MODIFIED POLYMERASES FOR IMPROVED INCORPORATION OF NUCLEOTIDE ANALOGUES

Abstract

The invention relates to modified polymerase enzymes which exhibit improved incorporation of nucleotide analogues bearing substituents at the 3′ position of the sugar moiety that are larger in size than the naturally occurring 3′hydroxyl group. Also described are methods of using the polymerases to incorporate nucleotides into polynucleotides, particularly in the context of DNA sequencing.

Claims

1.-85. (canceled)

86. A polynucleotide extension composition comprising: one or more 3′-O-azidomethyl nucleotide triphosphates, and a protein means for incorporating said 3′-O-azidomethyl nucleotide triphosphates into a polynucleotide, wherein said protein means lacks 3′-5′ exonuclease activity and comprises at least two mutations in a motif A region.

87. The polynucleotide extension composition of claim 86, wherein said protein means comprises three mutations in the motif A region.

88. The polynucleotide extension composition of claim 86, wherein said protein means is selected from the group consisting of selected from Vent polymerase, Deep Vent polymerase, 9°N polymerase, Thermococcus sp. JDF-3 polymerase, and Pfu polymerase.

89. The polynucleotide extension composition of claim 86, wherein said protein means comprises a first amino acid of the motif A region that is an amino acid selected from the group consisting of isoleucine (I), alanine (A), valine (V), and serine (S); a second amino acid of the motif A region that is an amino acid selected from the group consisting of alanine (A) and glycine (G); and a third amino acid of the motif A region that is an amino acid selected from the group consisting of isoleucine (I), valine (V), leucine (L), threonine (T), and proline (P).

90. The polynucleotide extension composition of claim 89, wherein said first amino acid of the motif A region is an amino acid selected from the group consisting of isoleucine (I), alanine (A), and valine (V).

91. The polynucleotide extension composition of claim 89, wherein said second amino acid of the motif A region is an alanine (A).

92. The polynucleotide extension composition of claim 89, wherein said third amino acid of the motif A region is an amino acid selected from the group consisting of isoleucine (I), valine (V), leucine (L), and threonine (T).

93. The polynucleotide extension composition of claim 89, wherein said first amino acid of the motif A region is an amino acid selected from the group consisting of alanine (A) and serine (S).

94. The polynucleotide extension composition of claim 86, wherein said protein means comprises at least one mutation in a motif B region, wherein a second amino acid of the motif B region is an amino acid selected from the group consisting of leucine (L), valine (V), serine (S), lysine (K), arginine (R), and histidine (H).

95. The polynucleotide extension composition of claim 86, wherein said protein means comprises at least one mutation in a motif B region, wherein a second amino acid of the motif B region is an amino acid selected from the group consisting of leucine (L) and valine (V).

96. A polynucleotide extension composition comprising: a protein means for incorporating nucleotide triphosphates into a polynucleotide, wherein said protein means lacks 3′-5′ exonuclease activity and comprises at least two mutations in a motif A region, and a buffer solution suitable for protein-mediated incorporation of nucleotide triphosphates into a polynucleotide.

97. The polynucleotide extension composition of claim 96, wherein said composition further comprises one or more nucleotide triphosphate molecules that have been modified at the 3′ sugar hydroxyl such that the substituent is larger in size than the naturally occurring 3′ hydroxyl group.

98. The polynucleotide extension composition of claim 96, wherein said protein means is selected from the group consisting of selected from Vent polymerase, Deep Vent polymerase, 9°N polymerase, Thermococcus sp. JDF-3 polymerase, and Pfu polymerase.

99. The polynucleotide extension composition of claim 96, wherein said protein means comprises a first amino acid of the motif A region that is an amino acid selected from the group consisting of isoleucine (I), alanine (A), valine (V), and serine (S); a second amino acid of the motif A region that is an amino acid selected from the group consisting of alanine (A) and glycine (G); and a third amino acid of the motif A region that is an amino acid selected from the group consisting of isoleucine (I), valine (V), leucine (L), threonine (T), and proline (P).

100. The polynucleotide extension composition of claim 96, wherein said protein means comprises at least one mutation in a motif B region, wherein a second amino acid of the motif B region is an amino acid selected from the group consisting of leucine (L) and valine (V).

101. A polynucleotide extension composition comprising: one or more 3′-O-azidomethyl nucleotide triphosphates, and a protein means for incorporating said 3′-O-azidomethyl nucleotide triphosphates into a polynucleotide, wherein said protein means lacks 3′-5′ exonuclease activity and said protein means incorporates 3′-O-azidomethyl nucleotide triphosphates into a polynucleotide faster than a 9°N DNA polymerase that contains mutations D141A, D143A, Y409V, and A485L (SEQ ID NO: 16) incorporates 3′-O-azidomethyl nucleotide triphosphates into a polynucleotide.

102. A polynucleotide extension composition comprising: a protein means for incorporating nucleotide triphosphates into a polynucleotide, wherein said protein means lacks 3′-5′ exonuclease activity and said protein means incorporates 3′-O-azidomethyl nucleotide triphosphates into a polynucleotide faster than a 9°N DNA polymerase that contains mutations D141A, D143A, Y409V, and A485L (SEQ ID NO: 16) incorporates 3′-O-azidomethyl nucleotide triphosphates into a polynucleotide, and a buffer solution suitable for protein-mediated incorporation of nucleotide triphosphates into a polynucleotide.

103. The polynucleotide extension composition of claim 102, wherein said composition further comprises one or more nucleotide triphosphate molecules that have been modified at the 3′ sugar hydroxyl such that the substituent is larger in size than the naturally occurring 3′ hydroxyl group.

104. The polynucleotide extension composition of claim 103, wherein said nucleotide triphosphate molecules comprise a purine or pyrimidine base and a deoxyribose sugar moiety having a 3′carbon atom attached to a group of the structure —O—Z, wherein Z is an azidomethyl group.

