Genomic probes
11174507 · 2021-11-16
Assignee
Inventors
Cpc classification
C12Q1/683
CHEMISTRY; METALLURGY
C12Q2565/601
CHEMISTRY; METALLURGY
C12Q2565/601
CHEMISTRY; METALLURGY
C12P19/34
CHEMISTRY; METALLURGY
C12Q2525/185
CHEMISTRY; METALLURGY
C12Q1/6809
CHEMISTRY; METALLURGY
C12Q2525/185
CHEMISTRY; METALLURGY
International classification
C12Q1/683
CHEMISTRY; METALLURGY
C12P19/34
CHEMISTRY; METALLURGY
Abstract
Labeled probes, and methods of use thereof, comprise a Cas polypeptide conjugated to gRNA that is specific for target nucleic acid sequences, including genomic DNA sequences. The probes and methods can be used to label nucleic acid sequences without global DNA denaturation.
Claims
1. A method of customizing a probe for detecting a nucleic acid sequence, comprising: providing a polypeptide comprising the sequence of SEQ ID NO: 2 or SEQ ID NO: 4, which includes a Cas9 polypeptide and a tag configured to bind a secondary label; selecting and attaching the secondary label to the Cas9 polypeptide via the tag to create a labeled Cas9 polypeptide; providing a gRNA specific for a selected target nucleic acid; combining the labeled Cas9 polypeptide and the gRNA in a composition, such that the labeled Cas9 polypeptide to gRNA molar ratio is from 1:1 to 1:20, wherein the labeled Cas9 polypeptide and the gRNA form a complex for use as a probe for detecting the target nucleic acid.
2. The method of claim 1, wherein the secondary label comprises a synthetic dye that is not a fluorescent protein.
3. The method of claim 1, wherein the gRNA is unlabeled.
4. The method of claim 1, wherein the Cas9 polypeptide to gRNA molar ratio is from 1:1 to 1:4.
5. A method of detecting a target nucleic acid in a sample, comprising: providing a composition comprising a polypeptide comprising the sequence of SEQ ID NO: 2 or SEQ ID NO: 4, which includes a Cas9 polypeptide and a tag, a gRNA specific for a target nucleic acid, and a secondary label attached to the Cas9 polypeptide via the tag to provide a labeled Cas 9 polypeptide, wherein the labeled Cas9 polypeptide to gRNA molar ratio is from 1:1 to 1:20, and the Cas9 polypeptide and the gRNA form a complex; contacting the composition with a sample containing genetic material such that the complex can bind target nucleic acid within the sample; and detecting the secondary label to identify binding between the complex and the target nucleic acid.
6. The method of claim 5, and further comprising imaging the sample to determine the location and the relative copy number of the target nucleic acid sequence.
7. The method of claim 5, wherein the sample is selected from chromosome spreads for genetic testing, cultures, prenatal materials, samples for in vitro fertilization, swabs, air filters, water cooling towers, food, drink, hair, stool, urine, saliva, blood, lymph, sputum, cervical smears, sperm, sections of tissues from biopsies, sections of tissues from autopsies, and combinations thereof.
8. The method of claim 5, wherein the sample includes cells, and further comprising performing the contacting step by a method selected from the group consisting of bead loading, microinjection, nanoparticle or lipid mediated transduction, and combinations thereof.
9. The method claim 5, wherein the sample is a cell.
10. The method of claim 9, wherein the cell is a live cell.
11. The method of claim 5, wherein the sample is a tissue sample.
12. The method of claim 5, wherein the sample comprises a cell or tissue, and the method further comprises fixing the sample by contacting the sample with a solution of methanol and acetic acid at a 1:1 ratio; and washing the sample prior to contacting the sample with the composition.
