acid sequence; and (4) a fusion protein obtained by attaching a tag to N-terminus and/or C-terminus of the protein in any one of (1) to (3). The present disclosure not only verifies the function of an Lcye gene, but also provides a theoretical basis and a germplasm resource for improving the color character of flour and products thereof
Claims
1. A protein, being any of the following: (A1) a protein obtained by substituting serine at position 253 of an Lcye-D1 protein with phenylalanine; (A2) a protein derived from the protein defined in (A1), wherein, the protein is obtained by subjecting the protein defined in (A1) to substitution and/or deletion and/or addition of one or more amino acid residues and has the same ability as the protein defined in (A1); (A3) a protein that has a homology of more than 99%, more than 95%, more than 90%, more than 85%, or more than 80% with the amino acid sequence defined in any one of (A1) and (A2) and has the same function as the amino acid sequence; and (A4) a fusion protein obtained by attaching a tag to N-terminus and/or C-terminus of the protein defined in any one of (A1) to (A3).
2. The protein according to claim 1, wherein, the protein shown in (A1) is a protein composed of an amino acid sequence shown in SEQ ID No. 1.
3. A nucleic acid molecule encoding the protein according to claim 1 or 2.
4. The nucleic acid molecule according to claim 3, wherein, the nucleic acid molecule is a gene encoding the protein according to claim 1 or 2, and the gene is a DNA molecule shown in any of the following: (B1) a DNA molecule shown in SEQ ID No. 2; (B2) a DNA molecule that hybridizes with the DNA molecule defined in (B1) under stringent conditions and encodes the protein according to claims 1 or 2; and (B3) a DNA molecule that has a homology of more than 99%, more than 95%, more than 90%, more than 85%, or more than 80% with the DNA sequence defined in (B1) or (B2) and encodes the protein according to claim 1 or 2.
5. A recombinant vector, an expression cassette, a transgenic cell line, or a recombinant bacterial strain containing the nucleic acid molecule according to claim 3 or 4.
6. Use of the protein according to claim 1 or 2, the nucleic acid molecule according to claim 3 or 4, or the recombinant vector, expression cassette, transgenic cell line, or recombinant bacterial strain according to claim 5 in any of the following: (C1) down-regulation of a total expression level of a wheat Lcye gene; or preparation of a product for down-regulating the total expression level of the wheat Lcye gene; (C2) down-regulation of an expression level of a wheat Lcye-B1 and/or Lcye-D1 gene; or preparation of a product for down-regulating the expression level of the wheat Lcye-B1 and/or Lcye-D1 gene; and (C3) reduction of a yellow pigment content in wheat grains; or preparation of a product for reducing a yellow pigment content in wheat grains.
7. A method for reducing a yellow pigment content in wheat grains, comprising the following steps: substituting only a codon in a recipient wheat genome that encodes serine at position 253 of an Lcye-D1 protein with a codon that encodes phenylalanine.
8. The method according to claim 7, wherein, the substituting a codon in a recipient wheat genome that encodes serine at position 253 of an Lcye-D1 protein with a codon that encodes phenylalanine refers to substituting a gene in the recipient wheat genome that encodes an Lcye-D1 protein with a gene that encodes a protein consisting of an amino acid sequence shown in SEQ ID No. 1.
9. The method according to claim 8, wherein, the gene that encodes a protein consisting of an amino acid sequence shown in SEQ ID No. 1 is a DNA molecule shown in SEQ ID No. 2.
10. Use, being any of the following: (D1) the use according to claim 6 of the protein according to claim 1 or 2, the nucleic acid molecule according to claim 3 or 4, or the recombinant vector, expression cassette, transgenic cell line, or recombinant bacterial strain according to claim 5, or use of the method according to any one of claims 7 to 9 in the improvement of a color of wheat flour or flour products; and (D2) use of wheat varieties with a reduced grain yellow pigment content cultivated by the method according to any one of claims 7 to 9 in wheat breeding.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0033]
[0034]
[0035]
[0036]
DETAILED DESCRIPTION
[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0038] The materials, reagents, etc. used in the following examples are all commercially available, unless otherwise specified.