105. The polynucleotide extension composition of claim 102, wherein said protein means exhibits a time to 50% nucleotide triphosphate incorporation on the first incorporation cycle of 20 seconds or less.

Description

[0184] The invention is now further described in the following non-limiting examples and accompanying drawings in which:

[0185] FIG. 1 compares the ability of the library of altered 9°N DNA polymerases to incorporate modified nucleotides against the 9DM control 9°N DNA polymerase. The relative increase in rate is given for each of the altered 9°N DNA polymerases tested.

[0186] FIG. 2 illustrates the activity (% product conversion vs time (minutes)) for various polymerases on a first cycle of enzyme of enzymology at 45° C., 50 mM Trio pH8, 4 mM MgSO.sub.L, 0.05 (v/v) Tween, 50 μg/ml enzyme and 2 μM 3′ modified nucleotide.

[0187] FIG. 3 illustrates the activity (% product conversion vs time (minutes)) of the 9°N ED mutant polymerase and the 9°N YAV mutant polymerase compared to the control 9°N DM polymerase on a single cycle of nucleotide incorporation using three different uracil nucleotide analogues: 3′ O-allyl, 3'S-methyl and 3′ O-azido methyl).

[0188] FIG. 4 illustrates the activity (% product conversion vs time (minutes)) of mutant polymerases 9°N DM V409A and 9°N DM V409G compared to the control 9°N DM polymerase on two cycles of incorporation of O-azido methyl modified nucleotide.

[0189] FIG. 5 illustrates the activity (% product conversion vs time (minutes)) of various polymerases at 30° C.

[0190] FIG. 6 illustrates incorporation (% incorporation vs time (minutes)) of 3′ blocked nucleotide by a 9°N (exo-) mutant polymerase having the amino acid sequence YAV in the motif A region at various different substrate concentrations.

EXAMPLE 1

[0191] Herein is reported a series of polymerase variants that improve the incorporation of 3′modified nucleotide analogues. Some of these variant enzymes share sequence similarity to each other over the six randomised amino acid residues; by contrast, other enzymes that show improved incorporation bear no sequence similarity in these regions.

[0192] Mutations were introduced simultaneously at two regions of the 9°N DNA polymerase sequence, residues 408-410, and residues 484-486. A library of polymerase variants was screened for the incorporation of the 3′ modified nucleotide analogues. Variants that displayed enhanced levels of incorporation compared to the parental clone were purified and tested to confirm their activity.

[0193] The variant polymerases have increased activity towards the modified nucleotides utilised in the experiments. Thus, they appear to incorporate nucleotide analogues which have been modified at the 3′ sugar hydroxyl such that the substituent is larger in size than the naturally occurring 3′ hydroxyl group in primer extension assays faster than previously available polymerases which can act as a control polymerase, such as the 9°N (-exo)Y409V/A485L double mutant (designated 9DM herein).

[0194] Table II Comparison of the amino acid sequence of novel improved DNA polymerases across the regions targeted for mutagenesis. The sites of the various substitution mutations in the 9°N DNA polymerase amino acid sequence are shown compared to the wild type 9°N DNA polymerase amino acid sequence and the 9DM 9°N DNA polymerase amino acid sequence. Mutations were carried out in 2 regions, Motif A (amino acid 408-410) and Motif B (amino acid 484-486). Each clone was given an individual identifier, a short name to allow easy identification.

TABLE-US-00003 Motif A Motif B Amino Acid number Clone name 408 409 410 484 485 486 Wild Type L Y P R A I 9DM L V P R L I 1A4 W A L S K N 1A2 D V G G R D 1E M L F K H N 1G V D G G A L 2E V A L I S N 2G4 S S L N A Q 6D11 Y A L T H H

Methods:

Construction of a Library of Mutant Polymerases.

[0195] There are many methods for introducing mutations into DNA (see Sambrook and Russell, 2001 and references therein for examples). One method that has been used is described below for the mutagenesis of 9°N at amino acids 408-410 and 484-486.

[0196] A sequenced and functionally validated clone of the polymerase is used as the starting material. In this particular example the plasmid from the 9°N (-exo) Y409V/A485L (9°N DM) double mutant was utilised (SEQ ID NO:15).

[0197] Table III shows the nucleotide sequences of the oligonucleotide primers used in order to generate the library of mutant 9°N DNA polymerases in the mutagenesis experiments.

