SYSTEM FOR PROTEIN INACTIVATION AND RECOMBINANT PHAGES FOR TARGETED BACTERIAL KILLING, INFECTION, BIODETECTION, AND AS A MEANS OF PROTEIN EXTRACTION
20220010284 · 2022-01-13
Assignee
Inventors
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N15/74
CHEMISTRY; METALLURGY
C12N15/73
CHEMISTRY; METALLURGY
C12N2795/10122
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C12N2795/10121
CHEMISTRY; METALLURGY
International classification
C12N7/00
CHEMISTRY; METALLURGY
C12N15/73
CHEMISTRY; METALLURGY
Abstract
Disclosed are recombinant phages that infect and kill bacterial hosts in response to user-defined inputs. The components that encode the user-defined inputs can be combined, such that multiple inputs are maintained on a single recombinant phage, enabling precise control over the targeting strategy. The phages can be engineered to kill a specific bacterial species or multiple species simultaneously. Recombinant phages can also be engineered to harbor fluorescent and bioluminescent reporter genes that enable them to be used for tracking, detection, and in biosensing applications. Recombinant phages can also be used to lyse bacterial cells that produce recombinant proteins, as a rapid method to enable extraction and high-level purification of potentially valuable and/or industrially important proteins. Also disclosed is a system that can also be used to control the activity of a protein of interest, by taking advantage of an interaction between Qtip and a phage repressor protein; a phage repressor protein can be fused to a protein-of-interest, and by controlling the expression of qtip, the phage repressor protein fused to a protein-of-interest will be inactivated when Qtip is expressed and interacts with the phage repressor protein.
Claims
1. An engineered recombinant phage, comprising a first DNA construct configured to drive a phage lytic program for a first bacterium, and where at least one regulator of a phage lytic gene is subject to a promoter, wherein the engineered recombinant phage is capable of responding to a host-produced quorum-sensing autoinducer.
2. The engineered recombinant phage according to claim 1, wherein the first DNA construct is configured to drive the phage lytic program for the first bacterium and an additional phage lytic program for an additional bacterium.
3. The engineered recombinant phage according to claim 1, wherein the engineered recombinant phage comprises a component from a phage that is specific to a second bacterium different from the first bacterium.
4. The engineered recombinant phage according to claim 1, wherein the at least one regulator of the phage lytic gene is a phage protein.
5. The engineered recombinant phage according to claim 4, wherein the phage protein is Qtip (quorum triggered inactivator of cI protein).
6. The engineered recombinant phage according to claim 1, wherein the at least one regulator of a phage lytic gene is a non-phage protein
7. The engineered recombinant phage according to claim 1, wherein the at least one regulator of a phage lytic gene encodes a repressor.
8. The engineered recombinant phage according to claim 1, wherein the at least one regulator of a phage lytic gene encodes an antirepressor.
9. The engineered recombinant phage according to claim 1, wherein the promoter is activated by a specific species of bacteria.
10. The engineered recombinant phage according to claim 1, wherein the phage has been modified such that it does not respond to any of its native biological inputs.
11. The engineered recombinant phage according to claim 10, wherein the promoter is configured to be light-activated via a photoresponsive transcription factor.
12. The engineered recombinant phage according to claim 1, wherein the promoter is configured to be activated by the presence of a chemical species.
13. The engineered recombinant phage according to claim 12, wherein the chemical species is a small molecule, a metabolite, or an artificial inducer.
14. The engineered recombinant phage according to claim 1, wherein the engineered recombinant phage comprises a plurality of DNA constructs.
15. The engineered recombinant phage according to claim 14, wherein the phage further comprises a second DNA construct configured to prevent a phage lytic program, the second genetic construct having at least one regulator of a phage lytic gene subject to a promoter.
16. The engineered recombinant phage according to claim 14, wherein the phage further comprises a second DNA construct configured to lyse bacteria producing recombinant proteins.
17. A method for selectively lysing a bacterium, comprising the steps of: providing an engineered recombinant phage according to claim 1; and contacting a target bacterium with the phage; and allowing the phage to lyse the bacterium.
18. A prophylactic method for a high-risk individual, comprising the steps of: introducing a plurality of engineered recombinant phages according to claim 1, which are delivered by commensal bacteria to the high-risk individual prior to coming in contact with a pathogenic bacterium; wherein the engineered recombinant phage comprises a first DNA construct configured to drive a phage lytic program for the pathogenic bacterium, and where at least one regulator of a phage lytic gene is subject to a promoter that is activated by the pathogenic bacterium.
19. The prophylactic method according to claim 18, wherein the promoter is induced by an external trigger or activated by a cue that is specifically produced by the pathogenic bacterium.
20. A method for manufacturing an engineered recombinant phage, comprising the steps of: providing a first gene adapted to drive a phage lytic program; providing a first promoter; and integrating the first gene under the first promoter on a plasmid, wherein the phage is capable of responding to a host-produced quorum-sensing autoinducer.
21. The method according to claim 20, further comprising removing a natural lytic regulatory component of the phage, modifying the phage such that it does not respond to any of its native biological inputs, or a combination thereof.
22. The method according to claim 20, wherein the first gene, the first promoter, or both comprises either synthetic DNA or transgenic DNA.
23. The method according to claim 20, wherein integrating is accomplished by a method selected from the group consisting of: in-vitro or in-vivo transposon mutagenesis, homologous recombination promoted by natural competence mechanisms or a suicide vector, recombineering with the lambda red system, restriction enzyme-based cloning or isothermal assembly, and genome editing using transcription activator-like effector nucleases (TALENs), zinc-finger nucleases (ZFNs), or clustered regulatory interspaced short palindromic repeat (CRISPR-Cas) based procedures.
24. An engineered recombinant phage, comprising: a DNA construct having at least one reporter tag subject to a promoter, wherein the phage is capable of responding to a host-produced quorum-sensing autoinducer.
25. The engineered recombinant phage according to claim 24, wherein the reporter tag is a fluorescent or luminescent reporter tag.
26. A system for inactivating a protein of interest, comprising: a first promoter controlling expression of a qtip (quorum triggered inactivator of cI protein) gene; and a second promoter controlling expression of a gene that encodes a phage repressor protein fused to a protein of interest, wherein the phage repressor protein is capable of being inactivated by Qtip.
27. The system according to claim 26, wherein the second promoter is a natural promoter of the protein of interest.
28. The system according to claim 26, wherein the first promoter is activated by a specific species of bacteria, light-activated via a photoresponsive transcription factor, or activated by the presence of a chemical species.
29. The system according to claim 26, wherein the chemical species is a small molecule, a metabolite, or an artificial inducer.
30. A method for controlling the activity of a protein of interest, comprising the steps of: providing a system according to claim 26; producing a fusion protein containing the phage repressor protein fused to a protein of interest by expressing the gene that encodes the phage repressor protein fused to a protein of interest; and producing a Qtip protein by inducing expression of the qtip gene at a point in time after the fusion protein is produced; and allowing the Qtip protein to inactivate the phage repressor protein.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
DETAILED DESCRIPTION
[0029] The term “conservative substitution” as used herein refers to an amino acid replacement in a protein that changes a given amino acid to a different amino acid with similar biochemical properties (e.g. charge, hydrophobicity and size).
[0030] The term “homology” as used herein refers to a degree of identity. There may be partial homology or complete homology. A partially identical sequence is one that is less than 100% identical to another sequence.
[0031] The term “isolated” as used herein refers to a nucleic acid or polypeptide separated from at least one other component (e.g., nucleic acid or polypeptide) present with the nucleic acid or polypeptide in its natural source. In one embodiment, the nucleic acid or polypeptide is found in the presence of (if anything) only a solvent, buffer, ion, or other component normally present in a solution of the same. The terms “isolated” and “purified” do not encompass nucleic acids or polypeptides present in their natural source.
[0032] The term “pharmaceutically acceptable” as used herein with respect to an amount or substance means that an amount or substance which is, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit/risk ratio, and effective for the intended use when the substance is used in a pharmaceutical composition.
[0033] The term “primer” refers to an oligonucleotide which is capable of acting as a point of initiation of synthesis when placed under conditions in which primer extension is initiated. An oligonucleotide “primer” may occur naturally, as in a purified restriction digest or may be produced synthetically.
[0034] The term “protein” or its interchangeably used term “polypeptide” as used herein refer to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). Post-translational modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations, and the like are also encompassed. The terms “protein” or “polypeptide” also includes variants which should encompass any polypeptide comprising, or alternatively or preferably consisting of, any natural or genetically engineered polypeptide having more than 70%, preferably more than 80%, even more preferably more than 90%, again more preferably more than 95%, and most preferably more than 97% amino acid sequence identity with the sequence of the polypeptide. Preferred methods of generating a variant of a polypeptide is by genetic engineering, preferably by insertion, substitution, deletion or a combination thereof.
[0035] The term “recombinant” as used herein with respect to a polypeptide or protein means that a polypeptide or protein is derived from recombinant (e.g., microbial or mammalian) expression systems, where “microbial” refers to recombinant polypeptides or proteins made in bacterial or fungal (e.g., yeast) expression systems.
[0036] A first aspect of the disclosed invention is drawn to an engineered recombinant phage that is capable of responding to a host-produced quorum-sensing autoinducer and includes a first DNA construct configured to drive a phage lytic program for a first bacterium, where at least one regulator of a phage lytic gene is subject to a promoter.
[0037] Host-produced quorum-sensing autoinducer. The host-produced quorum-sensing autoinducer can include any known to those of skill in the art, including but not limited to 3,5-dimethylpyrazine-2-ol (DPO), cholera autoinducer-1 (CAI-1), autoinducer-2 (AI-2), N-acyl homoserine lactones, and autoinducing peptides.
[0038] Regulator of a phage lytic gene. Any regulator of a phage lytic gene known to those of skill in the art may be used, including, but not limited to VqmA, HapR, LuxR, VpsT, LasR, RhlR, EL222, AraC, LacI, TetR, HilA, and CRP. In some embodiments, the regulator of the phage lytic gene is a phage protein, such as Qtip. Qtip is a small (79 amino acid) protein [SEQ ID NO.: 1] that aggregates and inactivates the VP882 repressor of lysis.
[0039] In some embodiments, the regulator of the phage lytic gene is a non-phage protein.
[0040] In some embodiments, the recombinant phage may include one or more additional phage lytic genes, which may utilize a component from a phage that is specific to a second bacterium that is different from the first bacterium. That is, one of skill in the art can produce a recombinant phage that can drive a lytic program in two or more species of bacteria, by putting different regulators under one or more promoters.
[0041] In some embodiments, the at least one regulator of a phage lytic gene encodes a repressor known to those of skill in the art, including, but not limited to phage repressors, cI-like repressors, LexA-like repressors, and TetR-type repressors. In some embodiments, the at least one regulator of a phage lytic gene encodes an antirepressor known to those of skill in the art, including, but not limited to Qtip, Ant, Tum, and RstC.
[0042] In some embodiments, the page can include a plurality of DNA constructs, such as a second DNA construct configured to prevent a phage lytic program, the second DNA construct having at least one regulator of a phage lytic gene subject to a promoter. The recombinant phage may include a second DNA construct configured to lyse bacteria producing recombinant proteins.
[0043] Promoter. The promoter may be any appropriate promoter known to those of skill in the art. In some embodiments, the promoter is activated by a specific species of bacteria, such that expression of the promoter-controlled gene is restricted to the specific species of bacteria. In some embodiments, the promoter is configured to be light-activated via a photoresponsive transcription factor, such as the EL222 bacterial transcription factor (a photosensor LOV domain and a Helix-Turn-Helix (HTH) DNA-binding domain), where in the dark, the LOV domain binds the HTH domain, blocking dimerization and DNA binding, while blue light illumination produces structural changes that allow the EL222 to dimerize and bind DNA.
[0044] In some embodiments, the promoter is configured to be activated by the presence of a chemical species, such as a small molecule, a metabolite, or an artificial inducer.
[0045] In some embodiments, the phage has been modified such that it does not respond to any of its native biological inputs.
[0046] As an example, the vibriophage, VP882 has the capacity to respond to a host-produced QS AI. The VP882 phage-encoded protein, Gp56, which as used herein is named as VqmA.sub.Phage, is a viral DPO binding QS receptor and transcription factor with homology to the vibrio QS receptor VqmA. DPO, via VqmA.sub.Phage, activates the phage lytic program via induction of expression of a phage gene that, as used herein, is named Op (quorum triggered inactivator of cI protein). Qtip is a small (79 amino acid) protein [SEQ ID NO.: 1] that aggregates and inactivates the VP882 repressor of lysis. DPO-bound VqmA.sub.Phage recognizes the V. cholerae vqmR promoter whereas V. cholerae VqmA is unable to recognize the phage qtip promoter. This “one-sided conversation” enables the VP882 prophage to influence host QS while executing its own lifestyle programs with immunity from host interference. Thus, this is a novel phage-encoded receptor that senses a host-produced AI to mediate the lysis-lysogeny decision.
[0047] Phages related to VP882 encode DNA-binding transcription factors and small proteins in the identical genomic locations as VP882 vqmA.sub.Phage and qtip, respectively. Qtip aggregates the repressors from these phages but not the distant, prototypical lambda repressor. In the opposite vein, the protein encoded in the qtip location in one of these other phages, despite having no similarity to Qtip, can induce aggregation of the VP882 repressor. Thus phages, in addition to VP882, control their lysis-lysogeny decisions by tuning into host-produced signaling factors using a Qtip-like lysis de-repression mechanism. The VP882 phage can be reprogrammed to be insensitive to native inputs but responsive to user-defined cues. These reprogrammable “kill-switches” could be useful for environmental, industrial, and medical applications.
[0048] V. cholerae VqmA (denoted VqmA.sub.Vc) is a dual QS receptor-transcription factor. Predicted VqmA homologs consisted of C-terminal DNA-binding domains and N-terminal PAS-domains, presumably for binding the ligand, DPO. To identify other DPO-binding proteins, a bioinformatic search was performed for proteins possessing the PAS fold-4 subtype domain (InterPro, IPR013656) present in V. cholerae VqmA.sub.Vc. Of the 103,219 returned proteins, only one was in the virus category, Gp56 of the Myoviridae virus VP882, a non-integrating temperate phage from a pandemic V. parahaemolyticus 03:K6 strain. VP882 infects vibrios including V. parahaemolyticus and V. cholerae, however, the GC content of the VP882-encoded gp56 is markedly higher than host encoded vqmA genes (55.5% in phage VP882 versus 46.5% and 47.5% in V. parahaemolyticus and V. cholerae, respectively) suggesting the phage gene was not directly transferred from the vibrio host. Referring to
[0049] Examination of the 38.2 kb VP882 genome (100) shows that gp56 (120) lies between repA (125) and telN (105); two essential genes conserved across all known linear phage, which are required for replication and maintenance as linear plasmids, respectively. The curious location of gp56 (120), hereafter called VqmA.sub.Phage, within a critical region of the phage genome, suggested that it too might be essential for some crucial phage-related process.
