PROTEIN TRANSDUCTION DOMAIN, FUSION COMPOUND CONTAINING THE SAME, AND PHARMACEUTICAL COMPOSITION CONTAINING THE FUSION COMPOUND

Abstract

A protein transduction domain and a fusion compound, which are more efficient, are proposed. As a result of selecting and testing a number of candidate peptides, the present inventors found that a GK1 peptide comprising 18 amino acids and a modified sequence obtained by replacing, adding, or deleting some sequences are bonded to high-molecular-weight materials such as proteins based on the basic sequence of the peptide, thus enabling the high-molecular-weight materials to smoothly penetrate into living bodies, for example, cells, tissues, or blood. A fusion compound, oligonucleotide, or vector using the same may be applied as a pharmaceutical composition for preventing or treating diseases.

Claims

1. A protein transduction domain which is any one selected from (A) to (C) below, comprising 18 to 29 amino acids, and is chemically bonded to a cargo molecule to thus transport the cargo molecule into mammalian cell or tissue: TABLE-US-00004 (A) R.sub.1R.sub.2R.sub.3DLAEGLAELADTR.sub.4R.sub.5R.sub.6, (R.sub.1 is A or R, R.sub.2 is A or R, R.sub.3 is N or R, R.sub.4 is V or R, R.sub.5 is G or R, and R.sub.6 is V or R), (B) R.sub.7AANDLAEGLAELADTVGV or AANDLAEGLAELADTVGVR.sub.7, (R.sub.7 is R, RR, or RRR), (C) R.sub.8AANDLAEGLAELADTVGV or AANDLAEGLAELADTVGVR.sub.8, (R.sub.8 is RKKRRQRRR, KETWWET, or EWSQPKKKRKV).

2. The protein transduction domain of claim 1, wherein the protein transduction domain is any one selected from SEQ ID NO: 1 to SEQ ID NO: 23.

3. The protein transduction domain of claim 1, wherein the cargo molecule is selected from among proteins, peptides, amino acids, nucleic acids, carbohydrates, lipids, and a mixture of one or more thereof.

4. The protein transduction domain of claim 1, wherein bonding between the cargo molecules and the protein transduction domain is covalent bonding or non-covalent bonding.

5. A fusion compound penetrating into mammalian cell or tissue, comprising: a protein transduction domain which is any one selected from (A) to (C) below, comprising 18 to 29 amino acids, and is chemically bonded to cargo molecule for preventing or treating diseases to thus transport the cargo molecule into mammalian cell or tissue: TABLE-US-00005 (A) R.sub.1R.sub.2R.sub.3DLAEGLAELADTR.sub.4R.sub.5R.sub.6, (R.sub.1 is A or R, R.sub.2 is A or R, R.sub.3 is N or R, R.sub.4 is V or R, R.sub.5 is G or R, and R.sub.6 is V or R), (B) R.sub.7AANDLAEGLAELADTVGV or AANDLAEGLAELADTVGVR.sub.7, (R.sub.7 is R, RR, or RRR), (C) R.sub.8AANDLAEGLAELADTVGV or AANDLAEGLAELADTVGVR.sub.8, (R.sub.8 is RKKRRQRRR, KETWWET, or EWSQPKKKRKV).

6. The fusion compound of claim 5, wherein the protein transduction domain is any one selected from SEQ ID NO: 1 to SEQ ID NO: 23.

7. The fusion compound of claim 5, wherein the cargo molecule is selected from among proteins, peptides, amino acids, nucleic acids, carbohydrates, lipids, and a mixture of one or more thereof.

8. A method for treating disease in a subject, said method consisting of administering to said subject a therapeutically effective amount of the fusion compound penetrating into mammalian cell or tissue of claim 5.

9. A cosmetic composition comprising: the fusion compound penetrating into mammalian cell or tissue of claim 5.

10. A recombinant polynucleotide encoding a fusion compound penetrating into mammalian cell or tissue, in which an oligonucleotide sequence encoding the protein transduction domain of claim 1 is chemically bonded to a cDNA sequence encoding cargo molecule for preventing or treating diseases so that the protein transduction domain is chemically bonded to the cargo molecule for preventing or treating diseases.

