IMPROVED PRODUCTION OF RIBOFLAVIN

Abstract

The present invention is related to an improved process for production of vitamin B2 using a genetically engineered host cell comprising a heterologous enzyme with pyridoxal phosphatase activity. Using said modified host cell, the yield of riboflavin production could be increased by at least about 5%.

Claims

1. A riboflavin-producing host cell comprising riboflavin biosynthetic genes (rib operon) and a heterologous enzyme with pyridoxal phosphatase [EC 3.1.3.74] activity.

2. The riboflavin-producing host cell of claim 1 comprising the riboflavin biosynthetic genes from Bacillus.

3. The riboflavin-producing host cell of claim 1 comprising a polypeptide with at least about 70% identity to SEQ ID NO:2.

4. The riboflavin-producing host cell according to claim 3, expressing a polynucleotide encoding a polypeptide with at least 70% identity to SEQ ID NO:2.

5. The riboflavin-producing host cell according to claim 1, wherein the heterologous enzyme is selected from bacteria, preferably Rhizobia, more preferably Sinorhizobium.

6. The riboflavin-producing host cell according to claim 1, wherein the activity of the endogenous ribC gene has been reduced.

7. The riboflavin-producing host cell according to claim 1 producing wherein the yield of riboflavin is increased by at least about 5% from a given carbon source compared to production of riboflavin using a host cell not expressing a polynucleotide encoding a polypeptide with at least 70% identity to SEQ ID NO:2.

8. The riboflavin-producing host cell according to claim 1, which is selected from Bacillus, Corynebacterium, Streptococcus, Clostridium, Lactococcus or Streptomyces, preferably selected from the group consisting of Bacillus subtilis, Bacillus cereus, Bacillus amyloliquefaciens, Bacillus stearothermophilus, Bacillus halodurans, Bacillus licheniformis, Streptococcus aureus, Streptococcus pneumoniae, Clostridium acetobutylicum, Clostridium difficile, Lactococcus lactis, Streptomyces coelicolor, Corynebacterium diphteriae and Corynebacterium glutamicum.

9. Process for production of riboflavin, wherein the riboflavin-producing host cell according to claim 1 is incubated in an aqueous medium under conditions that allow the production of riboflavin from a given substrate.

10. The process according to claim 9, wherein the yield of riboflavin is increased by at least 5% compared to a process wherein the host cell does not express a polynucleotide encoding a polypeptide with at least 70% identity to SEQ ID NO:2.

11. A process according to claim 9 comprising the steps of: (a) providing a riboflavin-producing host cell according to any one of claims 1 to 7, (b) incubating said host cell in an aqueous medium under conditions that allow the production of riboflavin from a given substrate, and optionally (c) isolating and purifying the riboflavin from the cultivation medium.

12. Use of a polypeptide with at least 70% identity to SEQ ID NO:2 or of a riboflavin-producing host cell according to claim 1 in a process for production of riboflavin.

13. A riboflavin-producing host cell comprising riboflavin biosynthetic genes (rib operon) and a heterologous enzyme having pyridoxal phosphatase activity [EC 3.1.3.74] used for a process for production of riboflavin.

Description

FIGURES

[0045] FIG. 1: Scheme of B. subtilis strain lineage.

[0046] FIG. 2: Riboflavin production yields in % (y-axis) in the presence (i.e. BS9646 or BS8638) or absence (BS9645 or BS4905) of pdxP gene. For more details, see Example 4 (Table 3).

[0047] The following examples are illustrative only and are not intended to limit the scope of the invention in any way. The contents of all references, patent applications, patents, and published patent applications, cited throughout this application, particularly EP405370, WO2007051552, U.S. Pat. No. 5,837,528, WO2006077258, WO2008000632, WO2017036903, WO2010052319, WO2004113510 and EP1186664 are hereby incorporated by reference.

EXAMPLES

Example 1: General Methods, Strains and Plasmids

[0048] Unless otherwise mentioned, all media and general methods are disclosed in WO2017036903. Genotyps of the used B. subtilis strains are listed in Table 1.

[0049] For isolation of plasmid DNA from B. subtilis the QIAprep Spin Miniprep Kit (Qiagen), following the manufacturer's recommendations, was used. Cells were harvested by centrifugation from a 10-ml culture in VY supplemented with ampicillin (100 μg/ml final) and incubated at 37° C., 250 rpm up to OD.sub.600 nm˜0.8-1.2. The lysis buffer was supplemented with lysozyme (1 mg/ml f.c.) to degrade B. subtilis cell wall for 10 minutes at 37° C.