13. The method of claim 5, wherein the secondary label include a first dye having a first emission color, wherein the method further comprises providing a second Cas9 polypeptide with a second tag bound to the second Cas9 polypeptide and a second dye having a second emission color attached to the second Cas9 polypeptide via the second tag to create a second labeled Cas9 polypeptide; providing a second gRNA specific for a selected second target nucleic acid; combining the second labeled Cas9 polypeptide and the second gRNA in a second composition, such that the amount of the second gRNA in the second composition is equal to or greater than the amount of the second labeled Cas9 polypeptide in the second composition, wherein the second labeled Cas9 polypeptide and the second gRNA form a second complex for use as a second probe for detecting the second target nucleic acid; and combining the first complex and the second complex to obtain a combination composition for detecting the target nucleic acid and the second target nucleic acid.
14. The method of claim 13, wherein the Cas9 polypeptide and the second Cas9 polypeptide are the same species of Cas9 polypeptide.
15. The composition of claim 14, wherein the species of Cas9 polypeptide is Streptococcus pyogenes Cas9 (spCas9).
16. The method of claim 5, wherein the Cas9 polypeptide to gRNA molar ratio is from 1:1 to 1:4.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
DESCRIPTION OF EXEMPLARY EMBODIMENTS
(12) The details of one or more embodiments of the presently-disclosed subject matter are set forth in this document. Modifications to embodiments described in this document, and other embodiments, will be evident to those of ordinary skill in the art after a study of the information provided in this document. The information provided in this document, and particularly the specific details of the described exemplary embodiments, is provided primarily for clearness of understanding and no unnecessary limitations are to be understood therefrom. In case of conflict, the specification of this document, including definitions, will control.
(13) The presently-disclosed subject matter includes probes, kits, and methods useful for detecting nucleic acid sequences. Embodiments of the presently-disclosed subject matter can operate with or without requiring denaturation and/or fixation of a sample, and in some embodiments the probes can detect genomic DNA sequences. In this regard, because some embodiments of the presently-disclosed probes do not require denaturation of a sample, imaging methods that utilize the present probes can exclude time-consuming and sample-destroying denaturation steps that are commonly associated with other known imaging techniques. This, in turn, can enhance the rapidity with which the present probes can image nucleic acid sequences, which can be particularly advantageous for processes that are time sensitive, such as certain diagnostic, treatment, or screening processes.
(14) Provided herein is use of in vitro synthesized Cas protein and gRNA molecules followed by in vitro assembly as a programmable and sequence-dependent probe for visualizing genomic DNA in situ. The disclosed in vitro synthesis and in vitro assembly method allow efficient and effective assembly of Cas9 protein, containing any given modification for detection, with any given gRNA and with any given number of gRNAs. All assembled Cas/gRNA complex can be applied at once to its target DNA. Our and others' in vitro studies of the CRISPR system have indicated that Cas9/sgRNA had a strong and stable affinity for its target DNA. Also disclosed herein is a method for imaging multiple target DNA elements with multiple colors, by either applying multiple probes labeled with different colors at once to cells or applying multiple rounds of probe reactions with washing steps in between. These methods allow for multicolored and expansive labeling of genomic sequences in cells and tissues.
(15) Provided herein is use of a Cas/gRNA binary complex as a highly specific and efficient enzymatic probe for labeling nucleic acids, such as DNA, without global denaturation, which is generated by heat or chemical treatments in DNA FISH protocols. Also disclosed herein is a method of exploiting a CRISPR/Cas system for nucleic acid FISH studies, which allow for multicolored and expansive labeling of genomic sequences in cells and tissues.
(16) The presently-disclosed subject matter includes a probe which comprises a Cas polypeptide, a gRNA that is complexed with the Cas polypeptide. The gRNA is specific for a target nucleic acid sequence of interest. The selected gRNA and Cas polypeptide of certain embodiments of the probes disclosed herein are assembled together before applied to a sample. In some instance, Cas polypeptide and gRNA can be applied simultaneously, or in subsequent order, to a sample. The probes also include one or more labels bound to the Cas polypeptide, the gRNA, or both.
(17) Embodiments of the probes disclosed herein can be assembled in vitro. Indeed, the complex probes disclosed herein have been found to be stable after assembly in vitro, allowing multiple probes for distinct target nucleic acid sequences to be applied simultaneously to a sample without significant disassembly and/or reassembly of the complex(es) that would result in unintended combinations of labels and target sequences.