[0050] VqmA.sub.Phage induces host cell lysis. To study the function of VqmA.sub.Phage, vqmA.sub.Phage was cloned onto a vector under an arabinose inducible promoter and introduced it into the V. parahaemolyticus clinical isolate in which the phage was originally discovered. Referring to
[0051]
[0052] Consistent with this result, induction of vqmA.sub.Phage in bacterial hosts that do not harbor the VP882 prophage (Escherichia coli, V. cholerae, and a different isolate of V. parahaemolyticus) also did not cause lysis. Thus, VqmA.sub.Phage promotes host cell lysis in a phage-dependent manner.
[0053] MMC treatment, in addition to lysing the host, leads to production of VP882 phage particles and their release into culture fluids. Indeed, VP882 phage DNA could be purified from culture fluids of MMC-treated but not untreated V. parahaemolyticus harboring phage VP882. Induction of VqmA.sub.Phage in V. parahaemolyticus harboring phage VP882 also results in release of phage DNA. Phage DNA could not be isolated if the phage was defective for the major capsid gene (gp07::Tn5). These results demonstrate that VqmA.sub.Phage, like MMC, launches the complete phage VP882 lytic cycle.
[0054] VqmA.sub.Phage is activated by the quorum-sensing autoinducer DPO. VqmA.sub.Vc and DPO were originally discovered as a QS receptor-AI pair in V. cholerae where they control biofilm formation and virulence factor production. Maximal transcriptional activation of the direct target of VqmA.sub.Vc, vqmR, occurs only when VqmA.sub.Vc is bound to DPO. A phage genome that encodes a VqmA homolog suggests that VqmA.sub.Phage activity could likewise be modulated by DPO. Vibrios produce DPO from threonine so growth in minimal medium lacking threonine eliminates DPO production, including in a lysogenized V. parahaemolyticus strain used as part of a study discussed herein. In the absence of DPO, induction of VqmA.sub.Phage in the V. parahaemolyticus caused a low, basal level of cell lysis, whereas maximal host cell lysis occurred when DPO was supplied. See
[0055] To explore whether DPO acts directly on VqmA.sub.Phage, the VqmA.sub.Phage protein from E. coli was overexpressed and purified. Importantly, E. coli naturally produces DPO. VqmA.sub.Vc was also overexpressed and purified. As a control, V. cholerae LuxO, a DNA-binding QS transcription factor that does not bind DPO, was overexpressed and purified. The three proteins were denatured, removed from suspension, and the remaining soluble fractions were extracted and assessed for DPO content by bioassay and liquid chromatography-mass spectrometry (LC-MS). Synthetic DPO was used as the standard. Referring to
[0056] Lytic development in phage VP882 is sensitive to at least two inputs, DNA damage and QS. The first input, DNA damage, leads to proteolysis of the phage VP882 cI repressor, which occurs in a host RecA-dependent fashion and requires no other phage components. QS constitutes the second input and involves the production of the bacterial host cell density-dependent factor, DPO, to activate a phage-dependent process consisting of VqmA.sub.Phage-induced expression of qtip; ber
[0057] Without wishing to be held to a particular theory, two feedback mechanisms that could amplify VqmA.sub.Phage production, once initiated. First, VqmA.sub.Phage activates its own expression. Second, phage plasmid copy number increases in the absence of cI similar to the plasmid-like phage N15. Qtip-directed inactivation of cI thus elevates phage copy number, increasing the pool of vqmA.sub.Phage and qtip DNA that can be transcribed. Aided by these two mechanisms, it is suspected that low-level production of VqmA.sub.Phage, triggered by some environmental stimulus or unstable state, is sufficient to drive the phage lysis program.
[0058] DNA damage and quorum-sensing control phage lysis via activation of expression of the gene encoding the Q antiterminator. It can be seen that cI directly represses the gene encoding the antiterminator Q, and cI is cleaved upon DNA damage, which launches the phage lysis program. DPO-driven QS, mediated by VqmA.sub.Phage, also launches the phage lysis program. The occurrence of these two phage regulatory systems in the context of the natural V. parahaemolyticus host can be connected.
[0059] First DNA damage: MMC was added to the V. parahaemolyticus lysogen harboring a plasmid carrying a reporter for the antiterminator Q (Pq-lux) or a reporter for its target operon (Pgp69-lux). Light production rapidly increased with a 10-minute offset between activation of Pq-lux and activation of Pgp69-lux. The delay between the two reporters was consistent with a model in which the antiterminator Q is produced first and, only after, and as a consequence of Q production, are genes involved in lysis expressed.
[0060] Second QS: Light output from V. parahaemolyticus lysogens carrying either Pq-lux or Pgp69-lux and also the arabinose inducible VqmA.sub.Phage construct was monitored. Thirty minutes after arabinose addition, light production from the Pq-lux reporter occurred. Ten minutes later, light production commenced from the Pgp69-lux reporter. Again, this shows that q expression occurs prior to genes for lysis. The time delay in the QS experiment roughly matches the delay in the MMC experiment. Thus, DNA damage-induced lysis and QS-induced lysis converge at the point of activation of expression of q, after which, Q activates gp69 irrespective of which input launched the program.
[0061] VqmA.sub.Phage activates expression of a gene encoding an antirepressor. VqmA.sub.Phage could act in one of three ways to initiate the Q-directed phage lysis program: by directly activating q expression, by directly repressing cI expression, thereby de-repressing q, or by indirectly repressing cI, again leading to de-repression of q. To distinguish between these possibilities, VqmA.sub.Phage was produced from one plasmid in E. coli and Pq-lux expression was monitored from a second plasmid in E. coli. No change in light production occurred, excluding the first possibility that VqmA.sub.Phage directly activates q expression. To this system, a third plasmid carrying the phage cI gene was introduced. cI repressed Pq-lux expression, but again, no effect on reporter activity occurred when vqmA.sub.Phage was expressed, eliminating the second possibility that VqmA.sub.Phage directly represses cI. To investigate the third possibility, that an additional, VqmA.sub.Phage-controlled intermediate component exists linking VqmA.sub.Phage to repression of cI and subsequent de-repression of q, the lysis-defective phage carrying Tn5 in q was introduced into E. coli harboring the plasmid with inducible vqmA.sub.Phage and the Pq-lux reporter plasmid. Addition of arabinose to this strain resulted in a twenty-fold increase in Pq-lux output, indicating that an element encoded on the phage is required to connect VqmA.sub.Phage to cI expression.
[0062] To identify the gene that VqmA.sub.Phage controls, a recombinant E. coli strain carrying arabinose inducible vqmA.sub.Phage, Pq-lux, and the cI repressor gene on a single plasmid was made. Into this strain, a library of phage genomic fragments on a vector were introduced. The transformants were screened for those that activated Pq-lux expression following induction of vqmA.sub.Phage. One ˜600 bp phage genomic fragment that was sufficient (denoted “Active Fragment”) was identified. This fragment mapped to a region immediately upstream of the vqmA.sub.Phage locus and harbored only one complete ORF (gp55) of 240 bp. This was verified by electromobility shift assays (EMSA) that the VqmA.sub.Phage protein binds phage DNA immediately upstream of gp55.
[0063] To show that Gp55 (Qtip) links VqmA.sub.Phage to cI repression and, in turn, to q de-repression, the gp55 ORF was cloned under a tetracycline inducible promoter on a plasmid (pTetA-gp55) and introduced it into the E. coli strain harboring the above combined reporter. Induction of gp55 was sufficient to generate Pq-lux activity. The pTetA-gp55 construct was introduced into the V. parahaemolyticus strain harboring the VP882 lysogen. Induction of gp55 expression caused host cell lysis comparable to when MMC was added or vqmA.sub.Phage was induced. These results indicate that Gp55 (Qtip) is the effector connecting QS to de-repression of q to the triggering of host cell lysis.
[0064] Gp55 (Qtip) is a 79 amino acid protein with no predicted domains and no significant homology to any protein in the NCBI database. The small size and lack of a DNA-binding domain implies that Gp55 may act post-translationally on cl. To test this, HALO-cI and HIS-Gp55 were individually produced from plasmids in recombinant E. coli, collected and combined the cell pellets from the two strains, lysed the cells, and purified the HIS-Gp55 protein. It was seen that cI binds to Gp55 during purification and that the effect of Gp55 on q promoter activity occurs only when cI is present. These results suggest that Gp55 is an antirepressor, which acts directly on the cI repressor and prevents cI from binding to q promoter DNA.
[0065] To explore the Qtip mechanism of inactivation of cI in vivo, HALO-cI protein localization was monitored at the single-cell level in E. coli. In the absence of Qtip, the cI protein was uniformly dispersed in the cytoplasm. Production of Qtip caused cI to form foci located primarily at the cell poles and Qtip colocalizes with cI suggesting that Qtip drives aggregation of the cI repressor. By contrast, in MMC-treated cells, the cI protein remained diffuse indicating that cleavage of cI does not cause foci formation. Thus, both the QS and DNA damage inputs eliminate cI activity, derepress q, and cause lysis, however, their underlying mechanisms of action are different: DNA damage stimulates cI cleavage, whereas VqmA.sub.Phage—directed QS produces Qtip, which inactivates the cI repressor via aggregation.
[0066] The Qtip mechanism is reminiscent of small phage antirepressors such as those from coliphage P1, 186, and N15 which engage in non-covalent interactions with partner repressor proteins, thereby, inhibiting repressor activity. However, unlike in phage VP882, the promoters driving these antirepressors are LexA-controlled, indicating they are induced exclusively by DNA-damage, not by QS.
[0067] Referring to
[0068] With respect to vibriophage, the antirepressor, RstC, encoded by the CTX satellite phage RS1, which is integrated into some V. cholerae genomes induces aggregation of multiple RstR repressor variants that share little identity (Davis et al., 2002). Davis hypothesized that RstC recognizes a common structural motif in the RstR proteins. Similarly, Qtip can aggregate multiple repressor proteins, and moreover, different Qtip-like antirepressors with little amino acid identity can aggregate the same phage repressor protein.
[0069] An asymmetric binding pattern was uncovered: VqmA.sub.Phage binds its own (qtip) and host (vqmR) target promoters, whereas VqmA.sub.Vc only binds its own (vqmR) target promoter. The lack of sequence similarity between PvqmR [SEQ ID NO.: 3] and Pqtip [SEQ ID NO.: 4], coupled with the ability of VqmA.sub.Phage to bind both, can represent a strategy by which the VP882 phage can tune-in and respond to host QS, while maintaining the ability to execute its own Qtip-mediated lysis-lysogeny pathway without host interference.
[0070] Database analyses show that V. cholerae strain FORC 055, has two CRISPRs matching regions of the VP882 genome (AATCGAAAAAGAGCTCCGCGGCGACCTGTTCCA [SEQ ID NO.: 5]) suggesting that V. cholerae is vulnerable to phage VP882 and needs to defend itself.
[0071] Further, phage-vibrio interactions could occur during human infection. For example, V. cholerae encounters the host and associated microbiota upon infection. DPO is produced by the host microbiota from the threonine-rich resource, mucin, and DPO represses V. cholerae biofilm formation and virulence. Thus, the human host and its microbiota “team up” to defend against V. cholerae using DPO. DPO is also produced and detected by V. cholerae leading to dispersal, a crucial step in the V. cholerae lifecycle because it maximizes dissemination to new hosts. It is envisioned that a phage also uses DPO to trigger dissemination, in this case, via host V. cholerae cell lysis at high host-cell population density. This strategy likely maximizes phage infection of the next V. cholerae cell. Thus, interactions across the eukaryotic, bacterial, and viral kingdoms all rely on one QS AI, DPO. Presumably, each entity in these combined beneficial and parasitic partnerships is garnering the information encoded in the DPO molecule to optimize its survival and reproduction.
[0072] gp62 is the VqmA.sub.Phage-controlled gene required for lysis. To identify phage genes required for lysis, in vitro Tn5 mutagenesis was used. Individual mutant phage were introduced into the phage-cured V. parahaemolyticus host harboring arabinose inducible vqmA.sub.Phage where they were assessed for the ability/inability to lyse the host when arabinose was added. Phage mutants with insertions in gp62 were defective for lysis. By contrast, a phage carrying a Tn5 insertion immediately downstream of gp62 had the wild-type (WT) lysis phenotype. In trans expression of gp62 restored lysis to V. parahaemolyticus carrying the VP882 phage harboring gp62::Tn5. These results show that Gp62 is necessary for phage-mediated host lysis.
[0073] Epistasis analysis was used to define the relationship between VqmA.sub.Phage and Gp62. In trans expression of gp62 caused lysis in strains carrying either the wild-type VP882 phage or a VP882 phage with a Tn5 in vqmA.sub.Phage. By contrast, in trans expression of vqmA.sub.Phage in a strain carrying the VP882 phage harboring gp62::Tn5 was lysis defective. Thus, Gp62 acts downstream of vqmA.sub.phage. Consistent with this finding, strains carrying VP882 phage harboring vqmA.sub.phage::Tn5 lyse upon MMC treatment, whereas strains carrying VP882 phage harboring gp62::Tn5 do not. These results suggest that DNA damage—mediated by Gp62—and QS communication—mediated by DPO, VqmA.sub.Phage, and Gp62—constitute two distinct triggers that promote phage VP882-induced host cell lysis.
[0074] Gp62 is a phage antiterminator and Gp70 is a lysin.
[0075] gp62 is predicted to encode a protein similar to Q from the lambdoid bacteriophage 82 (pairwise BLAST E-value, 5e-19; 30% identity), suggesting that Gp62 is likely a regulator of phage lytic genes. To determine what Gp62 controls, a region ˜1 kb downstream ofgp62 encoding a three-gene operon (gp69-71, ref. 150 in
[0076] To explore the link between Gp62 and gp69-71 a Pgp69-lux transcriptional fusion was engineered that included the putative antiterminator sequence. Referring to
[0077] Gp59 is a phage lysis repressor.