EXAMPLE 1
Study on the Function of a Lcye Gene Crucial in a Wheat Carotenoid Synthesis Pathway
[0039] I. Materials and Methods
[0040] 1. Construction of EMS-Mutagenized Populations
[0041] A method for constructing the EMS-mutagenized populations refers to the method of Slade et al. (2005). A batch of Jimai 20 (Ma et al., Effects of different water and nitrogen treatments on protein composition and processing quality of Jimai 20. Journal of Triticeae Crops, 2010, 30 (3): 477-481) and Jimai 22 (Liu et al., Changes of chlorophyll in flag leaves and enzyme activities in active oxygen scavenging system of high-yield Jimai 22, Shandong Agricultural Sciences, 2012, 44 (8): 31-34) seeds with stable homozygosity, uniform sizes, and full grains were first screened out; a chemical mutagen EMS with a concentration of 1.2% (Solarbio, E8150) was used for mutagenesis to produce a series of point mutations; treated seeds were grown in the greenhouse to obtain the Mi mutant population; seeds of the M.sub.1 were grown in field to obtain 2,491 M.sub.2 plants (Jimai 20: 1,251 plants; Jimai 22: 1,240 plants), and grains of each plant were harvested and stored, separately.
[0042] 2. Screening an EMS mutant library with the TILLING technology
[0043] EMS mutants were screened with reference to the method of Till et al. (2006). Specific steps were as follows:
[0044] (1) Construction of the mutant DNA pool: A genomic DNA (gDNA) of each M.sub.2 mutant was extracted with the CTAB method (Doyle and Doyle, 1987) and stored in a 96-well plate. A NanoDrop-2000 ultra-micro spectrophotometer (Thermo Scientific) was used to determine the concentration and quality of DNA. Every 8 samples were classified in a group, and DNAs thereof were mixed in equal amounts to construct the 8-fold DNA mixed pool, which was stored at 4° C. for later use.
[0045] (2) Design of Lcye-specific primers: Based on the differences among homologous gene sequences of wheat Lcye, specific primers were designed for the A, B and D genomes. Triticum dicoccoides-nudigl nullisomic-tetrasomic materials (Ni et al. Cloning and identification of wheat transcription factor (TF) TaDREB6 gene. Journal of Triticeae Crops, 2008, 28 (3): 357-363) and PCR product sequencing methods were used to verify primer genome specificity; and the CODDLE (Codons Optimized to Discover Deleterious Lesions; http://www.proweb.org/coddle/) software was used to analyze whether the amplified region plays an important role in gene functions. Four pairs of Lcye-specific primers were obtained by screening (Table 1).
TABLE-US-00001 TABLE 1 Primer information for Lcye mutants screened by the TILLING technology Amplifi- cation length Gene Name Sequence (5′-3′) (bp) Lcye- A3F- F: CCACAGTAGCAAAAATTAGTCA 1450 A1 A7R R: TGCTACATTTCACAGTGGTGAA Lcye- A8F- F: GGTTGAAAGATATCCGTACAAC 978 A1 A9R R: TTTGGGTAACCGGAAAAAGGTT Lcye- B4F- F: CACCAACCCTGCACAAAGTGCC 578 B1 B6R R: GGAATATAAGACCACTCCTGAG Lcye- D2F- F: GCTGAGAAGGTACATTCTATCA 437 D1 D5R R: TTGAACTGGTGCACAAACAACA
[0046] (3) PCR amplification and heteroduplex generation: PCR amplification was conducted under the following conditions: template: DNA pools; reaction system: 15 μL in total: 50 ng of DNA, 7.5 μL of SuperMix (Transgen, AS111-01), 1 μL of each of upstream and downstream primers (10 μmol.Math.L.sup.−1), and the balance of ddH.sub.2O; reaction procedure: first 95° C. for 5 min, then 95° C. for 30 s; starting from 66° C., annealing at a temperature reduced by 0.3° C. for each cycle, annealing time: 45 s, 72° C. for 1.5 min, a total of 35 cycles; extension at 72° C. for 10 min, then at 99° C., and 85° C. for 1 min; starting from 85° C., annealing at a temperature reduced by 0.5° C. for each cycle, annealing time: 30 s, a total of 99 cycles; incubation at 16° C. for later use. If there is a mutation site in the target fragment sequence of DNA mixed pool sample, the amplification product can undergo repeated denaturation and renaturation to form a heteroduplex (namely, with mismatched bases) of wild-type and mutant amplified fragments.
