SCREENING AGENTS CAPABLE OF INHIBITING PAIN AND/OR PRURITUS AND METHODS AND COMPOSITIONS FOR TREATING PAIN AND/OR PRURITUS USING SAID AGENTS
20210356455 · 2021-11-18
Assignee
Inventors
Cpc classification
G01N33/74
PHYSICS
A61K49/0008
HUMAN NECESSITIES
G01N2333/726
PHYSICS
International classification
Abstract
The present disclosure provides a newly conceived of platform for identifying novel pain and/or pruritus-inhibiting agents (e.g., small molecule compounds, peptides, antigen binding proteins (e.g., antibodies or antibody fragments) that are efficacious, safe, and non-addictive alternatives for pain and pruritus management in place of (or in some embodiments, in combination with) “first line” treatments, such as gabapentin, pregabalin, and opioids. The present disclosure also provides for a method of treating pain and/or a pruritus comprising administering a therapeutically effective amount of an agent that activates a G.sub.ai/o-coupled G-Protein Coupled Receptor (GPCR) that is selectively expressed in the nociceptor and/or pruriceptor neuron subtypes of the somatosensory neurons. The disclosure also provides a method of inhibiting a nociceptor and/or pruriceptor somatosensory neurons, comprising contacting the nociceptor and/or pruriceptor somatosensory neuron with an agonist of a G-Protein Coupled Receptor (GPCR) expressed on the nociceptor and/or pruriceptor somatosensory neuron.
Claims
1. A method of screening to identify an agent that selectively inhibits primary nociceptors to attenuate pain perception, said method comprising contacting a G-Protein Coupled Receptor (GPCR) that is selectively expressed in said nociceptors relative to other subtypes of somatosensory neurons with a candidate agent and detecting whether said candidate agent activates the G-Protein Coupled Receptor.
2. The method of claim 1, wherein the G-Protein Coupled Receptor is highly expressed in said nociceptors but expressed at low levels in other subtypes of somatosensory neurons.
3. The method of claim 2, wherein the G-Protein Coupled Receptor is expressed at low levels in peripheral tissues and/or brain.
4. The method of claim 1, wherein the G-Protein Coupled Receptor is coupled to the G.sub.ai/o-signaling pathway.
5. The method of claim 1, wherein the G-Protein Coupled Receptor exhibits a conserved pattern of expression between rodent and human dorsal root ganglia (DRG).
6. The method of claim 1, wherein the G-Protein Coupled Receptor is selected from the group consisting of ADGRA1, ADGRD1, ADGRE5, ADGRF5, ADORA2A, ADORA2B, ADRA2A, ADRA2C, AGTR1A, AGTR1B, AGTRAP, AVPR1A, CALCRL, CELSR2, CESLR3, CHRM1, CRCP, CYSLTR2, DRD1, F2RL1, F2RL2, FZD3, FZD5, FZD8, GALR1, GHSR, GPR35, GPR149, GPR156, GPR173, GPR174, GPR19, GPR4, GRM5, GRM7, HCRTR1, HTR1B, HTR1F, HTR4, HTR5A, LPAR1, LPAR3, MRGPRA1, MRGPRA3, MRGPRA4, MRGPRB4, MRGPRB5, MRGRPD, MRGPRE, MRGPRX1, NPY1R, NYP2R, OGFR, OLFR139, OPN3, OPRK1, OPRM1, OXTR, PROKR2, PTAFR, PTGDR, PTGER1, PTGER2, PTGER3, PTGFR, PTGIR, RAMP3, RHO, S1PR1, S1PR2, S1PR3, SSTR2, VMN1R85, and VMN1R89.
7. The method of claim 1, wherein the G-Protein Coupled Receptor is ADRA2C.
8. The method of claim 1, wherein the G-Protein Coupled Receptor is GPR35.
9. The method of claim 1, wherein the G-Protein Coupled Receptor is GPR149.
10. The method of claim 1, wherein the G-Protein Coupled Receptor is HTR1B.
11. The method of claim 1, wherein the G-Protein Coupled Receptor is PTGFR.
12. The method of claim 1, wherein the candidate agent is a small molecule compound, peptide, antigen binding protein, or nucleic acid molecule.
13. The method of claim 1, wherein the method of screening comprises an in vitro based assay.
14. The method of claim 13, wherein the in vitro based assay comprises contacting the candidate agent with a cell line expressing said G-Protein Coupled Receptor and detecting activation of the G-Protein Coupled Receptor.
15. The method of claim 1, wherein the method of screening comprises an in vivo based assay.
16. The method of claim 1, further comprising confirming the selectivity of the candidate agent by detecting no or minimal activation of one or more known control G-Protein Coupled Receptors by the candidate agent.
17. The method of claim 15, wherein the in vivo based assay comprises testing the efficacy of said candidate agent in attenuating pain perception in an animal model.
18. The method of claim 1, wherein the agent is a small molecule compound.
19. The method of claim 1, wherein the agent is a peptide.
20. The method of claim 1, wherein the agent is an antigen binding protein.
21. The method of claim 4, wherein the agent inhibits the G.sub.ai/o-signaling pathway.
22. A method of screening to identify an agent that selectively inhibits primary pruriceptors to attenuate itch perception, said method comprising contacting a G-Protein Coupled Receptor that is selectively expressed in said pruriceptors relative to other subtypes of somatosensory neurons with a candidate agent and detecting whether said candidate agent activates the G-Protein Coupled Receptor.
23. The method of claim 22, wherein the G-Protein Coupled Receptor is highly expressed in said pruriceptors but expressed at low levels in other subtypes of somatosensory neurons.
24. The method of claim 22, wherein the G-Protein Coupled Receptor is expressed at low levels in peripheral tissues and/or brain.
25. The method of claim 22, wherein the G-Protein Coupled Receptor is coupled to the G.sub.ai/o-signaling pathway.
26. The method of claim 22, wherein the G-Protein Coupled Receptor exhibits a conserved pattern of expression between rodent and human dorsal root ganglia (DRG).
27. The method of claim 22, wherein the G-Protein Coupled Receptor is selected from the group consisting of ADGRA1, ADGRD1, ADGRE5, ADGRF5, ADORA2A, ADORA2B, ADRA2A, ADRA2C, AGTR1A, AGTR1B, AGTRAP, AVPR1A, CALCRL, CELSR2, CESLR3, CHRM1, CRCP, CYSLTR2, DRD1, F2RL1, F2RL2, FZD3, FZD5, FZD8, GALR1, GHSR, GPR35, GPR149, GPR156, GPR173, GPR174, GPR19, GPR4, GRM5, GRM7, HCRTR1, HTR1B, HTR1F, HTR4, HTR5A, LPAR1, LPAR3, MRGPRA1, MRGPRA3, MRGPRA4, MRGPRB4, MRGPRB5, MRGRPD, MRGPRE, MRGPRX1, NPY1R, NYP2R, OGFR, OLFR139, OPN3, OPRK1, OPRM1, OXTR, PROKR2, PTAFR, PTGDR, PTGER1, PTGER2, PTGER3, PTGFR, PTGIR, RAMP3, RHO, S1PR1, S1PR2, S1PR3, SSTR2, VMN1R85, and VMN1R89.
28. The method of claim 22, wherein the G-Protein Coupled Receptor is ADRA2C.
29. The method of claim 22, wherein the G-Protein Coupled Receptor is GPR35.
30. The method of claim 22, wherein the G-Protein Coupled Receptor is GPR149.
31. The method of claim 22, wherein the G-Protein Coupled Receptor is HTR1B.
32. The method of claim 22, wherein the G-Protein Coupled Receptor is PTGFR.
33. The method of claim 22, wherein the candidate agent is a small molecule compound.
34. The method of claim 22, wherein the method of screening comprises an in vitro based assay.
35. The method of claim 34, wherein the in vitro based assay comprises contacting the candidate agent with a cell line expressing said G-Protein Coupled Receptor and detecting activation of the G-Protein Coupled Receptor.
36. The method of claim 22, wherein the method of screening comprises an in vivo based assay.
37. The method of claim 22, further comprising confirming the selectivity of the candidate agent by detecting no or minimal activation of one or more known control G-Protein Coupled Receptors which are expressed in cells other than pruriceptors.
38. The method of claim 36, wherein the in vivo based assay comprises testing the efficacy of said candidate agent in attenuating itch perception in an animal model.
39. The method of claim 22, wherein the candidate agent is a small molecule compound.
40. The method of claim 22, wherein the method of screening comprises an in vitro based assay.
41. The method of claim 40, wherein the in vitro based assay comprises contacting the candidate agent with a cell line expressing said G-Protein Coupled Receptor and detecting activation of the G-Protein Coupled Receptor.
42. The method of claim 22, wherein the method of screening comprises an in vivo based assay.
43. The method of claim 22, further comprising confirming the selectivity of the candidate agent by detecting no or minimal activation of one or more known control G-Protein Coupled Receptors by the candidate agent.
44. The method of claim 42, wherein the in vivo based assay comprises testing the efficacy of said candidate agent in attenuating pain perception in an animal model.
45. The method of claim 22, wherein the agent is a nucleic acid molecule.
46. The method of claim 22, wherein the agent is a peptide.
47. The method of claim 22, wherein the agent is an antigen binding protein.
48. The method of claim 25, wherein the agent inhibits the G.sub.ai/o-signaling pathway.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0096] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
DEFINITIONS
[0130] Definitions of common terms in immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 19th Edition, published by Merck Sharp & Dohme Corp., 2011 (ISBN 978-0-911910-19-3); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), Taylor & Francis Limited, 2014 (ISBN 0815345305, 9780815345305); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, A D A M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of which are all incorporated by reference herein in their entireties.
[0131] The disclosure contemplates that agents for activating the G-Protein Coupled Receptors (GPCR) in nociceptor and/or pruriceptor neurons can include small molecule compounds, peptides, and polypeptides (e.g., antibodies or antibody fragments), and the like. In various embodiments, that GPCRs are coupled to the G.sub.ai/o-signaling pathway.
[0132] With regard to agents which are chemical compounds, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75.sup.th Ed., inside cover, and specific functional groups are generally defined as described therein. Additionally, general principles of organic chemistry, as well as specific functional moieties and reactivity, are described in Thomas Sorrell, Organic Chemistry, University Science Books, Sausalito, 1999; Michael B. Smith, March's Advanced Organic Chemistry, 7.sup.th Edition, John Wiley & Sons, Inc., New York, 2013; Richard C. Larock, Comprehensive Organic Transformations, John Wiley & Sons, Inc., New York, 2018; and Carruthers, Some Modern Methods of Organic Synthesis, 3.sup.rd Edition, Cambridge University Press, Cambridge, 1987.
[0133] Compounds contemplated herein can comprise one or more asymmetric centers, and thus can exist in various stereoisomeric forms, e.g., enantiomers and/or diastereomers. For example, the compounds contemplated herein can be in the form of an individual enantiomer, diastereomer or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer. Isomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high pressure liquid chromatography (HPLC) and the formation and crystallization of chiral salts; or preferred isomers can be prepared by asymmetric syntheses. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, E. L. Stereochemistry of Carbon Compounds (McGraw-Hill, N Y, 1962); and Wilen, S. H., Tables of Resolving Agents and Optical Resolutions p. 268 (E. L. Eliel, Ed., Univ. of Notre Dame Press, Notre Dame, I N 1972). The disclosure additionally contemplates compounds as individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers.
[0134] As used herein, a “subject” means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include, for example, chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include, for example, mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include, for example, cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. In some embodiments, the subject is a mammal, e.g., a primate, e.g., a human. The terms, “individual,” “patient” and “subject” are used interchangeably herein.
[0135] As used herein, the terms “treat,” “treatment,” “treating,” or “amelioration” refer to therapeutic treatments, e.g., the inhibition of pain perception and/or itch perception, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with a disease. The term “treating” includes reducing or alleviating pain and/or itching or the perception thereof. Treatment is generally “effective” if one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective” if the progression of a disease is reduced or halted. That is, “treatment” includes not just the improvement of symptoms or markers, but also a cessation of, or at least slowing of, progress or worsening of symptoms compared to what would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, remission (whether partial or total), and/or decreased mortality, whether detectable or undetectable. The term “treatment” of a disease also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).
