Microbial hosts engineered for increased tolerance to temperature shifts

Abstract

The present invention relates to microbial host cells that have been engineered for increased tolerance to temperature shifts, for increased performance at temperatures different from the microorganism's optimal temperature and/or for changing at least one of the microorganism's cardinal temperatures by replacing an endogenous NAD.sup.+ biosynthesis gene by a heterologous gene encoding a corresponding enzyme with another temperature profile and/or from a microorganism with a different optimum growth temperature. The invention further relates to processes wherein the engineered microbial host cells are used for producing a fermentation product, and to the use nucleotide sequences encoding NAD.sup.+ biosynthesis gene for changing at least one of a microorganism's cardinal temperatures and/or for improving a microorganism's tolerance to temperature shifts.

Claims

1. A microbial host cell comprising a nucleotide sequence encoding a heterologous NAD+ biosynthesis enzyme, wherein at least one of: a) the heterologous NAD+ biosynthesis enzyme is from a microbial donor organism with an optimum growth temperature that is different from the optimum growth temperature of the microbial host cell, or from a microbial donor organism that has a wider range of growth temperatures than the microbial host cell; and, b) the heterologous NAD+ biosynthesis enzyme has a higher activity than the corresponding endogenous NAD+ biosynthesis enzyme of the host cell at a temperature that differs from the optimum growth temperature of the host cell, as determined in an assay for activity of the NAD+ biosynthesis enzyme wherein the activity of the endogenous and heterologous NAD+ biosynthesis enzymes is determined over a period of time of at least 10 minutes.

2. A microbial host cell according to claim 1, wherein the heterologous NAD+ biosynthesis enzyme is selected from the group consisting of L-aspartate oxidase, quinolinate synthase and quinolinate phosphoribosyl-transferase, and wherein preferably the microbial host cell comprises nucleotide sequences encoding two or all three of the heterologous NAD+ biosynthesis enzyme from the group consisting of L-aspartate oxidase, quinolinate synthase and quinolinate phosphoribosyl-transferase.

3. A microbial host cell according to claim 1 or 2, wherein the temperature difference in at least one of a) and b) is at least 2° C.

4. A microbial host cell according to any one of the preceding claim 1, wherein at least one of: a) the heterologous NAD+ biosynthesis enzyme has a higher activity than the corresponding endogenous NAD+ biosynthesis enzyme in the host cell at a temperature that is higher than the optimum growth temperature of the host cell; and, b) the heterologous NAD+ biosynthesis enzyme is from a microbial donor organism with an optimum growth temperature that is higher than the optimum growth temperature of the microbial host cell.

5. A microbial host cell according to claim 1 wherein the host cell comprises a genetic modification that reduces or eliminates the specific activity of an endogenous NAD+ biosynthesis enzyme that corresponds to the heterologous NAD+ biosynthesis enzyme encoded by the nucleotide sequence comprised in the host cell, wherein preferably, the nucleotide sequence encoding a heterologous NAD+ biosynthesis enzyme replaces the endogenous nucleotide sequence encoding the corresponding endogenous NAD+ biosynthesis enzyme.

6. A microbial host cell according to claim 1, wherein the host cell is a yeast, a filamentous fungus, a eubacterium or an archaebacterium, preferably a Gram-positive or a Gram-negative bacterium.