[0047] (4) CEL I digestion: CEL I (endonuclease) that specifically recognizes and cleaves mismatched bases was used to cleave heteroduplex nucleic acid molecules. The extraction method of CEL I refers to the method of Till et al. (2006). After the enzyme activity of CEL I was confirmed, the effects of CEL I concentration, digestion time, digestion temperature, and digestion buffer concentration on the digestion effect were analyzed to optimize the digestion system, according to the method of Panna et al. (2012). The optimal digestion reaction system was determined as follows: 20 μL in total: 2 μL of 10×digestion buffer, 1 μL of CEL I, 15 μL of heteroduplex DNA, and the balance of ddH.sub.2O. The digestion reaction was conducted at 45° C. for 20 min, and then 5 μL of EDTA (0.25 M, Sangon Biotech Co., Ltd., ET0895) was added to terminate the digestion reaction.
[0048] (5) Non-denaturing PAGE detection: The non-denaturing PAGE detection technology was used to screen out positive DNA pools with mutation sites. Each DNA in the positive DNA pool was mixed with wild-type DNA one by one, and the above step was repeated to screen out positive mutant individuals.
[0049] (6) Cloning and Sequencing of Mutants: Cloning and sequencing were conducted on PCR products of mutants to identify the type and location of mutations.
[0050] 3. Prediction of the Effects of Mutation Sites on Protein Functions
[0051] Proiect aligned related sequences and evaluate SNP (PARSESNP; http://www.proweb.org/parsesnp/) software was used to analyze the mutation type of the DNA sequence in the mutant plant and predict whether the mutation site will affect the function of LCYE. When the PSSM value is greater than 10 and the sorting intolerant from tolerant (SIFT) value is less than 0.05, amino acid alterations are considered to have a significant impact on protein functions (Ng and Henikoff, 2003; Taylor and Greene, 2003).
[0052] 4. Functional analysis of mutation sites
[0053] In order to reduce the influence of other mutation backgrounds, homozygous M.sub.3 plants with missense mutation sites in the Lcye gene were crossbred with wild-type plants to construct F.sub.2 populations (Grains of six M.sub.2 plants with missense mutation sites in the Lcye gene were harvested and planted in the field, the genotype of the M.sub.3 plants was identified by cloning and sequencing, and three homozygous mutants were selected and crossbred with corresponding wild-type plants to construct F.sub.2 populations. F.sub.0 grains were harvested from three hybrid ears, F.sub.0 plants were selfed to obtain F.sub.1 grains, and F.sub.1 grains were sown to obtain F.sub.2 populations), which were used to analyze the effects of mutation sites on gene expression levels and protein function. The F.sub.2 populations were planted in Jinan, Shandong from 2017 to 2018, with the row length of 3 m, the row spacing of 25 cm, 30 plants per row, and 15 rows for each F.sub.2 population. The field management adopted to the conventional method.
[0054] The method of cloning and sequencing was used to identify the Lcye genotype (homozygous mutant, heterozygous mutant, and wild type) of each plant in the F.sub.2 populations. For each genotype, 10 biological replicates with consistent growth and development processes were selected. The anthesis was recorded, and grains were collected at 7, 14, 21, and 28 days after anthesis and immediately stored in liquid nitrogen at −80° C., which would be used to analyze the expression level of the Lcye gene. Mature grains were harvested from each single plant, respectively, and stored at −20° C., which would be used to determine the yellow pigment content.