11. The recombinant polynucleotide of claim 10, wherein the oligonucleotide sequence encoding the protein transduction domain is any one selected from SEQ ID NO: 24 to SEQ ID NO: 46.

12. A pharmaceutical composition for preventing or treating diseases, comprising: the recombinant polynucleotide encoding a fusion compound of claim 10 penetrating into mammalian cell or tissue.

13. A fusion compound expression vector comprising: the recombinant polynucleotide encoding a fusion compound of claim 10 penetrating into mammalian cell or tissue.

14. A pharmaceutical composition for preventing or treating diseases, comprising: the fusion compound expression vector of claim 13.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0050] The above and other aspects, features and advantages of the present disclosure will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which:

[0051] FIGS. 1A and 1B show the construction of a GK1 expression vector on a pET-15b vector. A synthetic GK1 oligomer was cloned at the NdeI site, and human PGAM1 (phosphoglycerate mutase 1) cDNA or human BLVRA (biliverdin reductase A) cDNA was cloned at the XhoI and BamHI sites of pET-15b.

[0052] FIG. 2 shows results of western blotting analysis. A of FIG. 2 shows the result of western blotting analysis of the level of cell-transduced proteins after cells are treated with a Pep-1-PGAM1 fusion protein, a GK1-PGAM1 fusion protein, or a Tat-PGAM1 fusion protein for 1 hour. B of FIG. 2 shows the results of western blotting of cells treated with a GK1-PGAM1 fusion protein or a GK1-BLVRA fusion protein.

[0053] FIG. 3A shows the intracellular locations and levels of a cell-transduced control PGAM1 protein, a Pep-1-PGAM1 fusion protein, a GK1-PGAM1 fusion protein, and a Tat-PGAM1 fusion protein, which are photographed using a confocal fluorescence microscope, and FIG. 3B shows the intracellular locations and levels of a cell-transduced control PGAM1 protein, a GK1-PGAM1 fusion protein, a control BLVRA protein, and a GK1-BLVRA fusion protein, which are photographed using a confocal fluorescence microscope.

[0054] FIG. 4 is a graph showing the protective effect of each protein against oxidative stress. Cells were pre-treated with each of a control PGAM1 protein, a GK1-PGAM1 fusion protein, a control BLVRA protein, and a GK1-BLVRA fusion protein at a concentration of 5 μM for 1 hour, and were then treated with 100 μM H.sub.2O.sub.2 for 1 hour. Then, cell viability was evaluated using an MTT analysis method.

[0055] FIG. 5A and FIG. 5B show the intracellular location and level of a cell-transduced PGAM1 fusion protein, which are photographed using a confocal fluorescence microscope. The median number of the fusion protein is the name of the protein transduction domain shown in Table 1.

[0056] FIG. 6 shows the results obtained by testing the protective effect of cell-transduced PGAM1 fusion proteins against oxidative stress. Cells were treated with GK1-PGAM1 fusion proteins and a control PGAM1 protein at a concentration of 5 μM for 1 hour, and were then treated with 100 μM H.sub.2O.sub.2 for 1 hour. Then, cell viability was evaluated using an MTT analysis method. The median number of the fusion protein is the number of the protein transduction domain shown in Table 1.

DESCRIPTION OF EMBODIMENTS

[0057] Hereinafter, the configuration of the present disclosure will be described in more detail with reference to specific Examples. However, it is apparent to those of ordinary skill in the art that the scope of the present disclosure is not limited only to the description of the Examples.

[0058] The numerous protein transduction domains may be divided into three categories. The first is an amphiphilic peptide, and examples thereof may include a Pep-1 peptide. The Pep-1 peptide consists of 21 amino acids (KETWWETWWTEWSQPKKKRKV) and has three domains, namely a hydrophobic domain, a spacer, and a hydrophilic domain. The second is a cationic peptide, and examples thereof may include a HIV-Tat peptide (Hereinafter, “Tat” or “Tat peptide”), oligolysine, oligoarginine, and oligo (lysine+arginine). The sequence of the cell-transducing Tat peptide includes RKKRRQRRR, and the peptide has been used in the study of various proteins for treatment. The third is a hydrophobic peptide.