[0078] The results show that the Q antiterminator is required for phage-driven lysis. Q can be kept in check to enable the lysogenic state. To explore regulation, a Pq-lux transcriptional fusion was made. Twenty-five-fold more light was produced from this fusion in the V. parahaemolyticus strain that had been cured of the phage than in the strain carrying the phage, suggesting that the prophage encodes a repressor of Pq that promotes lysogeny. An ORF, gp59, predicted to encode a DNA-binding repressor similar to cI (pairwise BLAST E-value, 5e-22; 37% identity) is located adjacent to but in the opposite orientation of the operon encoding the q gene. In trans expression of gp59 repressed Pq-lux in V. parahaemolyticus. Moreover, Gp59 repression of Pq is likely direct. Referring to
[0079] Like lambda c1, Gp59 can be cleaved during the RecA-activated SOS response, which can explain how MMC induces VP882 phage-mediated lysis. A functional HIS-HALO-Gp59 protein fusion was generated and its fate in untreated and MMC-treated recA.sup.+ and ΔrecA E. coli cells was followed. Western blot revealed a single band of the expected size (˜60 kDa) in the untreated samples and lower-molecular-weight bands, presumably cleavage products, in the MMC-treated recA.sup.+ sample. The HIS-HALO-Gp59 protein in the ΔrecA sample was unaffected by MMC treatment, suggesting that RecA is required for MMC-mediated cleavage of Gp59. Consistent with this result, addition of MMC to recA.sup.+E. coli carrying the Pq-lux reporter plasmid and HIS-HALO-Gp59 led to a significant increase in light production, whereas if the E. coli was ΔrecA, MMC had no effect. These results suggest that Gp59 is subject to cleavage in a DNA-damage (MMC) and host-SOS response (recA) dependent manner, and moreover, that the activating effect of MMC on Pq coincides with this cleavage. As used herein, Gp59 may be referred to as cl.
[0080] Phage Qtip-type proteins and their host partner repressor proteins are conserved.
[0081] Databases for possible cI partners were scanned, and multiple putative repressors were identified, from VP882, MJ1, VP58.5, vB_VpaM_MAR, VHML, and lambda. One within the Gram-negative marine bacterium, Marinobacterium jannaschii DSM 6295 showed the cl-like gene was located on a previously unreported ˜35 kb contig with predicted repA and telN genes nearby. The repA gene from this element was confirmed as functional by PCR amplification of the repA locus, ligation to an antibiotic resistance cassette, and demonstration that the resulting vector was maintained as a plasmid in E. coli. The primers used were JSO-0897 (GAATACACTCCTTGTAAGTGATTGTTATAAGGAGC [SEQ ID NO.: 6]) and JSO-0899 (TGTTCGATAATTATTTGGTCTTCGGTCATTTTTCC [SEQ ID NO.: 7]) for VP882 and JSO-1279 (CCACGGAATAGGAGGTGTTTAG [SEQ ID NO.: 8]) and JSO-1280 (GAGGGATATCCATTACGCCAG [SEQ ID NO.: 9]) for MJ1. This result suggested that M. jannaschii is lysogenized with a VP882-like phage that harbors the cl-like gene. We hereafter refer to this element as phage MJ1. Co-expression of phage VP882 Qtip with HALO-cI from MJ1 resulted in foci. Aggregation also occurred when Qtip was co-expressed with a HALO-cI repressor from another vibriophage, VP58.5. No aggregation occurred when phage VP882 Qtip was co-expressed with lambda HALO-cI (
[0082] The region intervening the phage MJ1 telN and repA genes lacks a predicted vqmA.sub.Phage gene. Rather, there is an ORF encoding a different, putative transcription factor. Adjacent to that ORF, encoded in the opposite orientation, is a small gene (orf584). This arrangement exactly parallels the genomic organization of phage VP882 qtip-vqmA.sub.Phage. Despite orf584 and qtip having no detectable sequence similarity, it was expected that phage MJ1 orf584 encodes a protein with a Qtip-like function. Phage MJ1 orf584 was cloned and induced, and it caused aggregation of phage MJ1 cI and phage VP882 cI but not lambda cl. ORF.sub.584 leads to a stripe of cI localization along the length of the cell, whereas Qtip leads to foci at the poles. Like Qtip, ORF.sub.584 is sufficient to disrupt cI repressor activity, as its induction leads to de-repression of phage VP882 Pq expression and lysis of V. parahaemolyticus lysogenized with phage VP882. These results suggest that ORF584 and Qtip are functionally analogous: they induce aggregation of their native and related phage repressors, launching the phage lysis programs.
[0083] The genomes of nine linear plasmid-like phages were inspected. VP882, MJ1, VP58.5, VHML, vB_VpaM_MAR, N15, PY54, pKO2, and PhiHAP1. In 5 of the 9 cases, in the qtip-vqmA.sub.phage location, small genes and oppositely-oriented ORFs with strongly predicted DNA-binding domains could be identified (see
[0084] VqmA.sub.Phage can substitute for VqmA.sub.Vc but not the reverse.
[0085] VqmA-directed QS has only been studied in V. cholerae, where VqmA.sub.Vc, DPO, VqmR, and the downstream targets were discovered (Liu et al., 2006; Papenfort et al., 2015, 2017). Therefore, the VP882 prophage was transferred to V. cholerae.
[0086] It was first tested whether VqmA.sub.Phage could replace VqmA.sub.Vc. As a control we show that, as expected, a ΔvqmA.sub.Vc V. cholerae strain carrying a PvqmR-mKate2 reporter produces no fluorescence because VqmA is required for activation of vqmR expression (
[0087] Host QS Controls the Phage VP882 Lytic Cycle
[0088] The results show that DPO, in conjunction with VqmA.sub.Phage, drives the phage VP882 lysis-lysogeny decision. If so, host QS should influence the phage lifecycle. To verify this idea, a mutant VP882 phage carrying vqmA.sub.Phage::Tn5 was introduced into wild-type and Δtdh V. cholerae, each carrying the vector encoding arabinose-inducible vqmA.sub.Phage. This strategy restricted VqmA.sub.Phage production to that from the inducible promoter on the plasmid. The V. cholerae growth over time was measured by OD.sub.600 and phage production (viral load) was measured by quantitative PCR of viral preparations made from identical cultures that were grown in parallel to those from which the growth data was obtained. The Δtdh V. cholerae strain underwent minimal lysis and there was less than a 3-fold-change in viral load following induction of vqmA.sub.Phage. By contrast, induction of vqmA.sub.Phage caused WT V. cholerae to lyse and viral load to increase 15-fold relative to when vqmA.sub.Phage was not induced. Thus, the VP882 phage fate switch can be driven by endogenously produced host DPO. We also supplied synthetic DPO to the WT and Δtdh strains. In this case, lysis occurred, and viral load increased in both strains to similar extents. Moreover, in the WT strain, 25% more lysis occurred, and viral load increased an additional 35% when exogenous DPO was provided compared to when only endogenously-produced DPO was present (
[0089] To decouple QS regulation from Qtip-directed inactivation of cl, qtip was produced from an inducible promoter, thus bypassing the need for VqmA.sub.Phage. Near-complete lysis and increased viral production occurred in both the WT and Δtdh strains in response to qtip expression and both processes were insensitive to DPO. Similar results were obtained when MMC was added instead of induction of qtip, suggesting that, at least under these test conditions, inactivation of cI by Qtip or by RecA-assisted cleavage promotes the same outcomes to the host and the phage populations. However, input from Qtip enables the phage lysis-lysogeny decision to be connected to the cell density of the host.
[0090] Phage VP882 as a QS-activated kill switch.
[0091] The plasmid-like nature of phage VP882 allows it to be maintained in non-native hosts via its endogenously-encoded replication machinery. Among the limited number of plasmid-like prophages that have been discovered, phage VP882 is unique in that it also encodes a receptor for a host-produced QS AI, which is shown to activate the phage lytic cycle. This singular arrangement allows one to explore possibilities for synthetic control of VP882 with the goal of generating a recombinant phage with highly specific, quorum-controlled lytic triggers.
[0092] In contrast to the widespread production of DPO by diverse bacteria, the response to DPO, consisting of DPO binding to VqmA and activation of the vqmR promoter is, as far as is known, limited to the vibrio genus. This asymmetry was exploited to design a V. cholerae-specific phage kill switch. To do this, the VP882 phage q gene was cloned under the V. cholerae vqmR promoter (called PvqmR-q) on a plasmid. This plasmid was introduced into E. coli and V. cholerae each lysogenized with the identical lysis-defective phage carrying a Tn5 in the q gene. Introduction of the plasmid carrying PvqmR-q did not alter growth of E. coli. However, no colonies could be recovered from V. cholerae suggesting that Q protein, made as a consequence of DPO-VqmA.sub.Vc-directed activation of the vqmR promoter, killed the V. cholerae recipient. In contrast to the WT parent, no growth defect/no lysis occurred if the host was ΔvqmA V. cholerae. Indeed, ˜5 orders of magnitude more colonies were recovered from the ΔvqmA V. cholerae strain verifying that VqmA.sub.Vc is required to transduce the DPO information to the vqmR-q promoter on the phage.
[0093] To test for cross-activation of the V. cholerae vqmR-based kill switch in other vibrios, the plasmid with PvqmR-q was introduced into V. parahaemolyticus and V. vulnificus strains lysogenized with the lysis-defective phage VP882 harboring q::Tn5. The same number of colonies were recovered following introduction of the PvqmR-q kill switch or a control plasmid, despite the fact that both V. parahaemolyticus and V. vulnificus naturally encode vqmA homologs and they make DPO. Moreover, the number of colonies recovered in both cases was 5 orders of magnitude higher than when the killing module was introduced into V. cholerae. This result is interpreted to mean that V. parahaemolyticus and V. vulnificus VqmA cannot recognize the V. cholerae vqmR promoter, and, therefore, they do not activate PvqmR-q expression and, in turn, the downstream lytic functions. Taken together, the PvqmR-q construct is recognized in a V. cholerae VqmA.sub.Vc-specific manner and thus, this construct only kills V. cholerae, not closely related vibrios.
[0094] Phage VP882 kill switches specific for other pathogens.
[0095] To demonstrate the modularity of the species-specific kill switch, it was engineered to target a human pathogen unrelated to vibrios, Salmonella typhimurium. InvF is a transcriptional activator of genes encoding proteins essential for S. typhimurium pathogenicity. invF is indirectly activated by the HilD transcription factor. Specifically, HilD activates expression of hilA, encoding a second transcription factor, HilA, that directly activates expression of invF. The invF promoter was fused to the phage q gene (PinvF-q) and introduced the construct on a plasmid into S. typhimurium lysogenized with phage VP882 harboring q::Tn5, and also carrying a plasmid with tetracycline inducible hilD (pTetA-hilD). This S. typhimurium strain grew without defect, showing that q is not expressed. Addition of low level aTc (2 ng mL.sup.−1) to induce hilD, caused a dramatic decline in growth. Isogenic S. typhimurium strains containing the PinvF-q and pTetA-hilD plasmids but lacking the VP882 phage or with pTetA-hilD and the phage, but lacking the PinvF-q plasmid were unaffected by aTc. These results show that S. typhimurium killing is phage- and kill switch-dependent.
[0096] These results demonstrate that one can exploit phage VP882 q::Tn5 as a template, and by exchanging the promoter driving q expression, one can engineer phage kill switch systems that are specific for different bacterial species. In some embodiments, plasmids were used to carry the PvqmR and PinvF to facilitate testing in different hosts lysogenized with the q::Tn5 phage mutant. However, these fusions can be integrated onto the phage VP882 genome, making the recombinant phage the only required element for the kill switch. Finally, as several points of regulation have been uncovered within the phage lytic program, including the repressor cI and three activators, VqmA.sub.Phage, Qtip, and Q that function upstream and downstream of the cI repressor, it is envisioned that one could program phages to contain different logic circuits and multiple input dependencies.
[0097] Strains, DNA, Protein, and DPO Techniques
[0098] Unless otherwise indicated, E. coli, V. cholerae, V. parahaemolyticus, and V. vulnificus were grown with aeration in Luria-Bertani (LB-Miller, BD-Difco) broth at 37° C. Low salt LB (Lennox) broth was used for S. typhimurium, and M. jannaschii was grown in Marine Broth 2216 (BD-Difco) at room temperature. M9 minimal medium supplemented with 200 mM NaCl (for V. parahaemolyticus and V. cholerae) was used where indicated. Strains used are listed in Table 1.
TABLE-US-00001 TABLE 1 Strains used. Strain Genotype Vibrios V. cholerae Wild-type C6706 V. cholerae (KPS-842) str. C6706, Δtdh V. cholerae (KPS-661) str. C6706, PvqmR-mKate2, PmicX-sfgfp::lacZ V. cholerae (KPS-662) str. C6706, ΔvqmA/PvqmR-mKate2, PmicX-sfgfp::lacZ V. parahaemolyticus BB22OP Wild-type V. parahaemolyticus O3:K6 Wild-type, phage VP882 lysogen V. vulnificus Wild-type E. coli BL21(DE3) E. coli str. B, F- ompT hsdSB (rBmB-) gal dcm (DE3) BLR(DE3) E. coli str. B, F- ompT hsdSB(rB- mB-) gal lac ile dcm Δ(srl- recA)306::Tn10 (tetR)(DE3) BW25113 lacIq, rrnBT14, ΔlacZWJ16, hsdR514, ΔaraBADAH33, ΔrhaBADLD78, tdh::kanR T7Express lysY/Iq E. coli str. B, MiniF lysY lacIq(CamR)/fhuA2 lacZ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73::miniTn10-TetS)2 [dcm] R(zgb- 210::Tn10-TetS) endA1 Δ(mcrC-mrr) 114::IS10 TOP10 F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK λ- rpsL(StrR) endA1 nupG TransforMax EC100D pir+ F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL (StrR) nupG pir+(DHFR) S. typhimurium Wild-type M. jannaschii Wild-type DSM 6295, ATCC 27135
[0099] Unless otherwise noted, antibiotics, were used at: 50 U mL.sup.−1 polymyxin B (Pb, Sigma), 100 μg mL.sup.−1 ampicillin (Amp, Sigma), 100 μg mL-1 kanamycin (Kan, GoldBio), 80 μg mL-1 Zeocin (Zeo, Thermo), and 5 μg mL.sup.−1 or 10 μg mL.sup.−1 chloramphenicol (Cm, Sigma). Cm concentration was 10 μg mL.sup.−1 when it was the only antibiotic present and 5 μg mL.sup.−1 when used in conjunction with other antibiotics. When multiple plasmids were simultaneously present within a single strain, care was exercised to limit the number of passages. Inducers were used as follows: E. coli: 250 ng mL.sup.−1 mitomycin C (MMC, Sigma), 100 ng mL.sup.−1 anhydrotetracycline (aTc, Clontech), 0.2% L-arabinose (ara, Sigma), 0.5 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG, GoldBio). Vibrios: 50 ng mL.sup.−1 MMC, 10 ng mL.sup.−1 aTc, 0.2% ara. S. typhimurium: 2 ng mL.sup.−1 aTc. The HIS-VqmA.sub.Phage, HIS-VqmA.sub.Vc, and HIS-LuxO proteins were produced and purified as described (Papenfort et al., 2017), with the exception that HIS-VqmA.sub.Vc was treated with thrombin CleanCleave (Sigma) post-purification. DPO was analyzed for bioactivity as described (Papenfort et al., 2017), with the exception that a different reporter strain was used, see table 2, below.