[0055] The qRT-PCR technology was used to determine the expression levels of Lcye gene and homologous genes thereof at different developmental stages of grains of homozygous mutant, heterozygous mutant, and wild-type plants in the F.sub.2 populations (7, 14, 21, and 28 days after anthesis), and the influence of mutation sites on the expression level of Lcye gene was analyzed. Specific steps: RNAprep Pure kit (TIANGEN Biotech, DP441) was used to extract total RNA from grains, with three biological replicates for each of homozygous mutant, heterozygous mutant, and wild-type plants; PrimeScriptTM RT Reagent kit (Takara Bio Inc., RR047A) was used to reverse-transcribe the RNA into cDNA, which was stored at −20° C. for later use; based on the conservation and difference among cDNA sequences of wheat Lcye homologous genes, conserved primers and A, B, D genome-specific primers were designed for Lyce genes (Table 2), and the melting curve analysis and the cloning and sequencing of qRT-PCR products were conducted to verify the conservation and specificity of the primers; the common wheat (3-actin gene (AB181991) was adopted as the internal reference gene; the qRT-PCR technology was used to detect the expression levels of Lcye gene at different developmental stages of grains of homozygous mutant, heterozygous mutant, and wild-type plants in the F.sub.2 populations, with three technical replicates for each sample, where the relative gene expression level was expressed by mean±standard error (SE). Reaction system: 20 μL in total: 10 μL of LightCycler FastStart DNA Master SYBR Green (Roche Applied Sciences, No. 03003230001), 0.5 μM upstream and downstream primers, 50 ng of cDNA, and the balance of ddH.sub.2O. Reaction program: 95° C. for 10 min; 95° C. for 15 s, 60° C. for 20 s, and 72° C. for 20 s, a total of 40 cycles. The formula 2.sup.-ΔΔCT was used to calculate the relative expression level of the target gene (Livak and Schmittgen, 2001). The transcriptional level of the (3-actin gene in the same sample was used to correct the relative expression level of the target gene. The relative expression level of the target gene in grains of wild-type plants at 28 days after anthesis was set as 1, and then relative expression levels of the target gene in grains of plants with different genotypes at different developmental stages were calculated.
TABLE-US-00002 Table 2 qRT-PCR primer information of Lcye gene Gene Name Sequence (5′-3′) Lcye-all Lcye-all-F2 TGACCACYGAATATCCAGTTGC Lcye-all-R6 AGTTTTCTTTGAGGAAACATGC Lcye-A1 Lcye-A1-F7 GTTGCTGAGAAGATGCAACGAT Lcye-A1-R7 CAAAGTATCTTGCGGTCCCTTT Lcye-B1 Lcye-B1-F3 ATCTCCAGATGGACATCGAGTG Lcye-B1-R3 TCCAACCTCATACTCTAGAAGT Lcye-D1 Lcye-D1-F3 TTGGCCCTGATCTTCCATTC Lcye-D1-R1 ATATACTACTCGATGTCCATCA β-actin Actin-F CTGATCGCATGAGCAAAGAG Actin-R CCACCGATCCAGACACTGTA
[0056] The yellow pigment content in grains was determined for homozygous mutant, heterozygous mutant, and wild-type plants in the F.sub.2 populations, and the influence of mutation sites on the function of LCYE was analyzed. The method for determining the yellow pigment content in grains refers to AACC methods 14 to 50, with minor changes. Briefly, 1 g of whole wheat flour was weighed, and extraction under shaking was conducted with water-saturated n-butanol (at a volume ratio of 5:1) for 1 h; and the resulting solution was centrifuged at 5,000 rpm for 10 min. The absorbance microplate reader (http://www.moleculardevices.com) was used to determine the absorbance of a supernatant at 436.5 nm, and then the yellow pigment content was calculated. Three technical replicates were adopted for each sample, and the yellow pigment content was expressed by mean±SE.
[0057] 5. Prediction of functional domains of LCYE
[0058] National center for biotechnology information (NCBI; http://www.ncbi.nlm.nih.gov/) database was used to obtain cDNA sequences of Lcye genes of 27 species (Table 3), and MEME Suite 5.1.0 (http://meme-suite.org/) was used to predict the functional domains of LCYE, and the distribution of mutation sites in the domains was analyzed.
