GENERATION OF HOXA-EXPRESSING HEMOGENIC ENDOTHELIUM WITH ENHANCED T CELL POTENTIAL FROM HPSCS
20210355441 · 2021-11-18
Inventors
Cpc classification
C12N2501/125
CHEMISTRY; METALLURGY
C12N2501/165
CHEMISTRY; METALLURGY
C12N2502/1358
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C12N5/0647
CHEMISTRY; METALLURGY
C12N2501/16
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
C12N2501/155
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides methods of creating a population of hemogenic endothelial cells with arterial specification and enhanced T cell potential. The methods involve inducing the expression of a SOX17 transgene in human pluripotent stem cells starting at day 2 of differentiation. Stem cells that express the SOX17 transgene are also provided.
Claims
1. A method of enhancing HOXA gene expression and arterial specification of hemogenic endothelium in differentiating human pluripotent stem cells (hPSCs), the method comprising: (a) introducing an inducible SOX17 transgene into a population of hPSCs; (b) culturing the hPSCs for at least two days under conditions to differentiate the hPSC into KDR.sup.+ mesoderm cells; and (c) inducing expression of the SOX17 transgene in the KDR.sup.+ mesoderm cells and culturing for at least two days, such that DLL4.sup.+CXCR4.sup.+ arterial hemogenic endothelium (AHE) cells are obtained.
2. The method of claim 1, wherein the population of hPSCs expresses the SOX17 transgene for two to four days.
3. The method of claim 1, wherein step (a) comprises transducing the hPSCs with a vector comprising the SOX17 transgene.
4. The method of claim 3, wherein the vector comprises an inducible promoter operably linked to the SOX17 transgene.
5. The method of claim 4, wherein the vector comprises SEQ ID NO:1.
6. The method of claim 1, wherein the SOX17 transgene comprises SEQ ID NO:58.
7. The method of claim 1, wherein the AHE cells express one or more arterial markers selected from the group consisting of EFNB2, DLL4, NOTCH4, CXCR4, and HEY1.
8. The method of claim 1, wherein the AHE cells express one or more HOXA genes selected from the group consisting of HOXA5, HOXA7, HOXA9, HOXA10, and HOX11.
9. The method of claim 1, wherein the AHE cells express CDX2.
10. The method of claim 1, wherein the hPSCs are embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs).
11. The method claim 1, wherein the cells are further differentiated into a myeloid cell line or lymphoid cell line.
12. The method of claim 11, wherein the method further comprises: (d) culturing the hematopoietic progenitors produced in SOX17 overexpression cultures in the presence of cells overexpressing DLL4 in media comprising SCF, FLT3L and IL-7 for at least two weeks to produce CD4+CD8+ T cells.
13. The method of claim 11, wherein the method further comprises: (d) inducing expression of the SOX17 transgene in the mesodermal cells of step (c) such that DLL4.sup.+CXCR4.sup.+ arterial hemogenic endothelium (AHE) cells are obtained; (e) culturing AHE in the presence of cells overexpressing DLL4 for a sufficient time to differentiate to floating hematopoietic progenitors, and (f) collecting the floating hematopoietic progenitor cells and culturing in the presence of DLL4 in media comprising SCF, FLT3L and IL-7 for at least two weeks to produce CD4+CD8+ T cells.
14. A cell population produced by the method of claim 1.
15. The cell population of claim 14, wherein the cell population is at least 90% DLL4.sup.+CXCR4.sup.+ AHE cells.
16. An hPSC population that comprises a SOX17 transgene and is capable of differentiating into DLL4.sup.+CXCR4.sup.+ AHE cells.
17. The hPSC population of claim 16, wherein the cells comprise a vector comprising the SOX17 transgene.
18. The hPSC population of claim 17, wherein the vector comprises an inducible promoter operably linked to the SOX17 transgene.
19. The hPSC population of claim 18, wherein the vector comprises SEQ ID NO:1.
20. The hPSC population of any one of claim 16, wherein the SOX17 transgene comprises SEQ ID NO:58.
21. An isolated in vitro population of DLL4.sup.+CXCR4.sup.+ AHE cells differentiated from an hPSC population comprising a SOX17 transgene.
22. An isolated in vitro T cell population differentiated from the AHE cells of claim 21.
23. The isolated in vitro T cell population of claim 22, wherein the T cell population comprises more than 90% CD4.sup.+CD8.sup.+ T cells.
24. The isolated in vitro T cell population of claim 22, wherein the T cells are engineered to express an exogenous chimeric antigen receptor (CAR).
25. A method of expansion of hematopoietic progenitors comprising a) generating hemogenic endothelium (HE) cells in presence of SOX17 upregulation b) culturing the HE cells on OP9 or OP9-DLL4 cells in medium comprising FLT3L, TPO SCF, IL6, and IL3 for at least an additional 5 days; c) collecting the floating hematopoietic progenitor cells (HP); and d) culturing the HPs of step c in medium comprising FLT3L, TPO SCF, IL6, and IL3 for at least an additional 5 days to expand HPs with myeloid and lymphoid potential.
26. The method of claim 25, further comprising: (e) passaging the cells of step (d) for at least two weeks in medium comprising SCF, FLT3L and IL-7 for at least two weeks to produce CD4+CD8+ T cells.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
DETAILED DESCRIPTION
[0025] The generation of functional hematopoietic stem cell (HSC)-like cells from pluripotent stem cells (PSCs) has been a long-sought goal in hematology research. Previous efforts to generate cells with myeloid and T cell hematopoietic potential from human pluripotent stem cells (hPSCs) have produced few, if any, cells capable of engrafting in irradiated mice.
[0026] Recent advances in understanding the major bottlenecks in the derivation of engraftable hematopoietic cells and definitive lympho-myeloid progenitors from PSCs have identified deficiencies in NOTCH and HOXA signaling as major contributing factors to the observed functional deficiencies. However, the hierarchy of molecular events that are critical to establishing these programs is still poorly understood. In the present application, the inventors identified the transcription factor SOX17 as a critical upstream activator of these pathways. As is described in the Examples, the inventors generated SOX17-knockout and SOX17-inducible human hPSCs, and using cell biology and molecular profiling, they show that SOX17 activates HOXA and arterial programs in hemogenic endothelium (HE) and establishes definitive lympho-myeloid hematopoiesis. The inventors further show that SOX17 produces these effects through activation of NOTCH and CDX2 signaling.
[0027] Based on these findings, the inventors have devised a novel strategy for producing superior HE that expresses HOXA cluster genes and has enhanced T lymphoid potential. Importantly, these methods enable enhanced T cell production, which could facilitate the development of off-the-shelf immunotherapies derived from hPSCs.
Methods:
[0028] The present invention provides methods of enhancing arterial specification of hemogenic endothelium in differentiating human pluripotent stem cells (hPSCs). The methods involve (a) introducing an inducible SOX17 transgene into a population of hPSCs; (b) culturing the hPSCs for at least two days under conditions to differentiate the hPSC into mesoderm cells; and (c) inducing expression of the SOX17 transgene in the mesoderm cells on at least about day two of differentiation, such that DLL4.sup.+CXCR4.sup.+ arterial hemogenic endothelium (AHE) cells are obtained.
[0029] As is described in the Examples, the inventors discovered that they could promote the arterial program and HOXA gene expression in hemogenic endothelium derived from hPSCs in vitro by overexpressing SOX17 at a specific time (i.e., starting at day 2) and for a defined period (i.e., 2-4 days) during differentiation. SOX17 is a member of the Sry-related high mobility group domain (SOX) family of transcription factors, and is key developmental regulator of endothelial and hematopoietic lineages. In the methods of the present invention, differentiating hPSCs are forced to overexpress SOX17 during the mesoderm differentiation by introducing an inducible SOX17 transgene into the population of mesodermal cells to facilitate formation of AHE with robust lymphomyeloid potential. In addition, inventors discovered that an SOX17 expands in suspension cultures lymphomyeloid progenitors generated from hemogenic endothelium. This method provided increased amounts of progenitors which could differentiate into lymphoid cells.
[0030] The SOX17 transgene used with the present invention may comprise any nucleic acid sequence encoding the SOX17 protein. For Example, the SOX17 transgene may be obtained by amplifying the SOX17 gene sequence from the genomic locus in human cells or by amplifying SOX17 mRNA from hPSCs differentiated into endothelial and blood cells and converting it into cDNA. Alternatively, genomic DNA or cDNA clones can be obtained commercially (e.g., from Sino Biological, Origene, IDT, etc.). In some embodiments, the transgene comprises SEQ ID NO:58, a cDNA sequence encoding the human SOX17 protein.
[0031] In some embodiments, the SOX17 transgene further comprises a vector sequence that can be used to drive the expression of the SOX17 transgene within the cells. In these embodiments, the transgene is introduced by into the population of hPSCs by transducing the cells with said vector. As used herein, the term “vector” refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes the vector as a self-replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as “expression vectors”. Vectors suitable for use with the present invention comprise a nucleotide sequence encoding a SOX17 transgene and a heterogeneous sequence necessary for proper propagation of the vector and expression of the encoded polypeptide. The heterogeneous sequence (i.e., sequence from a different species than the transgene) can comprise a heterologous promoter or heterologous transcriptional regulatory region that allows for expression of the polypeptide. Suitable vectors for the expression of the SOX17 transgene include plasmids and viral vectors. In a preferred embodiment, the vector comprises heterologous sequence that allows the transient and/or inducible expression of the encoded SOX17 protein.
[0032] In some embodiments, the vector includes a transposase system, such as the PiggyBac transposon system (see Examples). The PiggyBac transposon is a TTAA-specific mobile genetic element that efficiently transposes between vectors and chromosomes via a “cut and paste” mechanism. PiggyBac transposase recognizes transposon-specific inverted terminal repeat sequences (ITRs) and moves the intervening contents to a TTAA insertion site in a chromosome or another vector. Thus, inserting a gene of interest between two ITRs in a transposon vector allows one to efficiently insert the gene into a target genome. Other suitable transposase systems for use with the present invention include, for example, Sleeping Beauty.
[0033] In other embodiments, the vector is a plasmid, a viral vector, a cosmids, or an artificial chromosome. Suitable plasmids include, for example, E. coli cloning vectors. Many suitable viral vectors are known in the art and include, but are not limited to, an adenovirus vector; an adeno-associated virus vector; a pox virus vector, such as a fowlpox virus vector; an alpha virus vector; a baculoviral vector; a herpes virus vector; a retrovirus vector, such as a lentivirus vector; a Modified Vaccinia virus Ankara vector; a Ross River virus vector; a Sindbis virus vector; a Semliki Forest virus vector; and a Venezuelan Equine Encephalitis virus vector. In one particular embodiment, the vector comprises SEQ ID NO:1.
[0034] In some embodiments, the vector is an expression vector that comprises a promoter that drives the expression of the SOX17 transgene, preferably transient or inducible expression of the SOX17 transgene. As used herein, the term “promoter” refers to a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a coding sequence. Although promoters are most commonly found immediately upstream of a coding sequence, they may also be found downstream of or within the coding sequence. Promoters may be derived in their entirety from a native gene or may be composed of multiple elements, including elements derived from promoters found in nature or elements comprising synthetic DNA sequences. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, at different stages of development, or in response to different environmental conditions. Preferably, the promoters used with the present invention are inducible promoters. An “inducible promoter” is a promoter that is activated (i.e., initiates transcription) only in the presence of a particular molecule. Inducible promoters allow tight control the expression of a transgene within cells. Many suitable inducible expression systems are known in the art and include, for example, Tet-On gene expression systems that allow one to induce the expression of a gene by administering tetracycline (Tc) or tetracycline-derivatives like doxycycline (DOX). Suitable Tet-On systems for use with the present invention include, without limitation, Tet-On Advanced and Tet-On 3G. Tet-On systems utilize several promoters, including both minimal promoters (e.g., CMV) flanked by a tetracycline response element (TRE) and engineered Tet-inducible promoters (e.g., TRE2 and TREtight). For instance, in the Examples, the SOX17 transgene is inserted (i.e., via conventional cloning methods) downstream of the doxycycline-inducible TREtight promoter within a vector. This vector was introduced into the hPSCs, allowing the inventors to induce expression of the SOX17 transgene at the desired stage of differentiation by adding doxycycline to the cell culture to activate expression from the TREtight promoter. Those of skill in the art are aware of many additional inducible gene expression systems, including both chemical-inducible and temperature-inducible systems. Other suitable inducible gene expression systems for use with the present invention include, without limitation, the glucocorticoid-responsive mouse mammary tumor virus promoter (MMTVprom), the tamoxifen-responsive hormone-binding domain of the estrogen receptor (ER.sup.TAM), the ecdysone-inducible promoter (EcP), heat shock inducible promoters (e.g., Hsp70 or Hsp90-derived promoters), and the T7 promoter/T7 RNA polymerase system (T7P). The SOX17 transgene may be introduced into the hPSCs using any suitable method, for example by transfection or transduction. In one embodiment, the transgene is introduced by transducing the hPSCs with a vector comprising the SOX17 transgene. In another embodiment, the hPSCs are transduced with an exogenous SOX17 mRNA. In yet another embodiment, the hPSCs are transduced with the SOX17 protein.