TABLE-US-00004 Long Short name name Nucleotide sequence reamp 133-2 CACTCATGATTAGATCTCGTGCAGC 9° N SEQ ID atg NO: 1 long 9° N 133-1 CACTCATGATTAGATCTCGTGCAGCCCATGGT atg SEQ ID GATTCTGATACCGACTACATCACCG long NO: 2 9° N 125-1 CGAGCGGAAGTCTAAATACACAAT 1221- SEQ ID 1198 NO: 3 9° N 119-5 3ATTGTGTATTTAGACTTCCGCTCG 1198- SEQ ID 1221 NO: 4 9° N 119-3 ATTGTGTATTTAGACTTCCGCTCGNNKNNKNN 1198- SEQ ID KTCGATCATCATAACCCACAAC 1251 NO: 5 NNK 9° N 119-6 GTAGAAGCTGTTGGCGAGGATCTTMNNMNNMN 1483- SEQ ID NCTGCCTGTAATCGAGGAGTTTC 1428 NO: 6 9° N 119-7 GTAGAAGCTGTTGGCGAGGATCTT 1483- SEQ ID 1460 NO: 7 9° N 125-2 AAGATCCTCGCCAACAGCTTCTAC 1460- SEQ ID 1483 NO: 8 9° N 133-3 GTCGTAGTCGGATGCTAACTACCAGGATCCTC term SEQ ID AATGCTTCTTCCCCTTCACCTTCAGCCACGC long NO: 9 reamp 133-4 GTCGTAGTCGGATGCTAACTACCAGG 9° N SEQ ID term NO: 10 long
1. The polymerase chain reaction (PCR) method was utilised following standard laboratory procedures (eg. Sambrook and Russell, 2001) 50 microlitre reactions contained the 9°N DM template, dNTPs, a suitable reaction buffer and PFU turbo hotstart (stratagene) following manufacturer's guidelines. Following an initial incubation at 94° C. for 10 sec, the DNA was amplified through 25 cycles, each containing three steps: 94° C., 10 sec; 50° C., 30 sec; 68° C., 150 sec to produce the following products:
2. product 1:—‘9°N atg long’ vs ‘9°N 1221-1198’=(133-lvs 125-1).
3. product 2:—‘9°N term long’ vs ‘9°N 1460-1483’=(133-3 vs 125-2).
4. product 3:—‘9°N 1198-1251 NNK’ vs ‘9°N 1483-1428’=(119-3 vs 119-6).
5. Analyse 5 μl on a gel, digest the remainder of the volume using DpnI (1 μl), then gel purify the digested products.
6. Combine 2 μl each of product 1 and product 3, amplify with primers, ‘9°N 1483-1460’ vs ‘reamp 9°N atg long’=(119-7 vs 133-2) using the conditions above.
7. Combine 2 μl each of product 3 and product 2, amplify with primers, ‘9°N 1198-1221’ vs ‘reamp 9°N term long’=(119-5 vs 133-3) using the conditions above.
8. Gel purify both products, combine 2 μl of each and reamplify with ‘reamp 9°N atg long’ vs ‘reamp 9°N term long’=(119-7 vs 133-4) using the conditions above.
9. The final DNA product was digested with NcoI (50 units) and BamHI (100 units) restriction enzymes for 2 hours at 37° C., and this fragment further purified using a Qiaquick procedure (Qiagen) following manufacturer's instructions. The resulting DNA was ligated into pET3d plasmid (Novagen), cut with NcoI and BamHI enzymes following standard procedures (Sambrook and Russell, 2001).

Transformation

[0198] A portion of the ligation was transformed directly into an strain of B. coli, such as BL21 (DE3) plysS, that allows expression of the variant genes, or alternatively into an intermediate host, such as E. coli DH5Alpha.

1. A transformation was carried out following standard procedures provided by manufacturer's of the relevant competent cells. Cells were plated onto two 20 cm×20 cm LB agar and carbenicillin (LBC) plates.
2. Colonies were grown overnight and an approximation of numbers indicated 50,000 independent clones.
3. The plates were overlaid with 50 ml each of LB carbenicillin broth. The colonies were manually agitated into solution with a disposable bacterial spreader. The liquor was transferred to several falcon tubes and further agitated manually to ensure that all colonies were distributed into the medium.
4. The tubes were transferred to an orbital shaker for incubation at 37° C. for two hours.
5. The bacterial broth was harvested and library plasmid DNA extracted by standard procedures.
6. The library plasmid DNA was used to transform BL21(DB3) pLysS bacterial expression hosts and a titre of colony forming units (CFU's) established for this plasmid preparation/host combination.

Screening Colonies for Incorporation of 3′ Modified Nucleotide Analogues

[0199] There are many different methods for screening for nucleotide incorporation that are variations on the method of Sagner et al. (1991). One suitable method is described herein for the incorporation of 3′ modified nucleotide analogues that uses a digoxigenin-3-O-methyl-carbonyl-e-aminocaproic acid (DIG) derivative of the relevant nucleotide analogue (ffT-DIG)

Day 1

[0200] 1. Transform library ligation into BL21(DE3)*pLysS strain (Invitrogen) and plate out onto a LB agar plate supplemented with 100 μg/ml carbenicillin (carb) and 34 μg/ml chloramphenicol (cam). Aim for 1×10exp5 colonies per 22 cm.sup.2 plate. Incubate at 37° C. overnight.

Day 2

[0201] 2. Pre-wet a Hybond C Extra nitrocellulose filter (Amersham Pharmacia Biotech) on a fresh LB agar plate supplemented with 100 μg/ml carbenicillin, 34 μg/ml chloramphenicol and 1 mM IPTG. Number the filter with a black biro and also number the plate from which the filter was taken. Carefully, so as not to trap air bubbles, lay the wetted filter paper over the colonies and leave for approximately 1 minute. Mark orientation marks with a needle (one, two and three spots around perimeter of filter to help alignment later). Carefully lift off the filter paper and place colony side up on the carb/cam/IPTG plate. Get rid of all air bubbles by lifting paper and re-laying. Incubate this filter on the plate at 37° C. for 4 hours. Also, incubate the original plate from which the colony lift was performed to allow the colonies to re-grow.

3. Lysis

[0202] Add 2 Al of Benzonase (Novagen) to 50 ml of Cell Lytic B Bacterial Cell lysis/extraction reagent (Sigma) solution. Pour over a square of 3 MM paper (Whatman) on a white tray and iron out any bubbles and remove excess solution by rolling over with a 10 ml pipette until flat and moist but not too wet. Pour off excess solution. Place filter on this paper colony side up for 1 hour at room temperature. Check 3 MM paper does not dry out. Preheat oven at 80° C.

4. Heat Treatment

[0203] Place 3 MM paper in new petri dish and wet with dH.sub.2O. Pour off excess dH.sub.2O and flatten paper using end of 5 ml pipette. Place filter colony side up on wetted 3 MM paper and seal petri dish with red electrical tape. Place in humidity box in 80° C. oven (already equilibrated to 80° C. with some water in the bottom of the tray) for 1 hour. (For big 22 cm.sup.2 plates place in autoclave bag taped up instead of humidity box). Defrost 10× Thermopol buffer (New England Biolabs).

5. Incorporation

[0204] Remove tape and 3 MM paper and place filter back in petri dish. Add incorporation solution pre-warmed to temperature that incorporation will be tested at. (1× Thermopol solution pH 8.8+0.05 μM ffT-DIG+0.05 μM dATP, dCTP, dGTP per filter). Use 10 ml volume per small round petri dish. (Use 90 ml for big 22 cm.sup.2 plates). If incubating at 45° C. or higher place tape around outside of petri dish. Incubate at required temperature statically for 30 min.