TABLE-US-00002 TABLE 2 Plasmids Used. Plasmids used Organism pJES-052 V. parahaemolyticus VP882 lysogen and cured pJES-052 V. parahaemolyticus VP882 lysogen and cured [pKP-367 + pJES-045] BW25113 tdh::kanR E. coli pJES-095; pKP-445; pWN-001 proteins from BL21(DE3) E. coli pJY-014; pJES-052; pJES-093; [JSP-003 + V. parahaemolyticus VP882 lysogen pJY-014]; [JSP-003 + pJES-052]; [JSP- 003 + pJES-093]; [JSP-002 + pJY-014]; [JSP-002 + pJES-052]; [JSP-002 + pJES- 093] [JSP-024 + pJY-014]; [JSP-024 + pJES- V. parahaemolyticus VP882 lysogen 052]; [JSP-024 + pJES-093]; [JSP-003 + pJY-014]; [JSP-003 + pJES-052]; [JSP- 003 + pJES-093] pJES-087 TOP10 E. coli [pJES-105 + pJY-014]; [pJES-105 + TOP10 E. coli pJES-093] pJES-097; [pJES-097 + pJES-174] V. parahaemolyticus VP882 lysogen and cured [pJES-104 + pJY-014]; [pJES-104 + TOP10 E. coli pJES-159] pJES-134 BLR(DE3) and T7Express E. coli [pJES-097 + pJES-134] BLR(DE3) and T7Express E. coli [pJES-104 + pJY-014]; [pJES-105 + pJY- V. parahaemolyticus VP882 lysogen 014]; [pJES-104 + pJES-052]; [pJES-105 + pJES-052] [pJES-130 + pXB-300]; [pJES-130 + TOP10 E. coli pJES-133]; [pJES-130 + pJES-141] pJY-014; pJES-052; pJES-143 V. parahaemolyticus VP882 lysogen pJES-147; pJES-157; pJES-154 proteins from BL21(DE3) E. coli [pJES-143 + pJES-134]; [pJES-143 + T7Express E. coli pJES-156] [pJES-166 + pJES-134] T7Express E. coli Upper: [pJES-143 + pJES-134]; [pJES- T7Express E. coli 143 + pJES-150]; [pJES-143 + pJES- 151]; Lower: [pJES-153 + pJES-134]; [pJES-153 + pJES-150]; [pJES-153 + pJES-151] pJES-143; pJES-153 V. parahaemolyticus VP882 lysogen pJY-014; pJES-023; pJES-052 KPS-662 V. cholerae pKP-445; pJES-095 proteins from BL21(DE3) E. coli [pJES-119 + pJES-052]; [pJES-101 + TOP10 E. coli pJES-052]; [pJES- 119 + pKP-375]; [pJES-101 + pKP-375] [JSP-002 + pKP-375]; [JSP-002 + pJES- V. cholerae 052] [JSP-024 + pJES-052]; [JSP-024 + pJES- V. cholerae and KPS-842 V. cholerae 143] [JSP-024 + pJES-052]; [JSP-024 + pJES- V. cholerae and KPS-842 V. cholerae 143] [JSP-003 + pJES-117] V. cholerae, KPS-662 V. cholerae, V. ON vulnificus, V. parahaemolyticus VP882 lysogen [pJES-171 + pJES-167]; [JSP-003 + S. typhimurium 14028 pJES-171]; [JSP-003 + pJES-171 + pJES- 167] pJES-052 V. parahaemolyticus VP882 lysogen and cured none V. parahaemolyticus VP882 lysogen and cured pJES-052 TOP10 E. coli, V. cholerae, V. parahaemolyticus BB22OP, V. parahaemolyticus VP882 lysogen JSP-1270 V. parahaemolyticus VP882 lysogen and cured pKP-445; pWN-001; pJES-095 proteins from BL21(DE3) E. coli pJES-052; [JSP-003 + pJES-052] V. parahaemolyticus VP882 lysogen [pJES-052 + pJES-128 + pJES-125]; TransforMax EC-100D E. coli [pJES-052 + pJES- 128 + pJES-140] [pJES-104 + pJES-052]; [pJES-104 + TOP10 E. coli pJES-052 + pJES- 174]; [pJES-104 + pJES-052 + JSP-003] pJES-095 TOP10 E. coli [pJES-143 + pJES-140]; [pJES-143 + proteins from BL21(DE3) E. coli pJES-158] pJES-174; pJES-173 TOP10 E. coli [pJES-143 + pJES-134]; [pJES-143 + T7Express E. coli pJES-150]; [pJES- 143 + pJES-148]; [pJES-143 + pJES-151] [pJES-104 + pJES-143]; [pJES-104 + TOP10 E. coli pJES-153] [JSP-024 + pJES-143] V. cholerae and KPS-842 V. cholerae [JSP-003 + pJY-014]; [JSP-003 + pJES- TOP10 E. coli 117] [pJES-120 + pJES-052] TOP10 E. coli pJES-174; pJES-177; pJES-176; pJES- TOP10 E. coli 175
[0100] Liquid Chromatography-Mass Spectrometry for DPO Detection
[0101] Standards were prepared in 50% MeOH. Samples and standards were loaded onto a 1 mm×75 mm C12 column (ACE 3 C18 PFP, Mac-Mod) using a Shimadzu HPLC system and PAL auto-sampler (20 μL per injection) at a flow rate of 70 μL min.sup.−1. The column was maintained at 45° C. using a column oven. The column was connected inline to an electrospray source coupled to an LTQ-Orbitrap XL mass spectrometer (Thermo). Caffeine (2 pM μL.sup.−1 in 50% acetonitrile with 0.1% formic acid) was injected as a lock mass through a tee at the column outlet using a syringe pump at 45 μL min.sup.−1 (Harvard PHD 2000). Chromatographic separation was achieved with a linear gradient from 1% to 45% B in 6 min (A: 0.1% formic acid, B: 0.1% formic acid in acetonitrile) with an initial 1 min hold at 1% B and followed by 4 min wash at 100% B and equilibration for 8 min with 1% B (total 20 min program). Electrospray ionization was achieved using a spray voltage of 4.50 kV aided by sheath gas (Nitrogen) at a flow rate of 12 (arbitrary units) and auxiliary gas (Nitrogen) flow rate of 1 (arbitrary units). Full scan MS data were acquired in the Orbitrap at a resolution of 60,000 in profile mode from the m/z range of 110-220. Raw files were imported into Skyline v4.1 (MacCoss Lab) and peak areas for DPO were extracted using the small molecule workflow.
[0102] Cloning Techniques
[0103] Primers and dsDNA (gene blocks) used for plasmid construction are listed in Tables 3 and 4, respectively, both obtained from Integrated DNA Technologies. Plasmids are listed in Table S3. The publicly available VP882 annotations associated with the available sequence (NC_009016.1; (Lan et al., 2009)) were used for reference and cloning with the exception of cI and q (gp59 and gp62, respectively), which, based on experimental characterization and sequence alignments, were deemed to start 27 codons downstream from the currently annotated start site of cI (gp59) and 39 codons downstream from the currently annotated start site of q (gp62). Gibson assembly, intramolecular reclosure, and traditional cloning methods, including blunt and restriction enzyme-based cloning, were employed for all cloning (see Table 5). PCR with Q5 High Fidelity Polymerase was used to generate insert and backbone DNA. Primer pairs and templates are described in Table 5. Gibson assembly relied on the HiFi DNA assembly mix. Intramolecular reclosure used the KLD enzyme mix. In traditional cloning, inserts were treated with DpnI and backbones with DpnI and CIP. Ligations were performed with T4 DNA ligase. All enzymes used in cloning were obtained from NEB. Constructs were initially transformed into TOP10 E. coli (Invitrogen). DNA was introduced by electroporation using 0.1 cm gap cuvettes (USA Scientific) with a Bio-Rad MicroPulser. For vibrios, DNA was introduced by triparental mating, as described (Bassler et al., 1993). V. parahaemolyticus was cured of phage VP882 via introduction of a plasmid (pJES-174) containing a fragment harboring the native VP882 origin of replication and plating with selection for the plasmid. The strain was subsequently cured of pJES-174 by growth in the absence of antibiotic selection. For S. typhimurium, plasmids and phage were introduced using electroporation and triparental matings. The efficiency of the V. cholerae-specific kill switch was quantified by calculating the difference in CFUs obtained from the indicated vibrio strains when mated with E. coli carrying a control plasmid (pJY-014) versus when mated with E. coli carrying the PvqmR-q kill switch plasmid (pJES-117).
TABLE-US-00003 TABLE 3 Oligonucleotides Used. Primer Sequence (5′ - 3′) 5′* Purpose JSO- GCATTTCCAGTGGAGGATAT [SEQ 5′P Plasmid 0080 ID NO.: 22] construction JSO- GTTTTTGGATCCAATCAGCTTGAC Plasmid 0083 GTTGTTGC [SEQ ID NO.: 23] construction JSO- GTCGACAATGAAGGGTCTTTTA Plasmid 0084 [SEQ ID NO.: 24] construction JSO- GTTTTTTGGATCCGGTGATTGATT Plasmid 0085 GAG [SEQ ID NO.: 25] construction JSO- TCTAGAAGAAGCTTGGGATC [SEQ Plasmid 0206 ID NO.: 26] construction JSO- CTGTTGCATGGGCATAAAG [SEQ Plasmid 0250 ID NO.: 27] construction JSO- TTCACACCTCCTGTACGC [SEQ ID Plasmid 0337 NO.: 28] construction JSO- GTTTTTTGAGCTCTGTTTATGTAAG Plasmid 0367 CAGACAGTTTTATTGTTCA [SEQ ID construction NO.: 29] JSO- TAATCAGAATTGGTTAATTGGTTG Plasmid 0369 TAACACT [SEQ ID NO.: 30] construction JSO- GGATCCGGTGATTGATTGAGC Plasmid 0402 [SEQ ID NO.: 31] construction JSO- GGAGAAACAGTAGAGAGTTGCGA Plasmid 0403 TA [SEQ ID NO.: 32] construction JSO- ATGACTAAAAAAATTTCATTCATT Plasmid 0404 ATTAACGGCC [SEQ ID NO.: 33] construction JSO- CCATTCCCAAACATTACCTACCAT Plasmid 0406 TAA [SEQ ID NO.: 34] construction JSO- GGATCCGGTGATTGATTGAGC Plasmid 0429 [SEQ ID NO.: 35] construction JSO- CACATTGGTCTCGAAGGATCC Plasmid 0703 [SEQ ID NO.: 36] construction JSO- GAATACACTCCTTGTAAGTGATTG 5′P Plasmid 0897 TTATAAGGAGC [SEQ ID NO.: 37] construction JSO- CCAAAAGCCCTGTTTCACACACA 5′P Plasmid 0898 [SEQ ID NO.: 38] construction JSO- TGTTCGATAATTATTTGGTCTTCG 5′P Plasmid 0899 GTCATTTTTCC [SEQ ID NO.: 39] construction JSO- AGAATCTTTATTTTCAGGGCATGT Plasmid 0941 CAATAAGCGAAGGGGATGA [SEQ construction ID NO.: 40] JSO- TTCGGGCTTTGTTAGCAGCCGGAT Plasmid 0942 CCTGGTTGCGCTAC [SEQ ID NO.: construction 41] JSO- TCCCCTTCGCTTATTGACATGCCCT Plasmid 0943 GAAAATAAAGATTCTCGCC [SEQ construction ID NO.: 42] JSO- CTGCTCAAGTAGCGCAACCAGGAT Plasmid 0944 CCGGCTGCTAACAAAG [SEQ ID construction NO.: 43] JSO- CTCAATGCTCCAGGGCGTTT [SEQ 5′P Plasmid 0956 ID NO.: 44] construction JSO- GCAGACACGTTGAAGAGTCCAG 5′P Plasmid 0957 [SEQ ID NO.: 45] construction JSO- GCGCCTCCTACCTTTGATGTC [SEQ 5′P Plasmid 0959 ID NO.: 