[0035] In the present methods, the hPSCs are cultured under conditions for at least two days to differentiate these cells into mesoderm cells. Notably, mesoderm cells can be identified by their KDR.sup.+ phenotype. Methods of differentiating hPSCs into progenitor mesoderm cells are known in the art. In one embodiment, mesoderm cells are obtained by culturing hPSCs in a chemically defined culture medium for about 2 days to about 4 days, whereby a cell population comprising mesoderm cells is obtained. For example, the hPSCs may be cultured in xenogen-free, serum-albumin free chemically defined medium comprising BMP4, activin A, LiCl, and FGF2, as described in Uenishi et al. (Stem cell reports (2014): 1073-1084) and U.S. Pat. No. 9,938,499, which is incorporated by reference in its entirety. For example, the chemically defined medium comprises about 10 ng/ml to about 50 ng/ml FGF2, about 50 ng/ml to about 250 mg/ml of BMP4 (e.g., 50 ng/ml to about 500 ng/ml BMP4), about 10 ng/ml to about 15 ng/ml Activin A, and about 1 to 2 mM LiCl under hypoxic conditions. In other embodiments, the cells are attached to a culture plate via extracellular matrix proteins. For example, in one embodiment, the cells are attached via collagena, fibronectin, matrigel™ or Tenascin C (TenC). In a preferred embodiment, the cells are cultured on plates coated with Collagen IV, as described in Uenishi et al. and U.S. Pat. No. 9,938.499.
[0036] The term “defined culture medium” is used herein to indicate that the identity and quantity of each medium ingredient is known. As used herein, the terms “chemically-defined culture conditions,” “fully defined, growth factor free culture conditions,” and “fully-defined conditions” indicate that the identity and quantity of each medium ingredient is known and the identity and quantity of supportive surface is known. As used herein the term “xenogen-free” refers to medium that does not contain any products obtained from a non-human animal source. As used herein, the term “serum albumin-free” indicates that the culture medium used contains no added serum albumin in any form, including without limitation bovine serum albumin (BSA) or any form of recombinant albumin. Standardizing culture conditions by using a chemically defined culture medium minimizes the potential for lot-to-lot or batch-to-batch variations in materials to which the cells are exposed during cell culture. Accordingly, the effects of various differentiation factors are more predictable when added to cells and tissues cultured under chemically defined conditions. As used herein, the term “serum-free” refers to cell culture materials that do not contain serum or serum replacement, or that contain essentially no serum or serum replacement. For example, an essentially serum-free medium can contain less than about 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1% serum. “Serum free” also refers to culture components free of serum obtained from animal blood and of animal-derived materials, which reduces or eliminates the potential for cross-species viral or prion transmission. Further, serum-containing medium is not chemically defined, producing a degree of variability in the culture conditions. Suitable defined media include, but are not limited to, E8 medium.
[0037] Expression of the SOX17 transgene may be induced using any suitable methods known in the art. For example, in embodiments in which the transgene is introduced as a vector comprising an inducible promoter operably linked to the SOX17 transgene, transgene expression can be induced by contacting the cells with the signaling molecule required for activation of the chosen promoter. In embodiments in which the transgene is introduced as SOX17 mRNA or protein, induction is accomplished by transducing with cells with the mRNA or protein at the appropriate stage of hPSC differentiation.
[0038] In a preferred embodiment, expression of the SOX17 transgene is induced at about day 2 of hPSC differentiation, i.e., in the mesoderm stage of development. In embodiments in which the transgene is provided as a vector, induction may involve treating the cells with the signaling molecule required to activate an inducible promoter (e.g., DOX). Alternatively, one can induce SOX17 expression by transfecting the hPSCs with mRNA encoding SOX17 or with the SOX17 protein at about day 2 of differentiation. The inventors discovered that inducing SOX17 expression for two to four days (i.e., from day 2 to day 4-6 of differentiation) generated the greatest number of CD43.sup.+/CD45.sup.+ cells (
[0039] In another embodiment, SOX17 was upregulated in CD43.sup.+ hematopoietic progenitors generated from hemogenic endothelium on day 9 of hematopoietic differentiation to further expand lymphomyeloid progenitors. This additional SOX17 upregulation resulted in an greater expansion of lymphomyeloid progenitors when compared to the method without such upregulation.
[0040] The human pluripotent stem cells (hPSCs) used with the present methods may be embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs). Many stem cells lines are commercially available. For example, the inventors utilized a H9 hESC (WA09) line from WiCell.
[0041] The goal of the present invention is to produce a population of arterial type hemogenic endothelial cells (AHEs) with broad lymphoid potential that are able to give rise to engraftable hematopoietic cells. These superior AHE cells can be identified as having the DLL4.sup.+CXCR4.sup.+ phenotype. CXCR4 is a HSC homing receptor that is not present in hematopoietic progenitors produced by traditional hESC differentiation methods, and DLL4 (Delta Like Canonical Notch Ligand 4) is a NOTCH-signaling ligand expressed by HE in vivo. In the Examples, the inventors show that by inducing SOX17 expression in differentiating hPSCs they produce a greater number of AHE cells with these desirable characteristics. Specifically, they found that SOX17 expression increases the production of AHE cells by about 50%.
[0042] As is demonstrated in the Examples, inducing the expression of SOX17 causes upregulation of genes encoding HOXA family members and arterial markers, which facilitates arterial specification of HE from mesoderm cells. In the present methods, hPSCs are cultured under conditions to differentiate the hPSC into mesoderm cells for about 4 days, and 24 hours later (on day 5) the HE begin to specify into DLL4.sup.+CXCR4.sup.+/− arterial HE and non-arterial DLL4.sup.− CXCR4.sup.− HE. Enhanced arterial specification may be detected at day 4 and 5 as (1) an increase in the percentage of VEC.sup.+CD73.sup.−CD43.sup.− HE cells generated, (2) an increase in the percentage of cells expressing DLL4 and CXCR4, which express increased levels of arterial marker genes (EFNB2, NOTCH4, HEY1, CXCR4, DLL4) and produce higher numbers of blood cells with colony forming cell (CFC) potential and/or T cell potential, as compared to the cells generated when SOX17 expression is not induced.
[0043] The inventors discovered that SOX17 expression enhances arterial specification via activation of several signaling pathways, including the Notch signaling pathways. Additionally, the inventors demonstrated that SOX17 is essential for the expression of HOXA genes in AHE. Thus, in some embodiments, the AHE cells produced by the methods disclosed herein express one or more HOXA genes selected from the group consisting of HOXA5, HOXA7, HOXA9, HOXA10, and HOX11. HOX genes have been implicated in hematopoiesis across species. For example, HOXA9 is the key homeotic gene that defines HSC identity, supporting HSC renewal during embryogenesis and stress hematopoiesis. HOXA5, HOXA9, and HOXA10 are transcriptional targets of Notch signaling in T cell progenitors, suggesting a role for these protein in T-lymphopoiesis. While SOX17 expression was previously known to be correlated with HOXA expression, it was not known to be causative. Thus, the inventors' discovery that SOX17 activates HOXA expression represents a significant advance in understanding the mechanisms of hematopoietic specification.
[0044] Further, the inventors have determined that SOX17 activates HOXA expression by binding to the promoter of CDX2 (a master regulator of HOX gene expression) and upregulating its expression. Thus, in some embodiments, the AHE cells produced by the methods disclosed herein express CDX2.
[0045] The AHE cells produced by the methods of the present invention have definitive lympho-myeloid potential and are, thus, useful for the production of myeloid and lymphoid progenitor cells. Those of skill in the art may consult a standard cell differentiation protocol (e.g., Stem cell reports (2014): 1073-1084; Nature protocols (2011): 296-313; Stem cells and development (2011): 1639-1647; and Blood (2005): 617-626) to obtain cell populations of the desired hematopoietic cell type. For example, the AHE of the present invention may be further differentiated into T cells, beta-hemoglobin-producing red blood cells, megakaryocytic cells, and multipotential myeloid progenitors, including granulocyte, erythrocyte, megakaryocyte, macrophage (GEMM) and granulocyte-macrophage (GM) colony forming cells (CFCs), and mature myelomonocytic cells. In some embodiments of the present methods, the cells are further differentiated into lymphoid cell lines.
[0046] In the Examples, the inventors demonstrate that DLL4.sup.+CXCR4.sup.+ AHE cells produced by the present methods have increased T cell potential, i.e., they give rise to an increased number of T cells. Specifically, in DOX-treated conditions, DLL4.sup.+CXCR4.sup.+ AHE cells generate 54-fold more CD4.sup.+CD8.sup.+ T cells as compared to DLL4.sup.−CXCR4.sup.− HE cells. Scalable T cell production is essential to advance iPSC-based immunotherapies into the clinic. Thus, in preferred embodiments, the cells are further differentiated into T cells. T cells may be differentiated using known methods, including the method disclosed in the Examples (see the Materials and Methods section titled “T cell differentiation”). The T cells can be identified as CD4+CD8+. In some embodiments, the T cells are identified as CD7+CD5+, CD8+CD4+, or a combination thereof (CD7+CD5+ and CD8+/CD4+).
[0047] Suitably, in one embodiment, the day 4 HE or day 5 AHE cells were cultured on OP9-DLL4 in presence of TPO (about 20-70 ng/ml, e.g., 50 ng/ml), SCF (about 20-70 ng/ml, e.g., 50 ng/ml), IL-6 (about 10-40 ng/ml, e.g., 20 ng/ml), IL-3 (about 5-30 ng/ml, e.g. 10 ng/ml) and FLT3L (3-20 ng/ml, e.g., 10 ng/ml) for about 4-5 days to produce hematopoietic progenitors enriched in T cell potential which were differentiated into T cells by culturing in the presence of delta-like ligand 4, e.g., cells overexpressing DLL4 (DLL4-expressing cells, e.g., OP9-DLL4 cells) for a sufficient time to produce T cells (e.g., at least 2 weeks, preferably at least three weeks or more). The media further comprise about 5-20 ng/ml SCF, about 3-20 ng/ml FLT3L and about 3-20 ng/ml IL-7 to augment T cell production. For example, in one embodiment, the AHE cells are passaged weekly onto fresh OP9-DLL4 cells in media comprising about 10 ng/ml SCF, about 5 ng/ml FLT3L and about 5 ng/ml IL-7 for about 3 weeks. Cells can be analyzed by flow cytometry for T cell surface markers.
[0048] In another embodiment, the hematopoietic progenitors obtained from AHE cells are cultured in media comprising 5-50 ng/ml SCF, about 3-20 ng/ml FLT3L and about 3-20 ng/ml IL7 in the presence of DLL4-Fc (commercially available), DLL4-Fc ligands or on DLL4-OP9 cells for a sufficient time to differentiate into T cells.
[0049] It was also surprisingly found that expansion of hemogenic progenitors (HP) which are subject to a second increased expression of SOX17 at day 4+5 through day 4+5+5 led to an increased expansion of myeloid and T lymphoid progenitors, as demonstrated in
[0050] Thus, in another embodiment, CD43+ hematopoietic progenitors generated from day 4 hemogenic endothelium in coculture with OP9 or OP9-DLL4 in medium comprising 20-70 ug/ml TPO and SCF (e.g., 50 ug/ml), 10-30 ng/ml IL6 (e.g., 20 ng/ml), and 5-25 ng/ml IL3 and FLT3L (e.g., 10 ng/ml) for 5 days, were collected and cultured in low attachment plate with IF9S media with 50-150 ng/ml FLT3L (e.g. 100 ng/ml) FLT3L, TPO and SCF, and about 10-40 ng/ml (e.g., 20 ng/ml) IL6, 3-20 ng/ml, e.g. 10 ng/ml IL3, with 2 μM Doxycyclin to induce expression of SOX17. As demonstrated in
[0051] T cells produced by the methods disclosed herein may be used for the production of various therapeutics, including chimeric antigen receptors (CAR) T cells. CAR T cells are T cells that have been genetically engineered to produce an artificial T cell receptor (i.e., a CAR) that allows them to target a specific protein of choice. CARs comprise an antigen-specific recognition domain that binds to specific target antigen or cell and a transmembrane domain linking the extracellular domain to an intracellular signaling domain. CAR T cells are commonly designed to recognize cancer cells (e.g., via recognition of an antigen that is present on the tumor surface) for use in cancer immunotherapies. Thus, in one embodiment, the methods of the present invention further comprise using the AHE to generate CAR expressing T cells that can be used to kill tumor cells. Methods of designing and producing CART cells are known in the art.