[0136] As used herein, the term “small molecule” refers to a organic or inorganic molecule, either natural (i.e., found in nature) or non-natural (i.e., not found in nature), which can include, but is not limited to, a peptide, a peptidomimetic, an amino acid, an amino acid analog, a polynucleotide, a polynucleotide analog, an aptamer, a nucleotide, a nucleotide analog, an organic or inorganic compound (e.g., including heterorganic and organometallic compounds) having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds. Examples of “small molecules” that occur in nature include, but are not limited to, taxol, dynemicin, and rapamycin. In certain other preferred embodiments, natural-product-like small molecules are utilized.
[0137] As used herein, a “compound” refers to any chemical, test chemical, drug, new chemical entity (NCE), or other moiety. For example, a compound can be any foreign chemical not normally present in a subject such as mammals including humans. A compound can also be an endogenous chemical that is normally present and synthesized in biological systems, such as mammals including humans. For example, a compound, such as a test compound, such as a drug, can activate GPCRs (such as those identified in
[0138] The term “derivative” as used herein means any chemical, conservative substitution, or structural modification of an agent. The derivative can improve characteristics of the agent or small molecule such as pharmacodynamics, pharmacokinetics, absorption, distribution, delivery, targeting to a specific receptor, or efficacy. For example, for a small molecule, the derivative can consist essentially of at least one chemical modification to about ten modifications. The derivative can also be the corresponding salt of the agent. The derivative can be the pro-drug of a small molecule as contemplated herein.
[0139] An “agent” as used herein is a chemical molecule of synthetic or biological origin. In the context of the present invention, an agent is generally a molecule that can be used in a pharmaceutical composition. Agents may include small molecule compounds, peptides, polypeptides, and antigen binding proteins (including antibodies), and the like. Agents can be a candidate agent, the ability or capacity of which to activate a nociceptor and/or pruriceptor-specific GPCR would need to be assayed in accordance with the herein methods. The agents may be provided as plurality of candidate agents in the form of a library, e.g., a peptide or antibody library. For example, the herein disclosed method may be used to screen and identify a small molecule, peptide, or antibody agent which can activate GPCRs (such as those identified in
[0140] The phrase “pharmaceutically acceptable carrier” as used herein means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject agents from one organ, or portion of the body, to another organ, or portion of the body. The term “pharmaceutically acceptable carrier” excludes tissue culture media. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation, for example the carrier does not decrease the impact of the agent on the treatment. In other words, a carrier is pharmaceutically inert. The terms “physiologically tolerable carriers” and “biocompatible delivery vehicles” are used interchangeably. Non-limiting examples of pharmaceutical carriers include particle or polymer-based vehicles such as nanoparticles, microparticles, polymer microspheres, or polymer-drug conjugates.
[0141] The term “effective amount” is used interchangeably with the term “therapeutically effective amount” or “amount sufficient” and refers to the amount of at least one activator of a GPCR, or a pharmaceutical composition thereof, at dosages and for periods of time necessary to achieve the desired therapeutic result, for example, to “attenuate,” reduce or stop at least one symptom of pain and/or chronic itch. For example, an effective amount using the methods as disclosed herein would be considered as the amount sufficient to reduce one or more symptoms of pain and/or chronic itch by at least 10%, as compared to the level of pain and/or chronic itch in the absence of the compound or agent. In other embodiments, an effective amount using the methods as disclosed herein would be considered as the amount sufficient to reduce one or more symptoms of pain and/or chronic itch by at least 5%, or by at least 10%, or by at least 15%, or by at least 20%, or by at least 25%, or by at least 30%, or by at least 35%, or by at least 40%, or by at least 45%, or by at least 50%, or by at least 55%, or by at least 60%, or by at least 65%, or by at least 70%, or by at least 75%, or by at least 80%, or by at least 85%, or by at least 90%, or by at least 95%, or up to 100% as compared to the level of pain and/or chronic itch in the absence of the compound or agent. An effective amount as used herein would also include an amount sufficient to prevent or delay the development of such a symptom, alter the course of a symptom disease (for example but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of the disease in a subject suffering from pain and/or chronic itch. Accordingly, the term “effective amount” or “therapeutically effective amount” as used herein refers to the amount of therapeutic agent of a pharmaceutical composition to alleviate at least one symptom of a disease. Stated another way, “therapeutically effective amount” of an activator of a GPCR as disclosed herein is the amount of an agonist which exerts a beneficial effect on, for example, the symptoms of the disease. The dosage administered, as single or multiple doses, to an individual will vary depending upon a variety of factors, including pharmacokinetic properties of the inhibitor, the route of administration, conditions and characteristics (sex, age, body weight, health, size) of subjects, extent of symptoms, concurrent treatments, frequency of treatment and the effect desired. A therapeutically effective amount is also one in which any toxic or detrimental effects of the therapeutic agent are outweighed by the therapeutically beneficial effects. The effective amount in each individual case can be determined empirically by a skilled artisan according to established methods in the art and without undue experimentation. In general, the phrases “therapeutically-effective” and “effective for the treatment, prevention, or inhibition”, are intended to qualify agonist as disclosed herein which will achieve the goal of reduction in the severity of a pain and/or chronic itch or at one related symptom thereof. In certain embodiments, the term “effective amount” means a dosage sufficient to produce a desired result. The desired result can be subjective or objective changes in the biological activity of a GPCR, especially signal transduction. Effective amounts of the GPCR polypeptide or composition, which may also include a functional derivative thereof, are from about 0.01 micrograms to about 100 mg/kg body weight, and preferably from about 10 micrograms to about 50 mg/kg body weight, such 0.05, 0.07, 0.09, 0.1, 0.5, 0.7, 0.9, 1, 2, 5, 10, 20, 25, 30, 40, 45, or 50 mg/kg.
[0142] In jurisdictions that forbid the patenting of methods that are practiced on the human body, the meaning of “administering” of a composition to a human subject shall be restricted to prescribing a controlled substance that a human subject will self-administer by any technique (e.g., orally, inhalation, topical application, injection, insertion, etc.). The broadest reasonable interpretation that is consistent with laws or regulations defining patentable subject matter is intended. In jurisdictions that do not forbid the patenting of methods that are practiced on the human body, the “administering” of compositions includes both methods practiced on the human body and also the foregoing activities.
[0143] As used herein, the term “administer” refers to the placement of a composition into a subject by a method or route which results in at least partial localization of the composition at a desired site such that desired effect is produced. A compound or composition described herein can be administered by any appropriate route known in the art including, but not limited to, oral or parenteral routes, including intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, nasal, rectal, and topical (including buccal and sublingual) administration.
[0144] The phrases “parenteral administration” and “administered parenterally” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrasternal injection, infusion and other injection or infusion techniques, without limitation. Without limitations, oral administration can be in the form of solutions, suspensions, tablets, pills, capsules, sustained-release formulations, oral rinses, powders and the like.
[0145] As used herein, the term “modulates” refers to an effect including increasing or decreasing a given parameter as those terms are defined herein.
[0146] As used herein, the term “contacting” when used in reference to a cell or organ, encompasses both introducing or administering an agent (small molecule, peptide, or antibody anti-pain or anti-itch agent) to the cell, tissue, or organ in a manner that permits physical contact of the cell with the agent.
[0147] The term “statistically significant” or “significantly” refers to statistical significance and generally means a two-standard deviation (2SD) or greater difference.
[0148] As used herein the term “comprising” or “comprises” is used in reference to compositions, methods, and respective component(s) thereof, that are essential to the method or composition, yet open to the inclusion of unspecified elements, whether essential or not.
[0149] As used herein the term “consisting essentially of” refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.
[0150] As used herein, the term “G-protein” is any member of the superfamily of signal transducing guanine nucleotide binding proteins.
[0151] As used herein, the term “G-protein-coupled receptor” is any member of a superfamily of receptors that mediates signal transduction by coupling with a G protein. Examples of such receptors include, but are not limited to: CC chemokine receptor 5 (CCR5), CXC chemokine receptor (CXCR4) cholecystokinin type A receptor (CCKAR), adenosine receptors, somatostatin receptors, dopamine receptors, muscarinic cholinergic receptors, alpha-adrenergic receptors, beta-adrenergic receptors, opiate receptors, cannabinoid receptors, growth hormone releasing factor, glucagon, cAMP receptors, serotonin receptors (5-HT), histamine H2 receptors, thrombin receptors, kinin receptors, follicle stimulating hormone receptors, opsins and rhodopsins, odorant receptors, cytomegalovirus GPCRs, histamine H2 receptors, octopanmine receptors, N-formyl receptors, anaphylatoxin receptors, thromboxane receptors, IL-8 receptors, platelet activating factor receptors, endothelin receptors, bombesin gastrin releasing peptide receptor, neuromedin B preferring bombesin receptors, vasoactive intestinal peptide receptors, neurotensin receptors, bradykinin receptors, thyrotropin-releasing hormone receptors, substance P receptors, neuromedin K receptors, renal angiotensin II type I receptors, mas oncogene (angiotensin) receptors lutropin-choriogonadotropin receptors, thyrotropin receptors, follicle stimulating hormone receptors, cannabinoid receptors, glucocorticoid-induced receptors, endothelial cell GPCRs, testis GPCRs, and thoracic aorta GPCRs, and homologs thereof having a homology of at least 80% with at least one of transmembrane domains 1-7, as described herein. See, e.g., Probst et al, DNA and Cell Biology 11: 1-20 (1992), which is entirely incorporated herein by reference. The term further encompasses subtypes of the named receptors, and mutants and homologs thereof, along with the DNA sequences encoding the same. Other examples which are disclosed in
[0152] As used herein, GPCR “ligands” refers to biological molecules that bind GPCRs in vitro, in situ or in vivo, and may include small molecule compounds, peptides, and antibodies and the like (or other agents disclosed herein).
[0153] As used herein, “nociceptors” are specialized somatorsensory neurons located in the peripheral nervous system which are activated by potentially noxious stimuli, such as thermal, mechanical, or chemical stimuli, which are transmitted as a pain signal to the central nervous system. The process of sensing pain is called nociception. Nociceptive pain can be classified according to the tissue in which the nociceptor activation occurred: superficual somatic (e.g., skin), deep somatic (e.g., ligaments/tendons/bones/muscles) or visceral (internal organs).
[0154] As used herein, “pruriceptors” are specialized somatosensory neurons located in the peripheral nervous system which are activated to perceive itching sensations.
[0155] As used herein, reference to “pruritus” is defined as an unpleasant sensation of the skin that provokes the urge to scratch. It is a characteristic feature of many skin diseases and an unusual sign of some systemic diseases. Pruritus may be localized or generalized and can occur as an acute or chronic condition. Itching lasting more than 6 weeks is termed “chronic pruritus.” Itching can be intractable and incapacitating, as well as a diagnostic and therapeutic challenge.
[0156] As used herein, a dorsal root ganglia (or “DRG”) refers to the cluster (or ganglion) of neurons in a dorsal root of a spinal nerve which includes cell bodies of sensory neurons which relay sensory information (e.g., pain) from the periphery (e.g., the skin) to the spinal cord.
[0157] As used herein, the term “signals” refer to internal and external factors that control changes in cell structure and function. They are chemical or physical in nature.
[0158] As used herein, the term “signaling” in reference to a “signal transduction protein” refers to proteins that are activated or otherwise affected by ligand binding to a membrane receptor protein or some other stimulus.
[0159] All references cited herein, including journal articles or abstracts, published or corresponding U.S. or foreign patent applications, issued U.S. or foreign patents, or any other references, are entirely incorporated by reference herein, including all data, tables, figures, and text presented in the cited references. Additionally, the contents of the references cited within the references cited herein are also entirely incorporated by reference.
DETAILED DESCRIPTION
[0160] The somatosensory system is a part of the sensory nervous system. The somatosensory system is a complex system of sensory neurons (i.e., somatosensory neurons) and neural pathways that responds to changes at the surface or inside the body. The axons as afferent nerve fibers of sensory neurons connect with, or respond to, various receptor cells. These sensory receptor cells are activated by different stimuli such as heat and nociception, giving a functional name to the responding sensory neuron, such as a thermoreceptor which carries information about temperature changes. Other sensory neuron subtypes include mechanoreceptors, chemoreceptors, and nociceptors which send signals along a sensory nerve to the spinal cord where they may be processed by other sensory neurons and then relayed to the brain for further processing. Sensory receptors are found all over the body including, the skin, epithelial, tissues, muscles, bones and joints, internal organs, and the cardiovascular system.