6. Washing

[0205] Pour off incorporation buffer and rinse with dH.sub.2O. Wash 2×5 min with DIG wash buffer (Roche) on rocker. Incubate in approx 10 ml DIG blocking buffer (Roche) on rocker overnight. (50 ml DIG blocking buffer for big 22 cm.sup.2 plates).

Day 3

7. Antibody Binding and Detection

[0206] Dilute anti-DIG alkaline phosphatase-conjugated antibody (Roche) 1:5000 in 10 ml DIG blocking buffer per small round filter (50 ml for big 22 cm.sup.2 plates). Incubate filters with antibody for 45 min at room temperature on rocker. Wash filters twice with DIG wash buffer for 15 min each on rocker. Equilibrate filters with 10 ml DIG detection buffer (Roche) for 2 min on rocker (50 ml for big 22 cm.sup.2 plates). Add 20 μl NBT/BCIP (Roche) to 10 ml fresh DIG detection solution per small round filter and incubate at room temperature on rocker for 20 min (100 μl NBT/BCIP to 50 ml DIG detection solution for big 22 cm.sup.2 plates. Petri dishes containing filters should be wrapped in foil during detection. Rinse filter thoroughly with tap water for a few minutes to stop reaction. Dry filters on 3 MM paper at 37° C.

Generalised Incorporation Experiment

[0207] This is a generalised method. Make a 15% polyacrylamide/urea sequencing gel according to standard procedures (Sambrook and Russell, 2001). For each time point add 5 μl formamide-bromophenol blue, cyanideloading dye (Sigma; stop mix) to labelled eppendorf in rack. Also, have ready eppendorf containing 1 μl CHASE mix for each reaction. Thaw all freezer components on ice.

Example Reaction Mix

[0208] For each reaction, mix together in eppendorf on ice:

5 μl 2 μM template

2.5 μl 2 U/μl 9°N DM

[0209] 5 μl 10× Thermopol buffer, or Tris-HCl, 50 mM, pH 8
30.5 μl dH.sub.2O
(50 μl total volume)

[0210] Other components of mix routinely used might be MnCl.sub.2, Tween, NaCl or other salts, EDTA and DTT. When other buffers or chemicals are used to test incorporation conditions. Place tubes in hot block set at 65° C., lower as necessary. Add 5 μl labelled primer (1 μM) to each reaction. For 0 min time point, remove 5 μl to 0 min time point tube containing 5 μl stop mix. Initiate reactions by adding 2 μl of 100 mM MgSO.sub.4+dNTPs, or nucleotide analogues, as appropriate, and at the required concentration (eg. 2 micromolar each). Start timer immediately after adding MgSO.sub.4/dNTP mix to first reaction. At each time point remove 5 μl to appropriate time point tube in rack containing 5 μl stop mix. After final time point, add 5 μl of reaction to 1 μl CHASE mix in eppendorf. Incubate at 65° C. for 10 min. Add 5 μl formamide loading dye. Load 3 μl of each reaction on gel. Run gel at 55 W for 2 h 15 min. Dry gel. Expose to phosphor screen overnight, scan using a phosphoimager instrument, and analyse with appropriate software.

EXAMPLE 2

[0211] In example 1 the so-called “double mutant” variant of the archaeal 9°N DNA polymerase that contains mutations in the 3′-5′ exonuclease domain (amino acids D141A; D143A) and in the catalytic site of the enzyme (amino acids Y409V; A485L) was modified to incorporate mutations at two distinct regions of the protein, herein named as region A (amino acids 408-410) and region B (amino acids 484-6). As a result a panel of seven altered polymerases were described, each of which carries mutations at both regions A and B.

[0212] In order to identify which region was responsible for the improved activity, a polymerase variant was constructed that carried only the changes in region A (these being the region A mutations VAL from the “2E” variant); region B was reverted back to the parental sequence of 9°N DM (A485L). This variant, known as “ED”, demonstrated an enhanced rate of incorporation of the modified nucleotides compared to the original mutant bearing changes at regions A and B together. This suggested that the mutation of only a single region of the polymerase gene could encode proteins that had enhanced enzymatic activity with 3′ modified nucleotide analogues compared to control polymerases. Therefore, from this observation a large panel of polymerase variants that carried changes in region A alone were constructed and screened for incorporation of the nucleotide analogues.

[0213] The polymerase variants that were identified from the screen of region A clones showed enhanced rates of incorporation of nucleotide analogues compared to the parental protein 9°N DM, and many of these new variants demonstrated improved activity compared to the ED polymerase. Furthermore, mutations to a third region of the polymerase (herein called region C; amino acids 493, 494 and 496 of 9°N polymerase), which together with region A forms part of the nucleotide binding pocket in the protein, did not result in improvements to the polymerase activity. These data demonstrated that changes to only certain amino acids within the nucleotide binding pocket that are important for the enhanced activity of the new polymerases.

Materials and Methods

Construction of Alone ED

[0214] The polymerase variant ED is a derivative of the 9°N DM DNA polymerase that bears the following mutations: L408V; V409A; P410L. This clone can be constructed in a variety of ways following standard molecular biology methods. One method for the construction of a gene encoding ED is described herein, and was used in our experiments.