[0050] For amplification of DNA by PCR, 0.1 μg of chromosomal DNA from S. meliloti or B. subtilis was used in a 50 μl reaction volume containing 25 μl of 2× Phusion high-fidelity PCR master mix (New England Biolabs), 1 μl of the respective primers (Table 2). The PCR reaction was performed in 29 cycles of three sequential steps: (i) denaturing step at 95° C. for 30 sec; (ii) annealing step at 55° C. for 30 sec; (iii) elongation step at 72° C. for 1 min per kb. The PCR cycles were preceded by a denaturation step at 95° C. for 2 min.

[0051] For transduction of B. subtilis with SPP1 bacteriophage lysate, the donor lysate was prepared by inoculating a single colony of the donor strain in 3 ml VY medium. The culture was incubated overnight at 37° C. in a roller drum. The next day, 100 μl of the preculture was mixed with 100 μl of fresh VY and 30 μl of SPP1 bacteriophage lysate. After a 15-minute incubation at 37° C. in a water bath, 4 ml of fresh VY supplemented with CaCl.sub.2) (5 mM final) were added. The infected culture was incubated during 4 hours at 37° C. in a roller drum. The lysed culture was centrifuged and the supernatant was filter-sterilized. The resulting donor lysate was stored at +4° C. for further use. The recipient strain was prepared by is inoculating a single colony of the donor strain in 3 ml VY medium. The culture was incubated overnight at 37° C. in a roller drum. The next day, 10 ml of fresh VY medium were inoculated with 500 μl of the preculture, and incubated at 37° C., 250 rpm up to OD.sub.600 nm˜0.8-1.2. 900 μl of the culture were then infected with 10 or 100 μl of the donor lysate. 9 ml of fresh VY supplemented with MgSO.sub.4 (10 mM final) were added to the culture. After a 30-minute incubation at 37° C. in a water bath, cells were harvested by centrifugation (10 min, 3500 rpm), suspended in 150 μl of 1×SS and spread on a selective agar medium, followed by incubation at 37° C. for 1 day.

[0052] Assay of riboflavin production in deep-well microtiter plates (MTP) was performed as follows: an overnight culture was made from a single colony in 3 ml of VY containing selective antibiotics where appropriate. The preculture was incubated at 39° C., 550 rpm, 80% humidity. The next day, 3 ml of RSM were inoculated with the preculture with a starting OD.sub.600 nm˜0.05. Cultures in MTP were made in triplicate, covering the wells with a breath seal. MTP were incubated at 39° C., 550 rpm, 80% humidity for 48 hours. 250 μl of the 48 hour-culture were treated with 20 μl of 4M NaOH solution to solubilize the riboflavin crystals (shaken for 1 min at 300 rpm). 230 μl of a 1M potassium phosphate buffer, pH 6.8 were added (shaken for 1 min at 300 rpm). Riboflavin was assayed by HPLC using an Agilent 1100 series HPLC system with a quaternary pump, an autosampler, a UV detector and Fluorescence detector. The separation was achieved using a Supelcosil LC-8 DB (150 mm×4.6 mm×5 um). Optimal column temperature was 20° C. The mobile phase was a gradient from 100% 0.1M acetic acid to 50/50 0.1M acetic acid/methanol at 15 minutes for total of 33 minutes per run. The flow rate was 1.0 ml/min and the injection volume set to 5 μl. The UV signal was monitored and used for detection. Calibration range from 0.1 μg/ml to 500 μg/ml. Additionally, the potential accumulation of glucose in the culture broth was analyzed by a Waters HPLC system using a binary pump, an autosampler, a UV- and a refractive index detector. The separation was achieved on a CAPCELL PAK NH2 UG80 column (4.6 mm×250 mm, 5 μm; Shiseido). The optimal column temperature was 40° C. The mobile phase was a mixture of acetonitrile and deionized water at a ratio of 65:35. The flow rate was 1.0 ml/min and the injection volume set to 5 μl or 10 μl. The refractive index signal was monitored and used for detection. The calibration range for each compound was from 0.3 mg/ml to 3 mg/ml.