7. A microbial host cell according to claim 6, wherein the host cell is of a genus selected from the group consisting of: Escherichia, Anabaena, Actinomyces, Acetobacter, Caulobacter, Clostridium, Gluconobacter, Gluconacetobacter, Rhodobacter, Pseudomonas, Paracoccus, Bacillus, Brevibacterium, Corynebacterium, Rhizobium Sinorhizobium, Flavobacterium, Klebsiella, Enterobacter, Lactobacillus, Lactococcus, Streptococcus, Oenococcus, Leuconostoc, Pediococcus, Carnobacterium, Propionibacterium, Enterococcus, Bifidobacterium, Methylobacterium, Micrococcus, Staphylococcus, Streptomyces. Zymomonas, Streptococcus, Bacteroides, Selenomonas, Megasphaera, Burkholderia, Cupriavidus, Ralstonia, Methylobacterium, Methylovorus, Rhodopseudomonas, Acidiphilium, Dinoroseobacter, Agrobacterium, Sulfolobus, Sphingomonas, Acremonium, Aspergillus, Aureobasidium, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trichoderma, Ustilago, Saccharomyces, Kluyveromyces, Candida, Pichia, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces, Yarrowia, Cryptococcus, Debaromyces, Saccharomycecopsis, Saccharomycodes, Wickerhamia, Debayomyces, Hanseniaspora, Ogataea, Kuraishia, Komagataella, Metschnikowia, Williopsis, Nakazawaea, Torulaspora, Bullera, Rhodotorula, and Sporobolomyces.

8. A microbial host cell according to claim 1, wherein the microbial donor organism is a psychrophilic, a psychrotrophic or a thermophilic organism and wherein preferably the microbial host cell is a mesophile.

9. A microbial host cell according to claim 1, wherein the heterologous NAD+ biosynthesis enzyme is a modified version of an enzyme that is endogenous to the host cell, which modified version enzyme comprises at least one modification in its amino acid sequence as compared to the endogenous enzyme, and wherein the modified version has a higher activity than the endogenous enzyme at a temperature that differs from the optimum growth temperature of the host cell, in an assay for activity of the NAD+ biosynthesis enzyme wherein the activity of the endogenous and the modified enzymes is determined over a period of time of at least 10 minutes.

10. A microbial host cell according to any one of the preceding claim 1, wherein the heterologous NAD+ biosynthesis enzyme comprises an amino acid sequence selected from the group consisting of: a) an amino acid sequence that is at least 45% identical to SEQ ID NO: 2; b) an amino acid sequence that is at least 45% identical to SEQ ID NO: 4; c) an amino acid sequence that is at least 45% identical to SEQ ID NO: 5; d) an amino acid sequence that is at least 45% identical to SEQ ID NO: 6; e) an amino acid sequence that is at least 45% identical to SEQ ID NO: 8; f) an amino acid sequence that is at least 45% identical to SEQ ID NO: 9; g) an amino acid sequence that is at least 45% identical to SEQ ID NO: 10; h) an amino acid sequence that is at least 45% identical to SEQ ID NO: 11; i) an amino acid sequence that is at least 45% identical to SEQ ID NO: 13; j) an amino acid sequence that is at least 45% identical to SEQ ID NO: 14; k) an amino acid sequence that is at least 45% identical to SEQ ID NO: 15; and, 1) an amino acid sequence that is at least 45% identical to SEQ ID NO: 16.

11. A process for producing a fermentation product, the process comprises the steps of: (a) culturing a host cell as defined in claim 1 in a medium, whereby the host cell converts nutrients in the medium to the fermentation product; and, (b) optionally, recovery of the fermentation product.

12. A process according to claim 11, wherein the process comprises a shift in temperature, wherein preferably the shift in temperature is a shift of at least 2, 5, 7 or 10° C.

13. Use of a nucleotide sequence encoding a NAD+ biosynthesis enzyme that is heterologous to a microbial host cell, for at least one of: a) changing at least one of the minimum, maximum and optimum growth temperature of the microbial host cell; and, b) improving resistance of the microbial host cell to a shift in temperature, wherein preferably the resistance of the microbial host cell to a shift to a higher temperature is improved.

14. A use according to claim 13, wherein the microbial host cell comprises a nucleotide sequence encoding a heterologous NAD+ biosynthesis enzyme wherein at least one of: a) the heterologous NAD+ biosynthesis enzyme is from a microbial donor organism with an optimum growth temperature that is different from the optimum growth temperature of the microbial host cell, or from a microbial donor organism that has a wider range of growth temperatures than the microbial host cell; and, b) the heterologous NAD+ biosynthesis enzyme has a higher activity than the corresponding endogenous NAD+ biosynthesis enzyme of the host cell at a temperature that differs from the optimum growth temperature of the host cell, as determined in an assay for activity of the NAD+ biosynthesis enzyme wherein the activity of the endogenous and heterologous NAD+ biosynthesis enzymes is determined over a period of time of at least 10 minutes.