[0215] DNA encoding the 2E gene product (as described in Example 1) was isolated and digested with restriction enzyme XhoI (New England Biolabs, NEB) following manufacturer's instructions. The resulting DNA fragment that encodes the region spanning amino acids 408-410 was purified from an agarose gel using standard methods. This DNA fragment was then ligated into the XhoI-digested vector backbone of the 9°N DM plasmid pNEB917(NEB; as described Example 1) using T4 DNA ligase (NEB), following standard procedures. The background of religated vector backbone was reduced by prior treatment with calf-intestinal phosphatase (EB) following standard procedures. The product of the ligation reaction was transformed into library efficiency E. coli DH5alpha competent cells (Invitrogen) following manufacturers instructions. Colonies were then screened by PCR using oligonucleotide primers that bind specifically to the 2E sequence (primer 2B 408-10; sequence 5′ GACTTCCGCTCGGTTGCGTTG 3′ SEQ ID NO:23) and the 9°N DM vector backbone (primer sequence 5′ AAGCCCCTCACGTAGAAGCC 3′ SEQ ID NO:24) in a 20 μl reaction mixture of the following composition: DNA/colony solution in water, 1 μl; 0.1 μM primers; 200 uM dNTPs; 1 unit Tag DNA polymerase; 2 μl 10×Taq reaction buffer. Reactions were cycled 30 times at 94° C., 1 min, 55° C., 1 min, 72° C., 2 min and positive colonies identified by inspection of the reaction products by agarose gel electrophoresis.

[0216] Construction of a library of clones with variation in region A (encoding amino acids 408-410)

[0217] The construction of a library of mutant proteins can be performed by different methods. The method used in this work involved two stages: the formation of a degenerate mix of DNA templates that encode the mutant polymerases, and the cloning of these DNA fragments into a suitable expression vector. The pool of degenerate DNA templates was formed by PCR using oligonucleotide primers Xba 408-410 (5′ GTGTATCTAGACTTCCGCTCGNNKNNKNNKTCAATCATCATAACCCACAAC 3′ SEQ ID NO:25; N, equimolar mixture of G, A, T and C bases; K, an equimolar mixture of G and T bases) and BamHI 3′ 9°N 5′ GTTAGCAGCCGGATCCTCACTTCTTCCCCTTCACCTTCAGCCACGC 3′ SEQ ID NO:26) which hybridise to the 9°N DM gene sequence. The DNA fragment was amplified by PCR in a 20 μl reaction as described above, using 10 ng 9°N DM template DNA. The 1200 bp DNA product was gel purified using a gel purification method (Qiagen) following the manufacturer's instructions, and the fragment digested with restriction enzymes XbaI and BamHI (NEB), using the 10×BamHI buffer (NEB) as recommended by the manufacturer. In the second stage, these DNA fragments were cloned into the XbaI-BamHI vector backbone of expression plasmid pSV13, a derivative of pNEB917 (NEB), which was constructed in a two step procedure, as follows. Firstly, the XbaI restriction site in the polylinker of the pNEB917 plasmid was destroyed by cutting the plasmid with XbaI, extension of the resulting 3′ overhang with Klenow polymerase, and relegation of blunt-ended DNA with T4 ligase, using standard molecular biology procedures (Sambrook and Russell, 2001). This plasmid, pSV12, was then mutated further to form pSV13 by the introduction of a unique XbaI site at position 1206 in the 9°N DNA sequence. This mutation was performed by PCR mutagenesis using oligonucleotide primers XbaI mut 5′ (5′ GGGACAACATTGTGTATCTAGACTTCCGCTCGCTGGTGCCTTC 3′ SEQ ID NO:27) and 1769R (5′ GTCTATCACAGCGTACTTCTTCTTCG 3′ SEQ ID NO:28) in one reaction, and XbaI mut 3′ (5′ GAAGGCACCAGCGAGCGGAAGTCTAGATACACAATGTTGTCCC 3′ SEQ ID NO:29) and 1032F 5′ GGCCAGAGCCTCTGGGACGTC 3′ SEQ ID NO:30) in a second reaction. PCR cycling conditions for these amplifications were 30 cycles of 95° C. for 1 min, 60° C. for 30 sec and 72° C. for 1.5 min using 1.5 units of Taq and 1 μM of primers per reaction. The products of these PCRs were two partially overlapping DNA fragments that were then used in a second PCR reaction with primers 1032F/1769R to produce a 737 bp DNA product, using identical reaction conditions. This final product was digested with XhoI (XhoI sites at 1040 and 1372 flanked the XbaI mutation) and ligated with XhoI cut pSV12. The orientation of the insertion was checked by restriction digestion and the resulting plasmid named pSV13. Both pSV12 and pSV13 were sequenced over the regions where the changes were made.

[0218] After ligation of the degenerate DNA fragments into pSV13, the DNA was transformed into competent E. coli BL21 Star (DE3) plysS (Invitrogen) following the manufacture's procedures, and plated out to single colonies as described in Example 1.

[0219] In a separate experiment, a different set of oligonucleotide primers was used to generate the mixture of DNA templates for cloning into pSV13. These primers also resulted in the production of degenerate series of bases encoding amino acids 408-410 of 9°N DM; however, in addition to these changes to region A, mutations were also introduced simultaneously to region C spanning amino acids 493, 494 and 496. The method used to make this degenerate pool of DNA fragments involved a 3-way PCR reaction with primers Xba 408-410 (described above) and 493-6Rev (5′ GCGTAGCCGTAMNNGCCMINMNNGCTGTTGGCGAGGATTTTGATCAGCCTC SEQ ID NO:31; M represents an equimolar mixture of bases A and C, and N represents an equimolar mixture of all 4 bases) in the first reaction, using reaction conditions as described above. The product of this reaction was then used as the template DNA in a second PCR reaction with primers Xba 408-410 and BamHI 3′ (5′ GCGCGCGGATCCTCACTTCTTCCCCTTCACC SEQ ID NO:32) using conditions described above. The DNA product from this second PCR was digested with restriction enzymes XbaI and BamHI and cloned into vector pSV13.

Screening Mutant Polymerases for Incorporation of Modified Nucleotides

[0220] The screening procedure that was used is described in Example 1. In one experiment, a total of 251 positive colonies were identified from a library of 4.2×10′ colonies (A and C regions randomised simultaneously), and in a second experiment, 255 positive colonies were identified from a library of 7×10′ colonies (region A randomised alone).