(18) The terms “polypeptide”, “protein”, and “peptide”, which are used interchangeably herein, refer to a polymer of the protein amino acids, or amino acid analogs, regardless of its size or function. Although “protein” is often used in reference to relatively large polypeptides, and “peptide” is often used in reference to small polypeptides, usage of these terms in the art overlaps and varies. The term “polypeptide” as used herein refers to peptides, polypeptides, and proteins, unless otherwise noted. The terms “protein”, “polypeptide”, and “peptide” are used interchangeably herein when referring to a gene product. Thus, exemplary polypeptides include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. Furthermore, the term “fusion polypeptide” is used herein to generally refer to a polypeptide formed from two or more distinct polypeptides.
(19) The terms “polypeptide fragment” or “fragment”, when used in reference to a reference polypeptide, refers to a polypeptide in which amino acid residues are deleted as compared to the reference polypeptide itself, but where the remaining amino acid sequence is usually identical to the corresponding positions in the reference polypeptide. Such deletions can occur at the amino-terminus of the reference polypeptide, the carboxy-terminus of the reference polypeptide, at intermediate regions of the reference polypeptide, or a combination thereof. Additionally or alternatively, some embodiments include alternative combinatory deletions. A fragment can also be a “functional fragment,” in which case the fragment retains some or all of the activity of the reference polypeptide as described herein. For example, a functional fragment of a particular Cas polypeptide variant retains some or all of the Cas-like activity. In some embodiments, the Cas polypeptide fragment and/or variant has up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 residues removed from its C-terminus and/or N-terminus, relative to wild type. In some embodiments, additional residues may be removed. In some embodiments, part or all residues of identified or unidentified domains of Cas9 protein, such as the N-terminal domain, HNH nuclease domain, RuvC nuclease domain, and PAM binding domain, C-terminal domain, can be removed or substituted or inserted with other residues. In some embodiments, the Cas polypeptide fragment and/or variant further includes deletion of residues useful for nuclease activity, for instance, residues in the HNH and RuvC nuclease domains. In some embodiments, the PAM binding domain can be modified to alter PAM motif that Cas9 can recognize.
(20) The term “variant” refers to an amino acid sequence that is different from the reference polypeptide by one or more amino acids, e.g., one or more amino acid substitutions. In some instances, the variant includes amino acid insertions or provides tagging of the polypeptide that differentiates the variant from the reference polypeptide. These variants can modulate properties of the polypeptide, for example, by modulating its activity or stability. In some embodiments, for example, an insertion could include a nuclear localization signal (NLS), a small epitope tag including but not limited to Flag, HA, Myc, Biotin, and Histidine, and polypeptide including but not limited to Halo, SNAP, CLIP, GFP, YFP, RFP, mCherry, and HRP. In some embodiments, for example, an insertion could be at N-terminal, or C-terminal, or internal, or in combination.
(21) Polypeptide mutants, including polypeptide variants and/or polypeptide fragments, can affect various activities of the polypeptide, including, but not limited to, the enzymatic activity, DNA recognition activity, nuclease activity, and/or the targeting activity of a polypeptide. Some embodiments utilize a probe that includes a Cas9 polypeptide to mediate a DNA-FISH process, and can be referred to as “CASFISH” herein.
(22) Cas polypeptides will be known to those of ordinary skill in the art with examples including, but are not limited to, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, and orthologous polypeptide in various microorganism species, and fragments and/or variants thereof. Cas polypeptide has many orthologous genes in different species. For instance, Cas9 include but not limited to Streptococcus pyogenes Cas9 (spCas9), Streptococcus thermophilus Cas9 (St1Cas9), Staphylococcus aureus Cas9 (SaCas9), and Neisseria meningitidis Cas9 (Nm Cas9). In specific embodiments of the presently-disclosed subject matter, the Cas polypeptide includes Streptococcus pyogenes Cas9 (spCas9), and variants and/or fragments thereof.
(23) CRISPR/Cas systems will be known to those skilled in the art and can be used in the probes of the presently-disclosed subject matter, as will become apparent to those skilled in the art upon study of this document. For example, in some embodiments, Type I, Type II, and/or Type II systems could be adapted for use in the present invention.