[0059] A bonding between a protein transduction domain and a biological cargo molecule (for example, nucleic acids, proteins, peptides, small molecules, cytotoxic drugs etc.) may be accomplished using various methods such as ionic bond and electrostatic bond, in addition to covalent bond.

[0060] The protein transduction domain has advantages of exhibiting lower toxicity and less frequent immunorejection than other delivery substances such as liposomes or polymers. However, few protein transduction domains are used in clinical practice.

[0061] <Method>

[0062] 1. Cell Culture

[0063] NSC34 cell line, which is a mouse-motoneuron-like hybrid cell line, was distributed from College of Natural Sciences of Hallym University. The cell culture solution was prepared by adding 10% fetal bovine serum (FBS) and an antibiotic solution (100 units/ml penicillin, 100 μg/ml streptomycin) to a DMEM medium. The NSC34 cell line was cultured using the above cell culture solution at 37° C. and 95% humidity under the condition in which 5% CO.sub.2 was maintained. When the cell reaches 70 to 80% confluent, treatment with trypsin-EDTA was performed to accomplish subculture.

[0064] 2. Construction of Recombinant GK1

[0065] Annealing was performed at 37° C. for 2 hours using the following oligonucleotides.

TABLE-US-00001 Sense oligonucleotide (SEQ ID NO: 47): tatggctgcgaatgatcttgcggaaggtctggcggaactcgcggatacgg taggcgtaca, Anti-sense oligonucleotide (SEQ ID NO: 48): tatgtacgcctaccgtatccgcgagttccgccagaccttccgcaagatca ttcgcagcca.

[0066] Thereafter, the NdeI site of a pET-15b vector was cut, and the GK1-coding oligonucleotide pairs prepared in the above were connected. Transformation of the Escherichia coli strain Top 10 with the recombinant GK1 was performed. The DNA separated from the transformed cell was amplified through PCR using the following primers.

[0067] Forward primer: T7, reverse primer: T7 terminator.

[0068] The BamHI and XhoI sites of the GK1 vector were cut to connect PGAM1 (phosphoglycerate mutase 1), BLVRA (biliverdin reductase A) or CNRIP1 (Cannabinoid Receptor Interacting Protein 1) gene.

[0069] 3. Expression and Purification of Recombinant GK1

[0070] Transformation of Escherichia coli strain BL21 with the recombinant GK1 plasmid was performed. After the transformed cell was cultured in 100 ml LB medium containing 100 μg/ml ampicillin at 37° C. and 180 rpm for 6 hours, 0.5 mM IPTG (isopropyl-β-D-thiogalactoside) was added thereto, and then culture was performed at 37° C. and 120 rpm for 16 hours. The recovered cells were subjected to ultrasonic treatment and centrifuged to isolate only a supernatant, followed by purification using an Ni.sup.2+-nitrilotriacetic acid Sepharose affinity chromatography column. A protein concentration was normalized with bovine serum albumin (BSA) and quantified using a protein quantitative assay kit.

[0071] 4. Transduction of GK1 Fusion Protein into NSC34 Cells

[0072] The NSC34 cell was dispensed on a 60 mm plate and cultured under conditions of 37° C., 95% humidity, and 5% CO.sub.2. In order to examine the cell penetration capability of GK1, Pep-1-PGAM1 fusion protein, Tat-PGAM1 fusion protein, and GK1-PGAM1 fusion protein at the same concentration (5 μM) were used in treatment for 20 minutes, respectively. Further, in order to confirm that the cell penetration capability of the protein transduction domain GK1 is shown in arbitrary protein, another protein at the same concentration, namely, a GK1-BLVRA fusion protein, was used in treatment for 20 minutes. The cultured cells were rinsed with PBS (phosphate-buffered saline). In order to extract proteins, a RIPA lysis buffer was added thereto and centrifuged (4° C., 12,000 rpm, and 10 min), thereby performing protein quantification with respect to the supernatant.

[0073] In order to compare the cell transduction efficiency, a Pep-1-PGAM1 fusion protein and a Tat-PGAM1 fusion protein that are fusion proteins using Pep-1 peptide and Tat peptide, were prepared according to a method similar to the method described above (Kim W. et al., Neurochemistry International, 10 Dec. 2019, 133:104631). Thereafter, the Pep-1-PGAM1 fusion protein and the Tat-PGAM1 fusion protein were transduced into NSC34 cell according to the method as described above.