Further Screens of Polymerase Activity on Isolated Colonies

[0221] To identify which of the several hundred positive colonies from the filter screen had high incorporation activities, we devised an plate-based assay to measure the enzymatic addition of a Digoxigenin-labelled version of the relevant 3′ blocked nucleotide analogue (ffT-DIG; described in Example 1) to a biotinylated oligonucleotide hairpin substrate. E. coli colonies expressing mutant polymerase proteins were grown overnight with shaking and this culture was used to inoculate 0.8 mL LB containing carbenicillin and chloramphenicol and grown with shaking for 3h at 37° C. After 3h, protein expression was induced by the addition of 1 mM IPTG, and the culture grown for a further 2.5h. Cells were pellet by centrifugation, washed and resuspended in 30 μl wash buffer (50 mM Tris HCl pH 7.9, 50 mM Glucose, 1 mM BDTA) containing 4 mg/ml lysozyme, and incubated at room temperature for 15 minutes. Cells were then lysed by the addition of an equal volume of lysis buffer (10 mM Tris HCl pH 7.9, 50 mM KCl, 1 mM EDTA, 0.5% Tween-20) containing 1 mM phenylmethanesulfonyl fluoride (PMSF; Sigma) and 0.5% NP-40 and incubated for 1h at 75° C. before pelleting the cell debris. The supernatants, which contain the mutant polymerase enzymes, were stored at 4° C.

[0222] The incorporation reactions were set up as follows: 10 nM biotinylated substrate DNA was added to the wells of a Strepavidin-coated microtitre plate (Sigma) in 50 mM Tris-HCl, pH 8. Wells were washed with three times with PBS buffer containing 0.05% Tween-20 (PBS-T) before the addition of 0.2 μM ffT-DIG in a volume of 40 μL buffer (50 mM Tris HCl, pH8, 0.05% Tween-20, 4 mM MgSO.sub.4), and 10 μL bacterial supernatant containing the recombinant enzyme (above). Reactions were incubated for 15 mins at 30° C. or 65° C. and stopped by the addition of 10 μL 0.5M EDTA. The reaction solutions were removed and the wells were washed with PBS-T as before. The presence of incorporated DIG was detected using a horseradish peroxidase-linked anti-DIG antibody (Roche) and 3,3′,5,5′-tetramethylbenzidine substrate (Sigma).

[0223] In some experiments, the recombinant proteins were purified from the bacterial supernatants and the quantity of recombinant protein determined. It was then possible to compare the rates of incorporation reactions of different polymerase enzymes by mixing the DNA substrate, enzyme and ffT-DIG in solutions and stopping the reactions at different times by diluting an aliquot (50 μL) of the reaction mixture into 10 μL 0.5M EDTA solution. These different samples were then added to the wells of a streptavidin-coated microtitre plate. The amount of DIG incorporation was measured in an identical fashion to the above procedure.

Protein Purification Method

[0224] The DNA encoding the mutant DNA polymerases was transformed into BL21(DE3) RIL Codon Plus competent cells (Stratagene) using the manufacturer's instructions. Single colonies of transformed bacteria were used to inoculate a flask of LB broth containing carbenicillin and chloramphenicol and this culture was grown with shaking overnight at 37° C. This culture was used to inoculate a larger volume of LB broth containing carbenicillin and chloramphenicol at a 1:100 dilution, and this culture was then grown with shaking at 37° C. to an optical density of approximately 0.4-0.6 at 600 nm. Protein expression was induced by the addition of 1 mM IPTG, and the culture grown for a further 2.5h at 37° C. Cells were pelleted by centrifugation and washed in PBS buffer. Cells were then resuspended in 1/100th original volume of wash buffer (50 mM Tris HCl pH 7.9, 50 mM Glucose, 1 mM EDTA) containing 4 mg/ml lysozyme, and incubated at room temperature for 15 minutes. Cells were then lysed by the addition of an equal volume of lysis buffer (10 mM Tris HCl pH 7.9, 50 mM KCl, 1 mM EDTA, 0.5 $ Tween-20) containing 1 mM PMSF and 0.5% NP-40 and incubated for 30 mine at room temperature. The samples were then heated at 75° C. for 30 minutes and centrifuged at 18000 rpm for 30 mine at 4° C. to remove denatured protein. After washing the pellet in wash buffer (above), the samples were diluted 3-fold in 10 mM Tris/HCl, pH 7.5, 300 mM NaCL, 0.1 mM EDTA, 0.05% Triton-X-100 and applied to a DEAE FF HiTrap chromatography column (Amersham Biosciences). The target protein was located in the flow through fraction, and further purification is achieved by chromatography using a Heparin FF column (Amersham Biosciences), after dilution in 10 mM KPO4, pH 6.9, 0.1 mM EDTA, 0.05% Triton-X-100. Fractions were eluted from the column in the same buffer and those containing the target protein were identified by SDS-PAGE and staining with Coommassie Brilliant Blue staining as described in Sambrook and Russell, 2001.

Analysis of Incorporation Rates of Mutant Polymerases

[0225] The mutant polymerases were assessed for their ability to incorporate a 3′ blocked nucleotide analogue using a gel-based assay as described in generic form in Example 1. The rates of incorporation of the modified nucleotides were compared to purified forms of related DNA polymerases in both a single round of incorporation and through two rounds of nucleotide incorporation. The DNA template that was used for these experiments was a commercially-synthesised biotinylated oligonucleotide.

[0226] The method for two cycles of incorporation involves the binding of the DNA primer-template to streptavidin-coated beads (Dynalbeads). These are prepared as follows:

Resuspend beads in storage pot by pipetting up and down
Take 20 μL beads
Wash 3×200 μL TE buffer (10 mM Tris HCl pH7.5, 1 mM EDTA)
Add 50 μL B&W buffer (5 mM Tris HCl, pH7.5; 1M NaCl, 0.5 μM EDTA)

25 μL H.SUB.2.O

[0227] 25 μL of .sup.32P-labelled biotin DNA template (final concentration of 100 nM)

[0228] Throughout the protocol the beads must be agitated every 3-5 minutes to ensure that the reactions are able to proceed.