(24) In some embodiments, the Cas polypeptide is a variant or fragment of a wild type Cas polypeptide. In some embodiments, the Cas polypeptide can be modified to further include an insertion capable of modulating the activity and/or stability of the polypeptide.
(25) Another example of the mutant and/or variant polypeptide is a split version of a Cas polypeptide. For example, a split-Cas polypeptide could include the nuclease lobe and α-helical lobe expressed as separate polypeptides. Another example of the mutant and/or variant polypeptide is a Cas polypeptide that could be engineered to recognize alternative PAM sequences. (reference: Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jul. 23; 523(7561):481-5. doi: 10.1038/nature14592. Epub 2015 Jun. 22.) In other embodiments, two or more Cas polypeptides or its variants can be used, for example, in fusion, to enhance targeting efficiency and/or specificity. In some instance, fusing Cas protein to split fluorescent protein could enhance the specificity since the split fluorescent protein becomes fluorescent only when two adjacent Cas/gRNA simultaneously bind to DNA template. Binding of one Cas/gRNA with half of the fluorescent protein at off-target site would be dark and thus reduce noise. In some instance, an engineered Cas polypeptide and/or gRNA that could sense binding to DNA and trigger fluorescence or other activity, could enhance specificity. For instance, the sensor could be Förster resonance energy transfer (FRET) sensor.
(26) In some embodiments, the Cas polypeptide provided has reduced to no nuclease activity, because nuclease activity could break a double stranded DNA sequence. In other embodiments, the protein can be a wild type protein with full activity. Embodiments where the polypeptide provided has reduced to no nuclease activity provide a probe that primarily functions as a probe for DNA sequences without cutting or altering the sequence of the DNA being imaged. Embodiments of polypeptides with reduced to no nuclease activity can include, for example, dmCas9, which is a Cas9 mutant polypeptide that has, relative to wild type Cas9, reduced to no nuclease activity. For example, SEQ ID NO: 1 provides the nucleic acid sequence of a Halo labeled (tagged) dmCas9 polypeptide. Likewise, SEQ ID NO: 2 provides the protein sequence of SEQ ID NO: 1.
(27) In some embodiments the mutant polypeptide can exhibit modified targeting activity. For instance, in some embodiments the polypeptide is imparted with a nuclear localization signal (NLS) that can assist the polypeptide in being incorporated by the nucleus of a cell. As described herein, embodiments of polypeptides that include a NLS can be incorporated into the nucleus of cell, and in some instances can permit the detection of predetermined genomic DNA sequences in unfixed and/or native samples. For example, SEQ ID NO: 3 provides the nucleic acid sequence of an exemplary Cas9 polypeptide that is Halo tagged and includes the NLS. Likewise, SEQ ID NO: 4 provides the protein sequence of SEQ ID NO: 3.
(28) Embodiments of the probes disclosed herein can also include tags, provided to confer various desired features to the probe, for example, facilitating preparation of the probe, detection of the probe, attachment of labels to the probe, and other desirable features that will be apparent to one of ordinary skill in the art upon study of this document.
(29) In some embodiments, detection of the target nucleic acid is achieved by directly observing the labels on the probe, for example, because of the fluorescence of the probe. In other embodiments, the target nucleic acid is detected from secondary reactions that recognize the activity of the probe, including binding of the probes to the target and/or full or partial nuclease activity of the probe. For example, antibodies against the probe can permit detection. That is, secondary reactions can recognize the activity of the probe, permitting detection. Thus, in some embodiments, the label is not itself detectable until it undergoes one or more reactions following hybridization.
(30) In this regard, a tag can be useful in subsequent secondary labeling. The probe need not be directly labeled, but could instead include a tag, such as a tag comprising an antibody target. Such tag could be used in subsequent secondary labeling, for example, making use of antibodies against the antibody target of the tag, and a secondary labeling reaction can recognize activity of the probe, e.g., probe binding to target and/or full or partial nuclease activity of the probe. As such, in some embodiments, the one or more labels of the probe can be a tag.