[0161] The present disclosure is based, in part, on the inventors' discovery that certain G-protein coupled receptors (GPCRs), and in particular, those which are coupled to the G.sub.ai/o-signaling pathway, are restricted in expression to certain nociceptor and pruriceptor subtypes, but not proprioceptors, mechanoreceptors, or other sensory neurons subtypes that are not involved in conveying pain and/or itch sensations. In particular, the present inventors herein discovered and describe at least six transcriptionally distinct cellular subtypes of nociceptors and at least two transcriptionally distinct cellular subtypes of pruriceptors, and revealed a set of new therapeutic GPCR targets showing restricted expression in said nociceptor and/or pruriceptor subtypes which may be selectively activated to inhibit pain and/or itch processing pathways, without affecting other sensory pathways (e.g., sensing through proprioceptors or mechanoceptors).
[0162] The present inventors show in
[0163] The inventors describe in
[0164] The inventors further show in
[0165] Through their work, the inventors determined that an ideal GPCR to be used as a target for an agent (e.g., small molecule compound, peptide, or antigen binding protein) that is useful for treating pain and/or itch may have one or more of the following properties, and in some embodiments, all of the following properties: (1) the GPCR is highly expressed in nociceptors, pruriceptors, or combinations of both; (2) the GPCR is coupled to the G.sub.ai/o signaling pathway; (3) the GPCR exhibits a conserved pattern of expression between rodent and human DRGs; (4) the GPCR is expressed at low levels in other sensory neuron subtypes (e.g., mechanoreceptors, proprioceptors, or other peripheral sensory neurons that convey sensations such as temperature, pressure, and limb movement or position, excluding pain and/or itch sensations), as well as low levels of expression in the peripheral tissues and/or the brain; and (5) activation of the GPCR attenuates pain or itch perception, in particular, where the GPCR is coupled to the G.sub.ai/o signaling pathway.
[0166] Accordingly, the present disclosure provides a newly conceived of platform for identifying novel pain and/or pruritus-inhibiting agents (e.g., small molecule compounds, peptides, antigen binding proteins (e.g., antibodies or antibody fragments) that are efficacious, safe, and non-addictive alternatives for pain and pruritus management in place of (or in some embodiments, in combination with) “first line” treatments, such as gabapentin, pregabalin, and opioids. In another aspect, the present disclosure provides methods for treating pain and/or pruritus with pain and/or pruritus-inhibiting agents (e.g., small molecule compounds, peptides, antigen binding proteins (e.g., antibodies or antibody fragments) that are efficacious, safe, and non-addictive alternatives for pain and pruritus management in place of (or in some embodiments, in combination with) “first line” treatments, such as gabapentin, pregabalin, and opioids.
[0167] Thus, in various aspects, the present disclosure provides (1) a screening platform for identifying novel pain and/or pruritus-inhibiting agents (e.g., small molecule compounds, peptides, antigen binding proteins (e.g., antibodies or antibody fragments) that is based on the inventors' discovery that certain GPCRs are restricted in expression to one or more subsets of nociceptors and pruriceptors, but not proprioceptors or other sensory neurons subtypes not involved in pain and/or itch detection. In certain embodiments, that GPCRs are coupled to the G.sub.ai/o signaling pathway. The present disclosure further provides (2) identified pain and/or pruritus-inhibiting agents (e.g., small molecule compounds, peptides, antigen binding proteins (e.g., antibodies or antibody) which (i) activate certain GPCRs (e.g., those of
[0168] Accordingly, in various embodiments, the disclosure provides methods for screening for agents from a plurality of candidate agents (a library of small molecules, peptides, or antigen binding proteins (e.g., antibodies), wherein said agents are pain and/or pruritus-inhibiting agents (e.g., small molecule compounds, peptides, antigen binding proteins (e.g., antibodies or antibody fragments) that bind to and activate one or more GPCRs which are restricted in expression to one or more subsets of nociceptors and pruriceptors but which are not expressed in proprioceptors or other sensory neuron subtypes not involved in pain and/or itch detection. In certain embodiments, that GPCRs are coupled to the G.sub.ai/o signaling pathway. In various embodiments, the disclosure also provides methods of testing and confirming whether a given GPCR is coupled to the G.sub.ai/o signaling pathway.
[0169] In still other embodiments, the present disclosure provides libraries of candidate agents, e.g., small molecule libraries, peptide libraries, antibody libraries, etc. which may be screened using the methods disclosed herein to assay for binding to and activating one or more GPCRs (e.g., the GPCRs of
[0170] Libraries of candidate agents may be constructed using any methods known in the art, or obtained from any suitable source, so long as they are suitable for screening using the methods disclosed herein, e.g., Examples 1-3. For examples, combinatorial peptide or polypeptide libraries of GPCR polypeptide modulators are described in U.S. Pat. Nos. 10,745,456, 7,232,659, the contents of which are incorporated by reference. In addition, agents that bind and activate GPCRs are described U.S. Pat. No. 10,590,196 (Antibodies targeting G-protein coupled receptor and methods of use), U.S. Pat. No. 10,358,416 (Substituted pyrrolidines as G-protein coupled receptor 43 agonists), and U.S. Pat. No. 8,193,359 (G-protein coupled receptor agonists), each of which are incorporated herein by reference in their entireties. These agents and derivatives obtained thereof may be screened using the methods disclosed herein to identify agents which activate the nociceptor and/or pruriceptor-expressed GPCRs, e.g., those described in
[0171] In yet other embodiments, the present disclosure provides nucleic acid molecules encoding the nociceptor and/or pruriceptor-specific GPCRs (including those which are coupled to the G.sub.ai/o signaling pathway), and to cloning and/or expression vectors comprising said nucleic acid molecules encoding the nociceptor and/or pruriceptor-specific GPCRs. Further, the disclosure provides for cells comprising said cloning and/or expression vector comprising said nucleic acid molecules encoding the nociceptor and/or pruriceptor-specific GPCRs.
[0172] In various embodiments, the disclosure also provides for various reagents, biochemical assays, etc. capable of detecting when a particular candidate agent binds to and/or activates a nociceptor and/or pruriceptor-specific GPCR (e.g., one or more of those GPCRs of
[0173] In still further embodiments, the disclosure also provides for various reagents, biochemical assays, etc. capable of detecting when a particular candidate agent binds to and/or activates a nociceptor and/or pruriceptor-specific GPCR (e.g., one or more of those GPCRs of
[0174] In yet further embodiments, the disclosure also provides for various animal models capable of detecting when a particular candidate agent binds to and/or activates a nociceptor and/or pruriceptor-specific GPCR (e.g., one or more of those GPCRs of
[0175] In one aspect, provided herein is a method of treating pain and/or a pruritus comprising administering a therapeutically effective amount of an agent that activates a G.sub.ai/o-coupled G-Protein Coupled Receptor (GPCR) that is selectively expressed in the nociceptor and/or pruriceptor neuron subtypes of the somatosensory neurons.
[0176] In various embodiments, the disclose method results of the activation of the G.sub.ai/o-coupled G-Protein Coupled Receptor (GPCR). The activation of the G.sub.ai/o-coupled GPCR results in the blocking and/or reduction of pain and/or itch signaling by nociceptor and/or pruriceptor neurons which express the G.sub.ai/o-coupled GPCR.
[0177] In various embodiments, the blocking and/or reduction of pain and/or itch signaling by nociceptor and/or pruriceptor neurons which express the G.sub.ai/o-coupled GPCR is selective because the particular target G.sub.ai/o-coupled GPCR is not expressed or is expressed at low levels (or is not detectable) in other somatosensory neurons that are not nociceptors or pruriceptors.
[0178] In some embodiments, the agent binds and activates a G.sub.ai/o-coupled G-Protein Coupled Receptor (GPCR) that is selected from the group consisting of: ADGRA1, ADGRD1, ADGRE5, ADGRF5, ADORA2A, ADORA2B, ADRA2A, ADRA2C, AGTR1A, AGTR1B, AGTRAP, AVPR1A, CALCRL, CELSR2, CESLR3, CHRM1, CRCP, CYSLTR2, DRD1, F2RL1, F2RL2, FZD3, FZD5, FZD8, GALR1, GHSR, GPR35, GPR149, GPR156, GPR173, GPR174, GPR19, GPR4, GRM5, GRM7, HCRTR1, HTR1B, HTR1F, HTR4, HTR5A, LPAR1, LPAR3, MRGPRA1, MRGPRA3, MRGPRA4, MRGPRB4, MRGPRB5, MRGRPD, MRGPRE, MRGPRX1, NPY1R, NYP2R, OGFR, OLFR139, OPN3, OPRK1, OPRM1, OXTR, PROKR2, PTAFR, PTGDR, PTGER1, PTGER2, PTGER3, PTGFR, PTGIR, RAMP3, RHO, S1PR1, S1PR2, S1PR3, SSTR2, VMN1R85, and VMN1R89.
[0179] In various embodiments, that agent can be identified by performing a high throughput compound screen for molecules that activate the G.sub.ai/o-coupled G-Protein Coupled Receptor (GPCR).
[0180] In other embodiments, the agent can be a known ligand of a G.sub.ai/o-coupled G-Protein Coupled Receptor (GPCR).
[0181] In still other embodiments, the activation of the G.sub.ai/o-coupled G-Protein Coupled Receptor (GPCR) causes downstream activation of G-protein coupled inwardly rectifying potassium channels (GIRKs). And, the activation of the GIRKS can cause silencing of the neuronal activity of the nociceptor and/or pruriceptor neuron subtypes.
[0182] In another aspect, the disclosure provides a method of treating pain and/or a pruritus comprising administering a therapeutically effective amount of an agent that activates a G.sub.ai/o-coupled G-Protein Coupled Receptor (GPCR) that is selectively expressed in the nociceptor and/or pruriceptor neuron subtypes of the somatosensory neurons.
[0183] In various embodiments, the agent that activates a G.sub.ai/o-coupled G-Protein Coupled Receptor (GPCR) results in a reduction or blocking of the pain and/or itch signaling by the nociceptor and/or pruriceptor neuron.
[0184] In some embodiments, the G.sub.ai/o-coupled G-Protein Coupled Receptor (GPCR) is selectively expressed in the nociceptor and/or pruriceptor neuron subtypes of the somatosensory neurons because it is not expressed or expressed at low levels in other somatosensory neuron subtypes, peripheral tissues, and/or brain.
[0185] In some embodiments, the G.sub.ai/o-coupled G-Protein Coupled Receptor (GPCR) is selectively expressed in the nociceptor and/or pruriceptor neuron subtypes of the somatosensory neurons, but not detectable in other somatosensory neuron subtypes, peripheral tissues, and/or brain.
[0186] In other embodiments, the G.sub.ai/o-coupled G-Protein Coupled Receptor (GPCR) is selected from the group consisting of: ADGRA1, ADGRD1, ADGRE5, ADGRF5, ADORA2A, ADORA2B, ADRA2A, ADRA2C, AGTR1A, AGTR1B, AGTRAP, AVPR1A, CALCRL, CELSR2, CESLR3, CHRM1, CRCP, CYSLTR2, DRD1, F2RL1, F2RL2, FZD3, FZD5, FZD8, GALR1, GHSR, GPR35, GPR149, GPR156, GPR173, GPR174, GPR19, GPR4, GRM5, GRM7, HCRTR1, HTR1B, HTR1F, HTR4, HTR5A, LPAR1, LPAR3, MRGPRA1, MRGPRA3, MRGPRA4, MRGPRB4, MRGPRB5, MRGRPD, MRGPRE, MRGPRX1, NPY1R, NYP2R, OGFR, OLFR139, OPN3, OPRK1, OPRM1, OXTR, PROKR2, PTAFR, PTGDR, PTGER1, PTGER2, PTGER3, PTGFR, PTGIR, RAMP3, RHO, S1PR1, S1PR2, S1PR3, SSTR2, VMN1R85, and VMN1R89.
[0187] In certain embodiments, the activation of the G.sub.ai/o-coupled G-Protein Coupled Receptor (GPCR) causes silencing of neuronal activity of the nociceptor and/or pruriceptor neuron subtypes.
[0188] Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present disclosure to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference for the purposes or subject matter referenced herein.