46] construction JSO- GTTTTTTAATTAAGTCTGGCATCA Plasmid 0960 ATGCGGATAGTA [SEQ ID NO.: 47] construction JSO- ACCGATACTCCAATAAAAAACCCC 5′P Plasmid 0961 G [SEQ ID NO.: 48] construction JSO- GTTTTTTAATTAAGGCAGCGTTCA Plasmid 0962 ATTAAACAAAAGACC [SEQ ID NO.: construction 49] JSO- TAACTAAGTAACTAGTACAGGAG Plasmid 0969 GTGTGAAATGACT [SEQ ID NO.: 50] construction JSO- ATGAGAGTACGGGAATACAACGA Plasmid 0978 GC [SEQ ID NO.: 51] construction JSO- TTAATTAACTCGAGCGGTACCCG Plasmid 0985 [SEQ ID NO.: 52] construction JSO- GTTTTTTGGTACCTCTTACCAGCCT Plasmid 0999 AACTTCGATCA [SEQ ID NO.: 53] construction JSO- AGCAATTTAACTGTGATAAACTAC Plasmid 1000 CGCA [SEQ ID NO.: 54] construction JSO- TCTTTTTGCATGCGGCGG [SEQ ID Plasmid 1001 NO.: 55] construction JSO- AAGGATCAGATCACGCATCTTCC 5′P Plasmid 1002 [SEQ ID NO.: 56] construction JSO- TTGCTCAATCAATCACCGGATCC 5′P Plasmid 1014 [SEQ ID NO.: 57] construction JSO- GGATCCGGTGATTGATTGAGCA Plasmid 1026 [SEQ ID NO.: 58] construction JSO- TGTCATCTGGCAAATGGTCACTGA Plasmid 1058 [SEQ ID NO.: 59] construction JSO- CTGTTGCATGGGCATAAAGTTGC Plasmid 1088 [SEQ ID NO.: 60] construction JSO- GCGCGTACAGGAGGTGTGAAATG Plasmid 1096 AGAGTACGGGAATACAACGAG construction [SEQ ID NO.: 61] JSO- GCATAAAGCTTGCTCAATCAATCA 5′P Plasmid 1106 CC [SEQ ID NO.: 62] construction JSO- GTTTTTTAATTAACTTTTTCCAGGC Plasmid 1114 TGGATTGTAGGG [SEQ ID NO.: 63] construction JSO- CTTTTTCCAGGCTGGATTGTAGGG 5′P Plasmid 1115 [SEQ ID NO.: 64] construction JSO- GTTTTTTAATTAAAGCATCATCCC Plasmid 1118 CTTCGCTTATTGACAT [SEQ ID construction NO.: 65] JSO- AGCATCATCCCCTTCGCTTATTGA 5′P Plasmid 1119 CAT [SEQ ID NO.: 66] construction JSO- GTTTTTTAATTAAGGTTGTTGTGTA Plasmid 1138 GAGTTTAACTGGCC [SEQ ID NO.: construction 67] JSO- GAATCCCTGCTTCGTCCATTTGA Plasmid 1159 [SEQ ID NO.: 68] construction JSO- GTTTTTTAATTAACTACTCCGTCA Plasmid 1160 AGCCGTCAATT [SEQ ID NO.: 69] construction JSO- CGCGTTATCGCTCTGAAAGTACA Plasmid 1185 [SEQ ID NO.: 70] construction JSO- GTTTTTTAATTAACCAATTCCTGC Plasmid 1186 AGGATTTTGCG [SEQ ID NO.: 71] construction JSO- ATGAATTTTGGTAACGTCATAAGA 5′P Plasmid 1189 CGACTTAGG [SEQ ID NO.: 72] construction JSO- CATCTTATAATCCGTCGAAAAAAG Plasmid 1195 TCTGG [SEQ ID NO.: 73] construction JSO- GGCCAGTTAAACTCTACACAACAA Plasmid 1224 [SEQ ID NO.: 74] construction JSO- CGCAAAATCCTGCAGGAATTGG Plasmid 1225 [SEQ ID NO.: 75] construction JSO- ATGAAACATCATCACCATCACCAC 5′P Plasmid 1226 [SEQ ID NO.: 76] construction JSO- GTGGAGCTCCCATTTCACTTTTC Plasmid 1227 [SEQ ID NO.: 77] construction JSO- CGCTCTAGAACTAGTGGATCCC Plasmid 1228 [SEQ ID NO.: 78] construction JSO- AGGAGGTGTGAAGTGTGTGATTT 5′P Plasmid 1229 [SEQ ID NO.: 79] construction JSO- CTCAATCAATCACCGGATCCTG Plasmid 1230 [SEQ ID NO.: 80] construction JSO- GTCTCATGAGCGGATACATATTTG 5′P Plasmid 1240 AATGT [SEQ ID NO.: 81] construction JSO- GTTTTGGTACCTTTATAAAGGGGC Plasmid 1241 TGCTGG [SEQ ID NO.: 82] construction JSO- TCATCGAGTGCCTTTTGGCTG [SEQ Plasmid 1242 ID NO.: 83] construction JSO- TTCACACCTCCTGTGGAGCT [SEQ Plasmid 1243 ID NO.: 84] construction JSO- TTAATTAACCAATTCCTGCAGGAT Plasmid 1246 TTTGCG [SEQ ID NO.: 85] construction JSO- GGTATATCTCCTTCTTAAAGTTAA Plasmid 1247 ACAAAATTATTTCTAGAGG [SEQ construction ID NO.: 86] JSO- GTTTTTTGGATCCGGCTGCTAACA Plasmid 1248 AAG [SEQ ID NO.: 87] construction JSO- GTTTTTTGGATCCAAAAGGCACTC Plasmid 1249 GATGACTA [SEQ ID NO.: 88] construction JSO- GAAATGGGCAGCAGCCATC [SEQ 5′P Plasmid 1250 ID NO.: 89] construction JSO- CATGATGAATTCTCCTTAGTAAAG Plasmid 1255 TTAAAATACC [SEQ ID NO.: 90] construction JSO- GCAGAAATCGGTACTGGCTTT Plasmid 1256 [SEQ ID NO.: 91] construction JSO- GCTCTGAAAGTACAGATCCTCAGT Plasmid 1271 G [SEQ ID NO.: 92] construction JSO- TGATAAAACGCAGCAGTTATAATT Plasmid 1272 TGCGA [SEQ ID NO.: 93] construction JSO- TTCACACCTCCTGCAGGTAC [SEQ Plasmid 1273 ID NO.: 94] construction JSO- ATGATGAATTTTGGTAACGTCATA Plasmid 1274 AGACGACT [SEQ ID NO.: 95] construction JSO- CCACGGAATAGGAGGTGTTTAG Plasmid 1279 [SEQ ID NO.: 96] construction JSO- GAGGGATATCCATTACGCCAG Plasmid 1280 [SEQ ID NO.: 97] construction Tn5 construction** JSO- ctgtctcttatacacatctATTCCCATGTCAG 5′P oriR6ky-oriT- 0929 CCGTTAAGTG [SEQ ID NO.: 98] cmR JSO- ctgtctcttatacacatctAGGGCACCAATAA 5′P oriR6ky-ori T- 0930 CTGCCTTAAA [SEQ ID NO.: 99] cmR JSO- ctgtctcttatacacatctTCTAGAAGAAGCT 5′P oriR6ky-oriT- 0931 TGGGATC [SEQ ID NO.: 100] cmR JSO- ctgtctcttatacacatctCTGTTGCATGGGC 5′P oriR6ky-oriT- 0932 ATAAAG [SEQ ID NO.: 101] cmR JSO- ctgtctcttatacacatctCAAATGGACGAAG 5′P araC-pBAD- 1029 CAGGGATTC [SEQ ID NO.: 102] vqmAPhage- oriT-kanR JSO- ctgtctcttatacacatctTCCCTGTTAAGTAT 5′P araC-pBAD- 1031 CTTCCTGGC [SEQ ID NO.: 103] vqmAPhage- oriT-kanR EMSA Pairs JSO- GCATCATCCCCTTCGCTTATTGAC 5′B EMSA: Pqtip JSO-1089 × 1089 [SEQ ID NO.: 104] 0897 JSO- GAATACACTCCTTGTAAGTGATTG 5′P EMSA: Pqtip JSO-1089 × 0897 TTATAAGGAGC [SEQ ID NO.: 105] 0897 JSO- TCCGAGTATTGCGCGAGCTG [SEQ 5′B EMSA: PvqmR JSO-525 × 0525 ID NO.: 106] 526 JSO- GTTTGTACTTTACCGAACGC [SEQ EMSA: PvqmR JSO-525 × 0526 ID NO.: 107] 526 JSO- GATTTTCACCCTGGCCACCT [SEQ 5′B EMSA: JSO-1093 × 1093 ID NO.: 108] Downstream of 1095 gp55 JSO- CCCGATCCCAAGCTTCTTCTAGA EMSA: JSO-1093 × 1095 [SEQ ID NO.: 109] Downstream of 1095 gp55 JSO- CTGCCATCATCGAGCTACTGG 5′B EMSA: Internal JSO-1091 × 1091 [SEQ ID NO.: 110] to gp55 1092 JSO- GTTGATGATGAGCACTGGGAAGC EMSA: Internal JSO-1091 × 1092 [SEQ ID NO.: 111] to gp55 1092 J50- AGACAGGGCACACGATACCA [SEQ EMSA: JSO-1089 × 1090 ID NO.: 112] Upstream to 1090 gp55, promoter qPCR Pairs JSO- GACCCATTTCTAAACGCGCT [SEQ qRT-PCR, hfq JSO-134 × 0134 ID NO.: 113] 135 JSO- GCCGGCACAACTGTAGAAAT [SEQ qRT-PCR, hfq JSO-134 × 0135 ID NO.: 114] 135 JSO- ACCATTTTCCACGGACAAGAC qRT-PCR, JSO-702 × 0702 [SEQ ID NO.: 115] vqmaPhage 703 JSO- CACATTGGTCTCGAAGGATCC qRT-PCR, JSO-702 × 0703 [SEQ ID NO.: 116] vqmaPhage 703 JSO- TGATTGTGCTGGTTGTCGGTG [SEQ qRT-PCR, gp69 JSO-908 × 0908 ID NO.: 117] 909 JSO- CCATTTCGTGAGAGGTGATGTACT qRT-PCR, gp69 JSO-908 × 0909 TCTC [SEQ ID NO.: 118] 909 JSO- GTCATTTTCAACGGTTGCTCAACT qRT-PCR, gp70 JSO-910 × 0910 CAC [SEQ ID NO.: 119] 911 JSO- TAAGCGACTGGGCCAGAAC [SEQ qRT-PCR, gp70 JSO-910 × 0911 ID NO.: 120] 911 JSO- TCGAGGAGCTGGCCTATAAAGAC qRT-PCR, gp71 JSO-912 × 0912 [SEQ ID NO.: 121] 913 JSO- AAAGCGAACAGGCTCCATCC [SEQ qRT-PCR, gp71 JSO-912 × 0913 ID NO.: 122] 913 JSO- GCTGAGACGAAAAACATATTCTCA qPCR, VP882 JSO-1399 × 1399 ATAAACCC [SEQ ID NO.: 123] cmR Tn5 1400 specific JSO- GGCAGTTTCTACACATATATTCGC qPCR, VP882 JSO-1399 × 1400 AAGATG [SEQ ID NO.: 124] cmR Tn5 1400 specific JSO- GATTACTGGCTTACTATGTTGGCA qPCR, non- JSO-1401 × 1401 CTG [SEQ ID NO.: 125] phage plasmid 1402 specific JSO- GTCAGCAACACCTTCTTCACGA qPCR, non- JSO-1401 × 1402 [SEQ ID NO.: 126] phage plasmid 1402 specific Misc Pairs JSO- TCTAAAGAGTCGATGTGTTCACTG vqmaPhage JSO-747 × 0747 C [SEQ ID NO.: 127] locus 748 JSO- CCAAGAGGTAGAATTGGACAGAG vqmaPhage JSO-747 × 0748 ATC [SEQ ID NO.: 128] locus 748 JSO- AATACCATAGAACAGTCGCTCCTC V. JSO-781 × 0781 [SEQ ID NO.: 129] parahaemolyticus 782 vqmA JSO- TTGCTTTATCGATCAGCTCGTTCT V. JSO-781 × 0782 [SEQ ID NO.: 130] parahaemolyticus 782 vqmA JSO- CGTGAGCGTATTCCAGTGTC [SEQ hfq JSO-136 × 0136 ID NO.: 131] 137 JSO- AGAAATCGCGTGCTTGTACA [SEQ hfq JSO-136 × 0137 ID NO.: 132] 137 JSO- ATATTGCGGCCGGTGACAAAAG gp21-gp29 JSO-862 × 0862 [SEQ ID NO.: 133] fragment 875 JSO- CTGCCCATCTTGACCCCTT [SEQ ID gp21-gp29 JSO-862 × 0875 NO.: 134] fragment 875
TABLE-US-00004 TABLE 4 daDNA (gene blocks) Used. # gBlockname sequence (5′-3′) 1 JSgBlock- TAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGC 30 TTTTTATCGCAACTCTCTACTGTTTCTCCGGTACCTGCAGGA GGTGTGAAATGTCAATAAGCGAAGGGGATGATGCTTACAT CCGCTCGTTGATTCATTTTTTTGGCAATCAACCGGATCCGT GGGGCATCAAGGACACCAAGTCGGTGTTCATCTATGCAAA CCAGCCCTTTCGAGAGTTAGTCGGTATGAAGAACCGCAAC GTGGAAGGACTTACCGACGCTGATATGGATTGCGAAACTG CGGCCTTTGCCGACTCCTTTCAGGCCCAAGATAGGCTGGTC GAGCAAGGCCGGGAGAAGAAAATCGTCCTGGACGTACACC CCTACGCGAATGGTTGGCGCGTTTTCACTTTCACCAAGACC CCTCTCATCATGCCGTCCGGACGTGTGGCCGGCACCATTTT CCACGGACAAGACCTGACTGACACGGCTGGCCGCATCGAG CGTGCAGTGGTTGAGCTGCTGCTGCCTTCCAGTGGCCAGGC TGGATCCTTCGAGACCAATGTGGTCGGTCTCAACTTGACCG AACGCGAGGAACTGGTGCTGTTCTTCCTGCTTCGTGGCCGA ACGGCCAAGGATATCGCTGGCATGCTGGGGCGCTCTCCCC GCACCATCGAACACGCTATCGAGCGCATCCGCAACAAATT CGGTGCTGGCAACAAGCGGGAGCTCATCGATATGGCCATG TCCAAGGGTTATTACAGCATGGTGCCAAAAGCCCTGTTTCA CACACAGGTCTCGATGCTGCTCAAGTAGCGCAACCAGGAT CCGGTGATTGATTGAGCAAGCTTTATGCTTGTAAACCGTTT TGTGA [SEQ ID NO.: 10] 2 JSgBlock- TAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGC 40 TTTTTATCGCAACTCTCTACTGTTTCTCCGGTACCTGCAGGA GGTGTGAAATGGATTTGAGCACCCTTATCGCCCTGCTGACT CTGATTGTGCTGGTTGTCGGTGGTTTGCTCTCCCTCCTTTGG GGAAAGGTGAACAGCATCTCTCAGCAGCTGGCCGACGAGC GTGTCCGGTCTGCCGAGAAGTACATCACCTCTCACGAAATG GAACGGCGCCTCGAGCAAGCCATTGCACCGCTGGAGCGAA CGCTCGAGCGGATGGAAAACCAGAACAACCAGATTTTCCA GCTGTTGCGCCGCCACTACCACGCGGAGGCCAACTAATGG ACAAGCAGCAAGCGAAATCAATCGCCATCAACGAAGTGAT CGAACGTGAAGGCGGCTATGTGAATCACCCGGATGACCGA GGCGGCCCTACTCGCTGGGGCGTTACCCAGGCGAAGGCTC GGGAGCACGGTTATCACGGTGACATGCGCGACTATCCGGT CGAGGCAGCTTTCGCTGTTTATGACGCGGATTATTGGCAGC GCATGAAGCTGGACGAAATTGGCGACTACAGCCCAGACCT GGCTGTGAAGCTGTTCGACTTCGGTGTGAACAGTGGAACG