15. A use according to claim 13, wherein at least one of: a) at least one of the minimum, maximum and optimum growth temperature of the microbial host cell is changed by at least 1° C.; and, b) the lag phase of the microbial host cell upon a shift in temperature of at least 2° C., is reduced by at least a factor 1.1.

Description

DESCRIPTION OF THE FIGURES

[0083] FIG. 1. Overview of the pathway for de novo biosynthesis of NAD.sup.+. L-Aspartate oxidase (NadB) and quinolinate synthase (NadA) are part of the quinolinate synthase system. Quinolinate is then processed with nicotinate by NadC (quinolinate phosphoribosyl-transferase) to form nicotinate mononucleotide.

[0084] FIG. 2. E. coli growth curve after a temperature shift from 37 to 44° C. BW25113 wt, JW2558 (E. coli BW25113 ΔnadB) EnadB, and JW2558 (E. coli BW25113 ΔnadB) are used as controls. Growth monitored via a plate reader experiment, inoculated at OD.sub.600 0.05. Strains grown in M9 minimal medium. EnadB indicates expression of E. coli nadB from plasmid; PnadB indicates expression of P. putida nadB from plasmid; and BnadB indicates expression of B. smithii nadB from plasmid.

[0085] FIG. 3. Growth curves of P. putida KT2440 derivatives after a temperature shift from 30 to 40° C. P. putida KT2440 ΔnadB PnadB and P. putida KT2440 ΔnadB are used as controls. Growth monitored via a plate reader experiment, inoculated at OD.sub.600 0.05. Strains grown in DeBont minimal medium. KT2440 p638- indicates empty expression vector as negative control; KT2440 EnadB indicates expression of E. coli nadB from plasmid; KT2440 PnadB indicates expression of P. putida nadB from plasmid; and KT2440 TnadB indicates expression of T. flocculiformis nadB from plasmid.

[0086] FIG. 4. Flask growth experiments with P. putida KT2440 derivatives. Strains precultured in DeBont minimal medium o/n at 30° C., then passaged with a starting OD of 0.05 to 20 ml fresh medium. Growth was monitored by sampling at given time points and determining the OD, over a period of 21 h. P. putida KT2440 ΔnadB PnadB and P. putida KT2440 ΔnadB are used as controls. KT2440 p638- indicates empty expression vector as negative control; KT2440 EnadB indicates expression of E. coli nadB from plasmid; KT2440 PnadB indicates expression of P. putida nadB from plasmid; KT2440 BnadB indicates expression of B. smithii nadB from plasmid; and KT2440 TnadB indicates expression of T. flocculiformis nadB from plasmid.

[0087] FIG. 5. Flask growth experiments with P. putida KT2440 derivatives. Strains were isolated from the 40° C. cultures and passaged with a starting OD of 0.05 to 20 ml fresh medium. The cultures were grown at 41° C. Growth was monitored by sampling at given time points and determining the OD, over a period of 21 h. P. putida KT2440 ΔnadB PnadB and P. putida KT2440 ΔnadB are used as controls. KT2440 p638- indicates empty expression vector as negative control; KT2440 p638 EnadB indicates expression of E. coli nadB from plasmid; KT2440 p638 PnadB indicates expression of P. putida nadB from plasmid; KT2440 p638 BnadB indicates expression of B. smithii nadB from plasmid; and KT2440 p638 TnadB indicates expression of T. flocculiformis nadB from plasmid.