EXAMPLES
Example 1: The Emergence of Transcriptional Identity in Somatosensory Neurons
Abstract
[0189] Over a dozen morphologically and physiologically distinct primary somatosensory neuron subtypes report salient features of internal and external environments.sup.1-4. How specialized gene expression programs emerge during development to endow somatosensory neuron subtypes with their unique properties is unclear. To assess the developmental progression of transcriptional maturation of each principal somatosensory neuron subtype, a transcriptomic atlas of cells traversing the primary somatosensory neuron lineage was generated. It was found that somatosensory neurogenesis gives rise to neurons in a transcriptionally unspecialized state, characterized by co-expression of transcription factors (TFs) that become restricted to select subtypes as development proceeds. Single cell transcriptomic analyses of sensory neurons from mutant mice lacking TFs suggest that these broad-to-restricted TFs coordinate subtype-specific gene expression programs in the subtypes where their expression is maintained. Additionally, a role was defined for neuronal targets for TF expression as disruption of the prototypic target-derived neurotrophic factor NGF leads to aberrant subtype-restricted patterns of TF expression. These findings support a model in which cues emanating from intermediate and final target fields promote neuronal diversification in part by transitioning cells from a transcriptionally unspecialized state to transcriptionally distinct subtypes through modulating selection of subtype-restricted TFs.
[0190] Decades of analyses have revealed more than a dozen functionally distinct somatosensory neuron subtypes of the dorsal root ganglia (DRG) that collectively enable detection of a broad range of salient features of the external world.sup.1-4. A fundamental question in sensory and developmental biology is how somatosensory neuron subtypes acquire their characteristic physiological, morphological, and synaptic properties during development, enabling animals to detect and respond to innocuous and noxious thermal, chemical, and mechanical stimuli. Classical studies of embryonic development indicate that migrating multipotent neural crest progenitors, originating from the dorsal neural tube, populate nascent DRGs.sup.5. During ganglia formation, dedicated progenitors that express either Neurog1 (neurogenin-1) or Neurog2 (neurogenin-2) are proposed to give rise to distinct somatosensory neuron subtypes.sup.6, which then innervate peripheral target fields where they form morphologically distinct axonal ending types.sup.1. Current models of somatosensory neuron development have primarily been inferred from studies analyzing changes in expression of individual genes or axonal ending types in loss-of-function models.sup.1,7,8. Here, enome-wide transcriptomic analyses were used, coupled with molecular genetic approaches to define transcriptional mechanisms of somatosensory neuron subtype diversification.
scRNA-Seq of Somatosensory Neurons
[0191] To begin to define transcriptional cascades underlying somatosensory neuron subtype specification, single-cell RNA sequencing (scRNA-seq) was performed at embryonic day 11.5 (E11.5), which is shortly after DRG formation, and at critical developmental milestones during somatosensory neuron development: at E12.5, when virtually all DRG neurons are post-mitotic.sup.9 and have extended axons well into the periphery; at E15.5, when peripheral and central target fields of somatosensory neurons are being innervated.sup.1011; at P0, when maturation of sensory neuron endings within the skin and other targets is occurring.sup.12,13; at P5, when peripheral endings have mostly refined into their mature morphological states and central projection terminals are properly organized within select spinal cord laminae.sup.8,14,15; and in early adulthood (P28-42) (
[0192] Next, how the transcriptional identities of mature somatosensory neuron subtypes compare to those of newborn sensory neurons by analyzing the transcriptomes of cells from DRGs at E11.5 (
[0193] To address this, scRNA-seq transcriptomes generated from sensory neurons between E11.5 and adulthood were compared. Prospective identities for sensory neurons at each developmental stage were assigned based on transcriptional similarity using canonical correlation analysis.sup.27 (
[0194] Next, whether this graph-based representation of developmental gene expression profiles of sensory neuron subtypes recapitulates known developmental relationships was tested. The expression patterns of the TFs Runx1 and Runx3 were inspected, which are implicated in development of select unmyelinated (C-fiber) neuron subtypes and proprioceptors, respectively.sup.28-30. It was found that Runx1 expression was prominent in unmyelinated sensory neuron subtypes, whereas Runx3 expression was restricted to mature proprioceptors of adult ganglia, as previously described.sup.28,29 (
TFs in Sensory Neuron Development
[0195] One observation from the initial analysis of the graph-based representation of developmental transcriptomes of sensory neurons is that TFs implicated in development of sensory neuron subtypes, Runx1 and Runx3, are broadly co-expressed in nascent E11.5 Avil.sup.+ sensory neurons, which stands in contrast to their mutually exclusive expression patterns in terminally differentiated subtypes of adult DRGs (
Specification of Subtype Identity
[0196] Next, it was asked if broad-to-restricted TFs contribute to sensory neuron diversification during the transcriptionally unspecialized state, thus broadly influencing transcriptional maturation of sensory neurons, or whether these TFs primarily influence the subtypes in which their expression is maintained. DRGs were harvested from neonatal (P0-5) pups harboring null alleles of either Pou4f2 or Pou4f3, which are representative broad-to-restricted TFs, and generated scRNA-seq transcriptomes from Pou4f2.sup.KO(Cre)/KO(Cre) mice and Pou4f2.sup.++/littermate controls as well Pou4f3.sup.−/− mice and Pou4f3.sup.++/littermate controls. Initial inspection of the scRNA-seq data obtained from both Pou4f2 and Pou4f3 mutant animals revealed clusters corresponding to each somatosensory subtype (
Extrinsic Control of Subtype Identity
[0197] Whether differential maintenance or extinction of TFs in emerging subtypes occurs via a process that is entirely intrinsic to developing sensory neurons or guided by extrinsic cues was next addressed. The mesenchymal and epidermal environments through which embryonic somatosensory axons extend are rich sources of extrinsic signals including neuronal growth factors.sup.8. Therefore, whether nerve growth factor (NGF), an extrinsic cue critical for growth and survival of Ntrk1 (TrkA; NGF-receptor)-expressing embryonic somatosensory neurons.sup.34, which represent ˜80% of the adult DRG, may exert control over the TF selection process, was sought. To address this, scRNA-seq was performed using DRGs from neonatal mice harboring a targeted mutation in the NGF gene. This genome-wide analysis of NGF-dependent gene expression was done using the apoptosis deficient Bax-knockout genetic background to circumvent the apoptotic cell death of DRG neurons associated with developmental loss of NGF.sup.35. While clustering analysis of the scRNA-seq data revealed that all somatosensory neuron subtypes are present in Bax.sup.−/− controls (
DISCUSSION
[0198] The genome-wide transcriptomic analyses of cells traversing somatosensory neuron developmental stages support a model in which newborn somatosensory neurons are unspecialized with respect to expression of subtype-restricted TFs, and that differential maintenance of unique combinations of these subtype-restricted TFs enables nascent sensory neurons to resolve into mature subtypes (
Methods
[0199] Animals
[0200] All mouse experiments in this study were approved by the National Institutes of Health and the Harvard Medical School IACUC. Experiments followed the ethical guidelines outlined in the NIH ‘Guide for the care and use of laboratory animals (grants.nih/gov/grants/olaw/guide-for-the-care-and-use-of-laboratory-animals.pdf). Avpr1a and Bmpr1b.sup.T2a-Cre mice were generated using standard homologous recombination techniques in ES cells. Chimeras were generated by blastocyst injection and subsequent germline transmission was confirmed by tail PCR. The neo selection cassette was excised using a Flp-deleter strain for the Avpr1a.sup.T2a-Cre but left intact for the Bmpr1b.sup.T2a-Cre lines. Mice were housed under standard conditions and provided chow and water ad libitum. Plug date was considered embryonic day 0.5 (E0.5) and date of birth was considered postnatal day 0 (P0). Pou4f3 null mice were obtained from Jax (Stock No. 008645). Pou4f2 null(Cre) mice were obtained from Jax (Stock No. 030357). Rosa26 Cre-dependent tdtomato reporter mice were obtained from Jax (Stock No. 007914). AvilCreERT2 mice were obtained from Jax (Stock No. 032027). All experiments with wild-type animals were conducted with mice on the C57Bl/6J background and were obtained from Jackson Laboratory.
[0201] Dissociation and Purification of Isolated Single Sensory Neurons.
[0202] The dissection strategy used were nearly identical for all ages presented in this study. Specifically, animals were sacrificed, and spinal columns were removed and placed on a tray of ice. Individual DRGs with central and peripheral nerves attached were removed from all axial levels and placed into ice-cold DMEM:F12 (1:1) supplemented with 1% pen/strep and 12.5 mM D-Glucose. A fine dissection was performed to remove the peripheral and central nerve roots, resulting in only the sensory ganglia remaining. 200-400 individual ganglia were collected for the DRG and 20-30 ganglia for the trigeminal for each bioreplicate of single-cell sequencing. All scRNA-seq experiments in this study were performed with >2 bioreplicates. Sensory ganglia were dissociated in 40 units papain, 4 mg/ml Collagenase, 10 mg/mL BSA, 1 mg/mL hyalurdonidase, 0.6 mg/mL DNAse in DMEM:F12+1% pen/strep+12.5 mM glucose for 10 minutes at 37° C. Digestion was quenched using 20 mg/mL ovomucoid (trypsin inhibitor), 20 mg/mL BSA in DMEM:F12+1% pen/strep+12.5 mM glucose. Ganglia were gently triturated with fire polished glass pipettes (opening diameter of approx. 150-200 μm). Neurons were then passed through a 70μm filter to remove cell doublets and debris. Neurons were pelleted and washed 4-8× in 20 mg/mL ovomucoid (trypsin inhibitor), 20 mg/mL BSA in DMEM:F12+1% pen/strep+12.5 mM glucose followed by 2× washes with DMEM:F12+1% pen/strep+12.5 mM Glucose all at 4 C. After washing, cells were resuspended in 50-200 uL of DMEM:F12+1% pen/strep+12.5 mM glucose. Cells were counter stained with Trypan blue, visually inspected, counted with a hemocytometer. Dissociated ganglia preparations were considered to pass quality control and used for scRNA-seq if >90% of cells were viable, as measured by exclusion of trypan blue and virtually no cellular debris was visible.
[0203] Tissue Processing for RNA Florescent In Situ Hybridization (RNA-FISH).
[0204] For sample preparation, individual DRGs from mice were rapidly dissected and axial level was identified by identifying specific DRGs using the T12 DRG as a landmark. The T12 DRG was defined as the ganglia immediately caudal to the last rib. DRGs were frozen in dry-ice cooled 2-metylbutane and stored at −80° C. until sectioned. DRGs were sectioned at a thickness of 15-20 μm and RNAs were detected by RNAscope (Advanced Cell Diagnostics) using the manufacturer's protocol. Total numbers of neurons per section of DRG were estimated by counting neuronal nuclei as measured by DAPI and counts were confirmed as reasonable estimates by comparing to counts measured by measuring Advillin or Pou4f/Brn3a, which are both pan-somatosensory neuron markers. It was observed that somatosensory neuron number per section were similar for DAPI vs Advillin or Pou4f1/Brn3a. The following probes were used: Mm-Th (Cat #: 317621), Mm-Calb1 (Cat #-428431), Mm-Pou4f2 (Custom made), Mm-Pou4f3 (Custom made), Mm-Avil (Cat #: 498531), Mm-Asic1 (Cat #: 480581), Mm-Mrgpra3 (Cat #: 548161), Mm-Pou4f1 (Cat #: 414671), Mm-Colq (Cat #: 496211), Mm-Sst (Cat #: 404631), Mm-Pvalb (Cat #: 421931), Mm-Ikzf1 (Cat #: 511201), Mm-Avpr1a (Cat #: 418061), Mm-Oprk1 (Cat #: 316111), Mm-Mrgprd (Cat #: 417921), Mm-Bmpr1b (Custom made), Mm-Vcan (Cat #: 486231), Mm-Trpm8 (Cat #: 420451), Mm-Neurod1 (Cat #: 416871), Mm-Neurod6 (Cat #: 444851), Mm-Shox2 (Cat #: 554291), Mm-Hopx (Cat #: 405161), Mm-Runx1 (Cat #: 406671), Mm-Runx3 (Cat #: 451271) GFP (Cat #: 400281), tdTomato (Cat #: 317041).
[0205] Single-Cell RNA Library Preparation, Sequencing, and Analysis.