[0074] 5. Western Blotting Analysis

[0075] 50 μg of the fusion protein or the control protein was mixed with a 5× sample buffer and then boiled for 2 minutes to prepare a protein sample, followed by separation according to molecular weight using 15% mini gel SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis). After the electrophoresis was finished, the resultant was transferred to a nitrocellulose membrane, and blocking of the membrane was carried out using TBS-T (pH 7.5, 25 mM Tris-Cl, 150 mM NaCl, and 0.1% Tween 20) containing 5% skim milk at room temperature for 1 hour. In order to measure the expression of the protein, a primary antibody (anti-histidine probe) was diluted in the TBS-T at a ratio of 1:1,000, reacted at room temperature for 1 hour, and then washed with the TBS-T. A HRP (horseradish peroxidase)-conjugated-anti-rabbit IgG as a secondary antibody was diluted in TBS-T at a ratio of 1:10,000 to be reacted at room temperature for 1 hour. After washing with the TBS-T, the expression level of each protein was confirmed using a detection reagent.

[0076] 6. Fluorescence Microscope Analysis

[0077] Each glass cover slip was placed on a 24-well plate, and cells were dispensed thereon and cultured for 24 hours. After 5 μM of the Pep-1-PGAM1 fusion protein, Tat-PGAM1 fusion protein, GK1-PGAM1 fusion protein, or GK1-BLVRA fusion protein was transduced into an NSC34 cell for 2 hours, the culture medium was removed, and rinsing was repeated with PBS three times. After 4% para-formaldehyde was added to each well and the cells were fixed for 5 minutes, PBS was added thereto, and washing was repeated three times for a short time. After blocking and penetration in PBS (PBS-BT) containing 3% BSA and 0.1% Triton X-100 at room temperature for 40 minutes, washing with PBS-BT was repeated three times. A His-probe primary antibody was diluted at a ratio of 1:2,000 and cultured at room temperature for 1 hour. A secondary antibody (Alexa Fluor 488) was diluted to a ratio of 1:10,000, reacted for 1 hour in dark, and washed with the PBS-BT three times for 5 minutes. The glass cover slip was separated from the well to remove moisture from the edge thereof, and was lifted. A fluorescence microscope was used for observation, and fluorescence emission was confirmed using an image analyzer.

[0078] <Result>

[0079] Result 1: Schematic Diagram and Purification of GK1 Fusion Protein

[0080] In order to express the protein transduction domain, cloning of a GK1 oligonucleotide (gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta; SEQ ID NO: 24) was performed at an NdeI site of a pET-15b plasmid. In order to confirm the cell penetration efficiency of the protein transduction domain GK1, cloning of PGAM1 (phosphoglycerate mutase 1) cDNA or BLVRA (biliverdin Reductase A) cDNA was performed at XhoI and BamHI sites of the pET-15b plasmid containing GK1 oligonucleotide. In the case of a control vector, cloning of the PGAM1 protein or the BLVRA protein was performed at the pET-15b plasmid not containing the GK1 oligonucleotide. After expression of the fusion protein or the protein, purification was performed using an Ni.sup.2+-nitrilotriacetic acid Sepharose affinity chromatography column, and was confirmed using SDS-PAGE [FIGS. 1A and 1B].

[0081] Result 2: Transduction of GK1 Fusion Protein into Cell

[0082] In order to examine the cell transduction efficiency of GK1, the Pep-1-PGAM1 fusion protein, the GK1-PGAM1 fusion protein, or the Tat-PGAM1 fusion protein at the same concentration (5 μM) was used to treat an NSC34 cell for 1 hour. Then, the cell transduction level was analyzed by western blotting. The level of intracellular fusion protein was highest in the case of the GK1-PGAM1 fusion protein. In comparison with the GK1-PGAM1 fusion protein, the Tat-PGAM1 fusion protein showed a cell transduction level of about 89%, and the Pep-1-PGAM1 fusion protein showed a cell transduction level of about 50% [A of FIG. 2]. The control PGAM1 protein did not penetrate into the cells.