[0088] FIG. 6. Top: Saccharomyces cerevisiae at 30° C., Bottom Saccharomyces cerevisiae at 41° C. From left to right YNB medium, YNB+Aspartate medium and YNB+Tryptophan medium. Depicted are S. cerevisiae BY4741 WT (triangle), pRV156 empty plasmid (circle), pRV156 nadABC B. smithii (square), pRV157 nadABC P. putida (diamond). Growth in flasks was monitored for 24 hours. Blank flasks with un-inoculated medium were used to correct for background emission.

EXAMPLES

[0089] Materials and Methods

[0090] Strains and Culture Conditions

[0091] Bacterial strains and plasmids used in this study are listed in Table 1. E. coli DH5a was used for routine cloning procedures and plasmid maintenance, and was routinely cultivated at 37° C. in aerated conditions in LB medium (10 g/l tryptone, 10 g/l NaCl and 5 g/l yeast extract, adding 15 g/l agar for solid medium), optionally containing antibiotics for plasmid selection (10 μg/ml gentamycin as indicated). P. putida KT2440, P. putida KT2440 ΔnadB, E. coli BW25113 or E. coli BW25113 ΔnadB (JW2558) were routinely cultivated under oxic conditions in minimal medium. P. putida was cultured at 30° C. in De Bont minimal medium (DB) [10] (3.88 g/L K.sub.2HPO.sub.4, 1.63 g/l NaH.sub.2PO.sub.4.2H.sub.2O, 2.00 g/l (NH.sub.4).sub.2SO.sub.4, 0.1 g/l MgCl.sub.2.6H.sub.2O, 10 mg/l EDTA, 2 mg/l ZnSO.sub.4.7H.sub.2O, 1 mg/l CaCl.sub.2.2H.sub.2O, 5 mg/l FeSO.sub.4.7H.sub.2O, 0.2 mg/l Na.sub.2MoO.sub.4.2H.sub.2O, 0.2 mg/l CuSO.sub.4.5H.sub.2O, 0.4 mg/l CoCl.sub.2.6H.sub.2O, 1 mg/l MnCl.sub.2.2H.sub.2O, All chemicals and antibiotics were purchased at Machery-Nagel GmbH & Co. (Düren). E. coli was cultured at 37° C. in M9 minimal medium (5×M9 minimal salts, 1M MgSO.sub.4, 1M CaCl.sub.2, Thiamin and 100× DeBont Trace Elements). In all experiments 20 g/l glucose was used as the sole carbon source, with 10 μg/ml gentamycin to select for recombinant strains. The optical cell density was analysed photometrically at 600 nm (OD600). Precultures were prepared by overnight (o/n) cultivation at 200 rpm at the indicated cultivation temperature.

[0092] Plasmid Construction

[0093] DNA segments were amplified by colony PCR using the Phire Green Hot Start II DNA Polymerase kit (Thermo Fisher Scientific, Waltham, Mass., USA), according to the manufacturer's protocol. Clones were regularly checked by colony PCR and sequencing. All primer oligonucleotides used were purchased from Sigma-Aldrich Co. (Table 2). Restriction enzymes were obtained from NEB (New England BioLabs®.sub.inc.). Using the Standardized SEVA plasmid system [17, 18], the cargo (nadB from E. coli, P. putida, T. flocculiformis or B. smithii) was designed with BamHI and EcoRI restriction sites on the 5′-end and 3′-end, respectively. DNA fragments were purified from agarose gel using the Machery-Nagel GmbH & Co. KG Gel Purification Kit (Machery-Nagel GmbH & Co. Düren, Germany). Plasmid inserts were verified by gel electrophoresis or DNA sequencing via Lightrun sequencing at GATC Biotech. T4 DNA Ligase (Roche Applied Science Indianapolis, Ind. USA) was used to ligate the isolated DNA fragments in the pSEVA 638 backbone. DNA segments were stored at −20° C. Plasmids were electroporated into competent P. putida KT2440 ΔnadB or into competent E. coli JW2558.