[0206] Single cell RNA-seq was performed with the 10× Genomics Chromium Single Cell Kit (v2 & v3). Approximately 1000-8000 cells were added to the RT mix prior to loading on the microfluidic chip. Downstream reverse transcription, cDNA synthesis/amplification, and library preparation were performed according to manufacturer's instructions. All samples were sequenced on a NextSeq 500 with 58 bp sequenced into the 3′ end of the mRNAs. Initial gene expression tables for individual barcodes were generated using the cellranger pipeline according to instructions provided by 10× Genomics. All gene expression tables were then imported into R and analyzed with Seurat (v 2.3) with standard procedures. Cluster identification: clusters were classified into transcriptionally distinct somatosensory neuron subtypes: Aβ RA-LTMRs.sup.44-46, Aβ Field-LTMRs/Aβ SA1-LTMRs.sup.46,47, Aδ-LTMRs.sup.46,48, C-LTMRs.sup.46,49, CGRP.sup.+ neurons.sup.50,51 (containing six transcriptionally discrete subtypes), Mrgprd.sup.+ polymodal nociceptors.sup.46,52-54, proprioceptors.sup.55,56, Sst.sup.+ pruriceptors (Somatostatin/Nppb.sup.+).sup.57,58, cold sensitive thermoceptors.sup.50,59,60, as well as two main classes of support cells (Endothelial and Schwann cells). It was noted that a transcriptionally distinct cluster uniquely corresponding to Merkel cell-associated Aβ SA1-LTMRs was not detected. However, based on bulk RNA-seq analysis of genetically defined and FACS-purified LTMR subtypes, Aβ SA1-LTMRs harbor transcriptomes bearing striking resemblance to Aβ Field-LTMRs.sup.46; therefore, these two Aβ LTMR subtypes are likely embedded within the same cluster in the tSNE plot. It was confirmed that marker genes for each of the sensory neuron subtypes are expressed in subsets of DRG neurons and noted that the relative proportions of certain sensory neuron subtypes varied across ganglia located at different axial levels (
1.
[0207] Cloning, Production, Purification, Concentration and Quality Control of Adeno-Associated Virus (AAV).
[0208] AAV backbones were generated using standing cloning and molecular biology techniques. The following sequences were used for shRNAs: Luciferase (GCGCGATAGCGCTAATAATTT (SEQ ID NO: 1)), Pou4f3 (TATCCCTTGGAGAAAAGCCTTGTT (SEQ ID NO: 2)). AAVs included GFP, tagged with hemagglutinin (TAC CCATACGATGTTCCAGATTACGCT (SEQ ID NO: 3)) as a reporter to monitor infectivity. Each individual preparation of AAV (2/9) and (2/PHP.S.sup.64) were produced by transient transfection of pRC9, pHelper, and AAV-genome plasmid into 6-12 T225 flasks of HEK 293T cells. Viral media was collected and replaced at 72 hours. 293T cells and a second round of viral media were collected at 120 hours post transfection. AAVs were extracted from cell pellets using Salt Active Nuclease (Articzymes) in 40 mM Tris, 500 mM NaCl and 2 mM MgCl.sub.2 pH8 (SAN buffer). AAV in supernatant were precipitated with 8% PEG/500 mM NaCl and resuspended in SAN buffer. Viral suspensions were loaded onto an iodixanol gradient (OptiPrep) and subsequently concentrated using Amicon filters with a 100 kD cutoffs to a volume of 25-30 uL (1×PBS+0.001% F-68) per 6 T225-flasks transfected. Viral titers were normalized to 1e10.sup.14 vg/mL and stored at −80C in 5-10 uL aliquots. AAVs (2/9) were injected intraperitoneally (IP) into postnatal day 0 pups. Pups transiently anesthetized by hypothermia and beveled pipettes were used to deliver 10.sup.12 viral genomes in a volume of 10 uL (0.01% Fast Green, 1×PBS). After mice were injected, they were returned to ambient temperature and upon regaining full mobility were cross fostered with nursing CD1 females. Approximately seven days after transduction, DRGs were extracted for subsequent experimental analysis. Upon dissecting, all DRGs were visualized and monitored for GFP expression. For behavioral experiments, a minimum of 10.sup.12 viral genomes of AAV (2/PHP.S) were delivered to P21 mice via intravenous injection (retroorbital vein).
[0209] Immunostaining Analysis.
[0210] DRG: For immunostaining analysis, mice (P28-42) were anesthetized with isoflurane and transcardially perfused with 10 mL of 1×PBS (with Heparin) followed by 10 mL of 1×PBS/4% paraformaldehyde at room temperature. Spinal columns were then removed and rinsed in 1×PBS and then cryoprotected overnight in 1×PBS/30% sucrose at 4° C., then embedded in NEG50 and stored at −70° C. For cryosectioning, tissue blocks were equilibrated to −20° C. for 1 hour and then sectioned onto glass slides at a thickness of 20-25 μm. Slides were stored at −70° C. until ready for staining. Slides with sections were taken from freezers and immediately placed into 1×PBS and washed 3× with 1×PBS for 5 minutes each at room temperature. Tissue was blocked using 1×PBS/5% Normal donkey serum/0.05% Triton X-100 for 1 hour at room temperature. Tissue was then washed with 1×PBS 3×5 minutes each at room temperature. Tissue was then incubated in primary antibody (Rabbit Anti-NeuN, Millipore: MAB377, 1:1000. Goat Anti-mCherry/tdTomato, CederLane: AB0040-200, 1:1000) in 1×PBS/5% Normal donkey serum/0.05% Triton X-100 overnight at 4° C. Tissue were washed in 1×PBS 3× for 5 minutes at room temperature followed by secondary antibody (Donkey Anti-Rabbit 488, 1:1000; Donkey Anti-Goat, 1:1000) diluted in 1×PBS/5% Normal donkey serum/0.05% Triton X-100 for 1 hour at room temperature. Lastly, tissue was washed in 1×PBS 3× for 5 minutes at room temperature followed by application of mounting media and glass coverslip. Skin sections. Skin sections were immunostained as described for DRG sections with the following differences: Section thickness was 55-60 μm. Primary antibodies used were (Chicken Anti-GFP, Ayes: GFP-1020, 1:1000. Goat Anti-mCherry/tdTomato, CederLane: AB0040-200, 1:1000, Rabbit Anti-CGRP, Immunostar: 24112, 1:1000). All images were obtained as z-stacks using a Zeiss LSM 700 confocal microscope using a 10× or 20× objective.
[0211] Two-Plate Temperature Choice Assay.
[0212] Animals were habituated to the behavioral apparatus for 30 minutes prior to experimental analysis. Animals were placed into the center of two identical chambers with one chamber randomly set to 30° C. and the other to the test temperature indicated. Animals were recorded as they freely explored the arena while automatic tracking software was used to track animals over a 5-minute period. Time spent in each temperature chamber was quantified as a fraction of total time tested and one temperature was tested per day.
[0213] RNA Isolation, Reverse Transcription, and qRT-PCR.
[0214] DRGs were dissected as described above; however, instead of subjecting ganglia to dissociation, they were directly lysed by gentle agitation in Trizol at room temperature for 10 minutes. The RNeasy Mini (Qiagen) kit was used according to manufacturer's instructions to purify DNA-free RNA. RNA was converted to cDNA using 200-250 ng of RNA with the High-capacity cDNA reverse transcription kit (Themofisher). qRT-PCR was performed with technical triplicates and mapped back to relative RNA concentrations using a standard curve built from a serial dilution of cDNA. Data were collected using the LightCycler 480 SYBR Green I Master mix (Roche) on a QuantStudio 3 qPCR machine (Applied Biosystems).
[0215] Statistics and Reproducibility.
[0216] For all scRNA-seq data shown all individual cells for the labeled cell type are shown with no downsampling or subsetting implemented unless explicitly indicated. Differential and comparative gene expression analysis were conducted using a two-sided Wilcoxon rank-sum test with Bonferroni correct p-values. Immunostaining and cell counting comparisons were done using a two-sided t-test. Behavioral analysis was compared using a two-way ANOVA followed by a Tukey's post-hoc test. All scRNA-seq samples were derived from n=2 biologically independent samples with the exception of the adult (P28-42) sample which was derived from n=6 biologically independent samples. The follow sample sizes (cell numbers) for each cell type and samples sizes for other analyses are as follows:
[0217] Data Availability.
[0218] Sequence data of this study have been deposited with accession code GSE139088. The data is also available for browsing and analysis via the HTML interface at kleintools.hms.harvard.edu/tools/springViewer_1_6_dev.html?datasets/Sharma2019/all.
[0219] Code Availability.
[0220] The computational code used in the study is available at GitHub (github.com/wagnerde) or upon request.
REFERENCES FOR EXAMPLE 1
[0221] 1 Abraira, V. E. & Ginty, D. D. The sensory neurons of touch. Neuron 79, 618-639, doi:10.1016/j.neuron.2013.07.051 (2013). [0222] 2 Julius, D. TRP channels and pain. Annu Rev Cell Dev Biol 29, 355-384, doi:10.1146/annurev-cellbio-101011-155833 (2013). [0223] 3 Basbaum, A. I., Bautista, D. M., Scherrer, G. & Julius, D. Cellular and molecular mechanisms of pain. Cell 139, 267-284, doi:10.1016/j.cell.2009.09.028 (2009). [0224] 4 Julius, D. & Basbaum, A. I. Molecular mechanisms of nociception. Nature 413, 203-210, doi:10.1038/35093019 (2001). [0225] 5 Le Douarin, N. The neural crest. (Cambridge University Press, 1982). [0226] 6 Anderson, D. J. Lineages and transcription factors in the specification of vertebrate primary sensory neurons. Curr Opin Neurobiol 9, 517-524, doi:10.1016/50959-4388(99)00015-X (1999). [0227] 7 Marmigere, F. & Ernfors, P. Specification and connectivity of neuronal subtypes in the sensory lineage. Nat Rev Neurosci 8, 114-127, doi:10.1038/nrn2057 (2007). [0228] 8 Lallemend, F. & Ernfors, P. Molecular interactions underlying the specification of sensory neurons. Trends Neurosci 35, 373-381, doi:10.1016/j.tins.2012.03.006 (2012). [0229] 9 Kitao, Y., Robertson, B., Kudo, M. & Grant, G. Neurogenesis of subpopulations of rat lumbar dorsal root ganglion neurons including neurons projecting to the dorsal column nuclei. J Comp Neurol 371, 249-257, doi:10.1002/(SICI)1096-9861(19960722)371:2<249::AID-CNE5>3.0.CO;2-2 (1996). [0230] 10 Hasegawa, H., Abbott, S., Han, B. X., Qi, Y. & Wang, F. Analyzing somatosensory axon projections with the sensory neuron-specific Advillin gene. J Neurosci 27, 14404-14414, doi:10.1523/JNEUROSCI.4908-07.2007 (2007). [0231] 11 Ozaki, S. & Snider, W. D. Initial trajectories of sensory axons toward laminar targets in the developing mouse spinal cord. J Comp Neurol 380, 215-229 (1997). [0232] 12 Mimics, K. & Koerber, H. R. Prenatal development of rat primary afferent fibers: II. Central projections. J Comp Neurol 355, 601-614, doi:10.1002/cne.903550409 (1995). [0233] 13 Mimics, K. & Koerber, H. R. Prenatal development of rat primary afferent fibers: I. Peripheral projections. J Comp Neurol 355, 589-600, doi:10.1002/cne.903550408 (1995). [0234] 14 Woodbury, C. J., Ritter, A. M. & Koerber, H. R. Central anatomy of individual rapidly adapting low-threshold mechanoreceptors innervating the “hairy” skin of newborn mice: early maturation of hair follicle afferents. J Comp Neurol 436, 304-323 (2001). [0235] 15 Woodbury, C. J. & Koerber, H. R. Widespread projections from myelinated nociceptors throughout the substantia gelatinosa provide novel insights into neonatal hypersensitivity. J Neurosci 23, 601-610 (2003). [0236] 16 Zeisel, A. et al. Molecular Architecture of the Mouse Nervous System. Cell 174, 999-1014 e1022, doi:10.1016/j.cell.2018.06.021 (2018). [0237] 17 