TABLE-US-00001 TABLE 1 Bacillus subtilis strains. Strain Relevant genotype Reference BS168-SP1 CIP106309 Trp+ WO2017036903 BS9645 CIP106309 Trp+ pBHA12 E. coli/ This patent B. subtilis shuttle vector BS9646 CIP106309 Trp+ pBV213L This patent (P.sub.amyQ.sub.—pdxP) BS9502 CIP106309 Trp+ amyE::Pveg_pdxP* This patent BS4905 CIP106309 Trp+ Pspo15 triple WO2017036903 ribO_del mro175rib ribC820 BS8638 CIP106309 Trp+ Pspo15_triple This patent ribO_del mro175rib ribC820 amyE::Pveg_pdxP*

Example 2: Cloning of Sinorhizobium meliloti pdxP in a Replicative Vector and Insertion in a Bacillus subtilis Host

[0053] The pdxP gene from S. meliloti strain IFO14782 (SEQ ID NO:1) was amplified by PCR using primers P1 (SEQ ID NO:5) and P2 (SEQ ID NO:6). These oligos harbor BamHI (GGATTC) and NheI (GCTAGC) restriction sites, respectively. The resulting 0.8-kb fragment was purified by agarose gel electrophoresis and extracted from the gel using the QIAquick Gel Extraction Kit (Qiagen). The purified PCR product was cloned at the BamHI and NheI in the multiple cloning site of the pBHA12 E. coli/B. subtilis shuttle vector described in WO2008000632. This vector allows the expression of pdxP gene under the control of a promoter derived from the amyQ gene of Bacillus amyloliquefaciens. During the procedure of cloning and transformation of B. subtilis, E. coli was used as an intermediate host. The transformation of the ligation mixture was first performed in TOP10 Chemically Competent E. coli (Invitrogen). Several E. coli ampicillin-resistant colonies were isolated and the recombinant plasmid pBV213L (see FIG. 1) was extracted using the QIAprep Spin Miniprep Kit (Qiagen). The strain Bacillus subtilis BS168-SP1 is a tryptophan-prototroph derivative of the Marburg strain 168 (Germany) that was generated by replacing trpC2 mutation by a non-mutated trpC gene from strain B. subtilis ATCC 6051. Construction of BS168-SP1 is detailed in WO2017036903. BS168-SP1 is a naive strain with respect to riboflavin overproduction. In the next step, 10 μl of plasmid pBHA12 (WO2008000632) or 10 μl of plasmid pBV213L were transformed in strain BS168-SP1 by competent cell transformation, selecting for kanamycin-resistant clones (10 μg/ml f.c.) on TBAB plates. The resulting strains BS9645 and BS9646 were confirmed to harbor respectively the empty vector pBHA12 (BS9645) or the recombinant vector pBV213L with S. meliloti pdxP gene (BS9646). Nucleotide sequences showing the start codon of the coding sequences are listed in Table 2, with reference to the SEQ ID NO:s in the sequence listing.