GGCCGGGCGGCTCGTCATTTTCAACGGTTGCTCAACTCACT GAACAACCGCGGCGAGTTTTATCCGGACATTAAGGTCGAC GGCGCTATCGGTCAAAAGACCCTGGCTTCGCTGGCCGGCTT CTACCGCAAGCGCGGTGAGGCAGGCTTGGCCGTTCTGGCC CAGTCGCTTAACGGCCTGCGCATTGCTTTTTGCGTTGGCAT CACTGAGGACAACGAGTCGCAGGAAGTATTCGCCTTTGGC TGGTTGTCTCGCATCGTTCATTTGTAAGGAGCTGAAATGGA ACCTTTGACCATTGCGCTCGGCCTGGCCAAGTTGACCGGGC TGGATAAGAAAATCGGCCGCTGGATTGGTGGCGACAATGG CGAGGAGGTTGCCGAGAAGGTTGTCTCCATCGCCCAGCAG GTAACGGGCGCCAAGAATGGCGATCAGGCGCTGGCCAAGC TGGAAGCCAACCCTGAGCAGTTGATTGAGTTCGAGCAGGC AATGCACGAGCACGAACTGCACCTCGAGGAGCTGGCCTAT AAAGACCGCGCTGATGCTCGAGCGATGCAAGTGGCGGCGC TACAGGGTAACGATACCCTGTCTAAGCGTTTCGTCTATTAC TTCGCTATCGGATGGAGCCTGTTCGCTTTCCTGTACCTGGG CTTCATTACTTTCGGGGATATCCCGGAAGCAAACATCCGCT TTGCTGACACTGTCCTGGGCTTCCTGCTCGGTACAGTACTC GCTGGCATGTTCGGCTTCTTCTATGGCTCAAGCGCCGGGAA CGAACGTCGAGCAGAGCAGCAAGACTTGCACGCCGCGCTA ACGCCGCGGCGCCGCTAGTTTTCTCCACTTCTAGGGATCCG GTGATTGATTGAGCAAGCTTTATGCTTGTAAACCGTTTTGT GA [SEQ ID NO.: 11] 3 JSgBlock- TAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGC 42 TTTTTATCGCAACTCTCTACTGTTTCTCCGGTACCTGCAGGA GGTGTGAAATGAGAGTACGGGAATACAACGAGCAGCAACT TGACTGGGTGCGCCTTCGAATCTTTCAGGCGCATTCGCTGC ATATCAAGGGTAAGCCATTGTTTGAGGGCACGCAGTACTGT GTTCCGGCCTCTCACATAAAACGCGCCAAGACGAAAGAAG AACGAATCGAAAAAGAGCTCCGCGGCGACCTGTTCCAGGT GAAGGGCCGAGAGTCTCGCAGGGGGAAAAGTTCCATGCCA TTGCCGCCTTGGGCATTCGAGGATAGCAGAGTCGTCCGCGT GGTGAATGCCCTCCCTGATGGCCAGCGCCATTGGATCATGT ACGCATACAGCGACTGCTACAACTGGGACAATGAGTCCGG TGCGGTTGTCGCTCTCTGGAAAGAGTTCGAGCCAGAGCTGG AAGGTGTTCGCGATGACACCCTGCAGAAGCTGAAAGGCAT GGCTTACCTCTGTGTCCAGGACTTCAAGAACATCAAGAACC GAGGCAAGCCTGCACACTTGCCCTCACGCATTCGCCAGCTG ACTGGCGTGCCAGAGGGAAACTGGCGGCGTGACTGGTTGC CGCGCTGGAGACGAATGCAGCAAATCCTGACTGAGTTCGA CCGTGCGGCCCTGGCCAAGGTGATGGAGGTGATTTGTGAC CGACACGTTGCCTAAGGATCCGGTGATTGATTGAGCAAGCT TTATGCTTGTAAACCGTTTTGTGA [SEQ ID NO.: 12] 4 JSgBlock- TAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGC 44 TTTTTATCGCAACTCTCTACTGTTTCTCCGGTACCTGCAGGA GGTGTGAAGTGCATATTCGCAGAAAAATTTTCAATTCTATT CTTACTATCCGCATTGATGCCAGACTTTTTTCGACGGATTAT AAGATGATGAATTTTGGTAACGTCATAAGACGACTTAGGA AGGCTAAAGGCTGGACTCTTCAACGTGTCTGCGAAGAGAT GAATGGTGCCATTCAGACCGGTCACTTATCTCGCATTGAGC GAGGTGAACTGACGCCATCCGTTTACATAGCACGCAACATT GCCCGATCGCTTGGTACCTCACTGGATACCATGCTTGCCGA GGCCGATGGGGGGCCGCTCGCCCAAGTGGTACCGGATCCA GCGCAGCGGGTTCCGGTACTTTCATGGGTGCAAGCTGGCCT CTGGACTTCCTCGCCAACTGGCGTGGTGCCTGAGCTGTGCG ATAAATGGGTGGTTGCGCCAAGGGCCAAGTTACCGCCCCG GTGTTATGCACTGGAGGTAAGGGGCGACAGCATGCAAGCG CAGTATGGCATGAGCTTCCCGGAGGGGTGCTACATCATCGT GGATCCGAACCGCGTGCCTGAAAACAAGTCCTTTGTCGTGG CGATGCAAACGAACGCGGAAGAGGCCACATTCAAGCAGCT GATCATCGAGGGCGCGGACAAGTATTTGAAGCCGTTAAAC CCACAATATCCACTGCTTAAAATTGACCAAGAAGTAATCAC TTGTGGCGTTGTTATCGATATGGTGTGTCATCTGGCAAATG GTCACTGATAAAACGCAGCAGTTATAATTTGCGAAAAGTG AGAAAATTAGCTTAAACTAGGGCAGCCATAGAAGCCTATC GGCTGCATTTTTGTGCAAGGTTAGATATGGATCCGGTGATT GATTGAGCAAGCTTTATGCTTGTAAACCGTTTTGTGA [SEQ ID NO.: 13] 5 JSgBlock- TAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGC 47 TTTTTATCGCAACTCTCTACTGTTTCTCCGGTACCTGCAGGA GGTGTGAAGTGTGTGATTTTTGCAGTGAACACATCGACTCT TTAGACGCCCTACAATCCAGCCTGGAAAAAGGTACTGCCA TCATCGAGCTACTGGACACCGCGCTTAGTGCCGGTATCGAG GTAAGCCCGAGGGTGGTATCGTGTGCCCTGTCTGCTGCCCA CCAGCACCTTCAGGTATCGGAAAAAATAAACCGCAGCCTG CAAATAGGCTGCGGTTCAAAGGAGGTGCTTCGCCTTGTTGA TTAGTCATCGAGTGCCTTTTGGCTGGCCTCCCATGCGGCTG TCATTGCCTCAACGCGGGTGCCCTTGATTTTCACCCTGGCC ACCTCCTCGCCTTCCACCAGCGCCCAGGCTTCCCAGTGCTC ATCATCAACCTGGTGAGCCACGAGTCTGGGCTTCTGCGCTT TCTTCGGCTGTTTTTCTTAGCGCAACCAGGATCCGGTGATT GATTGAGCAAGCTTTATGCTTGTAAACCGTTTTGTGA [SEQ ID NO.: 14] 6 JSgBlock- GCCAACCACTGAGGATCTGTACTTTCAGAGCGATAACGCG 53 ATAGAAATAGATATTGGCCCGGTATTAAAGCGCATCCGTTA TGAGCGAGGGCTAACGCTACAAAAGCTGTCACGGCTTACG GATGACAAAGTGCTACCAAGCAACATTTCCCGCATCGAGA GTGCGGGCGCTGGCGCTACGCTTAAAACCTTGACCACCTTG GCGAATGCGCTGGGGACTTCTCCTTCTGACATTCTTCGTGA AGCTGAGGGCGGTGATAAGGTGATCACCAAGCCGCAGCAA GTCCTTTATGTACCTGTTTTGTCTTGGGTTCAGGCTGGCACC TGGACTGAATCACCAGAGCAGCCTGCCGATGGTGACTATG ATGAATGGGTAGAGGCACCAAGAGGCGCATCCAGGAAGGC TTTCGGCCTTCGAGTTCAAGGGGATAGTATGCAAGCCCCTA TCGGCAAGTCGTTCCCGGAAGGATGCTGCATAGTTGTTGAC CCAACCAAACAAGCAGATAACCGCTCGTTTGTTGTTGCTCG CCTGGCAGACACAGGAGAGCACACGTTCAAGCAGCTGATC ATTGACGGGCCGCACCAATATCTAAAGCCGCTAAACCCAA GTTACCGAACCATAGAAGTGAACAGCGAAGTACACGTCTG CGGGGTCGTTTTAGCATGGGGTGAAGGGTACACGGTGAAC GGTATTTAATTAATTAACCAATTCCTGCAGGATTTTGCGGC CGCTTGCT [SEQ ID NO.: 15] 7 JSgBlock- GCCAACCACTGAGGATCTGTACTTTCAGAGCGATAACGCG 55 ACTTTAGGGCAAGTAATCAGACGGATACGCCACGCCAAAC AATGGACGCTACAGCGGACTTGCGAAGAAGTGGACTTCCA AATTCAACCAGGACACCTCTCCCGTATTGAGCGGGGCGAG GGAATTCCATCCATACACTTTGTAAATATCATTTCCAAAGC GCTTGGCGTTTCTATAGACGCGATAATGGAAGAGGTTGAA GGTAAAAGGCCTGTAAAAGTATCAACCACAGAACCCATCC CTTACCTACCAATAGTCTCATGGGTCCAAGCAGGATCCTGG ACCGACTCCCCACCGGCGGCAGACCCTCTCAGCTGTGATGA CTGGGTGATAGCCCCTAAGAAACTCCCAAAGAACTGCTAT GCATTGCGCGTAGTAGGCGACAGCATGACCGCACCATACG GCCCATCGTTCCCTGATGGCTGCATTATCATTGTTGACCCC ACCAAACAGCCTGAGAACAAGAGTTTTGTTGTTGCAAGGC AGGAAGGCTCAGACGAAGCAACCTTCAAACAACTAGCCAT TGAAGGCGGAACAAGATACTTAAAGCCACTGAATCAACAA TACCCACTGATTCAGATAAATGGCGACACTAGGTTCTGCGG AGTCGTGACCTTCATAATTTCACAAATCTAGTTAATTAACC AATTCCTGCAGGATTTTGCGGCCGCTTGCT [SEQ ID NO.: 16] 8 JSgBlock- GCCAACCACTGAGGATCTGTACTTTCAGAGCGATAACGCG 56 AGCACAAAAAAGAAACCATTAACACAAGAGCAGCTTGAGG ACGCACGTCGCCTTAAAGCAATTTATGAAAAAAAGAAAAA TGAACTTGGCTTATCCCAGGAATCTGTCGCAGACAAGATGG GGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATGGCATC AATGCATTAAATGCTTATAACGCCGCATTGCTTGCAAAAAT TCTCAAAGTTAGCGTTGAAGAATTTAGCCCTTCAATCGCCA GAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCC GTCACTTAGAAGTGAGTATGAGTACCCTGTTTTTTCTCATG TTCAGGCAGGGATGTTCTCACCTGAGCTTAGAACCTTTACC AAAGGTGATGCGGAGAGATGGGTAAGCACAACCAAAAAA GCCAGTGATTCTGCATTCTGGCTTGAGGTTGAAGGTAATTC CATGACCGCACCAACAGGCTCCAAGCCAAGCTTTCCTGAC GGAATGTTAATTCTCGTTGACCCTGAGCAGGCTGTTGAGCC AGGTGATTTCTGCATAGCCAGACTTGGGGGTGATGAGTTTA CCTTCAAGAAACTGATCAGGGATAGCGGTCAGGTGTTTTTA CAACCACTAAACCCACAGTACCCAATGATCCCATGCAATG AGAGTTGTTCCGTTGTGGGGAAAGTTATCGCTAGTCAGTGG CCTGAAGAGACGTTTGGCTGATTAATTAACCAATTCCTGCA GGATTTTGCGGCCGCTTGCT [SEQ ID NO.: 17] 9 JSgBlock- CCTATCAGTGATAGAGAAAAGTGAAATGGGAGCTCCACAG 58 GAGGTGTGAAATGGATTTAAGGGTTTCAAACGCTAAGGAT TTATTGGATAAGTTCGAGGAGAAAGCTGTACAGATGGAAT CAATCAGCCAGTTACTGGCTAATGCGCCGGAGGATCTGAC GCTGGCCACCGTGCAAGGTAGTCTATCGGCATTGGCATCGA TCGCCAGGGATGCCGGGGAGGCTGCTGATCGCCTGAGGAC GATCAGCAGTGCGGAAGGTTAGTCGCGGTTGCGGAAGATG TTCCAGGCCGCGGCGATCGCTGCAGCCCTGGAGCTCATCGA GTGCCTTTTGGCTGGCCTCCCATGCGGCTGTCATTGCCTCA AC [SEQ ID NO.: 18] 10 JSgBlock- CCTATCAGTGATAGAGAAAAGTGAAATGGGAGCTCCACAG 60 GAGGTGTGAAATGGACAAAGATTGCGAAATGAAACGTACC ACCCTGGATAGCCCGCTGGGCAAACTGGAACTGAGCGGCT GCGAACAGGGCCTGCATGAAATTAAACTGCTGGGTAAAGG CACCAGCGCGGCCGATGCGGTTGAAGTTCCGGCCCCGGCC GCCGTGCTGGGTGGTCCGGAACCGCTGATGCAGGCGACCG CGTGGCTGAACGCGTATTTTCATCAGCCGGAAGCGATTGAA GAATTTCCGGTTCCGGCGCTGCATCATCCGGTGTTTCAGCA GGAGAGCTTTACCCGTCAGGTGCTGTGGAAACTGCTGAAA GTGGTTAAATTTGGCGAAGTGATTAGCTATCAGCAGCTGGC GGCCCTGGCGGGTAATCCGGCGGCCACCGCCGCCGTTAAA ACCGCGCTGAGCGGTAACCCGGTGCCGATTCTGATTCCGTG CCATCGTGTGGTTAGCTCTAGCGGTGCGGTTGGCGGTTATG AAGGTGGTCTGGCGGTGAAAGAGTGGCTGCTGGCCCATGA AGGTCATCGTCTGGGTAAACCGGGTCTGGGACCTGCAGGC GGATCCGGCGAGCCAACCACTGAGGATCTGTACTTTCAGA GCGATAACGCGTGTGATTTTTGCAGTGAACACATCGACTCT TTAGACGCCCTACAATCCAGCCTGGAAAAAGGTACTGCCA TCATCGAGCTACTGGACACCGCGCTTAGTGCCGGTATCGAG GTAAGCCCGAGGGTGGTATCGTGTGCCCTGTCTGCTGCCCA CCAGCACCTTCAGGTATCGGAAAAAATAAACCGCAGCCTG CAAATAGGCTGCGGTTCAAAGGAGGTGCTTCGCCTTGTTGA TTAGTCATCGAGTGCCTTTTGGCTGGCCTCCCATGCGGCTG TCATTGCCTCAAC [SEQ ID NO.: 19] 11 JSgBlock- GGGTCTTTTTGCATGCGGCGGGTACCGCTCGAGTTAATTAA 69 TATTTTAAATCAGCAAACACTATGCAAGTTGGCCAATTTAA TTAGCGGGCGGCATCAGTTTCATAATGATTGCATCAGGATT TTGCCACCCGCTCCCGGTATTGTTTACATATTAAAATGATTT TTAACTGGTGCTGACAACTATGCTAAATACGCAGGAAGTA CTTAAAGAAGGAGAGAAGCGGAAAATCCGCAGCCCGGAA GCATGGTTTATACAGACGTGTTCCGCGCAAAAGCTGCATAT GAGAGTACGGGAATACAACGAGCAGCAACTTGACTGGG [SEQ ID NO.: 20] 12 JSgBlock- CCTATCAGTGATAGAGAAAAGTGAAATGGGAGCTCCACAG 73 GAGGTGTGAAATGGAAAATGTAACCTTTGTAAGTAATAGT CATCAGCGTCCTGCCGCAGATAACTTACAGAAATTAAAATC ACTTTTGACAAATACCCGGCAGCAAATTAAAAGTCAGACT CAGCAGGTTACCATCAAAAATCTTTATGTAAGCAGTTTCAC TTTAGTTTGCTTTCGGAGCGGTAAACTGACGATTAGCAATA ATCACGATACGATTTACTGTGACGAACCTGGGATGTTGGTG CTCAAAAAAGAGCAGGTAGTTAACGTGACGCTTGAAGAGG TCAATGGCCACATGGATTTCGATATACTCGAGATACCGACG CAACGACTTGGCGCTCTCTATGCACTTATCCCAAACGAGCA GCAAACCAAAATGGCGGTACCCACAGAGAAAGCGCAGAA GATCTTCTATACGCCTGACTTTCCTGCCAGAAGAGAGGTAT TTGAACATCTGAAAACGGCGTTCTCCTGTACGAAGGATACA AGCAAAGGTTGCAGTAACTGTAACAACAAAAGTTGTATTG AAAATGAAGAGTTAATTCCTTATTTTCTGCTGTTCCTGCTTA CTGCTTTTCTCCGACTCCCGGAGAGTTATGAGATCATCCTT AGCTCGGCTCAGATAACGTTAAAGGAGCGCGTTTACAACA TTATATCTTCGTCACCCAGTAGACAGTGGAAGCTTACGGAT GTTGCCGATCATATATTTATGAGTACGTCAACGCTCAAACG GAAACTTGCAGAAGAAGGTACCAGCTTTAGCGACATCTAC TTATCGGCAAGAATGAATCAGGCAGCAAAACTTTTACGCA TAGGCAACCATAATGTTAATGCTGTAGCATTAAAATGTGGT TATGATAGCACGTCCTACTTCATTCAATGTTTCAAAAAATA TTTTAAAACTACGCCATCGACATTCATAAAAATGGCGAACC ATTAATCATCGAGTGCCTTTTGGCTGGCCTCCCATGCGGCT GTCATTGCCTCAAC [SEQ ID NO.: 21]