Compositions:
[0052] The present invention also encompasses cell populations produced by the methods disclosed herein. In some embodiments, the AHE cells are sorted from the cell culture, e.g., based on expression of DLL4 and CXCR4. The resulting hemogenic cell population will contain a SOX17 transgene, and may be at least 90%, 95% or 99% pure.
[0053] In another aspect, the present invention provides hPSC populations that comprise a SOX17 transgene and are capable of differentiating into DLL4.sup.+CXCR4.sup.+ arterial hemogenic endothelium (AHE) cells. In some embodiments, the hPSC cells comprise a vector comprising the SOX17 transgene. In some embodiments, said vector comprises an inducible promoter operably linked to the SOX17 transgene (e.g., the vector of SEQ ID NO:1 or a vector comprising SEQ ID NO:58), allowing for induction of SOX17 expression within the cells. Suitable vectors are discussed in the previous section.
[0054] Additionally, the present invention provides isolated in vitro populations of DLL4.sup.+CXCR4.sup.+ arterial hemogenic endothelium (AHE) cells differentiated from an hPSC population comprising a SOX17 transgene. As used herein, the phrase “isolated in vitro population” refers to a population of cells that is grown outside of a living organism (e.g., in a test tube, flask, or culture dish) under defined conditions.
[0055] These DLL4.sup.+CXCR4.sup.+ AHE cells may be further differentiated into T cells, forming an isolated in vitro T cell population. T cell differentiation may be accomplished using known methods, as discussed above. In some embodiments, the T cell population comprises more than 90% CD4.sup.+CD8.sup.+ T cells, alternatively at least 95% CD4.sup.+CD8.sup.+ T cells.
[0056] In some embodiments, the AHE derived herein can produce hematopoietic progenitors (HP) with a high T cells potential. As used herein, the phrase “hematopoietic progenitors with high T cell potential” refers to a population of HE cells that is able to differentiate into T cells at least 10 fold more efficiently.
[0057] Further, in some embodiments, the present invention provides hematopoietic progenitors (HP) derived from the AHE that have high myeloid and T cell potential, as demonstrated in Example 2. These cells are differentiated by a method comprising at least two induction of SOX17 expression, leading to a more robust production of cells with myeloid and T cell potential as compared to without SOX17 expression.
[0058] As is discussed in the previous section, T cells are useful for the production of therapeutics, including, for example, chimeric antigen receptors (CAR) T cells. Thus, in some embodiments, the T cells are engineered to express an exogenous chimeric antigen receptor (CAR).
[0059] The following non-limiting examples are included for purposes of illustration only, and are not intended to limit the scope of the range of techniques and protocols in which the compositions and methods of the present invention may find utility, as will be appreciated by one of skill in the art and can be readily implemented. The present invention has been described in terms of one or more preferred embodiments, and it should be appreciated that many equivalents, alternatives, variations, and modifications, aside from those expressly stated, are possible and within the scope of the invention.
EXAMPLES
Example 1
[0060] SOX17 has been implicated in arterial specification and the maintenance of hematopoietic stem cells (HSCs) in the murine embryo. However, knowledge about molecular pathways and stage-specific effects of SOX17 in humans remains limited. Here, using SOX17-knockout and SOX17-inducible human pluripotent stem cells (hPSCs), paired with molecular profiling studies, we reveal that SOX17 is a master regulator of HOXA and arterial programs in hemogenic endothelium (HE), and is required for the specification of HE with robust lympho-myeloid potential and DLL4.sup.+CXCR4.sup.+ phenotype resembling arterial HE at sites of HSC emergence. Along with activation of NOTCH signaling, SOX17 directly activates CDX2 expression leading to the upregulation of the HOXA cluster genes. Since deficiencies in NOTCH signaling and HOXA regulation were identified as major contributing factors to the impaired engraftment potential of hPSC-derived hematopoietic cells, identification of SOX17 as a key regulator linking arterial and HOXA programs in HE may help to program the HSC fate from hPSCs.
Background:
[0061] Sox17 has been found to be expressed in the arterial vasculature (Liao et al., 2009) and the hemogenic endothelium (HE) in aorta-gonad-mesonephros (AGM) region (Clarke et al., 2013; Corada et al., 2013), in which it is required for arterial specification (Corada et al., 2013) and essential for establishing the definitive, but not primitive, hematopoietic program (Clarke et al., 2013) within the murine embryo. Although Sox17 actively prevents endothelial-to-hematopoietic transition (EHT) by repressing Runx1 (Lizama et al., 2015), Sox17 remains critical for maintaining intra-aortic hematopoietic clusters (IAHC) and fetal liver HSCs (Kim et al., 2007; Nobuhisa et al., 2014; Saito et al., 2018). Transduction of human embryonic stem cell (hESC)-derived CD34.sup.+ HE/OP9 cocultures with a tamoxifen-inducible murine Sox17 transgene revealed that tamoxifen treatment expands CD34.sup.+CD43.sup.+CD45.sup.−/low cells co-expressing the endothelial marker VE-cadherin (VEC) (Nakajima-Takagi et al., 2013). Although these expanded cells possessed the capacity to form compact colonies in hematopoietic CFC medium with SCF, TPO and IL3, they were interpreted as HE cells. In mouse studies, the effects of Sox17 were attributed to the activation of the NOTCH signaling pathway by its direct binding to Dll4, Notch1 and Notch4 loci (Clarke et al., 2013; Corada et al., 2013). However, no activation of NOTCH pathway following Sox17 overexpression was observed during hESC differentiation (Nakajima-Takagi et al., 2013). While these studies established an important role of SOX17 in specification of definitive hematopoiesis and its diverse effects on EHT and HSCs, the molecular program induced by SOX17 at distinct stages of hematopoietic development, especially in humans, remains poorly understood.
[0062] To define the mechanisms of SOX17 action during specification and diversification of HE, we established SOX17-knockout and SOX17-inducible hESC lines and assessed their differentiation in a 2D chemically defined, feeder- and xeno-free human pluripotent stem cell (hPSC) differentiation system in which all stages of hematopoietic development are temporally, phenotypically, and functionally defined (Uenishi et al., 2014). In this study we specifically focused on the earliest stages of HE emergence and its arterial specification which have not been previously assessed. We reveal that SOX17 is required for the activation of HOXA expression and establishing arterial-type HE (AHE) with robust lympho-myeloid potential that can be identified by DLL4.sup.+CXCR4.sup.+ phenotype resembling AHE at sites of HSC emergence in vivo. Furthermore, the SOX17 effects are mediated by CDX2. These findings are important for understanding the molecular mechanisms controlling HE and definitive blood lineage development and designing strategies for specifying HSC fate from hPSCs.
Materials and Methods:
Generation Inducible SOX17 H9 ESC Line and SOX17 Knockout H9 ESC Line
[0063] We generated an inducible SOX17 cell line using the PiggyBac system (Park et al., 2018a). Human SOX17 CDS was cloned into PiggyBac transposon vector (Transposagen) downstream of TREtight promoter of pTRE-P2A-Venus-rpEF1a-Zeo plasmid, and cotransfected with pEF1α-M2rtTA-T2A-Puro and transposase plasmid into H9 hESCs using human stem cell nucleofector kit 2 (Lonza). Cells were selected in Zeocin (0.5 μg/ml, Thermofisher) and Puromycin (0.5 μg/ml, Sigma) for 10 days and resistant clones screened for Venus expression following DOX (Sigma) treatment. To generate SOX17.sup.−/− knockout H9 ESC line, two single guide RNAs were designed in CRISPR design tool (Synthego). The two sgRNA sequences are provided as SEQ ID NO:2 and SEQ ID NO:3. H9 ESCs were electroporated with the two sgRNAs and Cas9 protein (PNA Bio), and then plated at a low density on 6 well plate. After 7 days, individual colonies were picked and further expanded. After expansion, individual clones were screened by genomic PCR for the acquisition of 830 bp deletion in wildtype SOX17 allele using primers P1 and P2.
hESC Lines Maintenance and Hematopoietic Differentiation
[0064] hPSCs (H9 hESC (WA09) line from WiCell), iSOX17 H9 line and knockout SOX17 H9 line were maintained and passaged on Matrigel in mTeSR1 media (WiCell). The cell lines were differentiated on collagen IV (ColIV)-coated plate (Uenishi et al., 2014). Cell lines were plated at a density of 5,000 cells/cm.sup.2 onto 6 well plates with E8 media containing 10 μM Rock inhibitor (Y-27632, Cayman Chemicals). The following day, the media was changed to IF9S media with 50 ng/ml FGF2 (PeproTech), 50 ng/ml BMP4 (PeproTech), 15 ng/ml Activin A (PeproTech), and 2 mM LiCl (Sigma), and cultured in hypoxia (5% CO.sub.2, 5% O.sub.2). On day 2, the media was changed to IF9S media with 50 ng/ml FGF2, 50 ng/ml VEGF (PeproTech), and 2.5 μM TGF-β inhibitor (SB-431542, Cayman), and cultured in hypoxia (5% CO.sub.2, 5% O.sub.2). On days 4 and 6, the media was changed to IF9S media with 50 ng/ml FGF2, 50 ng/ml VEGF, 50 ng/ml TPO (PeproTech), 50 ng/ml IL-6 (PeproTech), 20 ng/ml SCF (PeproTech), and 10 ng/ml IL-3 (PeproTech), and cultured in normoxia (20% CO.sub.2, 5% O.sub.2). DOX (Sigma) was added to cultures on day 2 of differentiation at concentration of 2 μg/ml.
Hemangioblast (HB)-CFC and Hematopoietic CFC Assay
[0065] HB-CFCs were detected using a semisolid colony-forming serum-free medium (CF-SFM) containing 40% ES-Cult M3120 methylcellulose (2.5% solution in IMDM, Stem Cell Technologies), 25% StemSpan serum-free expansion medium (SFEM, Stem Cell Technologies), 25% human endothelial serum-free medium (ESFM, ThermoFisher), 10% BIT 9500 supplement (Stem Cell Technologies), GlutaMAX (1/100 dilution, ThermoFisher), Ex-Cyte (1/1000 dilution, Millipore), 100 μM MTG, 50 μg/ml ascorbic acid and 20 ng/ml FGF (Peprotech) (Vodyanik et al., 2010). Hematopoietic CFCs were detected using serum containing H4435 MethoCult with FGF, SCF, IL-3, IL-6 and EPO (Stem Cell Technologies) following plating 1000 CD43.sup.+ cells/dish in duplicates. CFCs numbers recalculated per 10.sup.5 cells.
Isolation and Culture of D4 HE
[0066] Immature/primordial HE cells were isolated from knockout SOX17 or DOX+ and DOX− iSOX17 differentiation cultures by CD31 MACS (Miltenyi Biotec) at D4. Isolated cells were plated on OP9 or OP9-DLL4 in α-MEM (Gibco) with 10% FBS (Hyclone) with TPO, SCF (50 ng/ml), IL-6 (20 ng/ml), IL-3 and FLT3L (10 ng/ml; all from Peprotech). The media was changed 24 hours later, and extra media was added another 2 days later. After 5 days in secondary culture, cells were collected and assessed for CFC and T cell potential.
Isolation and Culture of D5 HE and Limiting Dilution Assay (LDA)
[0067] H9, iSOX17 and SOX17.sup.−/− ESCs were collected on day 5 of differentiation, singularized by 1× TrypLE, and stained for VEC (CD144), CD73, CD43, DLL4, CXCR4 with dead cells excluded using Ghost Dye Violet 540 (Tonbo Biosciences). FMO controls for flow cytometric analysis are shown in
[0068] Expansion of Hematopoietic Progenitors.
[0069] On day 4, HE cells were isolated from DOX+ or DOX− cultures by CD31 MACS. Isolated cells were plated on OP9 or OP9-DLL4 in α-MEM with 10% FBS with 50 ug/ml TPO and SCF, 20 ng/ml IL6, and 10 ng/ml IL3 and FLT3L. The media was changed 24 hours later, and extra media was added another 2 days later. After 5 days in in secondary culture, floating cell were collected and plated lin ow attachment 24 well plate. Cell were cultured with IF9S media with 100 ng/ml FLT3L, TPO and SCF, 20 ng/ml IL6, 10 ng/ml IL3, and with or without 2 μM Doxycyclin, and extra media was added another 2 days later. After 5 days, cells were collected and assessed for CFC and T cell potential.
T Cell Differentiation
[0070] Floating hematopoietic cells were collected from day 9 differentiation cultures or day 5 secondary OP9 or OP9-DLL4 cocultures (D4 HE+5 or D5 HE +5), and were cultured on OP9-DLL4 in α-MEM with 20% FBS, 10 ng/ml SCF, 5 ng/ml FLT3L and IL-7 (PeproTech) on OP9-DLL4 for 3 weeks. Cells were passaged weekly onto fresh OP9-DLL4 cells. Cells were analyzed by flow cytometry for T cell surface markers after 21 days.