TABLE-US-00003 TABLE 3 cDNA sequence information of Lcye gene of 27 species Species name Genbank accession number Arabidopsis thaliana NM_125085 Brachypodium distachyon XM_003569209 Brassica rapa XM_009133907 Capsella rubella XM_006280236 Chlamydomonas reinhardtii XM_001696477 Citrus sinensis AY533827 Cucumis sativus XM_004157912 Fragaria vesca XM_004287534 Glycine max XM_003533727 Hordeum vulgare AK371513 Linum usitatissimum KC565894 Malus domestica XM_008389970 Medicago truncatula XM_003595195 Oryza sativa NM_001049945 Physcomitrella patens XM_001753846 Prunus persica XM_007203578 Ricinus communis XM_002514090 Setaria italica XM_004969360 Solanum lycopersicum EU533951 Solanum tuberosum XM_006353482 Sorghum bicolor XM_002455793 Theobroma cacao XM_007012707 Triticum aestivum EU649785 Triticum turgidum GAKM01004311 Triticum urartu GAKL01018490 Vitis vinifera JQ319637 Zea mays EU924262
[0059] 6. Statistical analysis
[0060] The Student's t test was used to analyze differences in the Lcye gene expression and yellow pigment content in grains of homozygous mutant, heterozygous mutant, and wild-type plants in the F.sub.2 populations.
[0061] II. Results
[0062] 1. Screening of EMS-induced mutant library
[0063] A total of 21 Lcye gene mutants were detected with the TILLING technology among 2,491 M.sub.2 EMS-mutagenized populations (Table 4). Cloning and sequencing and sequence analysis showed that the mutation frequency of nucleotides from C to T was 57.14%, the mutation frequency from G to A was 38.10%, and one specific mutation site from T to C was also detected. According to the mutation positions, eight were located in the exon region and 13 were located in the intron region. Point mutations in the exon region were further divided into six missense mutations and two synonymous mutations (
TABLE-US-00004 TABLE 4 Information of Lcye mutants screened out by the TILLING technology Nucleotide Codon Amino acid Gene Mutant No. Exon/intron alteration alteration alteration Genotype Lcye-A1 M091034 Intron C1184T Hom M091686 Intron C1243T Hom M091772 Intron C1418T Hom M092043 Intron C1478T Hom M092852 Intron C3222T Hom M090431 Intron C858T Het M090631 Intron T1461C Het M090897 Intron G1068A Hom M091996 Intron G1575A Hom M090147 Intron G3073A Hom M091648 Exon G3284A GGA.fwdarw.GAA G392E Hom M090201 Exon G3306A TTA.fwdarw.TTG L399= Hom Lcye-B1 M091626 Intron G2406A Hom Lcye-D1 M092404 Intron C2014T Het M091884 Intron C2017T Het M090945 Exon C2086T TAC.fwdarw.TAT Y214= Hom M092089 Exon C2087T CTC.fwdarw.TTC L215F Hom M091328 Exon C2121T CCT.fwdarw.CTT P226L Het M090815 Exon C2202T TCT.fwdarw.TTT S253F Het M092230 Exon G2195A GCA.fwdarw.ACA A251T Hom M091075 Exon G2262A GGT.fwdarw.GAT G273D Hom Notes: Hom: homozygous mutant; Het: heterozygous mutant. Each mutant in the table has only one corresponding mutation in the Lcye gene, that is, one mutant does not have multiple mutations in the Lcye gene.
[0064] In the present disclosure, conventional non-denaturing PAGE was used to separate the CEL I digestion product, and mismatches within 0.15 kb at both ends of the fragment would exceed the detection range, so the accumulative length of effective target fragments for Lcye gene screened was 2.24 kb (Table 1). The screening population included 2,491 M.sub.2 plants, and it was inferred that the Lcye gene had the mutation density of 1/266.1 kb in the EMS-mutagenized population.
[0065] 2. Prediction of the effects of mutation sites on protein functions Analysis results of the PARSESNP software showed that the PSSM values of missense mutants M090815 (C2202T) and M091648 (G3284A) were 26.9 and 27.7, respectively, and the SIFT values were 0. It was inferred that these mutation sites may have a significant impact on protein functions (Table 4).