TABLE-US-00005 TABLE 5 Summary of Cloning Techniques. Plasmid Relevant Marker, # Plasmid name ID Strain ID fragment Origin 1 control::Tn5 VP882 JSP-002 JSP-0002 full length Cm, VP882 phage and oriR6ky 2 q::7n5 VP882 JSP-003 JSP-0003 full length Cm, VP882 phage and oriR6ky 3 vqmA.sub.Phage::Tn5 JSP-024 JSP-0024 full length Cm, VP882 VP882 phage and oriR6ky 4 gp07::Tn5 (araC- JSP-1270 JSP-1270 full length Kan, VP882 pBAD-vqmA.sub.Phage- phage oriT-kanR) VP882 5 PvqmA.sub.Vc-vqmA.sub.Vc pJES-023 JSS-0319 vqmA.sub.Vc Kan, p15A 6 PvqmR-lux, ZeoR pJES-045 JSS-0787- PvqmR-lux Zeo, p15A 790 reporter, ZeoR 7 pBAD-vqmA.sub.Phage pJES-052 JSS-0864 vqmA.sub.Phage Kan, p15A 8 pBAD-gp69-71 pJES-087 JSS-1171 gp69-71 Kan, p15A 9 pBAD-q pJES-093 JSS-1197 q Kan, p15A 10 pET15b-T7-HIS- pJES-095 JSS-1204 HIS- Amp, pBR322 vqmA.sub.Phage vqmA.sub.Phage 11 Pq-lux, KanR pJES-097 JSS-1219 Pq-lux Kan, p15A reporter, KanR 12 PvqmR-lux, AmpR pJES-101 JSS-1245 PvqmR-lux Amp, pBR322 reporter, AmpR 13 Pq-lux, AmpR pJES-104 JSS-1271 Pq-lux Amp, pBR322 reporter, AmpR 14 Pgp69-lux pJES-105 JSS-1291 Pgp69-lux Amp, pBR322 reporter 15 PvqmR-q pJES-117 JSS-1345 PvqmR-q kill Kan, p15A switch 16 Pqtip-lux pJES-119 JSS-1357- Pqtip-lux Amp, pBR322 1358 reporter 17 PvqmA.sub.Phage-lux pJES-120 JSS-1365 PvqmA.sub.Phage- Amp, pBR322 lux reporter 18 cI.sub.VP882, Pq-lux pJES-125 JSS-1388 cI.sub.VP882, Pq- Amp, pBR322 lux reporter 19 minimal phage pJES-128 JSS-1384 “Active Cm, oriR6ky “Active Fragment”, Fragment”, CmR CmR 20 pBAD-vqmA.sub.Phage, pJES-130 JSS-1434 pBAD- Kan, p15A cI.sub.VP882, Pq-lux vqmA.sub.Phage, cI.sub.VP882, Pq- lux reporter 21 minimal phage pJES-133 JSS-1462 “Active Amp, pBR322 “Active Fragment”, Fragment”, AmpR AmpR 22 pH6HTN-pT7-HIS- pJES-134 JSS-1460 HIS-HALO- Amp, pBR322 HALO-cI.sub.VP882 cI.sub.VP882 23 HALO-cI.sub.VP882, Pq- pJES-140 JSS-1480 HALO- Amp, pBR322 lux cI.sub.VP882, Pq- lux reporter 24 pTetA-qtip, AmpR pJES-141 JSS-1487 qtip, AmpR Amp, pBR322 25 pTetA-qtip, KanR pJES-143 JSS-1507 qtip, KanR Kan, p15A 26 pET15b-pT7-HIS- pJES-147 JSS-1542 HIS-qtip Amp, pBR322 qtip 27 pH6HTN-pT7-HIS- pJES-148 JSS-1543 HIS-HALO- Amp, pBR322 HALO-cI.sub.VP58.5 cI.sub.VP58.5 28 pH6HTN-pT7-HIS- pJES-150 JSS-1545 HIS-HALO- Amp, pBR322 HALO-cI.sub.MJ1 cI.sub.MJ1 29 pH6HTN-pT7-HIS- pJES-151 JSS-1546 HIS-HALO- Amp, pBR322 HALO-cI.sub.lambda cI.sub.lambda 30 pTetA-orf.sub.584 pJES-153 JSS-1568 MJ1 orf.sub.584 Kan, p15A 31 pH6HTN-pT7- pJES-154 JSS-1575 HALO- Amp, pBR322 HALO-cI.sub.VP882 cI.sub.VP882 (no HIS) 32 pH6HTN-pT7-HIS- pJES-156 JSS-1584 HIS-HALO Amp, pBR322 HALO 33 pH6HTN-pT7- pJES-157 JSS-1590 HALO (no Amp, pBR322 HALO HIS) 34 HALO; Pq-lux pJES-158 JSS-1602 HALO (no Amp, pBR322 cI.sub.VP882), Pq- lux reporter 35 pBAD-cI pJES-159 JSS-1606 cI.sub.VP882 Amp, pBR322 36 pTetA-SNAP-qtip pJES-166 JSS-1619 SNAP-qtip Kan, p15A 37 PInvF-q pJES-167 JSS-1620 PinvF-q kill Kan, p15A switch 38 pTetA-hilD pJES-171 JSS-1624 hilD Amp, pBR322 39 cI.sub.MJ1, repA.sub.MJ1, pJES-173 JSS-1649-51 cI.sub.MJ1, Cm, MJ1 and pRE112 repA.sub.MJ1 oriR6ky 40 cI.sub.VP882, repA.sub.VP882, pJES-174 JSS-1180 cI.sub.VP882, Cm, VP882 vqmA.sub.Phage, pRE112 repA.sub.VP882, and oriR6ky vqmA.sub.Phage 41 ΔcI.sub.VP882, repA.sub.VP882, pJES-175 JSS-1703 repA.sub.VP882 Cm, VP882 ΔvqmA.sub.Phage, pRE112 and oriR6ky 42 ΔcI.sub.VP882, repA.sub.VP882, pJES-176 JSS-1704 repA.sub.VP882, Cm, VP882 vqmA.sub.Phage, pRE112 vqmA.sub.Phage and oriR6ky 43 cI.sub.VP882, repA.sub.VP882, pJES-177 JSS-1705 cI.sub.VP882, Cm, VP882 ΔvqmA.sub.Phage, pRE112 repA.sub.VP882 and oriR6ky 44 pBAD pJY-014 BB-Ec0366 Empty vector Kan, p15A 45 pBAD-vqmA.sub.Vc, pKP-367 KPS-0383 vqmA.sub.Vc Amp, pBR322 AmpR 46 pBAD-vqmA.sub.Vc, pKP-375 KPS-0441 vqmA.sub.Vc Kan, p15A KanR 47 pET15b-pT7-HIS- pKP-445 KPS-0929 HIS-vqmA.sub.Vc Amp, pBR322 vqmA.sub.Vc 48 pET28b-pT7-HIS- pWN-001 BB-Ec0194 HIS-luxO Kan, pBR322 luxO 49 pTetA pXB-300 NM-0196/ Empty vector Amp, pBR322 JSS-1478
TABLE-US-00006 TABLE 6 Cloning Techniques (Continued). Primers for Template for Primers for Template for Cloning # insert insert backbone backbone method 1 in vitro transposon mutagenesis 2 in vitro transposon mutagenesis 3 in vitro transposon mutagenesis 4 in vitro transposon mutagenesis 5 JSO-080 × V. cholerae JSO-084 × pEVS-143* Traditional 083 (BamHI) 085 (BamHI) (one-sided BamHI) 6 JSO-355 × pCR topo JSO-367 × JSS-743 Traditional 356 vector 369 (PvqmR-lux (blunt) (Thermo) KanR, unpublished) 7 n/a gblock30 JSO-402 × pKP-389 Gibson 403 (pBAD- vqmA.sub.Vc- 3XFLAG KanR, unpublished) 8 n/a gblock40 JSO-402 × pKP-389 Gibson 403 (pBAD- vqmA.sub.Vc- 3XFLAG KanR, unpublished) 9 n/a gblock42 JSO-402 × pKP-389 Gibson 403 (pBAD- vqmA.sub.Vc- 3XFLAG KanR, unpublished) 10 JSO-941 × pJES-052 JSO-943 × JSS-1023 Gibson 942 944 (pT7-HIS- TEV-vqmA.sub.Vc AmpR, unpublished) 11 JSO-959 × VP882 JSO-404 × JSS-743 Traditional 960 (PacI) 406 (PacI) (PvqmR-lux (one-sided KanR, PacI) unpublished) 12 JSO-1001 × JSS-743 JSO-999 × pKP-445 Traditional 1002 (KpnI) (PvqmR-lux 1000 (KpnI) (one-sided KanR, KpnI) unpublished plasmid) 13 JSO-959 × VP882 JSO-404 × pJES-101 Traditional 960 (PacI) 406 (PacI) (one-sided PacI) 14 JSO-961 × VP882 JSO-404 × pJES-101 Traditional 962 (PacI) 406 (PacI) (one-sided PacI) 15 JSO-1096 × pJES-093 JSO-337 × JSS-743 Gibson 1014 429 (PvqmR-lux KanR, unpublished plasmid) 16 JSO-1118 × VP882 JSO-969 × pJES-101 Traditional 1115 (PacI) 406 (PacI) (one-sided PacI) 17 JSO-1114 × VP882 JSO-969 × pJES-101 Traditional 1119 (PacI) 406 (PacI) (one-sided PacI) 18 JSO-1138 × VP882 JSO-404 × pJES-101 Traditional 956 (PacI) 406 (PacI) (one-sided PacI) 19 JSO-1088 × JSS-1300 n/a n/a Intramolecular 703 (phage (reclosure) miniplasmid, unpublished) 20 first round: first round: first round: first round: Multi-step: JSO-1138 × VP882; second JSO-404 × pJES-101; one-sided 956 (PacI); round: pJES- 406 (PacI); second round: PacI, one- second 125 second round: pJES-052 sided PacI round: JSO- JSO-1159 × 1138 × 1106 1160 (PacI) (PacI) 21 random VP882 obtained pSMART- Traditional fragments of commercially, LC-Amp (blunt) phage DNA ready-to-use (Lucigen) linear 22 JSO-1189 × VP882 JSO-1185 × pJES-156 Traditional 1138 (PacI) 1186 (PacI) (one-sided PacI) 23 JSO-1225 × pJES-134 JSO-1224 × pJES-125 Traditional 1226 (PacI) 1195 (PacI) (one-sided PacI) 24 JSO-1229 × gblock47 JSO-1227 × pXB-300** Traditional 1230 1228 (one-sided (BamHI) (BamHI) BamHI) 25 JSO-1240 × JSS-1487 JSO-985 × JSS-743 Traditional 1241 (KpnI) 1026 (KpnI) (PvqmR-lux (one-sided KanR, KpnI) unpublished plasmid) 26 JSO-1249 × JSS-1513 JSO-1247 × pKP-445 Traditional 1250 (pTetA-m- 1248 (one-sided (BamHI) qtip KanR, (BamHI) BamHI) unpublished) 27 n/a gblock53 JSO-1246 × pJES-156 Gibson 1185 28 n/a gblock55 JSO-1246 × pJES-156 Gibson 1185 29 n/a gblock56 JSO-1246 × pJES-156 Gibson 1185 30 n/a gblock58 JSO-1242 × pJES-143 Gibson 1243 31 JSO-1255 × pJES-134 n/a n/a Intramolecular 1256 (reclosure) 32 33 JSO-1255 × pJES-156 n/a n/a Intramolecular 1256 (reclosure) 34 JSO-1271 × pJES-140 n/a n/a Intramolecular 1272 (reclosure) 35 first round: first round: first round: pKP-389 Multi-step: n/a; second gblock44; JSO-402 × (pBAD- Gibson, round: JSO- second round: 403; second vqmA.sub.Vc- intramolecular 1273 × 1274 n/a round: n/a 3XFLAG (reclosure) KanR, unpublished); second round: n/a 36 n/a gblock60 JSO-1242 × pJES-143 Gibson 1243 37 n/a gblock69 JSO-985 × pJES-117 Gibson 978 38 n/a gblock73 JSO-1242 × pJES-141 Gibson 1243 39 JSO-1279 × MJ1 JSO-206 × pRE112*** Traditional 1280 250 (blunt) 40 JSO-897 × VP882 JSO-206 × pRE112*** Traditional 899 250 (blunt) 41 JSO-898 × pJES-176 n/a n/a Intramolecular 206 (reclosure) 42 JSO-957 × pJES-174 n/a n/a Intramolecular 1058 (reclosure) 43 JSO-898 × pJES-174 n/a n/a Intramolecular 206 (reclosure) 44 45 46 47 48 49
[0104] Growth, Lysis, and Reporter Assays. Typically, overnight cultures were back diluted 1:1000 into fresh medium with appropriate antibiotics and strains were grown to OD.sub.600 0.5-0.6. Cultures were back diluted 1:20, and grown to OD.sub.600 0.1, before being dispensed (200 μL) into 96 well plates (Corning Costar 3904). MMC, ara, or aTc was added as specified. Wells that did not receive treatment received an equivalent volume of water. Plates were shaken at 37° C. and a BioTek Synergy Neo2 Multi-Mode reader was used to measure OD.sub.600, OD.sub.600 and bioluminescence, or OD.sub.600 and fluorescence. Measurement times for single time point assays are provided in Table S4. In Figure S2D, V. parahaemolyticus was monitored at 6 h, V. cholerae at 8 h, and E. coli at 12 h. Relative light units (RLU) and relative fluorescence units (RFU) were calculated by dividing the bioluminescence and fluorescence readings, respectively, by the OD.sub.600 at that time. In the case of fluorescence assays, M9 supplemented with 0.4% casamino acids (BD-Difco) was used and readings were made by excitation at 588 nm and emission at 633 nm. The glycerol stocks were prepared from three independent colonies of each strain at a single OD.sub.600. Care was taken to ensure that the OD.sub.600 between these strains was identical prior to storage. Parallel cultures of the same strains were used for viral preparations.