DAPT Treatment and CDX2 Knockdown in Differentiation Cultures Using siRNA
[0071] Notch signaling was blocked by DAPT (-secretase inhibitor, 10 μM, Cayman Chemical) added on day 3 of differentiation. For knockdown of CDX2 expression, DOX-treated iSOX17 cells were transfected with 100 nM CDX2 siRNA SMARTpool (Dharmacon) or Scramble negative control siRNA (Dharmacon) on day 3 of differentiation using Lipofectamine RNAiMAX (ThermoFisher). Next day, differentiation media was replaced with fresh media and cells were harvested at day 5 of differentiation.
Apoptosis and Cell Cycle Analysis
[0072] Apoptosis was detected by flow cytometry using Annexin V (BD). For cell-cycle analysis, D5 cells were incubated in culture medium with BrdU (10 μM, BD Pharmingen) for 2 hours and stained with antibodies. For BrdU detection, the BrdU flow kit with 7 AAD was used and performed per the manufacturer's instructions. Fluorescent reagents used for analysis, cell viability, apoptosis, and proliferation are listed in Table 1.
TABLE-US-00001 TABLE 1 Key resource information REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Annexin V-APC BD Biosciences Cat# 550474; RRID: AB_2868885 BrdU BV450 (clone; 3D4) BD Biosciences Cat# 560810; RRID: AB_2033930 CD4 APC (clone: RPA-T4) BD Biosciences Cat# 555349; RRID: AB_398593 CD5 APC (clone: UCHT2) BD Biosciences Cat# 555355; RRID: AB_398594 CD5 APC-Vio770 (clone: REA782) Miltenyi Biotec Cat# 130-111-110; RRID: AB_2658602 CD5 PE-Vio770 (clone: REA782) Miltenyi Biotec Cat# 130-111-109; RRID: AB_2658600 CD7 FITC (clone: M-T701) BD Biosceinces Cat# 555360; RRID: AB_395763 CD7 PE (clone: CD7-6B7) Miltenyi Biotec Cat# 130-123-247; RRID: AB_2802013 CD7 PE-Vio770 (clone: CD7-6B7) Miltenyi Biotec Cat# 130-105-901; RRID: AB_2659106 CD8 PE (clone: HIT8a) BD Biosceinces Cat# 555635; RRID: AB_395997 CD31 MicroBeads Miltenyi Biotec Cat# 130-091-935 CD41a APC (clone: HIP8) BD Biosceinces Cat# 559777; RRID: AB_398671 CD43 BV510 (clone: 1G10) BD Biosceinces Cat# 563377; RRID: AB_2722767 CD43 PE (clone: 1G10) BD Biosceinces Cat# 560199; RRID: AB_1645655 CD43 PE-Vio770 (clone: DF-T1) Miltenyi Biotec Cat# 130-099-763; RRID: AB_2658133 CD43 APC (clone: DF-T1) Miltenyi Biotec Cat# 130-097-367; RRID: AB_2658128 CD43 APC-Vio770 (clone: DF-T1) Miltenyi Biotec Cat# 130-101-174; RRID: AB_2658135 CD45 BV421 (clone: HI30) BD Biosceinces Cat# 563879; RRID: AB_2744402 CD73 APC (clone: AD2) BD Biosceinces Cat# 560847; RRID: AB_10612019 CD73 BV421 (clone: AD2) BD Biosceinces Cat# 562430, RRID: AB_11153119 CD73 PE (clone: AD2) BD Biosceinces Cat# 550257; RRID: AB_393561 CD73 PE-Vio770 (clone: AD2) Miltenyi Biotec Cat# 130-120-795; RRID: AB_2752200 CD144 APC (clone: REA199) Miltenyi Biotec Cat# 130-100-708; RRID: AB_2655155 CD144 BV421 (clone: 55-7H1) BD Biosceinces Cat# 565670; RRID: AB_2744284 CD144 BV605 (clone: 55-7H1) BD Biosceinces Cat# 743705; RRID: AB_2741685 CD144 FITC (clone: REA199) Miltenyi Biotec Cat# 130-100-742; RRID: AB_2655151 CD144 PE (clone: REA199) Miltenyi Biotec Cat# 130-118-495; RRID: AB_2751528 CD144 PE-Vio770 (clone: 12G5) Miltenyi Biotec Cat# 130-100-720; RRID: AB_2655158 CD184 APC (clone: 12G5) BD Biosceinces Cat# 555976; RRID: AB_398616 CD184 APC-Vio770 (clone: Miltenyi Biotec Cat# 130-116-521; RRID: AB_2727587 REA649) CD184 BV421 (clone: 12G5) BD Biosceinces Cat# 562448; RRID: AB_11153865 CD235a APC (clone: GA-R2 BD Biosceinces Cat# 551336; RRID: AB_398499 (HIR2)) CD309 PE (clone: 89106) BD Biosceinces Cat# 560494; RRID: AB_1645503 CD309 PE-Vio770 (clone: Miltenyi Biotec Cat# 130-117-986; RRID: AB_2733181 REA1046) DLL4 APC (clone: MHD4-46) Miltenyi Biotec Cat# 130-096-560; RRID: AB_10827749 DLL4 PE (clone: MHD4-46) Miltenyi Biotec Cat# 130-096-567; RRID: AB_10831209 DLL4 PE-Vio770 (clone: MHD4- Miltenyi Biotec Cat# 130-101-587; RRID: AB_2651569 46) GAPDH Santa Cruz Cat# SC-25778; RRID: AB_10167668 Biotechnology Goat IgG R&D Cat# AB-108-C; RRID: AB_354267 Goat IgG HRP Santa Cruz Cat# SC-2354; RRID: AB_628490 Biotechnology H3K27ac Millipore Sigma Cat# 07-360; RRID: AB_310550 Mouse IgG HRP Santa Cruz Cat# SC-2005; RRID: AB_631736 Biotechnology SOX17 R&D Cat# AF1924; RRID: AB_355060 7AAD BD PharMingen Cat# 559925; RRID: AB_2869266 Chemicals, peptides, And recombinant proteins Recombinant Human/Murine/Rat PeproTech Cat# 120-14E Activin A Recombinant Human BMP4 PeproTech Cat# 120-05ET Recombinant Human FGF-basic PeproTech Cat# 100-18B Recombinant Human VEGF165 PeproTech Cat# 100-20 Recombinant Human IL-6 PeproTech Cat# 200-06 Recombinant Human IL-3 PeproTech Cat# 200-03 Recombinant Human SCF PeproTech Cat# 300-07 Recombinant Human TPO PeproTech Cat# 300-18 Recombinant Human Flt3-Ligand PeproTech Cat# 300-19 Recombinant Human IL-7 PeproTech Cat# 200-07 LiC1 Sigma Cat# L9659 SB431542 (TGF-13 inhibitor) Cayman Chemical Cat# 13031 Collagen IV Sigma Cat# C5533 Y-27632 (Rock inhibitor) Cayman Chemical Cat# 10005583 Doxycycline hyclate Sigma Cat# D9891 DAPI Sigma Cat# D8417 DAPT (γ-secretase inhibitor) Cayman Chemical Cat# 13197 Cas9 protein PNA Bio Cat# CP01 Lipofectamine RNAiMAX ThermoFisher Cat# 13778150 Critical commercial assays BrdU KIT BD PharMingen Cat# 559619; RRID: AB_2617060 Human stem cell nucleofector kit2 Lonza Cat# VPH-5022 EZ-Magna ChIP AIG Chromatin Sigma Cat# 17-10086 Immunoprecipitation kit ATAC-SEQ Active Motif Cat# 25079 Deposited data RNA-seq, ATAC-seq, ChIP-seq This study GEO: GSE140341 Experimental models: cc/Hines WA09 (H9) human ES cell WiCell Cat# RB66492 pTRE-SOX17-P2A-Venus-rpEF1a- This paper N/A Zeo and pEF1α-M2rtTA-T2A-Puro (PiggyBac) H9 hESC line SOX17-/- H9 hESC line This paper N/A Oligonucleotides Primers of RT-qPCR, gPCR, and This paper N/A ChIP-PCR, See Table S1 sgRNA targeting seq. for SOX17 #1 Synthego N/A GTTCATCGGCCGCCGGATAC (SEQ ID NO: 2) sgRNA targeting seq. for SOX17 #2 Synthego N/A TTCACCTGCTTGCGCCGCCG (SEQ ID NO: 3) ON-TARGETplus human CDX2 Dharmacon Cat# L-015636-00-0010 siRNA SMARTpool ON-TARGETplus Non-targeting Dharmacon Cat# D-001810-10-05 Control pool Recombinant DNA pTRE-SOX17-P2A-Venus-rpEF1a- This paper N/A Zeo pEF1α-M2rtTA-T2A-Puro This paper N/A Super piggyBac transposase Transposagen Cat# SPB-DNA expression vector Software and algorithms Prism versions 8 GraphPad Software www.graphpad.com/scientific-software/prism/ Inc. FlowJo 8.8.6 FlowJo www.flowjo.com STAR (version 2.5.2b) PMID: 23104886 github.com/alexdobin/STAR (Dobin et al., 2013) RSEM (version 1.3.0) PMID: 21816040 deweylab.github.io/RSEM/ (Li and Dewey, 2011) DESeq2 (version 1.22.2) DESeq2 (version bioconductor.org/packages/release/bioc/html/ 1.22.2) DESeq2.html MEME (version 5.0.4) PMID: 22610855 meme-suite.org (Bailey and Machanick, 2012) BWA (version 0.7.15) PMID: 19451168 github.com/lh3/bwa (Li and Durbin, 2009) MACS2 (version 2.1.0) PMID: 18798982 github.com/macs3-project/MACS (Zhang et al., 2008)
Western Blot Assay
[0073] Cell extracts were prepared by adding IP Lysis buffer (ThermoFisher) with protease inhibitor cocktail (Sigma). Cell lysates (10 μg) were separated by Mini-protean TGX gels (Bio-rad). The separated proteins were transferred to a PVDF membrane, and were stained with antibodies for SOX17 (R&D) and GAPDH (Santa Cruz). Immunoblots were visualized using the ECL PLUS detection kit (Amersham Pharmacia) and analyzed using ChemiDox XRS+ Image Lab Software Version 5.2.1 (Bio-Rad).
Real-Time qPCR
[0074] RNA was extracted using the RNeasy Plus Micro Kit (Qiagen). RNA was reverse-transcribed into cDNA using random hexamer primers (Qiagen) with SMART MMLV reverse transcriptase (TaKaRa). qPCR was conducted using TB Green Advantage qPCR Premix (TaKaRa). RPL13A was used as the reference gene to normalize the data. Primer sequences are listed in Table 2.