TABLE-US-00005 TABLE 4 Prediction of the impact of mutation sites on protein function Mutant Nucleotide Amino acid PSSM SIFT Gene No. alteration alteration value value Lcye-D1 M090815 C2202T S253F 26.9 0 Lcye -A1 M091648 G3284A G392E 27.7 0 Notes: The genomic sequence of the mutated Lcye-D1 gene in the missense mutant M090815 (C2202T) is shown in SEQ ID No. 2, which encodes the mutated Lcye-D1 protein shown in SEQ ID No. 1.
[0066] 3. Analysis of the Lcye gene expression and yellow pigment content in mutants
[0067] Homozygous missense mutants were crossbred with wild-type plants to construct six F.sub.2 populations, and the effects of mutation sites on the Lcye gene expression level and grain yellow pigment content were analyzed. Results showed that, in six F.sub.2 populations, only the M090815 (C2202T) mutation site significantly reduced the Lcye gene expression level and yellow pigment content (
[0068] The expression levels of Lcye and homologous genes thereof were shown in
[0069] 4. Prediction of functional domains of LCYE Based on the known cDNA sequences of Lcye gene in 27 species including Arabidopsis thaliana, Oryza sativa, and Hordeum vulgare, MEME Suite 5.1.0 was used to predict the functional domains of LCYE, and a total of three domains were detected (
[0070] III. Discussion 1. LCYE regulates the carotenoid synthesis in wheat grains
[0071] The carotenoid content in wheat grains affects the nutritional quality and apparent color of flour products. The carotenoid content and composition dynamically change during the development process, exhibiting a complex network regulation mechanism (Howitt et al., 2009). Lycopene cyclization is an important branch point in the carotenoid synthesis pathway, and different products are generated through two pathways: carotenoids such as zeaxanthin, antheraxanthin, and violaxanthin are generated through the β-β pathway; and lutein is eventually generated through the other β-ε pathway. The β-β pathway carotenoid products have a relatively-high expression level at the early development stage of common wheat grains, and with the growth and development of grains, the expression level and proportion of the β-β pathway carotenoid products gradually decrease. There were almost no zeaxanthin, antheraxanthin, and violaxanthin in mature grains. On the contrary, the accumulation of lutein is relatively stable at all development stages of grains, and lutein is the main component of carotenoids in mature grains (Howitt et al., 2009).
[0072] By adjusting the relative activity and content of LCYB and LCYE, proportions of α-carotene and β-carotene converted from substrates can be determined. In a tomato Delta mutant (Hornero-Mendez et al., 2000), the β-carotene content in fruits greatly increases due to the increase of Lcye transcriptional level; while in the tomato Beta mutant, the large amount of β-carotene accumulates in fruits due to the overexpression of Lcyb. The comparison between the two tomato mutants further confirms that the accumulation of carotenoids in tomato fruits is mainly due to the differential expression of related genes at the transcriptional level (Ronen et al., 2000).
[0073] The TILLING technology effectively combine high-frequency point mutation with modern analysis technique, which can be used to not only obtain a series of point mutation alleles, but also screen the target gene mutants with only a small mutant population (Till et al., 2003b). Richaud et al. (2018) used the TILLING technology to screen durum wheat Lcye mutants. The W437* (Lcye A1) mutation site significantly increases the (3-carotene and carotenoid contents in leaves of the mutants, but shows no significant influence on the carotenoid content in grains. In the present disclosure, the TILLING technology is used to screen a common wheat EMS-induced mutant library to obtain a series of allelic variation of Lcye genes, and their effects on the gene expression and grain yellow pigment content is studied, which lays theoretical foundation and provides important germplasm resources for the research on gene functions and the improvement of flour products color.
[0074] 2. Screening of Lcye mutants
[0075] The TILLING technology effectively combines high-frequency point mutations of chemical mutagenesis with fast and simple mutant detection technologies, which can quickly and effectively detect point mutations of the target genes from mutant populations, and has gradually become an important tool in research of plant functional genomics, crop genetics and breeding, and genetic diversity assessment of natural resources (Gilchris and Haughn, 2005; Till et al., 2018). At present, the technology has been widely used in more than 20 crops such as Oryza sativa (Till et al., 2007), Zea mays (Till et al., 2004), Triticum (Acevedo-Garcia et al., 2017; Kim et al., 2018), Hordeum vulgare (Gottwald et al., 2009), Glycine max (Hoshino et al., 2010), and Sorghum bicolor (Nida et al., 2016).