TABLE-US-00002 TABLE 2  Nucleotide sequences of pdxP as isolated from S. Meliloti   and as codon-optimized for expression in B. subtilis  (pdxP*). The start codon of the coding sequence is underlined.   For more details, see text and sequence listing. SEQ  Name Sequence 5′ to 3′ ID NO: pdxP ATGGCCAATCGGGTCGCAGGTGAACAAACCGTTTTGCTTCGCAAG 1 CCGGCCGTGTCATAAACCCGCCCATGAAGAAGCTCGACCGCATGC CGACCCACGCCGAATTCGCCCATGTCACCGACTGGGTCTTCGACC TCGACAACACGCTCTATCCGCATCACGTCAATCTGTTCTCACAGA TCGACCGCAACATGACGGCCTATGTTGCCGAACTCCTGTCGCTGG AGCCTGCGGAGGCGAAGAAGCTGCAGAAGGAATACTACCGCGACC ACGGCACCACGCTTCAGGGCCTGATGCTTCATCACGGCATCGATC CCAATGATTTCCTCGAAAGAGCCCACGCCATCGACTATAGCGTGG TGCCGGCCGATCCGGCGCTCGGCGAGGCGATCAAGGCGCTGCCCG GACGCAAGTTCATCTTCACCAACGGCAGCGTCGCCCATGCGGAGA TGACCGCGCGGGCGCTCGGCATTCTCGAGCATTTCAACGACATCT TCGACATCGTCGCCGCCGGCTTCATACCGAAGCCCGCCGGCGACA CCTACGACAAGTTCATGGGCCTTCACCGCATCGACACGGCGAATG CGGTGATGTTCGAGGATCTGCCGCGCAACCTGGTCGTCCCTAAGG CGCTCGGCATGAAGACGGTGCTGCTCGTGCCGCGCAATCTCGAAT ACGAGTTCGCCGAGGCCTGGGAAACGTCGAGCGACGCGGACGATC AGATCGACTACGTCACGGAAGACCTGGCGGGTTTCCTGCGCAGTG TGATTGTTTAA Pveg; TTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATG 3 spoVG RBS  TTACTAGAGAAAGGTGGTGAACTACTATG pdxP* ATGGCTAATCGTGTGGCGGGTGAACAGACGGTGCTGCTGCGGAAA 4 GCGGGTCGGGTGATCAATCCTCCTATGAAAAAACTGGACAGAATG CCGACACATGCTGAATTTGCCCATGTTACAGATTGGGTGTTTGAT CTGGATAACACACTGTATCCGCATCATGTCAACTTATTTTCTCAA ATCGATAGAAACATGACAGCATACGTTGCGGAACTGCTTTCATTA GAACCGGCTGAAGCCAAAAAACTGCAAAAAGAATACTACAGAGAT CATGGCACAACACTGCAGGGACTTATGTTACATCATGGAATTGAT CCGAACGATTTTCTTGAACGCGCACATGCGATCGATTATTCTGTG GTGCCTGCTGATCCGGCACTGGGAGAAGCAATTAAAGCGCTTCCG GGAAGAAAATTTATCTTTACAAACGGCTCTGTGGCTCATGCCGAA ATGACAGCACGCGCGCTGGGCATTCTTGAACATTTTAACGATATC TTTGATATCGTCGCAGCGGGCTTTATCCCGAAACCGGCAGGAGAT ACATACGATAAATTTATGGGACTTCATAGAATCGATACAGCTAAC GCCGTTATGTTTGAAGATCTTCCGCGCAATTTAGTCGTTCCGAAA GCTCTTGGCATGAAAACAGTGTTACTGGTCCCGCGCAATTTAGAA TATGAATTTGCAGAAGCGTGGGAAACATCAAGCGATGCCGACGAC CAGATTGACTACGTTACGGAAGACTTGGCAGGCTTTTTACGGAGC GTGATTGTTTAA

Example 3: Insertion of S. meliloti pdxP in the Chromosome of a Riboflavin-Overproducing B. subtilis Host

[0054] A codon-optimized pdxP gene (SEQ ID NO:4)—encoding the same protein as the native gene—was inserted in the amyE locus in the chromosome of BS168-SP1 recipient strain. A splicing by overhang extension (SOEing) PCR was used to generate a DNA fragment bearing the pdxP* gene, flanked by amyE-5′ and the amyE-3′ DNA sequences that allows the stable insertion in BS168-SP1 chromosome by double crossing-over. A genetic module harboring a chloramphenicol acetyltransferase (E.0 2.3.1.28) gene, that provides an antibiotics resistance to chloramphenicol, was also inserted between the amy-E3′ flank and the pdxP* gene, in opposite orientation to pdxP*. First, individual PCRs were performed to amplify: (i) the 1.9 kb-DNA region that bears the amyE-3′ flank and the chloramphenicol cassette, from pDG1662 plasmid (Bacillus Genetic Stock Center, The Ohio State University, USA; GenBank U46197) using primer pair P3 (SEQ ID NO:7) and P4 (SEQ ID NO:8); (ii) the 0.9 kb-DNA region that bears the pdxP* gene using primer pair P5 (SEQ ID NO:9) and P6 (SEQ ID NO:10). The S. meliloti IF014782 pdxP* coding sequence (SEQ ID NO:4), which expression is driven by B. subtilis veg promoter and B. subtilis spoVG RBS (SEQ ID NO:3), was made synthetically and cloned in vector pJET1.2 (Thermo Fisher Scientific) by Genscript, Piscataway, N.J., USA. This recombinant vector was used as a template for the PCR; (iii) the 0.5 kb-DNA region that bears the amyE-5′ flank from pDG1662 plasmid using primer pair P7 (SEQ ID NO:11) and P8 (SEQ ID NO:12). The three PCR products were separated by agarose gel electrophoresis and extracted from the gel using the QIAquick Gel Extraction Kit (Qiagen). Thanks to the overlapping DNA regions, they were assembled in a 3.2 kb-SOEing PCR fragment, using primer pair P3 and P8. The resulting SOEing PCR product was purified by agarose gel electrophoresis and extracted from the gel using the QIAquick Gel Extraction Kit (Qiagen). 1 μg was then used for the transformation of competent B. subtilis BS168-SP1. Chloramphenicol-resistant (CmR) colonies were selected on TBAB plates containing chloramphenicol 5 μg/ml. The insertion of pdxP* in the chromosomal amyE gene (alpha-amylase) of BS168-SP1 was confirmed by a starch hydrolysis test using iodine stain. The correct genotype of the resulting strain BS9502 was also confirmed by a PCR. Insertion of pdxP* gene in the chromosomal amyE locus of the B. subtilis riboflavin overproducing strain BS4905 (described in WO2017036903) was then performed with SPP1 phage according to the method described above, wherein a lysate of BS9502 was used to transduce the strain B. subtilis BS4905. CmR colonies were selected on TBAB plates containing 5 μg/ml chloramphenicol. The insertion of pdxP* in the chromosomal amyE gene (alpha-amylase) of BS168-SP1 was confirmed by a starch hydrolysis test using iodine stain. The correct genotype of the resulting strain BS8638 was also confirmed by PCR.