TABLE-US-00002 TABLE 2 Primers used for RT-qPCR.00 Gene Forward Sequence (5′-3′) Reverse Sequence (5′-3′) Purpose ALDH1A2 TCTGTCCCTCTCTGCTTTCT CTGCCTGGCCTACATGTTATC qPCR (SEQ ID NO: 4) (SEQ ID NO: 5) CDX2 CCGAACAGGGACTTGTTTAGAG AGGTTGGCTCTGGCATTTATAG qPCR (SEQ ID NO: 6) (SEQ ID NO: 7) CXCR4 TCAGTGGCTGACCTCCTCTT CTTGGCCTTTGACTGTTGGT qPCR (SEQ ID NO: 8) (SEQ ID NO: 9) DLL4 CAGTGGGCAGCGAAGCTACA ACAGGCAGTGGTAGCCATCCTC qPCR (SEQ ID NO: 10) (SEQ ID NO: 11) EFNB2 CTCCTCAACTGTGCCAAACCA GGTTATCCAGGCCCTCCAAA qPCR (SEQ ID NO: 12) (SEQ ID NO: 13) HEY1 GGACTATCGGAGTTTGGGATTT TGGGAAGCGTAGTTGTTGAG qPCR (SEQ ID NO: 14) (SEQ ID NO: 15) HEY2 TTCAAGGCAGCTCGGTAACTGAC CATACTGATGCACTGCTGGATGG qPCR (SEQ ID NO: 16) (SEQ ID NO: 17) HOXA1 CCAACAGAAACATGCCAGAAG CTCGCCTTTCGCTATATCCTAC qPCR (SEQ ID NO: 18) (SEQ ID NO: 19) HOXA2 GATGCAGTTTCACCCAGTTTG GATTGTGGTGAGTGTGTCTGTA qPCR (SEQ ID NO: 20) (SEQ ID NO: 21) HOXA3 GATGGAGCCATGGGAAGATTAC CATAGGGAGGAGGCTGAGATATAG qPCR (SEQ ID NO: 22) (SEQ ID NO: 23) HOXA4 GGAGAAGGAGTTCCACTTCAAT GGTCTTTCTTCCACTTCATCCT qPCR (SEQ ID NO: 24) (SEQ ID NO: 25) HOXA5 GTTCCTGTCTCAATAGCTCCAA GTGTCTCATCAAGTCACCTCTAC qPCR (SEQ ID NO: 26) (SEQ ID NO: 27) HOXA6 AAAGCACTCCATGACGAAGG GTCTGGTAGCGCGTGTAGGT qPCR (SEQ ID NO: 28) (SEQ ID NO: 29) HOXA7 AGGTCCAGGATCAGGGTATT CCAGAGAAGGAGGGATTGATTC qPCR (SEQ ID NO: 30) (SEQ ID NO: 31) HOXA9 GCGCCTTCTCTGAAAACAAT CAGTTCCAGGGTCTGGTGTT qPCR (SEQ ID NO: 32) (SEQ ID NO: 33) HOXA10 GCAAAGAGTGGTCGGAAGAA CGCTCTCGAGTAAGGTACATATTG qPCR (SEQ ID NO: 34) (SEQ ID NO: 35) HOXA11 TGGTCTGGGACTCTCTTGAT GGTCCCAAACCTGTCATTCT qPCR (SEQ ID NO: 36) (SEQ ID NO: 37) HOXA13 CTGGAACGGCCAAATGTACT GCTTCTTTCTCCCCCTCCTA qPCR (SEQ ID NO: 38) (SEQ ID NO: 39) LFNG GCAACGTGGTCATCACAAAC CTCGATGAAGCGGTCATACTC qPCR (SEQ ID NO: 40) (SEQ ID NO: 41) NOTCH1 CAATGTGGATGCCGCAGTTGTG CAGCACCTTGGCGGTCTCGTA qPCR (SEQ ID NO: 42) (SEQ ID NO: 43) NOTCH4 AGCTCTGGAAAGAGGGTTTAAG CTCCTGTGGCCTGTCTTATTT qPCR (SEQ ID NO: 44) (SEQ ID NO: 45) NR2F2 TGGTTCCAAACCAGTTTATTCTGT AAGTGCGTTTCCATCATCTTTGAG qPCR (SEQ ID NO: 46) (SEQ ID NO: 47) RARγ ATGACCGGAACAAGAAGAAGAA TTGCTGACCTTGGTGATGAG qPCR (SEQ ID NO: 48) (SEQ ID NO: 49) RPL13A CCTGGAGGAGAAGAGGAAAGAGA TTGAGGACCTCTGTGTATTTGTCAA qPCR (SEQ ID NO: 50) (SEQ ID NO: 51) SOX17 GCCAAGGGCGAGTCCCGTA GCATCTTGCTCAACTCGGCGTTGTGCA qPCR (SEQ ID NO: 52) (SEQ ID NO: 53) P1/P2 GGGTACGCTGTAGACCAGAC TTCAGCCGCTTCACCTGCTT Genomic (SEQ ID NO: 54) (SEQ ID NO: 55) PCR CDX2 ACTCCCAAAGCAGTTGGATG GCTTTTTTATGGCCCAGGCTG ChIP-PCR promoter (SEQ ID NO: 56) (SEQ ID NO: 57)
RNA-Seq
[0075] One hundred nanograms of total RNA was used to prepare sequencing libraries using the Ligation Mediated Sequencing (LM-Seq) protocol, according to the paper guidelines (Hou et al., 2015) and quantified with the Qubit fluorometer (ThermoFisher). Final cDNA libraries were quantitated with the Qubit Fluorometer (ThermoFisher), multiplexed, loaded at a final concentration of 2.5 nM, and sequenced as single reads on the Illumina HiSeq 3000 (Illumina).
ChIP-seq
[0076] Chromatin immunoprecipitation (ChIP) analysis of day 4 HE was performed, as described in the protocol included in the EZ-Magna ChIP A/G Chromatin Immunoprecipitation Kit (Millipore Sigma). Five nanograms of IP or control DNA was used to prepare sequencing libraries using the TruSeq ChIP Sample Preparation Kit (Illumina) as per the manufacturer instructions and quantified with the Qubit fluorometer (Life Technologies). All six TruSeq ChIP indexed samples were pooled per lane, loaded at a final concentration of 2.5 nM, and sequenced as single reads on the Illumina HiSeq 3000 (Illumina).
ATAC-seq
[0077] Day 4 HE cells were harvested and frozen in culture media containing FBS and 5% DMSO. Cryopreserved cells were sent to Active Motif to perform the ATAC-seq assay. The cells were then thawed in a 37° C. water bath, pelleted, washed with cold PBS, and tagmented as previously described (Buenrostro et al., 2013). Briefly, cell pellets were resuspended in lysis buffer, pelleted, and tagmented using the enzyme and buffer provided in the Nextera Library Prep Kit (Illumina). Tagmented DNA was then purified using the MinElute PCR purification kit (Qiagen), amplified with 10 cycles of PCR, and purified using Agencourt AMPure SPRI beads (Beckman Coulter). Resulting material was quantified using the KAPA Library Quantification Kit for Illumina platforms (KAPA Biosystems), and sequenced with PE42 sequencing on the NextSeq 500 sequencer (Illumina).
RNA-Seq Analysis
[0078] RNA-seq analyses were performed on three biological replicates in DOX− and DOX+ conditions. Sequencing fragments were aligned by STAR (version 2.5.2b) to human genome (hg38) with gene annotations from GENCODE (version 27). Transcript expression levels were quantified by RSEM (version 1.3.0) and differentially expression analysis was performed by DESeq2 (version 1.22.2). KEGG gene sets were defined by MSigDB (version 6.1).
ATAC-Seq Analysis
[0079] ATAC-seq analyses were performed on two biological replicates in DOX− and DOX+ conditions. Sequencing fragments were pre-processed by the company Active Motif, Inc. Briefly, ATAC-seq reads were mapped to the human genome by BWA with default settings. Only reads that passed Illumina's purity filter, aligned with no more than 2 mismatches, and mapped uniquely to human genome were used in the subsequent analysis. Duplicate reads (“PCR duplicates”) were removed. To calculate signals, human genome was divided into 32 bp bins and the number of reads in each bin was counted. In order to smooth the data, reads were extended to 200 bp. To normalize signals across ATAC-seq datasets, the number of reads in each dataset was reduced by random sampling to the smallest number of reads present in the datasets.
[0080] ATAC-seq peaks were called by Active Motif, Inc using MACS2. For DOX− or DOX+ condition, we defined condition-specific peaks by selecting those existing in both ATAC-seq replicates of that condition and not overlapping with any peak from the two replicates of the other condition. From condition-specific peaks, we identified ‘promoter peaks’ by choosing those overlapped with protein-coding transcript's 5 kb upstream region and do not overlap with any intron or exon. DNA sequences for the 250 bp flanking regions to the center of promoter peaks were prepared for motif enrichment analysis. Motif enrichment was performed by MEME (version 5.0.4)'s CentriMo function with default settings based on motifs from HOCOMOCO human database (version 11).
[0081] ATAC-seq signals were calculated for gene's promoter region, which was defined as the 5 kb region upstream of its transcription start site (TSS). If a gene encoded for multiple transcripts, the most upstream TSS will be used as this gene's TSS. A gene's ATAC-seq promoter signal change upon DOX+ activation was computed by taking the difference of averaged signals from the two ATAC-seq replicates under DOX− or DOX+ condition. The top 5% genes that have the largest increase of ATAC-seq promoter signals were collected for GO term analysis by the Bioconductor package limma's function goana. P-values were adjusted by Benjamini & Hochberg method.
ChIP-seq Analysis
[0082] SOX17 and IgG control ChIP-seq fragments from were aligned by BWA (version 0.7.15) with a quality threshold at 5 for read trimming and all the other options in default settings. Normalized SOX17 ChIP-seq signals were calculated by MACS2 by using all the tags at the same loci. SOX17's fold enrichment over IgG control were calculated by MACS2 using all default options.
Statistical Analysis
[0083] Experiments were analyzed using GraphPad Prism versions 8 (GraphPad Software Inc.) and Microsoft Excel (Microsoft Corporation). Tests for statistical significance are listed with each experiment and included two-sided Student's t-test for paired analyses and one-way ANOVA, and two-way ANOVA for experiments with multiple comparisons of or grouped variables, accompanied by Tukey and Sidak post hoc tests indicated as appropriate by the software. *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001. All error bars represent the mean±SD and duplicated or triplicated independent experiments.
Results:
[0084] SOX17 Knockout Impairs AHE Specification and Definitive Lympho-Myeloid Hematopoiesis from hPSCs
[0085] To assess the effect of SOX17 on hematopoietic development, we generated SOX17 knockout H9 human embryonic stem cell (hESC; SOX17.sup.−/−) lines using CRISPR/Cas9 (
[0086] To assess the hematopoietic potential of SOX17.sup.−/− and SOX17.sup.+/+ HE cells and their dependence on NOTCH signaling, we isolated D4 HE cells and co-cultured them on OP9 or OP9-DLL4 (
[0087] Overall, these results demonstrate the critical role of SOX17 in the specification of definitive lympho-myeloid hematopoiesis and DLL4.sup.+CXCR4.sup.+ AHE from hPSCs. Although both, DLL4 and CXCR4, are considered markers of AHE (Chong et al., 2011; Yamamizu et al., 2010), DLL4 expression has been found in arterial vessels of yolk sac and aorta (Duarte et al., 2004; Herman et al., 2018; Robert-Moreno et al., 2005), while CXCR4 expression was detected in aorta and vitelline/umbilical arteries (McGrath et al., 1999; Werner et al., 2020), i.e. vasculature harboring precursors capable of maturing into definitive HSCs (Dzierzak and Medvinsky, 1995; Gordon-Keylock et al., 2013), but not in yolk sac (McGrath et al., 1999; Venkatesh et al., 2008; Werner et al., 2020). Thus, SOX17 is the most essential factor for the formation of AHE with the CXCR4.sup.+ phenotype typical of HE with HSC potential in vivo.
SOX17 Induction at the Mesodermal Stage Enhances AHE Specification and Definitive Lympho-Myeloid Hematopoiesis
[0088] To further characterize the role of SOX17 during hematoendothelial development, we engineered an H9 hESC line with a transgene cassette that expresses SOX17 upon treatment with doxycycline (DOX; iSOX17-hESCs;
[0089] As we previously demonstrated, D4 HE specifies 24 hours later (D5) into DLL4.sup.+CXCR4.sup.+/− arterial HE and non-arterial DLL4.sup.−CXCR4.sup.− HE (Park et al., 2018b; Uenishi et al., 2018). Assessment of HE phenotype on D5 (
[0090] Collectively, these studies suggest that SOX17 upregulation promotes definitive lympho-myeloid hematopoiesis from hPSCs through enhancement of AHE specification with CXCR4.sup.+DLL4.sup.+ phenotype, typical for HE at sites of HSC emergence.