[0094] Growth Experiments

[0095] Platereader experiments were performed to monitor growth at varying temperatures closely over periods of 24-72 h. Recombinant E. coli was precultured at 37° C. in minimal M9 medium with glucose and 10 μg/ml Gentamycin as a selection marker. Recombinant P. putida was precultured at 30° C. in minimal DeBont medium with 20 g/l glucose and 10 μg/ml Gentamycin as a selection marker. 96 wells-plates were inoculated at a starting OD of 0.05. As a control, blank wells and wells inoculated with wild-type E. coli BW25113 or P. putida KT2440 were prepared with M9 or DeBont medium without selection marker. The platereader was run 48 to 72 h at varying temperatures while measuring the OD every 20 minutes, whilst shaking continuously. The plates were taped on both sides to counter condensation at higher temperatures.

[0096] Statistical Analysis

[0097] All of the reported experiments were independently repeated twice. Figures represent the mean values of corresponding biological triplicates and the standard deviation. The level of significance of the differences when comparing results was evaluated by means of analysis of variance (ANOVA), with α=0.05.

Example 1

[0098] We found that if the gene coding for nadB in a mesophilic strain is replaced by the nadB gene of a thermophile, the mesophilic strain is more resistant to shifts in temperature instantly. Since nadB deletion directly influences the redox balance, changing either nadC or nadA has a similar effect. The increase in tolerance also occurs when shifting to lower temperatures during growth, after the integration of a psychrophilic nadB, nadC or nadA gene.

[0099] This finding was proved by using two mesophilic strains, E. coli BW25113 and P. putida KT2440, both from which the nadB gene was removed (E. coli ΔnadB and P. putida ΔnadB). The nadB gene was reintroduced via the pSEVA plasmid system. Plasmids were prepared with the nadB gene of E. coli BW25113, P. putida KT2440, B. smithii DSM 4216 (a thermophile, optimal growth temperature of 55° C., temperature growth range of 25-65° C.) and T. flocculiformis DSM2094 (a psychrotolerant mesophile, optimal growth temperature of 35° C., temperature growth range of 2° C.-40° C.). The nadB knock out strains were used as negative controls. All plasmids were introduced in either the E. coli ΔnadB strain or the P. putida ΔnadB strain. The strains were cultivated in rich LB or minimal M9 medium. Precultures were prepared at the strain specific optimal temperature (P. putida at 30° C., E. coli at 37° C.). Growth experiments were performed in a plate reader to determine the lag phase before adjusting to a temperature shift.

[0100] FIG. 2 shows that in E. coli, the replacement of the inherent gene by the thermophilic B. smithii nadB gene results in a 10 times shorter lag phase when shifting the growth temperature from 37° C. to 44° C., compared to a wild type control.

[0101] FIG. 3 shows that in P. putida, the replacement of the inherent gene by that of E. coli or B. smithii caused the maximum growth rate to increase by a factor 2, from 0.0453 to 0.0943 h.sup.−1 (E. coli) or 0.0922 h.sup.−1 (B. smithii) after a temperature shift from 30° C. to 40° C. FIG. 4 shows the growth of the various P. putida strains in shake flasks at 40° C. Isolation of the growing strains and increasing the temperature by 1° C. even resulted in growth at 41° C., which P. putida normally is not capable of (FIG. 5).

Example 2

[0102] Further experimentation including the expression of nadA-nadB-nadC of P. putida or B. smithii in S. cerevisiae (BY4741: MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0)

[0103] FIG. 6 shows that expression of nadA-nadB-nadC of P. putida or B. smithii in S. cerevisiae consistently has a positive effect on temperature tolerance. The increased temperature tolerance effect also does not hold under anoxic conditions, linking the surplus of NAD+ to a decrease in reactive oxygen species which is now shown to increase temperature tolerance.