Usoskin, D. et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat Neurosci 18, 145-153, doi:10.1038/nn.3881 (2015). [0238] 18 Zheng, Y. et al. Deep Sequencing of Somatosensory Neurons Reveals Molecular Determinants of Intrinsic Physiological Properties. Neuron 103, 598-616 e597, doi:10.1016/j.neuron.2019.05.039 (2019). [0239] 19 Nguyen, M. Q., Wu, Y., Bonilla, L. S., von Buchholtz, L. J. & Ryba, N. J. P. Diversity amongst trigeminal neurons revealed by high throughput single cell sequencing. PLoS One 12, e0185543, doi:10.1371/journal.pone.0185543 (2017). [0240] 20 McInnes, L., Healy, J. & Melville, J. UMAP: Uniform manifold approximation and projection for dimension reduction. arXiv, 1-51 (2018). [0241] 21 Kim, J., Lo, L., Dormand, E. & Anderson, D. J. SOX10 maintains multipotency and inhibits neuronal differentiation of neural crest stem cells. Neuron 38, 17-31 (2003). [0242] 22 Britsch, S. et al. The transcription factor Sox10 is a key regulator of peripheral glial development. Genes Dev 15, 66-78 (2001). [0243] 23 Ma, Q., Fode, C., Guillemot, F. & Anderson, D. J. Neurogenin1 and neurogenin2 control two distinct waves of neurogenesis in developing dorsal root ganglia. Genes Dev 13, 1717-1728 (1999). [0244] 24 Zurborg, S. et al. Generation and characterization of an Advillin-Cre driver mouse line. Mol Pain 7, 66, doi:10.1186/1744-8069-7-66 (2011). [0245] 25 Cao, J. et al. The single-cell transcriptional landscape of mammalian organogenesis. Nature 566, 496-502, doi:10.1038/s41586-019-0969-x (2019). [0246] 26 Blanchard, J. W. et al. Selective conversion of fibroblasts into peripheral sensory neurons. Nat Neurosci 18, 25-35, doi:10.1038/nn.3887 (2015). [0247] 27 Mayer, C. et al. Developmental diversification of cortical inhibitory interneurons. Nature 555, 457-462, doi:10.1038/nature25999 (2018). [0248] 28 Inoue, K. et al. Runx3 controls the axonal projection of proprioceptive dorsal root ganglion neurons. Nat Neurosci 5, 946-954, doi:10.1038/nn925 (2002). [0249] 29 Levanon, D. et al. The Runx3 transcription factor regulates development and survival of TrkC dorsal root ganglia neurons. EMBO J 21, 3454-3463, doi:10.1093/emboj/cdf370 (2002). [0250] 30 Chen, C. L. et al. Runx1 determines nociceptive sensory neuron phenotype and is required for thermal and neuropathic pain. Neuron 49, 365-377, doi:10.1016/j.neuron.2005.10.036 (2006). [0251] 31 Yoshikawa, M. et al. Coexpression of Runx1 and Runx3 in mechanoreceptive dorsal root ganglion neurons. Dev Neurobiol 73, 469-479, doi:10.1002/dneu.22073 (2013). [0252] 32 Lawson, S. N. & Biscoe, T. J. Development of mouse dorsal root ganglia: an autoradiographic and quantitative study. J Neurocytol 8, 265-274 (1979). [0253] 33 Lawson, S. N., Caddy, K. W. & Biscoe, T. J. Development of rat dorsal root ganglion neurones. Studies of cell birthdays and changes in mean cell diameter. Cell Tissue Res 153, 399-413, doi:10.1007/bf00229167 (1974). [0254] 34 Crowley, C. et al. Mice lacking nerve growth factor display perinatal loss of sensory and sympathetic neurons yet develop basal forebrain cholinergic neurons. Cell 76, 1001-1011 (1994). [0255] 35 Patel, T. D., Jackman, A., Rice, F. L., Kucera, J. & Snider, W. D. Development of sensory neurons in the absence of NGF/TrkA signaling in vivo. Neuron 25, 345-357 (2000). [0256] 36 Miyamoto, T. et al. Myeloid or lymphoid promiscuity as a critical step in hematopoietic lineage commitment. Dev Cell 3, 137-147 (2002). [0257] 37 Hu, M. et al. Multilineage gene expression precedes commitment in the hemopoietic system. Genes Dev 11, 774-785, doi:10.1101/gad.11.6.774 (1997). [0258] 38 Orkin, S. H. Diversification of haematopoietic stem cells to specific lineages. Nat Rev Genet 1, 57-64, doi:10.1038/35049577 (2000). [0259] 39 Soldatov, R. et al. Spatiotemporal structure of cell fate decisions in murine neural crest. Science 364, doi:10.1126/science.aas9536 (2019). [0260] 40 Dasen, J. S., Tice, B. C., Brenner-Morton, S. & Jessell, T. M. A Hox regulatory network establishes motor neuron pool identity and target-muscle connectivity. Cell 123, 477-491, doi:10.1016/j.cell.2005.09.009 (2005). [0261] 41 Dasen, J. S., Liu, J. P. & Jessell, T. M. Motor neuron columnar fate imposed by sequential phases of Hox-c activity. Nature 425, 926-933, doi:10.1038/nature02051 (2003). [0262] 42 Briscoe, J., Pierani, A., Jessell, T. M. & Ericson, J. A homeodomain protein code specifies progenitor cell identity and neuronal fate in the ventral neural tube. Cell 101, 435-445, doi:10.1016/s0092-8674(00)80853-3 (2000). [0263] 43 Hoppe, P. S. et al. Early myeloid lineage choice is not initiated by random PU.1 to GATA1 protein ratios. Nature 535, 299-302, doi:10.1038/nature18320 (2016). [0264] 44 Wende, H. et al. The transcription factor c-Maf controls touch receptor development and function. Science 335, 1373-1376, doi:10.1126/science.1214314 (2012). [0265] 45 Ichikawa, H., Deguchi, T., Nakago, T., Jacobowitz, D. M. & Sugimoto, T. Parvalbumin, calretinin and carbonic anhydrase in the trigeminal and spinal primary neurons of the rat. Brain Res 655, 241-245 (1994). [0266] 46 Zheng, Y. et al. Deep sequencing of somatosensory neurons reveals molecular determinants of intrinsic physiological properties. Neuron In Press (2019). [0267] 47 Bal, L. et al. Genetic Identification of an Expansive Mechanoreceptor Sensitive to Skin Stroking. Cell 163, 1783-1795, doi:10.1016/j.cell.2015.11.060 (2015). [0268] 48 Rutlin, M. et al. The cellular and molecular basis of direction selectivity of Adelta-LTMRs. Cell 159, 1640-1651, doi:10.1016/j.cell.2014.11.038 (2014). [0269] 49 Li, L. et al. The functional organization of cutaneous low-threshold mechanosensory neurons. Cell 147, 1615-1627, doi:10.1016/j.cell.2011.11.027 (2011). [0270] 50 Kobayashi, K. et al. Distinct expression of TRPM8, TRPA1, and TRPV1 mRNAs in rat primary afferent neurons with adelta/c-fibers and colocalization with trk receptors. J Comp Neurol 493, 596-606, doi:10.1002/cne.20794 (2005). [0271] 51 Rosenfeld, M. G. et al. Production of a novel neuropeptide encoded by the calcitonin gene via tissue-specific RNA processing. Nature 304, 129-135 (1983). [0272] 52 Dong, X., Han, S., Zylka, M. J., Simon, M. I. & Anderson, D. J. A diverse family of GPCRs expressed in specific subsets of nociceptive sensory neurons. Cell 106, 619-632 (2001). [0273] 53 Zylka, M. J., Dong, X., Southwell, A. L. & Anderson, D. J. Atypical expansion in mice of the sensory neuron-specific Mrg G protein-coupled receptor family. Proc Natl Acad Sci USA 100, 10043-10048, doi:10.1073/pnas.1732949100 (2003). [0274] 54 Zylka, M. J., Rice, F. L. & Anderson, D. J. Topographically distinct epidermal nociceptive circuits revealed by axonal tracers targeted to Mrgprd. Neuron 45, 17-25, doi:10.1016/j.neuron.2004.12.015 (2005). [0275] 55 Arber, S., Ladle, D. R., Lin, J. H., Frank, E. & Jessell, T. M. ETS gene Er81 controls the formation of functional connections between group Ia sensory afferents and motor neurons. Cell 101, 485-498 (2000). [0276] 56 de Nooij, J. C., Doobar, S. & Jessell, T. M. Etv1 inactivation reveals proprioceptor subclasses that reflect the level of NT3 expression in muscle targets. Neuron 77, 1055-1068, doi:10.1016/j.neuron.2013.01.015 (2013). [0277] 57 Stantcheva, K. K. et al. A subpopulation of itch-sensing neurons marked by Ret and somatostatin expression. EMBO Rep 17, 585-600, doi:10.15252/embr.201540983 (2016). [0278] 58 Mishra, S. K. & Hoon, M. A. The cells and circuitry for itch responses in mice. Science 340, 968-971, doi:10.1126/science.1233765 (2013). [0279] 59 Bautista, D. M. et al. The menthol receptor TRPM8 is the principal detector of environmental cold. Nature 448, 204-208, doi:10.1038/nature05910 (2007). [0280] 60 McKemy, D. D., Neuhausser, W. M. & Julius, D. Identification of a cold receptor reveals a general role for TRP channels in thermosensation. Nature 416, 52-58, doi:10.1038/nature719 (2002). [0281] 61 Hockley, J. R. F. et al. Single-cell RNAseq reveals seven classes of colonic sensory neuron. Gut, doi:10.1136/gutjnl-2017-315631 (2018). [0282] 62 Li, C. L. et al. Somatosensory neuron types identified by high-coverage single-cell RNA-sequencing and functional heterogeneity. Cell Res 26, 967, doi:10.1038/cr.2016.90 (2016).
Example 2: Selective Inhibition of Primary Nociceptors to Reduce Pain and Itch
INTRODUCTION
[0283] The perception of pain relies on primary sensory neurons that innervate the skin and other peripheral organs. The current understanding of the mechanisms by which noxious stimuli are detected and conveyed by primary sensory neurons to the central nervous system is remarkably deficient.sup.1,2. This has resulted in an innovation gap in developing new therapeutic approaches to pain, leaving few treatment options for prevalent diseases leading to debilitating pain and itch as found in painful diabetic neuropathy (PDN, ˜9,000 cases per 100,000 in the U.S.) or chronic pruritus (7,000 cases per 100,000). The current standard of care for these two disorders alone represents a market of nearly $10B, however the treatments for these, as well as a majority of pain disorders, have remained unchanged for decades. “First-line” treatment options include the anticonvulsants Gabapentin and Pregabalin, which have poor efficacy and serious side effects, while other treatment options involve the alarming use of opioids, contributing to the addiction epidemic. In light of limited treatment options for pain disorders, there is a clear clinical and societal need for understanding the first stage of nociception which will lead to the development of a fundamentally new class of treatment options to manage pain. Described herein is a strategy that combines next-generation genomic technologies and bioinformatics with compound screening to identify novel molecules that selectively inhibit primary nociceptors to reduce pain, circumventing addictive properties of existing pain treatment paradigms. A parallel strategy will be undertaken to identify drugs that reduce chronic itch.
Preliminary Results
[0284] The perception of pain and itch begins with detection of noxious stimuli by primary peripheral sensory neurons called nociceptors or pruriceptors, respectively. The development of all primary somatosensory neuron subtypes have recently been characterized, which include nociceptors and pruriceptors, using single-cell RNA-seq (scRNA-seq).sup.3. Through this analysis, gene expression patterns for six transcriptionally distinct cellular subtypes of nociceptors and two transcriptionally distinct cellular subtypes of pruriceptors have been defined. Furthermore, using computational algorithms, gene expression changes in each nociceptor and pruriceptor subtype throughout development and maturation (
[0285] Here, the knowledge of primary nociceptor and pruriceptor subtypes, and the newly identified genes they express, is used to develop therapeutic approaches to treat pain and chronic itch. In order to identify novel compounds useful for treating pain and chronic itch by silencing primary nociceptors and pruriceptors, the follow experiments can be conducted:
[0286] Experiment 1: Identify G.sub.ai/o-coupled GPCRs expressed in specific sensory neuron subtypes that, upon activation, suppress pain and itch processing. A series of established bioinformatics analysis pipelines, behavioral phenotyping, and confirmation of conservation in human tissue samples will be performed.