SOX17 Overexpression Activates NOTCH-Mediated Arterial Program and Expression of HOXA Cluster Genes in HE
[0091] To understand the molecular mechanisms of the effect of SOX17, we performed molecular profiling of D4 HE from DOX+ and DOX− cultures using RNA-seq and ATAC-seq. To analyze chromatin binding of SOX17 by ChIP-seq, we used DOX+ cultures because under DOX− conditions, SOX17 expression was absent in D4 HE, i.e., before AHE was formed (Uenishi et al., 2018) (
TABLE-US-00003 TABLE 3 Enriched KEGG terms from day 4 HE RNAseq Gene set name Up-regulated in Adjusted p-value KEGG_AXON_GUIDANCE DOX+ 2.10837179648431e−8 KEGG_CELL_ADHE_SION_MOLECULES_CAMS DOX+ 2.10837179648431e−8 KEGG_GLYCOSAMINOGLYCAN_BIOSYNTHESIS_CHONDROITIN_SULFATE DOX+ 2.10837179648431e−8 KEGG_RIBOSOME DOX− 6.73770384348161e−8 KEGG_ECM_RECEPTOR_INTERACTION DOX+ 1.00763E−06 KEGG_BASAL_CELL_CARCINOMA DOX+ 4.48645E−06 KEGG_GLYCO_SAMINOGLYCAN_BIOSYNTHESIS_HEPARAN_SULFATE DOX+ 5.33193E−05 KEGG_HEDGEHOG_SIGNALING_PATHWAY DOX+ 0.000133684 KEGG_AMINOACYL_TRNA_BIOSYNTHESIS DOX− 0.000276991 KEGG_FOCAL_ADHESION DOX+ 0.00051598 KEGG_VALINE_LEUCINE_AND_ISOLEUCINE_DEGRADATION DOX− 0.001401729 KEGG_PROPANOAIL_METABOLISM DOX− 0.002156859 KEGG_MELANOGENESIS DOX+ 0.002156859 KEGG_GAPJUNCTION DOX+ 0.002241927 KEGG_GLYCO_SPHINGOLIPID_BIOSYNTHESIS_LACTO_AND_NEOLACTO_SERIES DOX+ 0.00238555 KEGG_OXIDATIVE_PHOSPHORYLATION DOX− 0.003148941 KEGG_ARRHYTHMOGENIC_RIGHT_VENTRICULAR_CARDIOMYOPATHY_ARVC DOX+ 0.003281063 KEGG_RNA_DEGRADATION DOX− 0.003281063 KEGG_TGF_BETA_SIGNALING_PATHWAY DOX+ 0.003288519 KEGG_SPLICEOSOME DOX− 0.003288519 KEGG_MELANOMA DOX+ 0.003288519 KEGG_PATHWAYS_IN_CANCER DOX+ 0.00460277 KEGG_RNA_POLYMERASE DOX− 0.00460277 KEGG_PEROXISOME DOX− 0.006024659 KEGG_PYRUVAIL_METABOLISM DOX− 0.006685177 KEGG_FRUCTOSE_AND_MANNOSE_METABOLISM DOX− 0.008549323 KEGG_GLYCOLYSIS_GLUCONEOGENESIS DOX− 0.009118394 KEGG_PROSTATE_CANCER DOX+ 0.010329457 KEGG_NOTCH_SIGNALING_PATHWAY DOX+ 0.010329457 KEGG_ONE_CARBON_POOL_BY_FOLATE DOX− 0.011068986 KEGG_HUNTINGTONS_DISEASE DOX− 0.011068986 KEGG_DORSO_VENTRAL_AXIS_FORMATION DOX+ 0.011068986 KEGG_DILATED_CARDIOMYOPATHY DOX+ 0.011676678 KEGG_CITRATE_CYCLEJCA_CYCLE DOX− 0.012849034 KEGG_VALINE_LEUCINE_AND_ISOLEUCINE_BIOSYNTHESIS DOX− 0.027921813 KEGG_ENDOMETRIAL_CANCER DOX+ 0.031692773 KEGG_GNRH_SIGNALING_PATHWAY DOX+ 0.037610248 KEGG_WNT_SIGNALING_PATHWAY DOX+ 0.038958319 KEGG_GLYCO_SPHINGOLIPID_BIOSYNTHESIS_GANGLIO_SERIES DOX+ 0.039893448 KEGG_RENAL_CELL_CARCINOMA DOX+ 0.047099844
[0092] ATAC-seq analysis of D4 HE isolated from DOX-treated cultures identified 93,615 and 100,036 open chromatin regions in the two ATAC-seq replicates, respectively, of which 5,130 of which were specific to DOX+ conditions. Gene Ontology (GO) analysis of genes with increased ATAC-seq counts at promoters upon DOX treatment revealed enrichment in categories associated with development and morphogenesis, including blood vessel morphogenesis (Table 4), suggesting that SOX17 facilitates the establishment of gene regulatory networks essential for early morphogenesis, including vascular development. Motif-enrichment analysis of ATAC-seq peaks at promoters in DOX+ and DOX− conditions revealed enrichment in ETS-binding motifs for both conditions, consistent with the endothelial nature of the analyzed cells. However, in DOX+ conditions we observed a unique enrichment in retinoic receptor alpha (RARA) and estrogen receptor 2 (ESR2) motifs at open chromatin regions (
TABLE-US-00004 TABLE 4 Top 5% of genes with ATAC-seq signals increased at promoters upon DOX induction GO term Adjusted p-value anatomical structure morphogenesis 1.78003407755937e−7 nervous system development 2.85807041113842e−7 neurogenesis 4.58194E−06 central nervous system development 8.16944E−06 tube morphogenesis 2.44821E−05 system development 2.44821E−05 generation of neurons 2.92474E−05 tube development 0.000110693 multicellular organism development 0.000110693 regulation of nervous system development 0.000161455 regulation of multicellular organismal development 0.000161455 anatomical structure development 0.000185597 neuron differentiation 0.000185597 locomotion 0.000185597 regulation of anatomical structure morphogenesis 0.000185597 cell migration 0.000246498 regulation of developmental process 0.000342946 head development 0.000342946 positive regulation of developmental process 0.000465449 blood vessel morphogenesis 0.000758105 neuron development 0.000758105 adenylate cyclase-modulating G protein-coupled 0.000761229 receptor signaling pathway neuron projection development 0.000761229 vasculature development 0.000865103 anatomical structure formation involved in 0.000920372 morphogenesis neuron part 0.001038012 developmental process 0.001038012 angiogenesis 0.00105143 cardiovascular system development 0.00105143 embryonic morphogenesis 0.001067191 basement membrane 0.001075712 brain development 0.001301484 cellular developmental process 0.001476637 animal organ morphogenesis 0.001521223 neuron projection 0.001521223 cell motility 0.001521223 localization of cell 0.001521223 blood vessel development 0.001567922 intrinsic component of plasma membrane 0.001593111 regulation of cell development 0.001593111 regulation of neurogenesis 0.001610939 animal organ development 0.001714315 multicellular organismal process 0.001735658 G protein-coupled receptor signaling pathway, 0.002324971 coupled to cyclic nucleotide second messenger integral component of plasma membrane 0.002408441 circulatory system development 0.002859264 regulation of multicellular organismal process 0.003115049 cell development 0.003234361 axon development 0.003618464 cell differentiation 0.003626835 embryonic organ development 0.003626835 cell part morphogenesis 0.006182665 embryo development 0.007461113 signaling receptor binding 0.008843617 synapse 0.008843617 movement of cell or subcellular component 0.009048212 cellular component morphogenesis 0.009048212 tumor necrosis factor-activated receptor activity 0.009048212 renal system development 0.009737108 tissue morphogenesis 0.009737108 axonogenesis 0.01004697 regulation of neuron differentiation 0.010178993 positive regulation of cell development 0.010271038 axon 0.010271038 adenylate cyclase-inhibiting G protein-coupled 0.010271038 receptor signaling pathway regulation of cell differentiation 0.011531827 positive regulation of nervous system development 0.012459588 ear development 0.012623805 positive regulation of cell differentiation 0.013451981 metanephros morphogenesis 0.015724879 synaptic membrane adhesion 0.015740799 ear morphogenesis 0.015896 inner ear morphogenesis 0.016315176 cell morphogenesis involved in neuron 0.017844159 differentiation neuron projection morphogenesis 0.020119928 chondrocyte differentiation 0.020119928 plasma membrane bounded cell projection 0.020119928 morphogenesis positive regulation of epithelial cell migration 0.020320479 system process 0.020320479 cell morphogenesis 0.020320479 collagen-containing extracellular matrix 0.020320479 inner ear development 0.02054135 positive regulation of protein phosphorylation 0.02187698 cell projection morphogenesis 0.02187698 positive regulation of multicellular organismal 0.02187698 process second-messenger-mediated signaling 0.02187698 sensory organ development 0.022685916 positive regulation of neurogenesis 0.022685916 nephron development 0.023439655 chemotaxis 0.023462666 death receptor activity 0.023660162 regulation of system process 0.024178531 cAMP-mediated signaling 0.024615989 taxis 0.024615989 positive regulation of cell proliferation 0.0260098 sensory organ morphogenesis 0.0260098 cell proliferation 0.028080528 positive regulation of cell migration 0.029165326 negative regulation of apoptotic process 0.032275505 cell morphogenesis involved in differentiation 0.03348346 growth factor activity 0.03348346 extracellular matrix 0.033910658 dichotomous subdivision of terminal units 0.035191974 involved in lung branching extracellular matrix organization 0.036705001 extracellular structure organization 0.036705001 intrinsic component of membrane 0.036875421 cell communication 0.038652168 kidney morphogenesis 0.039463928 dopamine transport 0.040553679 regulation of neuron projection development 0.041435175 positive regulation of locomotion 0.042212449 metal ion transmembrane transporter activity 0.042443184 regulation of developmental growth 0.042443184 urogenital system development 0.042443184 regulation of cell migration 0.044587154 regulation of cell proliferation 0.045698414 positive regulation of phosphorylation 0.048504286 receptor tyrosine kinase binding 0.049864381
TABLE-US-00005 TABLE 5 Enriched motifs in condition-specific ATAC-seq promoter peaks Motif Condition Adjusted p-value ETS1 DOX+ 0.0000032 ETV1 DOX+ 0.00022 ELK4 DOX+ 0.00023 ETV2 DOX+ 0.00043 ELF1 DOX+ 0.0009 ELK1 DOX+ 0.002 ERG DOX+ 0.0026 GABPA DOX+ 0.0047 ESR2 DOX+ 0.012 ETV4 DOX+ 0.018 RARA DOX+ 0.025 GABPA DOX− 1.4e−13 ELF1 DOX− 1.9e−13 ETV1 DOX− 9.6e−13 ELF2 DOX− 1.2e−12 ELF5 DOX− 2.7e−10 ETS1 DOX− 2.2e−9 ETV2 DOX− 2.6e−9 ERG DOX− 1.5e−8 ELK4 DOX− 3.2e−8 ETV4 DOX− 9.8e−8 ELK1 DOX− 5.6e−7 EHF DOX− 9.2e−7 ELF3 DOX− 0.0000071 SPI1 DOX− 0.000012 FOSL1 DOX− 0.00011 ETV5 DOX− 0.0002 CTCF DOX− 0.00025 ZN341 DOX− 0.00045 FLI1 DOX− 0.00061 SPIB DOX− 0.0011 ZSC22 DOX− 0.0014 FEV DOX− 0.0019 ZN449 DOX− 0.0026 CTCFL DOX− 0.0034 FOSL2 DOX− 0.0071 PBX3 DOX− 0.0077 EGR2 DOX− 0.015 HINFP DOX− 0.019 KLF12 DOX− 0.023
[0093] To identify direct targets of SOX17 in D4 HE, we analyzed overlapping SOX17 ChIP-seq and ATAC-seq peaks at promoters and intragenic regions of differentially expressed genes (DEGs) between DOX+ and DOX− conditions. The set of DEGs bound by SOX17 at open chromatin regions was enriched in the Hippo, Wnt, TGFβ, and Notch signaling pathways, and included genes important for NOTCH regulation, arterial specification and hematopoietic development such as NOTCH4, CDX2 (
TABLE-US-00006 TABLE 6 DEGs with overlapping TS and intragenic SOX17 and ATAC peaks KEGG Adjusted p-value Axon guidance 0.000039 Hippo signaling pathway 0.00061 Prostate cancer 0.0025 Parathyroid hormone synthesis, secretion 0.0026 and action Wnt signaling pathway 0.0026 Pathways in cancer 0.0038 EGFR tyrosine kinase inhibitor resistance 0.0047 Cell adhesion molecules (CAMs) 0.0066 TGF-beta signaling pathway 0.0066 Proteoglycans in cancer 0.0066 Breast cancer 0.0066 Gastric cancer 0.0066 Notch signaling pathway 0.0066 MicroRNAs in cancer 0.011 Hippo signaling pathway-multiple species 0.013 ECM-receptor interaction 0.036 Morphine addiction 0.039 Protein digestion and absorption 0.042 Endocrine resistance 0.042 Melanogenesis 0.048 NF-kappa B signaling pathway 0.048
[0094] To confirm the role of SOX17 in establishing the HOXA pattern in HE, we evaluated expression of arterial and HOXA genes in the three major subsets of HE on D5 (
[0095] QPCR analysis of phenotypically similar HE populations generated from SOX17.sup.−/− and wild type hESCs revealed substantial reduction of arterial genes in both DLL4.sup.+CXCR4.sup.− and DLL4.sup.+CXCR4.sup.+ AHE subsets as compared to wild type cells. However, significant reduction in HOXA5-HOX10 gene expression was observed only in DLL4.sup.+CXCR4.sup.+ AHE subset (
[0096] Taken together, our molecular profiling studies indicate that SOX17 acts as a key factor in activating the arterial program and HOXA expression in HE.
SOX17 Promotes Arterial Program in HE Through Activation of NOTCH Signaling
[0097] To determine whether SOX17 induction promotes arterial specification through activation of NOTCH signaling, we evaluated hematopoiesis following SOX17 upregulation in the presence of the NOTCH signaling inhibitor N—[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) (
SOX17 Mediates HOXA Gene Expression Through Activation of CDX2 Expression in HE
[0098] Despite significant upregulation of HOXA cluster genes in SOX17-expressing HE, our molecular profiling studies lacked of evidence for their direct regulation by SOX17. However, we found that SOX17 binds to and increases ATAC-seq counts of H3K27ac levels at the CDX2 promoter, along with the upregulation of CDX2 gene expression (
[0099] Overall, these observations indicate that the effect of SOX17 expression on establishing HOXA signature in HE is mediated through CDX2 signaling.