(31) Exemplary tags can also include, but are not limited to, a polyhistidine tag, an aldehyde tag, and a HaloTag™ (Promega Corporation, Madison, Wis., USA). Other tags SNAP, CLIP, and numerous fluorescent protein such as GFP, YFP, RFP, TagRFP, tandem tomato and mCherry, and enzyme HRP. Some of these proteins may be phooactivatable or photoswitchable.
(32) In some embodiments, a tag is bound to the Cas polypeptide. In some embodiments the Cas polypeptide is expressed as a fusion protein with the tag. For example, in some embodiments, the Cas polypeptide is expressed as a fusion protein with a HaloTag and/or a polyhistidine tag. In other embodiments, the Cas polypeptide is bound to a particular tag, such as a HaloTag, a polyhistidine tag, and/or an aldehyde tag.
(33) Certain tags are useful for easily labeling the Cas polypeptide with one or more labels. In this regard, although embodiments of the presently-disclosed probes include label-conjugated sgRNA probes, they can be costly. However, making use of labeling the Cas polypeptide using a tag can be efficient and cost effective. The HaloTag is one example, which allow for the Cas polypeptide to be easily labelled with a variety of labels (e.g., fluorescent labels) allowing multiplexing with differently labelled probes. As will be recognized by the skilled artisan, there are various alternatives to the HaloTag, for example, SNAP or CLIP.
(34) As noted herein, embodiments of the presently-disclosed probes can include one or more labels bound to the Cas polypeptide, the gRNA, or both. The probe can be labeled by any means that permit detection of the probe within a sample. Thus, a label is any compound or element that permits detection of the probe within a sample, directly or indirectly, including by subsequent secondary labeling.
(35) Examples of labels that can be used in the presently-disclosed probes include, but are not limited to fluorescent labels and fluorophores (e.g. cyanine dyes (Cy dyes), Alexas Fluor dye series, Quasar dyes), dyes, quantum dots, gold particles, radioactive labels, magnetic particles, enzymes, catalysts, spectrophotometric labels, and other analytes for microscopy or other detection methods, such as MRI, CAT or PET. Additional non-limiting examples include Alexa 488, DY547, Cy5, JF549, and JF646. It will be recognized that dyes that can be conjugated to a protein and a nucleic acid can be used in connection with the present invention.
(36) In some embodiments wherein the polypeptide is labeled, the probe can exhibit increased sensitivity relative to other DNA probes. Without being bound by theory, the increased sensitivity is believed to be at least partially due to the fact that polypeptides can be capable of accepting a higher concentration of labels relative to other known probes that are comprised of nucleic acids.
(37) In some embodiments, the Cas polypeptide is bound to the one or more labels. In some embodiments, the gRNA is bound to the one or more labels. In some embodiments, both the Cas polypeptide and the gRNA are bound to the one or more labels. In some embodiments, each of the multiple labels has a distinct emission color. As will be recognized by one of ordinary skill in the art upon study of this document, where there are multiple labels associated with a probe specific for a particular nucleic acid sequences, there is an ability to amplify the signal associate with detection of that target sequence. In this manner, detection of lower copy nucleic acid sequences can be facilitated.
(38) The presently-disclosed subject matter also beneficially allows for multicolor and/or multiplex probes, the understanding of examples of which can be facilitated with reference to
(39) In some embodiments, the probe can include a Cas polypeptide and multiple gRNAs specific for one or more additional target nucleic acid sequence, wherein each gRNA is complexed with the Cas polypeptide. In some embodiments, the probe can also include multiple labels are bound to the Cas polypeptide, the gRNA, or both. In some embodiments, multiple labels are bound to the Cas polypeptide. Such multiple labels can be bound to the Cas polypeptide, for example via a tag, such as a HaloTag. In some embodiments, each label has a distinct emission color. In some embodiments, the labels are selected from Alexa 488, DY547, Cy5, JF549, and JF646.