[0083] In order to prove that the cell-penetrating domain GK1 was fused with an arbitrary protein to penetrate the cell, the GK1-PGAM1 fusion protein and the GK1-BLVRA fusion protein, prepared by fusing the protein transducing domain GK1 with the two types of proteins PGAM1 and BLVRA respectively were used at the same concentration (5 μM) to treat the cell for 1 hour. Although there is a difference in cell transduction efficiency depending on the protein type, the two types of proteins smoothly penetrated into the NSC34 cells [B of FIG. 2].

[0084] In order to examine the location of the Pep-1-PGAM1 fusion protein, GK1-PGAM1 fusion protein, or Tat-PGAM1 fusion protein transduced into the cells, the cells into which each fusion protein penetrated were subjected to immunostaining using DAPI and Alexa Fluor 488-conjugated secondary antibodies. A control PGAM1 protein was not observed in the NSC34 cell. Unlike this, the Pep-1-PGAM1 fusion protein, the GK1-PGAM1 fusion protein, and the Tat-PGAM1 fusion protein were detected mainly in the cytoplasm using a fluorescence microscope, and were also detected in the nucleus [FIG. 3A]. Further, in the case of the GK1-PGAM1 fusion protein, a fluorescence signal having a higher intensity was observed compared to the Pep-1-PGAM1 fusion protein and the Tat-PGAM1 fusion protein. This implies that the cell transduction efficiency of the GK1-PGAM1 fusion protein is the highest.

[0085] Further, the intracellular location of the GK1 fused with an arbitrary protein to penetrate into a cell was examined using the above-described method. The GK1-PGAM1 fusion protein and the GK1-BLVRA fusion protein were detected mainly in the cytoplasm, and were also detected in the nucleus [FIGS. 3A and 3B].

[0086] Result 3: Effect of GK1 Fusion Protein Against Oxidative Stress

[0087] It was examined whether the GK1 fusion protein transducing into cells had a protective effect against oxidative stress. Treatment was performed with a GK1-PGAM1 fusion protein, a GK1-CNRIP1 fusion protein, a control PGAM1 protein, and a control CNRIP1 protein at a constant concentration (5 μM) for 1 hour, followed by treatment with 100 μM H.sub.2O.sub.2 for 1 hour. Thereafter, cell viability was evaluated using an MTT analysis method [FIGS. 5A and 5B]. The viability of the cell treated with H.sub.2O.sub.2 was reduced by about 57% compared to the control cell. The viability of the cell pre-treated with GK1-PGAM1 fusion protein or GK1-BLVRA fusion protein was increased by about 83%. In comparison, the control PGAM1 protein and the control CNRIP1 protein had no protective effect against cell death caused by H.sub.2O.sub.2.

[0088] Result 4: Transduction of Fusion Protein Using the GK1 Protein Transduction Domain into Cells and Effect Thereof Against Oxidative Stress

[0089] A GK1 peptide sequence (AANDLAEGLAELADTVGV; SEQ ID NO: 1) or a GK1 derivative peptide in which one or more peptides are substituted into or added to a part of the sequence, sequences in which partial consecutive sequence of the GK1 peptide and sequence of Tat peptide or partial consecutive sequence thereof are bonded, and sequences in which partial consecutive sequence of the GK1 peptide and native or partial consecutive sequence of the Tat peptide, and native or partial consecutive sequence of the Pep-1 peptide are bonded are shown in Table 1. It should be noted that the sequences listed in Table 1 are just some examples of the protein transduction domain claimed in the present disclosure, and the protein transduction domain of the present disclosure is not limited to the sequences listed in Table 1.

[0090] In order to confirm the intracellular locations of the cell-transduced fusion protein in which a GK1 derivative peptide fused with the PGAM1 protein, immunostaining was performed in the same manner as described above. The GK1 derivative peptides were also detected in the cytoplasm and nucleus. Among them, eight peptides having favorable cell transduction efficiency were selected, and are shown in FIGS. 5A and 5B.