[0105] Phage DNA Isolation. Phage DNA was purified from phage particles present in the supernatants of lysed cells (virion) and from host cell pellets lysogenized with VP882 (prophage). Prophage DNA was purified using the FosmidMAX kit (Lucigen) according to the manufacturer's protocol for 1.5 mL cultures. Virion DNA was isolated using a Phage DNA isolation kit (Norgen Biotek) including the DNase I and Proteinase K treatment steps indicated in the manufacturer's protocol.
[0106] In vitro Tn5 (IVT) Mutagenesis. VP882 phage DNA was used as the target for IVT. VP882 prophage DNA was isolated as described above, with the addition of a final digestion step to remove residual genomic DNA. Removal was accomplished by treatment with EcoRI, a restriction site that is absent in the VP882 genome, followed by Plasmid-Safe DNase (Lucigen). The transposon was constructed by PCR amplification of pRE112 (Edwards et al., 1998) with primers JSO-929×930 and JSO-931×932 (see Table 2) to make recombinant VP882 phage carrying an oriR6ky-oriT-cmR Tn5 transposon. To engineer the recombinant VP882 phage carrying the araC-pBAD-vqmA.sub.Phage-oriT-kanR Tn5 transposon, PCR amplification of pJES-052 with JSO-1029×1031 was used (see Table 3). All IVT reactions were carried out in a PCR thermocycler with EZ-Tn5 transposase (Lucigen) as described by the manufacturer for in vitro insertion reactions.
[0107] RT-qPCR. Overnight cultures of V. parahaemolyticus carrying pJES-052 and either WT phage VP882 or phage VP882 q::Tn5 were back diluted 1:1000 and grown with shaking at 37° C. Upon reaching OD.sub.600 0.2-0.4, cultures were divided in half, ara (0.2% final) was added to one aliquot and an equal volume of water to the other. These preparations were allowed to continue to grow at 37° C. for 60 min. A total of 1.5-2 OD.sub.600 worth of cells was treated with RNAProtect Bacteria Reagent (Qiagen) according to the supplier's protocol. The cells were pelleted at 4,000 RPM for 10 min at 4° C. Pellets were stored at −80° C. prior to processing. Total RNA was isolated from three independent cultures per condition using the RNeasy Mini Kit (Qiagen). The samples were treated with DNAse using a TURBO DNA-free Kit (Thermo). cDNA was prepared from 1.5 μg RNA as described (Tu and Bassler, 2007) using SuperscriptIII reverse transcriptase (Thermo). SYBR Green mix (Quanta) and Applied Biosystems QuantStudio 6 Flex Real-Time PCR detection system (Thermo) were used for real-time PCR. Each cDNA sample was amplified in technical quadruplicate. Data were analyzed by a comparative CT method, in which the indicated target gene (vqmA.sub.Phage or gp69-71) was normalized to an internal bacterial control gene (hfq). The reference sample for all comparisons was the WT V. parahaemolyticus strain lysogenized with phage VP882 q::Tn5 to which no arabinose was added.
[0108] qPCR and Viral Preparations. Viral preparations consisted of purified non-chromosomal DNA (ZR BAC kit, Zymo Research) prepared from 2 mL of cells. Following addition of the indicated compounds or water control, the cultures were returned to growth for 3 h prior to harvesting. This alteration in procedure was necessary to enable growth of sufficient cells for use with the viral preparation kit. 0.5 ng of purified non-chromosomal DNA was used for each qPCR reaction. qPCR reactions were performed as described above for qRT-PCR reactions. Data were analyzed by a comparative CT method in which the VP882 phage-specific primer set (JSO-1399×1400) was normalized to the non-phage plasmid-specific primer set (JSO-1401×1402). The reference sample for each comparison was the isogenic strain (Δtdh or WT) that was not induced.
[0109] Western Blot to Assess HALO-cl. The pJES-134 plasmid carrying the HIS-HALO-cI protein construct was transformed into recA.sup.+E. coli T7Express (NEB) and ΔrecA E. coli BLR(DE3) (Novagen). Overnight cultures were back-diluted 1:100 into fresh medium and grown to OD.sub.600˜0.4-0.6. The cultures were divided in half. To one aliquot, MMC (250 ng mL.sup.−1 final conc.) was added, and to the other aliquot, an equivalent volume of water was added. Samples were incubated for an additional 2.5 h. 1 mL of culture was collected from each sample, the cells were pelleted (13,000 g×1 min), and resuspended in HALO western lysis buffer (30 μL B-PER complete (Thermo), 1× Halt protease inhibitor cocktail (Thermo), 0.5 mM EDTA, 5 μM HALO-TMR ligand (Promega), 1 μL benzonase (Millipore)). The samples were incubated in the dark at 37° C. for 15-20 min before addition of 10 μL Laemmli sample buffer (Bio-Rad), followed by incubation at 70° C. for 15-20 min. 10 μL of each sample was separated by SDS-PAGE in 4-20% Mini-Protein TGX gels (Bio-Rad) and imaged using an ImageQuant LAS 4000 (GE) imager under the SYBR-Green setting.
[0110] Co-Immunoprecipitation. Cultures of E. coli BL21(DE3) producing HIS-Qtip, HALO-cI, and HALO were grown overnight, back-diluted 1:100, and grown to OD.sub.600˜0.5-0.8. 0.5 mM IPTG was added, followed by 4 h continued incubation. The cultures were moved to ice and 75 mL of cells containing HIS-Qtip were divided into three equal aliquots of 25 mL and placed in 50 mL conical tubes. To one tube, 25 mL of cells that had produced HIS-Qtip were added. To a second tube, 25 mL of cells that had produced HALO-cI were added. To the third tube, 25 mL of cells that had produced HALO were added. Each mixture was made in triplicate and immediately pelleted at 4,000 RPM for 10 min at 4° C. The cell pellets were stored at −80° C.
[0111] Cell lysis was carried out by resuspending each pellet in 1 mL of lysis buffer (20 mM Tris-HCl pH 8, 150 mM NaCl, lx protease inhibitor cocktail, and benzonase) followed by sonication (Branson). 50 μL of magnetic cobalt based beads (Thermo, Dynabeads His-Tag Isolation and Pulldown) were added to each lysate and the samples incubated at RT for 10-20 min with gentle agitation. The samples were placed in a magnetic stand separator (Thermo) for 2 min. Proteins that remained associated with the magnetic particles were retained on the tube-wall facing the magnet while unbound and non-specifically bound proteins were removed via three washes with wash buffer (lysis buffer lacking protease inhibitor and benzonase). The washed magnetic beads were resuspended in 100 μL of wash buffer. 30 μL aliquots were taken as specified (input, first wash, cobalt beads). HALO-TMR ligand (5 μM) was added to each aliquot and the samples incubated for 10-20 min at RT, protected from light. 10 μL of 4× Laemmli buffer was added to each sample followed by incubation in a PCR machine at 70° C. for 15 min, after which the samples were separated by SDS-PAGE and imaged using an ImageQuant LAS 4000 imager under the SYBR-Green setting. Samples were diluted prior to loading onto a gel, as follows: Input, 1:5; Wash 1:2; Beads 1:4.
[0112] EMSA. 5′ biotinylated forward primers and unmodified reverse primers (see Table 3) were used to make probes. EMSAs were performed as described (Cho et al., 2006) using the LightShift Chemiluminescent EMSA Kit (Thermo) with the indicated quantities of proteins and probes noted in the figures/legends.
[0113] Confocal Microscopy. Overnight cultures, started from single colonies of E. coli (T7Express) carrying HALO and/or SNAP fusions (see Table 2) were back-diluted 1:1000, and grown at 37° C. to OD.sub.600˜0.2. Either MMC, aTc, or ethanol in water was added. The so-treated samples were returned to shaking at 37° C. for an additional 60 min prior to live-cell staining and imaging. Live-cell staining was performed using a protocol adapted from (Ke et al., 2016). Briefly, HALO-TMR was added to each sample at 10 μM. The samples were incubated in the dark for 15-20 min at 37° C. The cells were pelleted at 13,000 g×1 min, washed twice with M9 medium, and resuspended in 50-150 μL of fresh M9 medium. 5-10 μL of each sample was spotted onto a glass coverslip and overlaid with a small amount of M9-agar. The samples were imaged on a Leica SP8 Confocal microscope. HALO-TMR was excited with 561 nm light and detected within a range of 579-622 nm. For SNAP-Qtip co-localization experiments, the SNAP-specific dye JF.sub.503 (Grimm et al., 2017) was added at 10 μM at the same time as the HALO-TMR reagent was added. SNAP was visualized by excitation at 504 nm and detection within 516-540 nm. All images were acquired under the same conditions (laser power and gain) in LASX (Leica Microsystems). Images were imported into Fiji for processing, which consisted solely of adjusting brightness and contrast (min-max).
[0114] A second aspect of the disclosed invention is drawn to a method for selectively lysing a bacterium. The method includes providing a disclosed engineered recombinant phage, contacting a target bacterium with the phage, and allowing the phage to lyse the bacterium.
[0115] To make a controllable kill switch on the phage, the arabinose-inducible VqmA.sub.Phage module can be introduced onto the phage genome along with an antibiotic resistance marker to select for acquisition of the module. Since the phage harbors the genes encoding the machinery for stable inheritance, there is no need to continue selection for the inducible module beyond initial selection for the recombinant phage. Referring to
[0116] Despite the ability to be maintained and to lyse non-natural hosts such as E. coli, the VP882 phage, and recombinants, appear only capable of infecting vibrios. This feature allows one to build and employ a non-pathogenic organism (e.g., E. coli) as a production and delivery vehicle to initiate a phage infection that selectively targets vibrios. Upon encountering DPO, the disclosed phage-mediated kill switch should kill the bacterial delivery vehicle, as well as any other bacteria (i.e., vibrios) to which the phage had been transferred prior to exposure to DPO. In considering the broad-generalized DPO-based killer), one can conceive of environmental and remediation contexts in which this engineered phage could be a useful, most notably, when it is essential to eliminate the host strain that is used to deliver the phage to the treatment site and/or when multiple species are simultaneously targeted. As an example, maritime applications aimed at limiting the transfer of pathogenic vibrios in ballast water to foreign harbors could potentially employ such a phage. Indeed, the onset of cholera epidemics and V. parahaemolyticus outbreaks have coincided with the detection of those organisms in ballast water, and thus it would be useful to eliminate both of them. Hypothetically, in this use, ballast water could be treated with a Δtdh E. coli pseudolysogen as a delivery vector. Because this host makes no DPO, it would maintain the pseudolysogen. E. coli naturally conjugates with vibrios, which could be the mechanism used to transfer the phage to the prey. Treatment of the ballast water with a vqmA.sub.Phage inducer (arabinose in our setup) will make the prophage become DPO sensitive. DPO is made by V. cholerae and V. parahaemolyticus, triggering the kill switch both in the delivery host and in the pathogen. Infective phage particles, produced by the lysed vibrios, could go on to infect other vibrios in the ballast water, propagating the infection of the target species. Obviously, design features would need to be established to ensure high level mating efficiency between delivery vehicle and prey. Likewise, safety features would need to be built into the phage to track the extent of killing, absence of phage particles, elimination of the host, etc.
[0117] A third aspect of the disclosed invention is a prophylactic treatment method for a high-risk individual. The method includes introducing the disclosed engineered recombinant phages, which are delivered by commensal bacteria to the high-risk individual prior to coming in contact with a pathogenic bacterium. The engineered recombinant phage includes a first DNA construct configured to drive a phage lytic program for the pathogenic bacterium, and where at least one regulator of a phage lytic gene is subject to a promoter that is activated by the pathogenic bacterium. In some embodiments, the promoter is induced by an external trigger or activated by a cue that is specifically produced by the pathogenic bacterium.
[0118] A fourth aspect of the disclosed invention is a method for manufacturing an engineered recombinant phage. The method involves providing a first gene adapted to drive a phage lytic program, and providing a first promoter, then integrating the first gene under the first promoter on a plasmid such that the phage is capable of responding to a host-produced quorum-sensing autoinducer. Embodiments of the method may include removing a natural lytic regulatory component of the phage, modifying the phage such that it does not respond to any of its native biological inputs, or a combination of the two.
[0119] In some embodiments, the first gene and/or the first promoter comprises either synthetic DNA or transgenic DNA.
[0120] In some embodiments, the integration of the first gene under the first promoter is accomplished via methods known to those of skill in the art, such as (i) in-vitro or in-vivo transposon mutagenesis, (ii) homologous recombination promoted by natural competence mechanisms or a suicide vector, (iii) recombineering with the lambda red system, restriction enzyme-based cloning or isothermal assembly, or (iv) genome editing using transcription activator-like effector nucleases (TALENs), zinc-finger nucleases (ZFNs), or clustered regulatory interspaced short palindromic repeat (CRISPR-Cas) based procedures.
[0121] A fifth aspect of the disclosed invention is a biomarker, utilizing an engineered recombinant phage that includes a DNA construct with a reporter tag, such as a fluorescent or luminescent reporter tag (e.g., mCherry, GFP, PADRON-C, etc.), subject to a promoter, wherein the phage is capable of responding to a host-produced quorum-sensing autoinducer.
[0122] A sixth aspect of the disclosed invention involves a system for inactivating a protein of interest. The system includes two promoters: (i) a first promoter controlling expression of a qtip gene, and (ii) a second promoter, such as a natural promoter of the protein of interest, controlling expression of a gene that encodes a phage repressor protein fused to a protein of interest, configured such that the phage repressor protein is capable of being inactivated by qtip.
[0123] In some embodiments, the first promoter may be activated by a specific species of bacteria, light-activated via a photoresponsive transcription factor, or activated by the presence of a chemical species such as a small molecule, a metabolite, or an artificial inducer.
[0124] A seventh aspect of the disclosed invention is a method for controlling the activity of a protein of interest, that includes providing a system as described above. Then, producing (i) a fusion protein containing the phage repressor protein fused to a protein of interest by expressing the gene that encodes the phage repressor protein fused to a protein of interest, and (ii) a Qtip protein by inducing expression of the qtip gene at a point in time after the fusion protein is produced. The Qtip protein is then allowed to inactivate the phage repressor protein.