TABLE-US-00004 TABLE 1 Bacterial strains and plasmids used in this study Growth Bacterial strain or temperature Source or plasmid Relevant characteristics .sup.a range references Escherichia coli DH5α Cloning host; ϕ80lacZΔM15 recA1 endA1 27-44° C. [11] gyrA96 thi-1 hsdR17(r.sub.κ.sup.− m.sub.κ.sup.+ supE44 relA1 deoR Δ(lacZYA-argF)U169 BW25113 lacI.sup.q rrnB.sub.T14 ΔlacZ.sub.WJ16 hsdR514 [12]-[14] ΔaraBAD.sub.AH33 ΔrhaBAD.sub.LD78 JW2558 BW25113 with ΔnadB [12] Pseudomonas putida KT2440 Wild-type strain, spontaneous restriction- 25-40° C. [15] deficient derivative of strain mt-2 cured of the TOL-plasmid pWW0 KT2440 ΔnadB KT2440 with a knocked out nadB gene This study Bacillus smithii DSM 4216 Wild type strain 25-65° C. [16] Trichococcus flocculiformis DSM2094 Wild type strain [19] Plasmid pSEVA 638.sup.b Expression vector; pBBR1 xylS-Pm Gm.sup.R [17, 18] pSEVA 638 pSEVA 638 with nadB from Escherichia coli This study N_Eco.sup.b pSEVA 638 N pSEVA 638 with nadB from Pseudomonas This study Ppu.sup.b putida pSEVA 638 N pSEVA 638 with nadB from Bacillus smithii This study Bsm.sup.b pSEVA 638 N Tfl.sup.b pSEVA 638 with nadB from T. flocculiformis This study .sup.a Antibiotic marker: Gm, gentamycin .sup.bPlasmids belonging to the SEVA (Standard European Vector Architecture) collection [17, 18].

TABLE-US-00005 TABLE 2 Primers used in this study Primer purpose Forward primer Reverse primer E. coli BW25113 ACTGGAGCTCCACCCCAGGAa ACTGGGATCCTTATCTGTTTATGTA nadB isolation ggaggaaaaaacatATGAATACTCT ATGATTGCCGG CCCTGAACATTC P. putida ACTGGAGCTCCACCCCAGGAa ACTGGGATCCTCAGAGCGGGTTAA KT2440 nadB ggaggaaaaaacatATGAGCCAACA GGATGGTG isolation ATTCCAACATGATGTCC B. smithii DSM cagtCATatggagaaagaagcggatg cagtGGATCCttaagcatggattccagtttg 4216 nadB isolation T. flocculiformis CATATGATGCGCAACTATGATG GGATCCTTACTTTGCATGAGCTTCC DSM 2094 nadB TCC TC  isolation

TABLE-US-00006 TABLE 3 NAD.sup.+ biosynthesis genes and enzymes in the sequence listing. Enzyme/gene Type SEQ ID NO B. smithii nadB DNA 1 B. smithii nadB protein 2 T. flocculiformis nadB DNA 3 T. flocculiformis nadB protein 4 P. putida KT2440 nadB protein 5 E. coli BW25113 nadB protein 6 B. smithii nadA DNA 7 B. smithii nadA protein 8 T. flocculiformis nadA protein 9 P. putida KT2440 nadA protein 10 E. coli BW25113 nadA protein 11 B. smithii nadC DNA 12 B. smithii nadC protein 13 T. flocculiformis nadC protein 14 P. putida KT2440 nadC protein 15 E. coli BW25113 nadC protein 16