[0229] Incubate for 15 minutes at room temperature

Wash beads 3×200 μL TE buffer
Resuspend in 100 μL of TE and remove a 5 μL sample and add 5 μL gel loading buffer (0.5% bromophenol blue 0.5% xylene cyanol in formamide:H.sub.2O 4:1; Sigma B3269) with 0.05 M EDTA Remove TR buffer.

[0230] The first cycle of enzymatic incorporation is performed on these beads as follows:

[0231] Incorporation mix 1 is added to the bead pellet from above.

Incorporation mix 1:

[0232] 2 μL 0.1 mM 3′modified nucleotide triphosphate [0233] 10 μL 500 mM Trio pH 8.0 [0234] 5 μL 1% Tween-20 [0235] 4 μL 100 mM MgSO4 [0236] 50 μg/ml purified polymerase [0237] H.sub.2O to make up the volume to 100 μL
Reactions are incubated at 45° C. for 15 minutes
A 5 μL sample is removed and added to gel loading buffer with EDTA
A second 5 μL sample is also removed to which is added 1 μL of 4 natural nucleotide triphosphates (Sigma) and incubated for a further 10 minutes at 45° C. To 5 μL of this sample is added 1 μl gel loading buffer with BDTA

[0238] The first cycle of enzymology is then deblocked by treatment with tri (carboxyethyl) phosphine (TCEP) as follows:

Wash beads 3×200 μL TE buffer
Add 65 μL TCEP (100 mM) in water and incubate at 65° C. for 15 minutes
Wash beads 3×200 μL TE buffer
Add 65 μL of TE buffer and take out a 5 μL sample and add to gel loading buffer with EDTA

[0239] After removal of the TE buffer, a second cycle of enzymatic incorporation is then performed by the addition of incorporation mix 2, as follows:

[0240] To the deblocked beads (above) add: [0241] 1 μL 0.1 mM 3′ modified nucleotide analogue [0242] 5 μL mM Tris pH 8.0 [0243] 2.5 μL 11 Tween-20 [0244] 2 μL 100 mM MgSO4 [0245] 50 μg/ml purified DNA polymerase [0246] H.sub.2O to make up the volume to 50 μL

[0247] Take 5 μL samples out at M, 1, 2, 4, 10, 30, 60 mins and add to gel loading buffer with EDTA.

[0248] Heat all samples to 95° C. for 10 mins and load 3 μl on a 12% acrylamide gel (Sambrook and Russell, 2001).

Results

[0249] The following are sequences of amino acids 408-410 for DNA polymerases exhibiting improved activity compared to 9°N DM

YST

FAI

PAP

VAP

AAA

YAS.SUP.&

YAV.SUP.&

YGI.SUP.&

YSG.SUP.&

SGG.SUP.#

CST

IAL

CGG

SAL

SAA

CAA

YAA

QAS

VSS

VAG

VAV

FAV

AGI

YSS

AAT

FSS

VAL .sup.# this polymerase also contained the F493H mutation in region C.sup.& this clone was obtained from a library in which both regions A and C were randomised; however, the amino acid sequence of region C was identical to wild type

Amino Acid Frequency at Each Position in Region a Among Selected Clones

[0250] The frequency of the amino acids at each of the three positions suggests the following sequence preferences:

408: preference for aromatic amino acids, particularly Y and F
preference for amino acids with aliphatic side chains, eg. I, A, V
preference for cysteine and serine (C and S)
absence of charged amino acids (R, K, H, D, E)
absence of proline (P)
occurrence of glutamate (Q)
409: preference for A
preference for amino acids with small side chains (A, S, G)
absence of charged amino acids (R, K, H, D, E)
absence of proline (P)
410: preference for amino acids that have small side chains (S, A, G)
preference for amino acids with beta-branched side chains (I, T, V, L)
preference for proline (P)

Activity of Selected Polymerase Mutants

[0251] Time (mine) to 50% product conversion on second cycle of enzymology at 45° C., 50 mM Tris, pH8, 4 mM MgSO.sub.4, 0.05 (v/v) Tween, 50 μg/ml enzyme, and 2 μM 3′ modified nucleotide. Time to 50% product conversion on first cycle of incorporation shown in parentheses. For other mutants the time to 50% conversion on the first cycle was not measured in these experiments

TABLE-US-00005 Residues 408-10 time VAL (ED polymerase)  5.2 min (16 sec) YAS  1.5 min YAV  1.2 min (5 sec) FAP  5.5 min FAI  2.2 min YST  2.1 min CST 19.5 min AAA  6.9 min CAA   15 min VAP  5.9 min 9°N DM no product conversion under these conditions at first or second cycle

EXAMPLE 3—INCORPORATION OF DIFFERENT 3′ BLOCKED NUCLEOTIDES

[0252] In order to determine whether the modified polymerases described in the previous examples have the capability to incorporate different nucleotide analogues that bear large modifications at the 3′ position of the sugar, three different uracil nucleotide analogues (3′ O-allyl, 3'S-methyl, and 3′ O-azido methyl) were tested for their ability to be incorporated by two different modified nucleotides (9°N ED variant polymerase, and 9°N YAV variant polymerase), compared to a control polymerase (9°N DM). A single cycle of nucleotide incorporation was performed at different time intervals using a ‘single incorporation’ method described below. The results of the incorporation reaction (FIG. 3) demonstrate clearly that nucleotides analogues that bear different 3′ modifications on the sugar are all incorporated efficiently by the different DNA polymerases.