[0076] The gene mutation frequency in wheat is much higher than that in Arabidopsis thaliana, rice and corn. The TILLING technology has a huge application potential and a bright prospect in wheat and other Triticeae crops. For polyploid species with complex genomes, multiple gene copies result in a bottleneck restricting the efficient application of TILLING technology. It is very important to design specific primers, which will affect the detection efficiency. There is a high sequence similarity (89.1% to 97.0%) among homologous genes of wheat Lcye genes A, B, and D, so it is very difficult to design specific markers. In combination with the possible range of EMS-induced harmful mutations in plants given by the CODDLE program, four pairs of primers are finally screened out for Lcye mutant detection (Table 1). A total of 21 Lcye mutation sites are screened out, the mutation frequency from G/C to A/T is 95.24%, and the mutation frequency from T to C is 4.76%.
[0077] There are many methods for detecting digestion products, such as high-performance liquid chromatography (HPLC), PAGE, agarose gel electrophoresis and two-color infrared fluorescence detection (Colbert et al., 2001; Dong et al., 2009; Uauy et al., 2009; Colasuonno et al., 2016). The present disclosure adopts the non-denaturing PAGE detection technology, and adopts neither fluorescently-labeled primers nor expensive denaturing gel electrophoresis imaging systems, which effectively simplifies the experimental procedure, reduces the experimental cost, and expands the application scope and efficiency of TILLING to a certain extent.
[0078] 3. Important regulatory sites affecting LCYE functions
[0079] Based on the cDNA sequences of Lcye in 27 species such as Arabidopsis thaliana, Oryza sativa, and Hordeum vulgare, MEME is used to predict the functional domains of LCYE, and results show that the mutation sites of M090815 (C2202T) and M092230 (G2195A) are just located in domain 1 (
[0080] Prediction results by PARSESNP software show that the M090815 (C2202T) and M091648 (G3284A) mutation sites may have a significant effect on protein functions (Table 4). It further confirms the importance of the M090815 (C2202T) mutation site to the function of LCYE protein. However, in the F.sub.2 population constructed by M091648, the yellow pigment content between homozygous mutant plants and wild-type plants is not significantly different. This inconsistency may be due to the fact that the PARSESN software predicts the severity of the impact of mutation sites on protein function based on the sequence homology and the physical properties of amino acids, because some sites may not participate in protein function regulation (Ng and Henikoff, 2003; Taylor and Greene, 2003).
[0081] The expression levels of Lcye and homologous genes in the F.sub.2 population constructed by M090815 shows that the total expression level of Lcye gene in grains of homozygous mutant plants is significantly lower than that of the wild-type plants (
[0082] 4. Molecular breeding
[0083] The lack of germplasm resources has become a bottleneck in the improvement of the color of wheat flour and products thereof, which seriously affects the genetic improvement of the flour color character in China. EMS mutagenesis can create a large number of allelic variations, which are inherited stably in offspring. Since no transgenic operations are involved, excellent mutants obtained can be directly used in breeding practices (Hou et al., 2008; Slade et al., 2012). In China, flour products are mainly cooked in manners of steaming and stewing, and delicate and white flour is favored by consumers. In this study, the M090815 mutant screened out by the TILLING technology, which significantly reduces the yellow pigment content in grains, can be used as an important germplasm resource for the genetic improvement of flour color. In addition, Jimai 20 is a high-yield and high-quality strong gluten wheat that can be used for making both bread and noodles; and Jimai 22 is a super-high-yield, stable-yield, wide-adapted, multi-resistant wheat variety, both of which are excellent varieties with prominent comprehensive traits that are popularized in a large area. Excellent mutants generated by using these two varieties are more suitable for being use as hybrid parents, with a view to quickly cultivating new high-yield and high-quality wheat varieties.