[0287] Experiment 2: Perform high throughput compound screens for molecules that activate subtype restricted G.sub.ai/o-coupled GPCRs and therefore block pain and itch signaling. Compound libraries will be screened and hits will be tested in established behavioral and functional assays.
[0288] The goal is to identify ligands/agonists of sensory neuron subtype restricted G.sub.ai/o-coupled GPCRs that selectively block pain and itch signals emanating from the periphery and subsequently develop those hits into optimal therapeutics for treating pain and chronic itch disorders.
Experiment 1
[0289] Identify G.sub.ai/o-coupled GPCRs expressed in specific sensory neuron subtypes that, upon activation, suppress pain and itch processing.
[0290] Rationale
[0291] GPCRs represent a successful molecular target for modern drug development, with nearly a third of all FDA approved drugs targeting members of this receptor family. Importantly, it is well established that activation of GPCR family members coupled to G.sub.ai/o leads to downstream activation of G-protein coupled inwardly rectifying potassium channels (GIRKs) that silence neuronal activity.sup.4-6. Moreover, voltage-gated calcium channels necessary for neurotransmitter release from DRG sensory neurons are also inhibited by Gβγ released from G.sub.ai/o. Therefore, G.sub.ai/o coupled GPCRs are compelling pharmacological targets for silencing the sensory neuron subtypes in which they are expressed. Given that sensory neuron subtypes are responsible for responding to unique types of noxious stimuli, the aim is to identify G.sub.ai/o coupled GPCRs that are restricted in expression to one or more subsets of nociceptors and pruriceptors, but not proprioceptors or other sensory neurons subtypes; these will be useful candidate drug targets for selectively silencing the responses to painful stimuli or itch stimuli, thereby reducing pain or itch perception. The ideal GPCR for an agonist compound useful for treating pain or itch will have the following properties: 1) The GPCR is highly expressed in nociceptors, pruriceptors, or combinations of both; 2) The GPCR is coupled to the G.sub.ai/o signaling pathway; 3) The GPCR exhibits a conserved pattern of expression between rodent and human DRGs; 4) It is expressed at low levels in other sensory neuron subtypes, peripheral tissues, and brain; 5) Activation of the GPCR attenuates pain or itch perception. Experiment 1 will combine bioinformatic analyses and in vitro and in vivo experiments to identify GPCRs that satisfy these criteria and serve as targets for compound screening and drug development, described in Experiment 2.
[0292] 1a. Bioinformatic Identification of Subtype-Restricted GPCRs
[0293] To identify sensory neuron subtype-restricted G.sub.ai/o coupled GPCRs, first the scRNA-seq database will be analyzed, and GPCRs with expression profiles restricted to specific subsets of nociceptors and pruriceptors will be bioinformatically identified. The preliminary analysis identified several subtype-restricted GPCRs which are found in all nociceptors, a subset of nociceptors, or pruriceptor subtypes. These GPCRs are undetectable in other somatosensory neuron subtypes (two examples are shown in
[0294] 1b. Confirmation of GPCR Expression in Human DRG Tissue and Comparisons to Other Body Regions
[0295] A multi-pronged approach will be used to determine whether the GPCRs identified bioinformatically from the dataset of mouse DRG scRNA-Seq are conserved in their expression patterns in human DRGs, and also whether they are expressed at low or undetectable levels in other tissues. It is noteworthy that the degree of conservation of gene expression patterns between mouse and human DRG neurons is believed to be high.sup.8. As an initial approach, transcriptomic databases will be used to perform bioinformatic cross-species and tissue comparisons. First, expression profiles of the identified GPCRs will be compared to currently published human DRG datasets.sup.8 that are available to assess the conservation of subtype-restricted GPCRs from mouse to human. As an alternative approach, surgically excised human DRGs will be obtained from the Massachusetts General Hospital and will be sectioned and double smRNA-FISH hybridization will be performed for sensory neuron-subtype marker genes and candidate subtype-restricted GPCRs to evaluate mouse to human conservation.
[0296] As an additional bioinformatic analysis, subtype-restricted GPCRs that are confirmed to be conserved in humans will be examined for off-target tissue expression by bioinformatically examining published organism-wide scRNA-seq.sup.9,10 datasets and evaluating where else the identified subtype-restricted GPCRs are expressed. While some or many of the GPCRs that are expressed in a subset of sensory neurons may also be expressed in other tissues, the Master List will be prioritized to emphasize those GPCRs that show the least amount of expression in non-sensory neuron cell types. Thus, a new, revised GPCR Candidate Master List will be ranked in priority based on patterns of sensory neuron expression, conservation in human, and minimal off target patterns of tissue expression.
[0297] 1c. G-Protein Signaling Assays to Identify G.sub.ai/o-Coupled Receptors
[0298] Which of the subtype restricted GPCRs are G.sub.ai/o-coupled will be determined. Of those GPCRs listed in
[0299] 1d. Test the Suppressive Influence of Identified G.sub.ai/o-Coupled GPCRs on DRG Neuron Excitability
[0300] “Proof-of-principle” experiments will be done to ask if activation of the most promising Gallo coupled subtype-restricted GPCRs can indeed silence sensory neurons. For this, the G.sub.ai/o-coupled hM4DECD-GPCR chimera fusion proteins, described in Experiment 1c above, will be used and their activation results in reduction of nociceptor or pruriceptor electrical excitability in vitro will be determined. This will be accomplished by transducing mouse DRG neurons with the chimeric receptors using established AAV transduction protocols in the lab, and treat the neurons with CNO to selectively activate the receptors and measure excitability using standard calcium imaging and whole cell electrophysiological recordings of CGRP+ DRG neurons, which are also routine for the laboratory. It is anticipated that those G.sub.ai/o-coupled GPCRs that reduce nociceptor excitability in a CNO-dependent manner will represent a highly curated list of new candidate targets for ligands/agonist identification for treating pain and/or chronic itch. Promising candidates will be chosen from this curated list for subsequent drug screens, using the criteria outlined in the rationale section of this Example.
[0301] Milestones and Anticipated Results for Experiment 1.
[0302] Experiment 1a. The GPCR Candidate Master List will be completed and in situ hybridization experiments will be done to confirm sensory neuron subtype expression. It is anticipated that this will reveal more than 60 GPCRs that are candidate targets of new pain and itch therapies. Experiment 1b. Testing whether candidate GPCRs are expressed in human DRGs. There is a high degree of conservation of human and rodent DRG gene expression, and so it is anticipated that ˜40-50 GPCRs will remain. Experiment 1c. Determining whether candidate GPCRs are coupled to G.sub.ai/o. Since approximately 40% of GPCRs are estimated to be coupled to G.sub.ai/o signaling pathways, it is anticipated that ˜15-20 of the ˜40-50 GPCRs expressed in the DRG will be “subtype-select” G.sub.ai/o-coupled GPCRs, which will be selected for further functional analysis. Experiment 1d. Experiments that test the suppressive influence of top candidate G.sub.ai/o-coupled GPCRs on DRG neuron excitability will be done to test efficacy of GPCRs. A GPCR that suppresses neuronal firing will become a candidate, whereas one that does not suppress neuronal firing would be eliminated from further consideration.
Experiment 2
[0303] Identify small molecule ligands for nociceptor subtype restricted G.sub.ai/o-coupled GPCRs.
[0304] Rationale
[0305] The current standard of care for most pain disorders consists of non-steroidal anti-inflammatory (NSAIDs), serotonin and norepinephrine reuptake inhibitors (SNRIs), anticonvulsants, or opioid analgesics. Many of these treatments carry significant side effects or have high rates of abuse/addictive potential which dramatically diminish their usefulness. Furthermore, many of the current treatments act in the brain and central nervous system. As a result, there is a significant unmet need for therapeutics that are efficacious, safe, and non-addictive alternatives for pain management. This approach, which involves identifying new agonists for nociceptor and pruriceptor subtype specific G.sub.ai/o-coupled GPCRs, serves as a direct solution to these issues for several reasons:
[0306] 1. the primary site of action for these agonists will be peripheral sensory neurons, which have not been a major pharmacological target of pain therapies;
[0307] 2. the agonists will target select GPCRs and thus all or specific subsets of nociceptors or pruriceptors, thereby leaving other sensory signals that underlie touch and proprioception unaltered, and;
[0308] 3. future med-chem approaches can be used to generate agonists that are peripherally restricted so that they are bioavailable to peripheral neurons but do not enter the central nervous system, diminishing any potential brain-related side effects.
[0309] Here, the workflow that aims to identify new agonists that specifically activate the most compelling sensory neuron subtype specific G.sub.ai/o-coupled GPCRs identified in Experiment 1 is outlined.
[0310] 2a. Testing Candidate Agonists
[0311] First, the ability of known agonists for G.sub.ai/o-coupled GPCRs that have already been found to be expressed in nociceptor and/or pruriceptor subtypes for reducing behavioral responses to painful and itch stimuli will be tested, including measures of mechanical allodynia in models of neuropathic pain.sup.13. For example, whether serotonin analogs are effective at suppressing behavioral and physiological responses to itch compounds by silencing pruriceptors, which selectively express Htr1f, a G.sub.ai/o-coupled GPCR expressed exclusively in pruriceptors (
[0312] 2b. Using a Combination of In Vitro and In Vivo Based Assays, Candidate Agonists for Promising G.sub.ai/o GPCRs Will be Identified.
[0313] High-throughput screens for GPCR agonists will be performed using in vitro heterologous cell cultures systems and follow up positive hits with efficacy and specificity using in vivo assays. A five-stage approach is proposed to identifying promising candidate agonists, identified as Screening Stages 1-5, described below.
[0314] Screening Stage 1: Identifying Candidate Agonists for the High-Value GPCRs Identified.
[0315] In this stage, commercially available cell lines (Euofins) that stably express the GPCR of interest will be used. Of particular value, these GPCRs expressed in stable cell lines are fused in frame with a small enzyme donor fragment ProLink™ (PK) and co-expressed in cells stably expressing a fusion protein of β-arrestin and the larger, N-terminal deletion mutant of β-galactosidase (called enzyme acceptor or EA). Activation of the GPCR stimulates binding of β-arrestin to the PK-tagged GPCR and forces complementation of the two enzyme fragments, resulting in the formation of an active β-galactosidase enzyme, which can be easily quantified using chemiluminescent approaches. The reagents for performing this assay are standardized and commercially available through Eurofins. In collaboration with the ICCB-Longwood Screening Facility, libraries containing over 500,000 small molecules will be screened, with more compounds continuously becoming available (see letter for support from Drs. Caroline Shamu and Jennifer Smith of the ICCB-Longwood Screening Facility). Notably, the β-arrestin based β-galactosidase assay is readily compatible with 96- or 384-well formats for simple, high-throughput compound screening.
[0316] Screening Stage 2: Selectivity Determination with Broad Panel Profiling.
[0317] Next, hits that activate the GPCR of interest in Stage 1 will be taken, and the selectivity of the identified small molecule in comparison to a broad panel of other GPCRs will be determined. Here, a curated panel of 168 GPCRs made by Eurofins that cover 60 different receptor families (gperMAX™ GPCR Assay Panel) will be used. Through Eurofins, each compound will be tested at three different concentrations for their ability to activate 168 distinct GPCRs. Candidates that show maximal and specific activation of only the GPCR of interest, and not other GPCRs, will pass this stage.
[0318] Screening Stage 3: Candidate Agonists Will be Tested to Determine if they can Reduce Pain/Itch Related Behaviors in Mice.
[0319] The efficacy of agonists identified in reducing pain behaviors in established animal models will be tested. The ability of identified agonists to block painful mechanical hypersensitivity (allodynia) using the spared nerve injury (SNI) model.sup.13,16 will also be tested. Additionally, PDN will be induced using the established protocol of depleting pancreatic β cells using chemically-induced streptozotocin (STZ) based models.sup.17 and the ability of identified agonists to reduce thermal and mechanical hyperalgesia in this model of PDN will be tested. As the most robust models of itch in mice are acute, the ability of the newly identified agonists to block the robust paradigms of acutely induced chloroquine or histamine induced itch will be tested. Compounds will be intraperitoneally injected using a range of doses and time points, and all behavioral assays will be done using 6 or more mice per treatment group.
[0320] Screening Stage 4: Test Specificity by Determining Whether Candidate Agonist Effects are Lost in Receptor Knockout Mice.