(40) In some embodiments, there are a series of probes, each probe comprising a gRNA complexed with a Cas polypeptide, wherein each gRNA is specific for a distinct target nucleic acid sequence, and each probe includes a label having a distinct emission color. In some embodiment, the labels are bound to the Cas polypeptides, the gRNAs, or both. In some embodiments, the labels are bound to each of the Cas polypeptides. Such labels can be bound to the Cas polypeptides, for example via a tag, such as a HaloTag. In some embodiments, each label has a distinct emission color. In some embodiments, the labels are selected from Alexa 488, DY547, Cy5, JF549, and JF646. With reference to
(41) As noted here, the presently-disclosed probes further include a gRNA specific for a target nucleic acid sequence, which gRNA is complexed with the Cas polypeptide. In some embodiments of the present probes can include molar ratios of Cas polypeptide to gRNA at a molar ratio of 1:1 to 1:4. A large range of molar ratio can be used to enhance Cas/gRNA complex formation and optimize imaging results. When Cas polypeptide is labeled, equal or more gRNA, at 1:1, 1:2, 1:3, . . . 1:20 or even more is reacted together to enhance complex formation. When gRNA is labeled, equal or more Cas polypeptide is used. When both are labeled, use 1:1 ratio. Variation in ratios may still give good results once followed by extensive wash steps.
(42) The term “gRNA” is used herein to refer to an RNA sequence selected to specifically target a particular nucleic acid sequence of interest (a “target nucleic acid sequence” or a “predetermined nucleic acid sequence”). Complexing between a Cas polypeptide and a gRNA can include the binding of the gRNA and polypeptide by covalent bonding, hydrogen bonding, and/or other non-covalent bonding, and is well-understood in the field of CRISR/Cas systems. Exemplary gRNAs can therefore comprise a section that is targeted for a particular nucleic acid sequence of interest and section that is for binding to the Cas polypeptide, and these sections may or may not be mutually exclusive from one another. Moreover, additional sections may optionally be included in the gRNA.
(43) In some embodiments the present probes include a polypeptide that is conjugated to guide RNA (gRNA), wherein the gRNA is targeted to a predetermined nucleic acid sequence. In some embodiments, the gRNA has a target section. In some embodiments, the gRNA targets and hybridizes with the target nucleic acid sequence. The gRNA can comprise a single RNA molecule in some instances, and in other embodiments the gRNA can be assembled from two or more RNA molecules. The two or more RNA molecules individually may or may not be able to conjugate with the polypeptide, and may or may not target the predetermined nucleic acid sequences. However, upon assembly, the gRNA will perform to target a predetermined nucleic acid sequence.
(44) The gRNA molecules utilized in embodiments of the present probes can vary in sequence length. The portion of the gRNA that has complementarity to a target nucleic acid sequence, the target section, can also vary in length, and can be selected so that the gRNA targets the target nucleic acid sequences (or “particular nucleic acid sequences of interest” or “predetermined nucleic acid sequences”) of different lengths. In some embodiments the portion of the gRNA targeted to a predetermined nucleic acid sequence, the predetermined nucleic acid sequence, or the entire gRNA sequence is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more nucleic acids in length. In some preferred embodiments, the target section of the gRNA is about 15-25 nucleic acids in length. In some embodiments, the gRNA has a section binding to the polypeptide but not the target nucleic acid. In some embodiments, this section is about 80 to about 100 nucleic acids in length, more preferably about 90 nucleic acids in length.
(45) Methods and tools for designing gRNAs are known to those of ordinary skill in the art. For example, there are multiple publicly-available tools that can be accessed at the following sites: crispr.mit.edu/; chopchop.rc.fas.harvard.edu/; www.e-crisp.org/; crispr.cos.uni-heidelberg.de/
(46) The terms “target,” “targeting,” and the like refer to the characteristic of a compound being selectively drawn to and/or selectively bound a target compound. For instance, gRNA that targets a predetermined DNA sequence is drawn to and/or selectively binds the predetermined DNA sequence. In some embodiments a gRNA molecule is said to target a predetermined DNA sequence when the gRNA is hybridizable with the predetermined DNA sequence, wherein the term “hybridize” refers to the binding (e.g., non-covalent binding) of one nucleic acid sequence to another nucleic acid sequence in a sequence specific manner. Hybridizable sequences can therefore be referred to as “complementary” sequences herein.