[0091] In order to examine the cell protection effect of the fusion protein fused with the GK1 derivative peptide against oxidative stress, MTT analysis was performed in the same manner as described above. The cell viability, which had been reduced to 57% due to H.sub.2O.sub.2, was increased to the minimum value of 56% to the maximum value of 83% when pre-treatment was performed with the fusion protein in which the GK1 candidate protein was fused with the PGAM1 protein [FIG. 6]. In the case of the GK1-PGAM1 fusion protein, the cell viability was increased by 80%.

[0092] Table 1 below shows twenty-three specific examples of amino acid sequences of the protein transduction domain of the present disclosure. Further, Table 2 below shows nucleotide sequences encoding the twenty-three specific examples of the protein transduction domain of the present disclosure.

TABLE-US-00002 TABLE 1 Seq. Name No. Peptide sequence GK1 1 AANDLAEGLAELADTVGV GK1-1 2 RANDLAEGLAELADTVGV GK1-2 3 RRNDLAEGLAELADTVGV GK1-3 4 RRRDLAEGLAELADTVGV GK1-4 5 AANDLAEGLAELADTVGR GK1-5 6 AANDLAEGLAELADTVRR GK1-6 7 AANDLAEGLAELADTRRR GK1-7 8 ARNDLAEGLAELADTVGV GK1-8 9 AARDLAEGLAELADTVGV GK1-9 10 AANDLAEGLAELADTVRV GK1-10 11 AANDLAEGLAELADTRGV GK1-11 12 RAANDLAEGLAELADTVGV GK1-12 13 RRAANDLAEGLAELADTVGV GK1-13 14 RRRAANDLAEGLAELADTVGV GK1-14 15 AANDLAEGLAELADTVGVR GK1-15 16 AANDLAEGLAELADTVGVRR GK1-16 17 AANDLAEGLAELADTVGVRRR GK1-17 18 RKKRRQRRRAANDLAEGLAELADTVGV GK1-18 19 AANDLAEGLAELADTVGVRKKRRQRRR GK1-19 20 KETWWETAANDLAEGLAELADTVGV GK1-20 21 EWSQPKKKRKVAANDLAEGLAELADTVGV GK1-21 22 AANDLAEGLAELADTVGVKETWWET GK1-22 23 AANDLAEGLAELADTVGVEWSQPKKKRKV

TABLE-US-00003 TABLE 2 Seq. Name No. Nucleotide sequence GK1 24 gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta GK1-1 25 cgc gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta GK1-2 26 cgc cgt aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta GK1-3 27 cgc cgt cgc gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta GK1-4 28 gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc cgc GK1-5 29 gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta cgc cgc GK1-6 30 gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg cgt cgc cgc GK1-7 31 gct cgc aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta GK1-8 32 gct gcg cgc gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta GK1-9 33 gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta cgc gta GK1-10 34 gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg cgc ggc gta GK1-11 35 cgc gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta GK1-12 36 cgc cgt gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta GK1-13 37 cgc cgt cgc gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta GK1-14 38 gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta cgc GK1-15 39 gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta cgc cgt GK1-16 40 gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta cgc cgt cgc GK1-17 41 agg aag aag agg aga cag cga cga aga gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta GK1-18 42 gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta agg aag aag agg aga cag cga cga aga GK1-19 43 aaa gaa acc tgg tgg gaa acc gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta GK1-20 44 gaa tgg tct cag ccg aaa aaa aaa cgt aaa gtg gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta GK1-21 45 gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta aaa gaa acc tgg tgg gaa acc GK1-22 46 gct gcg aat gat ctt gcg gaa ggt ctg gcg gaa ctc gcg gat acg gta ggc gta gaa tgg tct cag ccg aaa aaa aaa cgt aaa gtg

[0093] Although embodiments of the present disclosure have been disclosed for illustrative purposes, those skilled in the art will appreciate that various modifications, additions and substitutions are possible, without departing from the scope and spirit of the disclosure as disclosed in the accompanying claims.

[0094] It is revealed that the present disclosure was carried out with the support of the Ministry of Science, Technology and Communication of the Republic of Korea (NRF-2018M3A9C8023568) and the Ministry of Education of the Republic of Korea (2019R1A6A11036849).