Methods

Single Incorporation

[0253] 1. In a clean reaction tube, mix the following components:
100 nM 32P-labelled duplex DNA substrate
50 μg/ml isolated DNA polymerase

50 mM TrisHCl, pH 8

0.05% Tween20

[0254] water to 47 μL
2. incubate the mixture at 45° C.
3. Add 4 mM MgSO.sub.4 and 2 μM 3′ modified nucleotide to the reaction mixture from 2, such that the total reaction volume is 50 μL
4. at various time intervals remove 5 μL aliquots from the reaction tube and mix with 5 μL gel loading buffer (described in Example 2)
5. Heat samples and load on acrylamide gels as described in Example 2.

EXAMPLE 4—INCORPORATION OF 3.SUP.4 .BLOCKED NUCLEOTIDES, WITH ALL FOUR BASES AND DIFFERENT FLUORESCENT REPORTER GROUPS

[0255] To determine if the DNA polymerases described in previous examples were capable of incorporating 3′ modified nucleotide derivatives of A, G, C and T bases, and also of incorporating such nucleotide derivatives further modified by different fluorescent reporter groups, a single incorporation reaction (as described in Example 3) was performed with the following 3′ O-azido methyl nucleotide derivatives:

TABLE-US-00006 TABLE IV Base Dye T Cy3 T Alexa 647 G Alexa 594 G Cy3 C Alexa 488 C Cy3 A Cy3 A Alexa 594 A Alexa 594 A Alexa 488 C Alexa 488 G Cy3 T Alexa 647 T Alexa 488 T Alexa 594

[0256] In each case, the 9°N ED polymerase variant was capable of greater than 90% substrate conversion at a 2 μM concentration of nucleotide within 3 minutes at 45° C.

EXAMPLE 5—ACTIVITY OF DNA POLYMERASES THAT HAVE A SINGLE MUTATION IN REGION A

[0257] To determine if a single mutation in region A was capable of conferring improved activity upon a control polymerase, point mutations were introduced into the 9°N DM polymerase to change codon 409 into Alanine (9°N DM V409A) or Glycine (9°N DM V409G). Mutations were introduced into the 9°N DM gene using the Quikchange XL site-directed mutagenesis procedure (Stratagene) following the manufacturer's instructions using 9°N DM DNA as template, and mutagenic primer pairs V409A 5′ GATGATTGACGGCGCCAGCGAGCGGAAG 3′ (SEQ ID NO: 33) and V409Areverse 5′ CTTCCGCTCGCTGGCGCCGTCAATCATC 3′ (SEQ ID NO: 34) for the 9°N DM V409A mutation, and 9DM 409G 5′ GATGATTGAAGGGCCCAGCGAGCGGAAG 3′ (SEQ ID NO: 35) and 9DM 409G reverse 5′ CTTCCGCTCGCTGGGCCCTTCAATCATC 3′ (SEQ ID NO: 36) for the 9°N DM V409G mutation. Positive clones were verified by DNA sequencing and purified preparations of each polymerase were prepared using protocols described in Example 2. To determine the activity of the different polymerases, two cycles of incorporation was performed using a 3′ O-azido methyl-modified nucleotide as described in Example 2. The data demonstrates that both 9°N DM V409A and 9°N DM V409G polymerases are capable of incorporation of 3′ modified nucleotides to a greater extent than the 9°N DM control polymerase when using a nucleotide that bears a large 3′ modification on the sugar (FIG. 4).

EXAMPLE 6

Incorporation of 3′ Blocked Nucleotide Analogues by Modified DNA Polymerases at 30° C.

[0258] To measure the incorporation of 3′ blocked nucleotide analogues at different temperatures, a modified version of the microtitre-based incorporation assay (described in Example 2) was developed. In this assay, a mixture of biotinylated DNA substrate at 10 nM concentration and purified polymerase enzyme at 50 nM concentration was mixed in a buffer comprising 50 mM Tris, 0.05% Tween 20 and 10 mM KCl. In a separate reaction tube, a mixture of 0.2 μM ffT-DIG (as described in Example 2) and 4 mM MgSO4 was made in an identical buffer to that described for the first mixture. Reaction volumes were adjusted so that the mixture in tube 1 comprised 40 μL, and in tube 2, 10 μL. Depending on the number of timepoints required in the experiment, the reaction volumes were scaled appropriately. All tubes were prewarmed at the appropriate temperature and the contents of tube 2 was added to tube 1 to initiate the incorporation reaction. At various time intervals, 50 μL of the combined reaction mixture was removed and the incorporation reaction terminated by the addition of 100 mM EDTA (final concentration). The different aliquots of stopped reaction mixture were then added to separate wells of a streptavidin-coated microtitre plate, and the extent of ffT-DIG incorporation was assessed as described in Example 2.

[0259] The results of the incorporation of a ffT-DIG nucleotide analogue with the 9°N DM ED and 2E polymerase variants at 30° C. are shown in FIG. 5, together with a comparison of the activity of 9°N DM control polymerase.

EXAMPLE 7

Incorporation of Different Concentrations of 3′ Modified Nucleotides by Modified DNA Polymerases

[0260] To determine over what range of nucleotide concentrations the modified DNA polymerases were capable of efficient incorporation of the 3′ modified nucleotide analogues, a two cycle incorporation experiment was performed as described in Example 2. The incorporation rates for a 3′ O-azido methyl-modified nucleotide (described in Example 2) were measured over a range of nucleotide concentrations from 0.2 μM to 50 μM of ffT, and the results for the 9°N YAV variant polymerase (exo-) are shown in FIG. 6. These data demonstrate that the modified polymerases described herein are capable of incorporation of 3′ modified nucleotides over a wide range of nucleotide concentrations on the second cycle of enzymatic incorporation. Indeed, these data also suggest that these modified polymerases would be capable of incorporation of 3′ blocked nucleotides at concentration in excess of 50 μM, and below 0.2 μM. Furthermore, it has been possible to determine the rates of nucleotide incorporation at the first cycle of enzymatic incorporation with 3′ modified nucleotide analogues by using a single cycle experiment as described in example 3. Under those conditions, it is possible to measure the incorporation of a 3′ blocked nucleotide at a concentration as low as 50 nM with the 9°N YAV polymerase variant at 45° C.