Discussion:
[0100] The critical role of SOX17 in HSC development has been well-recognized (Clarke et al., 2013; Kim et al., 2007; Lizama et al., 2015; Nobuhisa et al., 2014; Saito et al., 2018). Although SOX17 regulates multiple steps along the HSC developmental path, including HE specification, EHT, and HSC maintenance and expansion, the stage-specific molecular mechanisms of SOX17 are not well understood. Previously, overexpression of Sox17 was demonstrated to decrease cell numbers within the IAHC, while loss of Sox17 had the opposite effect (Lizama et al., 2015). However, the HSC potential of IAHC of manipulated AGM cells has not been characterized. The majority of cells within IAHC are differentiated hematopoietic cells, with only two of those cells possessing HSC potential (Kumaravelu et al., 2002; Solaimani Kartalaei et al., 2015). Thus, increase in IAHC cells following Sox17 downregulation could be associated with increase of lineage-committed progenitors which is accompanied by impaired HSC generation. This hypothesis is supported by observation that Sox17 loss leads to loss of CD45.sup.+VEC.sup.+ HSCs in AGM and fetal liver (Clarke et al., 2013; Kim et al., 2007). Demonstration of reduced multilineage CFC potential following knockdown of Sox17 in CD45.sup.lowCD117.sup.high cells from IAHC and expansion of undifferentiated hematopoietic cells following Sox17 overexpression (Nobuhisa et al., 2014) supports this hypothesis. In addition to regulating EHT and HSCs, SOX17 is essential for arterial specification and HE formation in the AGM (Clarke et al., 2013; Corada et al., 2013). Murine studies revealed that Sox17 effects are mediated through NOTCH signaling (Clarke et al., 2013; Lizama et al., 2015), while no effect of SOX17 on NOTCH signaling was observed in hESC cultures (Nakajima-Takagi et al., 2013).
[0101] A prior study revealed that Sox17 overexpression in hESC-derived during EHT expands VEC.sup.+CD34.sup.+CD43.sup.+CD45.sup.−/low cells with hematopoietic colony-forming potential (Nakajima-Takagi et al., 2013). In our study, we focused on defining the cellular and molecular pathways by which SOX17 regulates the earliest stages of HE specification and diversification from the mesoderm. Previously, we and others demonstrated that emerging HE cells lack arterial or venous characteristics (Ditadi et al., 2015; Uenishi et al., 2018) and express high levels of the mesodermal gene HAND1 (Uenishi et al., 2018). Therefore, we defined these cells as immature/primordial HE (Uenishi et al., 2018). When primordial HE cells get exposed to NOTCH signaling, they undergo arterial specification and formation of DLL4.sup.+CXCR4.sup.+/− AHE (Park et al., 2018b; Uenishi et al., 2018). Here, we show that SOX17 plays a critical role in specifying of AHE by upregulation of NOTCH4, DLL1 and DLL4 eventually leading to the formation of AHE with the DLL4.sup.+CXCR4.sup.+ phenotype typical of AHE at sites of HSC emergence, but not yolk sac AHE, which expresses DLL4, but not CXCR4 (McGrath et al., 1999; Venkatesh et al., 2008; Werner et al., 2020). Along with activating the arterial program, SOX17 is essential for expressing HOXA genes in AHE (
[0102] We found that SOX17 binds directly to the CDX2 promoter and increases chromatin accessibility and levels of H3K27ac activating histone modification leading to upregulated CDX2 expression. CDX2 knockdown with siRNA revokes SOX17-mediated effects on HOXA genes, thus demonstrating the critical role of a SOX17-CDX2 axis in establishing HOXA pattern in AHE. Genes of the CDX family (CDX1, CDX2 and CDX4) are well-known master regulators of HOX genes that mediate anterior-posterior patterning (Charite et al., 1998; Subramanian et al., 1995; van den Akker et al., 2002). In Wnt-activated epiblast stem cells, CDX2 binds to all four HOX cluster genes, including HOXA genes and is required for opening up the HOX cis-sequences (Neijts et al., 2017). Deficiency of cdx1 and cdx4 results in severe blood defects and altered expression of HOX genes in zebrafish (Davidson et al., 2003; Davidson and Zon, 2006). Similarly, impaired hematopoiesis from Cdx1, Cdx2 or Cdx4-deficient ESCs was observed in murine studies (Wang et al., 2008). Although ectopic expression of CDX4 enhanced definitive hematopoiesis from human and murine ESCs (Creamer et al., 2017; Wang et al., 2005), and hematopoietic engraftment in adult mice from murine ESCs (Wang et al., 2005), Cdx1 and Cdx4 double mutant mice were viable and did not show any hematopoietic defect (van Nes et al., 2006), which could be due to the observed functional redundancy of genes within the Cdx family (Davidson and Zon, 2006; Wang et al., 2008). It has been demonstrated that Cdx2 is the predominant Cdx gene expressed the AGM HE, while the expression of other Cdx genes is substantially lower (Gao et al., 2018). Cdx2 deficiency caused the most significant impairment in blood production from mouse ESCs (Wang et al., 2008) and Cdx1-Cdx2 compound conditional null mice failed to produce any blood at E11.5 (Foley et al., 2019), suggesting that among the Cdx family, Cdx2 is the most critical factor required for establishing hematopoiesis. Our finding of direct regulation of CDX2 expression by SOX17 provides an insight into the mechanisms responsible for establishing a CDX-HOXA pathway required for the formation of definitive AGM-like HE and lympho-myeloid hematopoiesis from hPSCs. Although previous studies with mouse ESCs found that overexpression of Cdx2 inhibits hematopoietic differentiation (McKinney-Freeman et al., 2008), such effect was not observed following upregulation of CDX2 by SOX17 in hESCs. This could be explained by differences in levels of upregulation or molecular programs activated by upregulation of CDX2 alone or in the context of SOX17 overexpression.
[0103] The de novo production of hematopoietic stem cells (HSCs) with robust multilineage reconstitution potential from human pluripotent stem cells (hPSCs) has long been sought after, but remains an elusive goal. Recent advances in understanding the molecular differences between HE and HSCs developed in vivo and their phenotypic counterparts produced from PSCs in vitro, have revealed that deficiencies in NOTCH and HOXA signaling are major factors responsible for aberrant functionality of PSC-derived hemogenic progenitors (Dou et al., 2016; Doulatov et al., 2013; McKinney-Freeman et al., 2012; Ng et al., 2016; Salvagiotto et al., 2008; Sugimura et al., 2017). It is well-established that NOTCH signaling is essential for arterial specification and development of HSCs (Burns et al., 2005; Kumano et al., 2003). Knock-out of the HOXA cluster in adult mice severely compromised HSC activity (Lebert-Ghali et al., 2016). In humans, HOXA5 and HOXA7 were shown to be critical for the expansion of engraftable fetal liver HSCs (Dou et al., 2016). Although overexpression of single or multiple medial HOXA genes in PSC-derived CD34.sup.+ cells was insufficient to confer HSC function (Dou et al., 2016; Ramos-Mejia et al., 2014), overexpression of HOXA5, HOXA9, and HOXA10 along with ERG, LCOR, RUNX1 and SPI1 hPSC-derived HE was capable of generating engraftable hematopoietic cells (Sugimura et al., 2017). In the present study, we provided a compelling evidence that SOX17 is a master regulator that integrates HOXA and arterial signature in HE through modulation of CDX2 signaling. This important finding may contribute to the strategic targeting of NOTCH and HOXA pathways to enhance lymphoid and engraftable hematopoietic cell production from hPSCs for the therapies of hematologic and oncologic diseases, including off-the-shelf immunotherapies.
Example 2
Expansion of Hematopoietic Progenitors with Myeloid and T Lymphoid Potentials
[0104] SOX17 expands lymphomyeloid progenitors generated from day 4 hemogenic endothelium.
[0105] To evaluate the role of SOX17 in expansion of hematopoietic progenitors, we isolated day 4 HE from DOX+ and DOX− cultures (phase I DOX treatment) and cultured these cells on OP9 or OP9-DLL4. After 5 days, floating hematopoietic progenitors were collected and cultured with or without DOX for additional 5 days (phase II DOX treatment) and evaluated for CFC and T lymphoid potential (
REFERENCES
[0106] Bailey, T. L. and Machanick, P. (2012). Inferring direct DNA binding from ChIP-seq. Nucleic Acids Res 40 e128 [0107] Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., and Greenleaf, W. J. (2013). Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods 10, 1213-1218. [0108] Burns, C. E., Traver, D., Mayhall, E., Shepard, J. L., and Zon, L. I. (2005). Hematopoietic stem cell fate is established by the Notch-Runx pathway. Genes Dev 19, 2331-2342. [0109] Charite, J., de Graaff, W., Consten, D., Reijnen, M. J., Korving, J., and Deschamps, J. (1998). Transducing positional information to the Hox genes: critical interaction of cdx gene products with position-sensitive regulatory elements. Development 125, 4349-4358. [0110] Choi, K. D., Vodyanik, M. A., Togarrati, P. P., Suknuntha, K., Kumar, A., Samarjeet, F., Probasco, M. D., Tian, S., Stewart, R., Thomson, J. A., et al. (2012). Identification of the hemogenic endothelial progenitor and its direct precursor in human pluripotent stem cell differentiation cultures. Cell Rep 2, 553-567. [0111] Chong, D. C., Koo, Y., Xu, K., Fu, S., and Cleaver, 0. (2011). Stepwise arteriovenous fate acquisition during mammalian vasculogenesis. Dev Dyn 240, 2153-2165. [0112] Clarke, R. L., Yzaguirre, A. D., Yashiro-Ohtani, Y., Bondue, A., Blanpain, C., Pear, W. S., Speck, N. A., and Keller, G. (2013). The expression of Sox17 identifies and regulates haemogenic endothelium. Nat Cell Biol 15, 502-510. [0113] Corada, M., Orsenigo, F., Morini, M. F., Pitulescu, M. E., Bhat, G., Nyqvist, D., Breviario, F., Conti, V., Briot, A., Iruela-Arispe, M. L., et al. (2013). Sox17 is indispensable for acquisition and maintenance of arterial identity. Nat Commun 4, 2609. [0114] Creamer, J. P., Dege, C., Ren, Q., Ho, J. T. K., Valentine, M. C., Druley, T. E., and Sturgeon, C. M. (2017). Human definitive hematopoietic specification from pluripotent stem cells is regulated by mesodermal expression of CDX4. Blood 129, 2988-2992. [0115] Davidson, A. J., Ernst, P., Wang, Y., Dekens, M. P., Kingsley, P. D., Palis, J., Korsmeyer, S. J., Daley, G. Q., and Zon, L. I. (2003). cdx4 mutants fail to specify blood progenitors and can be rescued by multiple hox genes. Nature 425, 300-306. [0116] Davidson, A. J., and Zon, L. I. (2006). The caudal-related homeobox genes cdx1a and cdx4 act redundantly to regulate hox gene expression and the formation of putative hematopoietic stem cells during zebrafish embryogenesis. Dev Biol 292, 506-518. [0117] Ditadi, A., Sturgeon, C. M., Tober, J., Awong, G., Kennedy, M., Yzaguirre, A. D., Azzola, L., Ng, E. S., Stanley, E. G., French, D. L., et al. (2015). Human definitive haemogenic endothelium and arterial vascular endothelium represent distinct lineages. Nat Cell Biol 17, 580-591. [0118] Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., and Gingeras, T. R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinfromatics 29, 15-21. [0119] Dou, D. R., Calvanese, V., Sierra, M. I., Nguyen, A. T., Minasian, A., Saarikoski, P., Sasidharan, R., Ramirez, C. M., Zack, J. A., Crooks, G. M., et al. (2016). Medial HOXA genes demarcate haematopoietic stem cell fate during human development. Nat Cell Biol 18, 