[0321] The great power of the mouse as a model system is that it affords the ability to do genetic experiments that address gene function in vivo. The specificity of newly identified agonists towards their GPCR targets will be tested by asking whether any inhibitory effects of the new GPCR agonists towards pain or itch behaviors are lost in mice in which the gene encoding the target GPCR is selectively deleted in the DRG. Mice lacking the GPCR of interest will be generated using standard gene-targeting strategies routinely performed in the lab. These GPCR conditional knockout experiments and behavioral measures will establish whether the newly identified compounds can effectively reduce pain or itch behaviors using the aforementioned in vivo mouse models by acting on their GPCR targets expressed in sensory neurons.
[0322] Screening Stage 5: Optimization of Candidate Agonist to Improve Bioavailability or Affinity.
[0323] Candidate molecules that pass Stages 1-4 will be considered for further development through partnering with medicinal chemists or biotech or pharmaceutical companies with expertise in med-chem for compound optimization, and for measurements of compound PK, oral availability, and toxicity.
[0324] Overview and Future Directions.
[0325] In the future, and depending on timing, the consequences of novel compound treatments will be tested using a range of behavioral assays routinely done in the laboratory. These will include gait analysis, touch sensitivity, temperature preference, measures of anxiety, general motor function, mating behaviors, weight, GI function and colonic pain, and more. Furthermore, using in vivo functional Ca2+ imaging (GCaMP7s), also routinely done in the lab, the effects of drug treatment on neuronal activity in nociceptor and pruriceptor populations will be measured. Together, the proposed and future studies will (a) define new candidate target G.sub.ai/o-coupled GPCRs expressed in nociceptors or pruriceptors, (b) identify GPCR agonists that silence nociceptor and pruriceptor subtypes, and (c) allow for the movement towards developing these new drugs to treat different types of pain and chronic itch.
[0326] Anticipated Results for Experiment 2
[0327] Candidate GPCR agonists will be tested for efficacy in pain and itch behavioral assays. A few candidate agonists are available to test immediately. Efficacy in the absence of unwanted side effects will determine whether a candidate is a go/no go for further development. Experiment 2b. First, high-throughput assays for G.sub.ai/o-coupled GPCRs will be designed, making use of cell lines purchased from the Eurofins collection of ProLink GPCRs. The ProLink β-galactosidase complementation assay will be used to perform high-throughput screens to identify agonists of the top two or three most promising candidate G.sub.ai/o GPCRs. As an example, if GPR149 (
REFERENCES FOR EXAMPLE 2
[0328] 1. Julius, D. TRP channels and pain. Annu Rev Cell Dev Biol 29, 355-384, doi:10.1146/annurev-cellbio-101011-155833 (2013). [0329] 2. Basbaum, A. I., Bautista, D. M., Scherrer, G. & Julius, D. Cellular and molecular mechanisms of pain. Cell 139, 267-284, doi:10.1016/j.cell.2009.09.028 (2009). [0330] 3. Sharma, N. et al. The emergence of transcriptional identity in somatosensory neurons. Nature 577, 392-398, doi:10.1038/s41586-019-1900-1 (2020). [0331] 4. Luscher, C. & Slesinger, P. A. Emerging roles for G protein-gated inwardly rectifying potassium (GIRK) channels in health and disease. Nat Rev Neurosci 11, 301-315, doi:10.1038/nrn2834 (2010). [0332] 5. Vardy, E. et al. A New DREADD Facilitates the Multiplexed Chemogenetic Interrogation of Behavior. Neuron 86, 936-946, doi:10.1016/j.neuron.2015.03.065 (2015). [0333] 6. Armbruster, B. N., Li, X., Pausch, M. H., Herlitze, S. & Roth, B. L. Evolving the lock to fit the key to create a family of G protein-coupled receptors potently activated by an inert ligand. Proc Natl Acad Sci USA 104, 5163-5168, doi:10.1073/pnas.0700293104 (2007). [0334] 7. Yudin, Y. & Rohacs, T. Inhibitory Gi/O-coupled receptors in somatosensory neurons: Potential therapeutic targets for novel analgesics. Mol Pain 14, 1744806918763646, doi:10.1177/1744806918763646 (2018). [0335] 8. Ray, P. et al. Comparative transcriptome profiling of the human and mouse dorsal root ganglia: an RNA-seq-based resource for pain and sensory neuroscience research. Pain 159, 1325-1345, doi:10.1097/j.pain.0000000000001217 (2018). [0336] 9. Zeisel, A. et al. Molecular Architecture of the Mouse Nervous System. Cell 174, 999-1014 e1022, doi:10.1016/j.cell.2018.06.021 (2018). [0337] 10. Cao, J. et al. The single-cell transcriptional landscape of mammalian organogenesis. Nature 566, 496-502, doi:10.1038/s41586-019-0969-x (2019). [0338] 11. Urban, D. J. & Roth, B. L. DREADDs (designer receptors exclusively activated by designer drugs): chemogenetic tools with therapeutic utility. Annu Rev Pharmacol Toxicol 55, 399-417, doi:10.1146/annurev-pharmtox-010814-124803 (2015). [0339] 12. Manglik, A. et al. Structure-based discovery of opioid analgesics with reduced side effects. Nature 537, 185-190, doi:10.1038/nature19112 (2016). [0340] 13. Decosterd, I. & Woolf, C. J. Spared nerve injury: an animal model of persistent peripheral neuropathic pain. Pain 87, 149-158, doi:10.1016/s0304-3959(00)00276-1 (2000). [0341] 14. Klein, M. T., Dukat, M., Glennon, R. A. & Teitler, M. Toward selective drug development for the human 5-hydroxytryptamine 1E receptor: a comparison of 5-hydroxytryptamine 1E and 1F receptor structure-affinity relationships. J Pharmacol Exp Ther 337, 860-867, doi:10.1124/jpet.111.179606 (2011). [0342] 15. Wainscott, D. B. et al. [3H]LY334370, a novel radioligand for the 5-HT1F receptor. I. In vitro characterization of binding properties. Naunyn Schmiedebergs Arch Pharmacol 371, 169-177, doi:10.1007/s00210-005-1035-9 (2005). [0343] 16. Shields, S. D., Eckert, W. A., 3rd & Basbaum, A. I. Spared nerve injury model of neuropathic pain in the mouse: a behavioral and anatomic analysis. J Pain 4, 465-470, doi:10.1067/s1526-5900(03)00781-8 (2003). [0344] 17. Leiter, E. H. Multiple low-dose streptozotocin-induced hyperglycemia and insulitis in C57BL mice: influence of inbred background, sex, and thymus. Proc Natl Acad Sci USA 79, 630-634, doi:10.1073/pnas.79.2.630 (1982).
Example 3
[0345] This example references
Descriptive Summary from Human Gene Database of the Identified Genes with One Nodal Involvement
[0346] Somatostatin node-Npy2r (Neuropeptide Y (NPY) receptors) are a family of Gi/o-protein-coupled receptors that are currently divided into four subtypes: Y1, Y2, Y4 and Y5. NPY receptors mediate a diverse range of biological actions including stimulation of food intake and modulation of circadian rhythm.
[0347] CGRP-θ node-Mrgpra3 (Mas-related G-protein coupled receptor member A3): Orphan receptor. May be a receptor for RFamide-family neuropeptides such as NPFF and NPAF, which are analgesic in vivo. May regulate nociceptor function and/or development, including the sensation or modulation of pain (By similarity). Activated by the antimalarial drug chloroquine. Mediates chloroquine-induced itch, in a histamine-independent manner.
[0348] Mrgprg+ve node-Mrgprd (MAS Related GPR Family Member D): May regulate nociceptor function and/or development, including the sensation or modulation of pain. Functions as a specific membrane receptor for beta-alanine. Beta-alanine at micromolar doses specifically evoked Ca(2+) influx in cells expressing the receptor. Beta-alanine decreases forskolin-stimulated cAMP production in cells expressing the receptor, suggesting that the receptor couples with G-protein G(q) and G(i).
[0349] CGRP-η node-Gpr174 (G Protein-Coupled Receptor 174): This family member is classified as an orphan receptor because the cognate ligand has not been identified. This gene encodes a protein belonging to the G protein-coupled receptor superfamily.
[0350] CGRP-ε node-Grm3 &Cold thermo node-Grm 5 (Glutamate Metabotropic Receptor 3/5): The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Potentially Gi coupled.
[0351] CGRP-α node-Htr5a (5-Hydroxytryptamine Receptor 5): The neurotransmitter serotonin (5-hydroxytryptamine, 5-HT) has been implicated in a wide range of psychiatric conditions and also has vasoconstrictive and vasodilatory effects. The gene described in this record is a member of 5-hydroxytryptamine (serotonin) receptor family and encodes a multi-pass membrane protein that functions as a receptor for 5-hydroxytryptamine and couples to G-proteins. This protein has been shown to function in part through the regulation of intracellular Ca2+ mobilization. Potentially Gs coupled.
Descriptive Summary from Human Gene Database of the Identified Genes with Two Nodal Involvement
[0352] CGRP-ε & CGRP-α node-Npy1r (Neuropeptide Y Receptor Y1): This gene belongs to the G-protein-coupled receptor superfamily. The encoded transmembrane protein mediates the function of neuropeptide Y (NPY), a neurotransmitter, and peptide YY (PYY), a gastrointestinal hormone. The encoded receptor undergoes fast agonist-induced internalization through clathrin-coated pits and is subsequently recycled back to the cell membrane. Activation of Y1 receptors may result in mobilization of intracellular calcium and inhibition of adenylate cyclase activity. Potentially Gi coupled.
[0353] CGRP-α & Cold thermo-Ntsr2 (Neurotensin Receptor 2): belongs to the G protein-coupled receptor family that activate a phosphatidylinositol-calcium second messenger system. Binding and pharmacological studies demonstrate that this receptor binds neurotensin as well as several other ligands already described for neurotensin NT1 receptor. However, unlike NT1 receptor, this gene recognizes, with high affinity, levocabastine, a histamine H1 receptor antagonist previously shown to compete with neurotensin for low-affinity binding sites in brain. These activities suggest that this receptor may be of physiological importance and that a natural agonist for the receptor may exist.
[0354] Somatostatin & CGRP-ε node-Htr1a (5-Hydroxytryptamine Receptor 1A): This gene encodes a G protein-coupled receptor for 5-hydroxytryptamine (serotonin), and belongs to the 5-hydroxytryptamine receptor subfamily. Inactivation of this gene in mice results in behavior consistent with an increased anxiety and stress response. Mutation in the promoter of this gene has been associated with menstrual cycle-dependent periodic fevers. Also functions as a receptor for various drugs and psychoactive substances. Ligand binding causes a conformation change that triggers signaling via guanine nucleotide-binding proteins (G proteins) and modulates the activity of down-stream effectors, such as adenylate cyclase. Beta-arrestin family members inhibit signaling via G proteins and mediate activation of alternative signaling pathways. Signaling inhibits adenylate cyclase activity and activates a phosphatidylinositol-calcium second messenger system that regulates the release of Ca(2±) ions from intracellular stores. Plays a role in the regulation of 5-hydroxytryptamine release and in the regulation of dopamine and 5-hydroxytryptamine metabolism. Potentially Gi coupled
EQUIVALENTS AND SCOPE
[0355] In the articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Embodiments or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.
[0356] Furthermore, the disclosure encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claims that is dependent on the same base claim. Where elements are presented as lists, e.g., in Markush group format, each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements and/or features, certain embodiments of the disclosure or aspects of the disclosure consist, or consist essentially of, such elements and/or features. For purposes of simplicity, those embodiments have not been specifically set forth in haec verba herein. It is also noted that the terms “comprising” and “containing” are intended to be open and permits the inclusion of additional elements or steps. Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or sub-range within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
[0357] This application refers to various issued patents, published patent applications, journal articles, and other publications, all of which are incorporated herein by reference. If there is a conflict between any of the incorporated references and the instant specification, the specification shall control. In addition, any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the embodiments. Because such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the invention can be excluded from any embodiment, for any reason, whether or not related to the existence of prior art.
[0358] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. The scope of the present embodiments described herein is not intended to be limited to the above Description, but rather is as set forth in the appended embodiments. Those of ordinary skill in the art will appreciate that various changes and modifications to this description may be made without departing from the spirit or scope of the present invention, as defined in the following embodiments.