Example 4: Riboflavin Production Assay in Presence/Absence of pdxP Gene

[0055] The pdxP gene is overexpressed on a replicative vector in strain BS9646 (see Ex. 2) and via chromosomal insertion in strain BS8638 (see Ex. 3). Assay of riboflavin production was made from a culture with RSM in deep-well microtiter plates, as described above. The results are shown in Table 3.

TABLE-US-00003 TABLE 3 Riboflavin production with various B. subtilis strains having different genotypes as indicated. Strains B. subtilis BS9645 and BS9646 share the same genotype background (except for pdxP insertion), strains B. subtilis BS4905 and BS8638 share the same genotype background (except for pdxP insertion). For more explanation see text. Riboflavin Yield (g/100 g Strain Relevant genotype Glucose) BS168-SP1 wild-type <0.003 BS9645 pBHA12 <0.003 BS9646 pBV213L (pBHA12 with Pveg_pdxP) 0.54 BS4905 riboflavin overproducer 6.21 BS8638 riboflavin overproducer with 7.11 Pveg_pdxP

[0056] The riboflavin production yield of BS9646 was improved by at least 18000% compared to its direct parent BS9645 (see FIG. 2A). As no riboflavin can be detected in the culture of BS9645, BS9646 was compared to the detection limit of our HPLC riboflavin assay (0.003 g/100 g glucose). Performing the experiments in a riboflavin-overproducing strain background, the riboflavin production yield was improved by 14.5% compared to its direct parent (BS8638 compared with BS4902 (see Table 3 and FIG. 2B). These results showed a positive impact of the pdxP gene expression on the riboflavin production, in both a wild-type based strain (non-overproducing strain background) and in riboflavin overproducing strain background of B. subtilis.

Example 5: Identification and Cloning of pdxP Homologues

[0057] A homology search using the PdxP from S. meliloti revealed several pdxP homologues from other Rhizobium strains (see Table 4).

TABLE-US-00004 TABLE 4 Homology (% identity) of PdxP protein sequence within various Rhizobium species. Rhizobium species % identity Sinorhizobium meliloti sp. 97-100%     Sinorhizobium medicae 95% Sinorhizobium saheli 91% Sinorhizobium americanum sp. 90-91% .sup.   Sinorhizobium fredii sp. 89-90% .sup.   Rhizobium arenae 86% Pararhizobium polinicum 84% Rhizobium oryzae 78% Rhizobium leguminosarum 74%

[0058] The homologs are cloned into a riboflavin-producing host, such as e.g. B. subtilis, as described above followed by a riboflavin production assay as described in Example 4.

[0059] When using the pdxP-homologs, the yield of riboflavin can be increased in the range of at least 5 to 20% in a riboflavin-overproducing strain background, i.e. equivalent to the numbers shown in Table 3.