REFERENCES

[0104] [1] K. N. Thomas, A. Ben-Bassat, and J. G. Zeikus, “Ethanol Production by Thermophilic Bacteria: Fermentation of Cellulosic Substrates by Cocultures of Clostridium thermocellum and Clostridium thermohydrosulfuricum,” Appl. Environ. Microbiol., vol. 41, no. 6, pp. 1337-1343, January 1981. [0105] [2] J. G. Zeikus, “Thermophilic bacteria: Ecology, physiology and technology,” Enzyme Microb. Technol., vol. 1, no. 4, pp. 243-252, October 1979. [0106] [3] H. Sakuraba, K. Yoneda, I. Asai, H. Tsuge, N. Katunuma, and T. Ohshima, “Structure of 1-aspartate oxidase from the hyperthermophilic archaeon Sulfolobus tokodaii,” Biochim. Biophys. Acta, vol. 1784, no. 3, pp. 563-571, March 2008. [0107] [4] I. Marinoni et al., “Characterization of 1-aspartate oxidase and quinolinate synthase from Bacillus subtilis,” FEBS J., vol. 275, no. 20, pp. 5090-5107, October 2008. [0108] [5] S. Nasu, F. D. Wicks, and R. K. Gholson, “L-Aspartate oxidase, a newly discovered enzyme of Escherichia coli, is the B protein of quinolinate synthetase.,” J. Biol. Chem., vol. 257, no. 2, pp. 626-632, January 1982. [0109] [6] W. T. Booth e.a., “Streptococcus pyogenes quinolinate-salvage pathway-structural and functional studies of quinolinate phosphoribosyl transferase and NH3-dependent NAD+ synthetase”, The FEBS Journal, vol. 284, nr. 15, pp. 2425-2441, aug. 2017. [0110] [7] P. De Maayer, D. Anderson, C. Cary, en D. A. Cowan, “Some like it cold: understanding the survival strategies of psychrophiles”, EMBO Rep, vol. 15, nr. 5, pp. 508-517, mei 2014. [0111] [8] M. Rafiq e.a., “Recovery of metallo-tolerant and antibiotic resistant psychrophilic bacteria from Siachen glacier, Pakistan”, PLoS ONE, vol. 12, nr. 7, p. e0178180, 2017. [0112] [9] P. Poltronieri, Microbiology in Dairy Processing: Challenges and Opportunities. John Wiley & Sons, 2017. [0113] [10] S. Hartmans, J. P. Smits, M. J. van der Werf, F. Volkering, and J. A. M. de Bont, “Metabolism of Styrene Oxide and 2-Phenylethanol in the Styrene-Degrading Xanthobacter Strain 124X,” Appl. Environ. Microbiol., vol. 55, no. 11, pp. 2850-2855, November 1989. [0114] [11] D. Hanahan and M. Meselson, “Plasmid screening at high colony density,” Gene, vol. 10, no. 1, pp. 63-67, June 1980. [0115] [12] T. Baba et al., “Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection,” Mol. Syst. Biol., vol. 2, p. 2006.0008, February 2006. [0116] [13] F. Grenier, D. Matteau, V. Baby, and S. Rodrigue, “Complete Genome Sequence of Escherichia coli BW25113,” Genome Announc., vol. 2, no. 5, pp. e01038-14, October 2014. [0117] [14] K. A. Datsenko and B. L. Wanner, “One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products,” Proc. Natl. Acad. Sci. U.S.A, vol. 97, no. 12, pp. 6640-6645, June 2000. [0118] [15] M. Bagdasarian et al., “Specific-purpose plasmid cloning vectors II. Broad host range, high copy number, RSF 1010-derived vectors, and a host-vector system for gene cloning in Pseudomonas,” Gene, vol. 16, no. 1-3, pp. 237-247, December 1981. [0119] [16] L. K. NAKAMURA, I. BLUMENSTOCK, and D. CLAUS, “Taxonomic Study of Bacillus coagulans Hammer 1915 with a Proposal for Bacillus smithii sp. nov.,” Int. J. Syst. Evol. Microbiol., vol. 38, no. 1, pp. 63-73, 1988. [0120] [17] R. Silva-Rocha et al., “The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes,” Nucleic Acids Res., vol. 41, no. Database issue, pp. D666-D675, January 2013. [0121] [18] E. Martinez-Garcia, T. Aparicio, A. Goñi-Moreno, S. Fraile, and V. de Lorenzo, “SEVA 2.0: an update of the Standard European Vector Architecture for de-/re-construction of bacterial functionalities,” Nucleic Acids Res., vol. 43, no. Database issue, pp. D1183-D1189, January 2015. [0122] [19] Strepis et al., Int J Syst Evol Microbiol. 2016 October; 66(10):3957-3963. doi: 10.1099/ijsem.0.001294. Epub 2016 Jul. 11.