595-606. [0120] Doulatov, S., Vo, L. T., Chou, S. S., Kim, P. G., Arora, N., Li, H., Hadland, B. K., Bernstein, I. D., Collins, J. J., Zon, L. I., et al. (2013). Induction of multipotential hematopoietic progenitors from human pluripotent stem cells via respecification of lineage-restricted precursors. Cell Stem Cell 13, 459-470. [0121] Duarte, A., Hirashima, M., Benedito, R., Trindade, A., Diniz, P., Bekman, E., Costa, L., Henrique, D., and Rossant, J. (2004). Dosage-sensitive requirement for mouse Dll4 in artery development. Genes Dev 18, 2474-2478. [0122] Dzierzak, E., and Medvinsky, A. (1995). Mouse embryonic hematopoiesis. Trends Genet 11, 359-366. [0123] Foley, T. E., Hess, B., Savory, J. G. A., Ringuette, R., and Lohnes, D. (2019). Role of Cdx factors in early mesodermal fate decisions. Development 146. [0124] Gao, L., Tober, J., Gao, P., Chen, C., Tan, K., and Speck, N. A. (2018). RUNX1 and the endothelial origin of blood. Exp Hematol 68, 2-9. [0125] Gordon-Keylock, S., Sobiesiak, M., Rybtsov, S., Moore, K., and Medvinsky, A. (2013). Mouse extraembryonic arterial vessels harbor precursors capable of maturing into definitive HSCs. Blood 122, 2338-2345. [0126] Hadland, B. K., Huppert, S. S., Kanungo, J., Xue, Y., Jiang, R., Gridley, T., Conlon, R. A., Cheng, A. M., Kopan, R., and Longmore, G. D. (2004). A requirement for Notch1 distinguishes 2 phases of definitive hematopoiesis during development. Blood 104, 3097-3105. [0127] Herman, A. M., Rhyner, A. M., Devine, W. P., Marrelli, S. P., Bruneau, B. G., and Wythe, J. D. (2018). A novel reporter allele for monitoring Dll4 expression within the embryonic and adult mouse. Biol Open 7. [0128] Hou, Z., Jiang, P., Swanson, S. A., Elwell, A. L., Nguyen, B. K., Bolin, J. M., Stewart, R., and Thomson, J. A. (2015). A cost-effective RNA sequencing protocol for large-scale gene expression studies. Sci Rep 5, 9570. [0129] Hu, Y., and Smyth, G. K. (2009). ELDA: extreme limiting dilution analysis for comparing depleted and enriched populations in stem cell and other assays. J Immunol Methods 347, 70-78. [0130] Kennedy, M., Awong, G., Sturgeon, C. M., Ditadi, A., LaMotte-Mohs, R., Zuniga-Pflucker, J. C., and Keller, G. (2012). T lymphocyte potential marks the emergence of definitive hematopoietic progenitors in human pluripotent stem cell differentiation cultures. Cell Rep 2, 1722-1735. [0131] Kim, I., Saunders, T. L., and Morrison, S. J. (2007). Sox17 dependence distinguishes the transcriptional regulation of fetal from adult hematopoietic stem cells. Cell 130, 470-483. [0132] Kumano, K., Chiba, S., Kunisato, A., Sata, M., Saito, T., Nakagami-Yamaguchi, E., Yamaguchi, T., Masuda, S., Shimizu, K., Takahashi, T., et al. (2003). Notch1 but not Notch2 is essential for generating hematopoietic stem cells from endothelial cells. Immunity 18, 699-711. [0133] Kumaravelu, P., Hook, L., Morrison, A. M., Ure, J., Zhao, S., Zuyev, S., Ansell, J., and Medvinsky, A. (2002). Quantitative developmental anatomy of definitive haematopoietic stem cells/long-term repopulating units (HSC/RUs): role of the aorta-gonad-mesonephros (AGM) region and the yolk sac in colonisation of the mouse embryonic liver. Development 129, 4891-4899. [0134] Lebert-Ghali, C. E., Fournier, M., Kettyle, L., Thompson, A., Sauvageau, G., and Bijl, J. J. (2016). Hoxa cluster genes determine the proliferative activity of adult mouse hematopoietic stem and progenitor cells. Blood 127, 87-90. [0135] Li, B. and Dewey, C. N. (2011). RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12, 323 [0136] Li, H. and Durbin, R. (2009). Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754-1960 [0137] Liao, W. P., Uetzmann, L., Burtscher, I., and Lickert, H. (2009). Generation of a mouse line expressing Sox17-driven Cre recombinase with specific activity in arteries. Genesis 47, 476-483. [0138] Liu, M., Zhang, L., Marsboom, G., Jambusaria, A., Xiong, S., Toth, P. T., Benevolenskaya, E. V., Rehman, J., and Malik, A. B. (2019). Sox17 is required for endothelial regeneration following inflammation-induced vascular injury. Nat Commun 10, 2126. [0139] Lizama, C. O., Hawkins, J. S., Schmitt, C. E., Bos, F. L., Zape, J. P., Cautivo, K. M., Borges Pinto, H., Rhyner, A. M., Yu, H., Donohoe, M. E., et al. (2015). Repression of arterial genes in hemogenic endothelium is sufficient for haematopoietic fate acquisition. Nat Commun 6, 7739. [0140] McGrath, K. E., Koniski, A. D., Maltby, K. M., McGann, J. K., and Palis, J. (1999). Embryonic expression and function of the chemokine SDF-1 and its receptor, CXCR4. Dev Biol 213, 442-456. [0141] McKinney-Freeman, S., Cahan, P., Li, H., Lacadie, S. A., Huang, H. T., Curran, M., Loewer, S., Naveiras, O., Kathrein, K. L., Konantz, M., et al. (2012). The transcriptional landscape of hematopoietic stem cell ontogeny. Cell Stem Cell 11, 701-714. [0142] McKinney-Freeman, S. L., Lengerke, C., Jang, I. H., Schmitt, S., Wang, Y., Philitas, M., Shea, J., and Daley, G. Q. (2008). Modulation of murine embryonic stem cell-derived CD41+c-kit+ hematopoietic progenitors by ectopic expression of Cdx genes. Blood 111, 4944-4953. [0143] Nakajima-Takagi, Y., Osawa, M., Oshima, M., Takagi, H., Miyagi, S., Endoh, M., Endo, T. A., Takayama, N., Eto, K., Toyoda, T., et al. (2013). Role of SOX17 in hematopoietic development from human embryonic stem cells. Blood 121, 447-458. [0144] Neijts, R., Amin, S., van Rooijen, C., and Deschamps, J. (2017). Cdx is crucial for the timing mechanism driving colinear Hox activation and defines a trunk segment in the Hox cluster topology. Dev Biol 422, 146-154. [0145] Ng, E. S., Azzola, L., Bruveris, F. F., Calvanese, V., Phipson, B., Vlahos, K., Hirst, C., Jokubaitis, V. J., Yu, Q. C., Maksimovic, J., et al. (2016). Differentiation of human embryonic stem cells to HOXA(+) hemogenic vasculature that resembles the aorta-gonad-mesonephros. Nat Biotechnol 34, 1168-1179. [0146] Nobuhisa, I., Osawa, M., Uemura, M., Kishikawa, Y., Anani, M., Harada, K., Takagi, H., Saito, K., Kanai-Azuma, M., Kanai, Y., et al. (2014). Sox17-mediated maintenance of fetal intra-aortic hematopoietic cell clusters. Mol Cell Biol 34, 1976-1990. [0147] Park, M. A., Jung, H. S., and Slukvin, I. (2018a). Genetic Engineering of Human Pluripotent Stem Cells Using PiggyBac Transposon System. Curr Protoc Stem Cell Biol 47, e63.
[0148] Park, M. A., Kumar, A., Jung, H. S., Uenishi, G., Moskvin, O. V., Thomson, J. A., and Slukvin, II (2018b). Activation of the Arterial Program Drives Development of Definitive Hemogenic Endothelium with Lymphoid Potential. Cell Rep 23, 2467-2481. [0149] Ramos-Mejia, V., Navarro-Montero, O., Ayllon, V., Bueno, C., Romero, T., Real, P. J., and Menendez, P. (2014). HOXA9 promotes hematopoietic commitment of human embryonic stem cells. Blood 124, 3065-3075. [0150] Robert-Moreno, A., Espinosa, L., de la Pompa, J. L., and Bigas, A. (2005). RBPjkappa-dependent Notch function regulates Gata2 and is essential for the formation of intra-embryonic hematopoietic cells. Development 132, 1117-1126. [0151] Saito, K., Nobuhisa, I., Harada, K., Takahashi, S., Anani, M., Lickert, H., Kanai-Azuma, M., Kanai, Y., and Taga, T. (2018). Maintenance of hematopoietic stem and progenitor cells in fetal intra-aortic hematopoietic clusters by the Sox17-Notch1-Hes1 axis. Exp Cell Res 365, 145-155. [0152] Salvagiotto, G., Zhao, Y., Vodyanik, M., Ruotti, V., Stewart, R., Marra, M., Thomson, J., Eaves, C., and Slukvin, I. (2008). Molecular profiling reveals similarities and differences between primitive subsets of hematopoietic cells generated in vitro from human embryonic stem cells and in vivo during embryogenesis. Exp Hematol 36, 1377-1389. [0153] Serrano, A. G., Gandillet, A., Pearson, S., Lacaud, G., and Kouskoff, V. (2010). Contrasting effects of Sox17- and Sox18-sustained expression at the onset of blood specification. Blood 115, 3895-3898.
[0154] Solaimani Kartalaei, P., Yamada-Inagawa, T., Vink, C. S., de Pater, E., van der Linden, R., Marks-Bluth, J., van der Sloot, A., van den Hout, M., Yokomizo, T., van Schaick-Solerno, M. L., et al. (2015). Whole-transcriptome analysis of endothelial to hematopoietic stem cell transition reveals a requirement for Gpr56 in HSC generation. J Exp Med 212, 93-106. [0155] Subramanian, V., Meyer, B. I., and Gruss, P. (1995). Disruption of the murine homeobox gene Cdx1 affects axial skeletal identities by altering the mesodermal expression domains of Hox genes. Cell 83, 641-653. [0156] Sugimura, R., Jha, D. K., Han, A., Soria-Valles, C., da Rocha, E. L., Lu, Y. F., Goettel, J. A., Serrao, E., Rowe, R. G., Malleshaiah, M., et al. (2017). Haematopoietic stem and progenitor cells from human pluripotent stem cells. Nature 545, 432-438. [0157] Uenishi, G., Theisen, D., Lee, J. H., Kumar, A., Raymond, M., Vodyanik, M., Swanson, S., Stewart, R., Thomson, J., and Slukvin, I. (2014). Tenascin C promotes hematoendothelial development and T lymphoid commitment from human pluripotent stem cells in chemically defined conditions. Stem cell reports 3, 1073-1084. [0158] Uenishi, G. I., Jung, H. S., Kumar, A., Park, M. A., Hadland, B. K., McLeod, E., Raymond, M., Moskvin, O., Zimmerman, C. E., Theisen, D. J., et al. (2018). NOTCH signaling specifies arterial-type definitive hemogenic endothelium from human pluripotent stem cells. Nat Commun 9, 1828. [0159] van den Akker, E., Forlani, S., Chawengsaksophak, K., de Graaff, W., Beck, F., Meyer, B. I., and Deschamps, J. (2002). Cdx1 and Cdx2 have overlapping functions in anteroposterior patterning and posterior axis elongation. Development 129, 2181-2193. [0160] van Nes, J., de Graaff, W., Lebrin, F., Gerhard, M., Beck, F., and Deschamps, J. (2006). The Cdx4 mutation affects axial development and reveals an essential role of Cdx genes in the ontogenesis of the placental labyrinth in mice. Development 133, 419-428. [0161] Venkatesh, D. A., Park, K. S., Harrington, A., Miceli-Libby, L., Yoon, J. K., and Liaw, L. (2008). Cardiovascular and hematopoietic defects associated with Notch1 activation in embryonic Tie2-expressing populations. Circ Res 103, 423-431. [0162] Vodyanik, M. A., Yu, J., Zhang, X., Tian, S., Stewart, R., Thomson, J. A., and Slukvin, II (2010). A mesoderm-derived precursor for mesenchymal stem and endothelial cells. Cell Stem Cell 7, 718-729. [0163] Wang, Y., Yabuuchi, A., McKinney-Freeman, S., Ducharme, D. M., Ray, M. K., Chawengsaksophak, K., Archer, T. K., and Daley, G. Q. (2008). Cdx gene deficiency compromises embryonic hematopoiesis in the mouse. Proc Natl Acad Sci USA 105, 7756-7761. [0164] Wang, Y., Yates, F., Naveiras, O., Ernst, P., and Daley, G. Q. (2005). Embryonic stem cell-derived hematopoietic stem cells. Proc Natl Acad Sci USA 102, 19081-19086. [0165] Werner, Y., Mass, E., Ashok Kumar, P., Ulas, T., Handler, K., Horne, A., Klee, K., Lupp, A., Schutz, D., Saaber, F., et al. (2020). Cxcr4 distinguishes HSC-derived monocytes from microglia and reveals monocyte immune responses to experimental stroke. Nat Neurosci 23, 351-362. [0166] Yamamizu, K., Matsunaga, T., Uosaki, H., Fukushima, H., Katayama, S., Hiraoka-Kanie, M., Mitani, K., and Yamashita, J. K. (2010). Convergence of Notch and beta-catenin signaling induces arterial fate in vascular progenitors. J Cell Biol 189, 325-338. [0167] Zhang, Y., Liu, T., Meyer, C. A., Eeckhoute, J., Johnson, D. S., Bernstein, B. E., Nusbaum, C., Myers, R. M., Brown, M., Li, W., and Liu, X. S. (2008). Model-based analysis of ChIP-Seq (MACS). Genome Biol 9, R137