(47) In some instances 100% complementarity of the target section of a nucleic acid (e.g., gRNA) to its target nucleic acid (e.g., DNA) is not required for hybridization. In some instances, a nucleotide can hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). The target section of a nucleotide can comprise at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% sequence complementarity to a hybridizable target sequence.
(48) “Complementarity” refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). “Perfectly complementary” means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. “Substantially complementary” as used herein refers to a degree of complementarity that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
(49) As used herein, “stringent conditions” for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part 1, Second Chapter “Overview of principles of hybridization and the strategy of nucleic acid probe assay”, Elsevier, N.Y.
(50) “Hybridization” refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is referred to as the “complement” of the given sequence.
(51) The terms “nucleotide,” “polynucleotide,” “nucleic acid,” and “nucleic acid sequence” are also used herein to refer to deoxyribonucleotides or ribonucleotides and polymers thereof in either single or double stranded form. Unless specifically limited, the terms encompass nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified versions thereof (e.g., degenerate codon substitutions) and complementary sequences and as well as the sequence explicitly indicated. Thus, the term nucleotide and the like is inclusive of the gRNAs that are described herein.
(52) The terms “predetermined nucleic acid sequence,” “target nucleic acid sequence,” and “particular nucleic acid sequence of interest” refer to a nucleic acid sequence of a nucleic acid molecule that is known and was chosen before synthesis of the gRNA in accordance with the invention disclosed herein. Accordingly, in its broadest sense the expression “target nucleic acid sequence” indicates merely that target nucleic acid sequence has a particular known sequence.
(53) The target nucleic acid sequence can be selected from a DNA sequence, an RNA sequence, or a sequence of another nucleic acid analogue such as but not limited to peptide nucleic acid (PNA), Morpholino and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). In some embodiments, the target nucleic acid sequence is a nucleic acid molecule in which one or more nucleotides have been modified such as but not limited to methylation, and hydroxymethylation. As noted herein, the target nucleic acid sequence can be in native DNA that has not been denatured, and the target nucleic acid sequence can be within chromosomal DNA that has not been denatured.
(54) The target nucleic acid sequence can be contained in any sample containing genetic material. In this regard, the probes, kits, and methods disclosed herein are useful for detecting and imaging target nucleic acid sequence(s) in a sample(s) containing genetic material.
(55) The sample types are not particularly limited so long as the samples comprise genetic material. In some embodiments, the cell is a human cell. In some embodiments, the sample comprises a virus, bacteria or fungus. In some embodiments, the sample is a cell. The cell can be a live cell or a fixed cell. The cell can be a plant cell or an animal cell. In some embodiments the sample includes an entire native chromosome and/or a portion of a native chromosome. In some embodiments, the cell can be a human cell.
(56) Thus, in some embodiments the samples include cells obtained from a subject. Exemplary samples from a subject may include chromosome spreads for genetic testing, cultures, prenatal materials, samples for in vitro fertilization, swabs, air filters, water cooling towers, food, drink, hair, stool, urine, saliva, blood, lymph, sputum, cervical smears, sperm, sections of tissues from biopsies, sections of tissues from autopsies, and the like. Samples can include fixed tissue samples by various fixation methods known in the art. Examples of chemical fixation include formaldehyde, paraformaldehyde, formamide, glutaraldehyde, Tween-20 and HCl, acetic acid and methanol, and other aldehydes and alcohols.
(57) The presently-disclosed subject matter further includes kits, which include probes or components of probes as disclosed herein. Exemplary kits can include a Cas polypeptide, a gRNA specific for a target nucleic acid sequence for complexing with the Cas polypeptide, and a label capable of being bound to the Cas polypeptide, the gRNA, or both. In some embodiments the kits are provided with a label is already bound to the Cas polypeptide. Subsequently, prior to performing an imaging procedure, one may mix the components of the kits to obtain a probe or collection of probes. The ability to store the probes as kits that include separate components permits one to synthesize the polypeptide separately from the gRNA. Maintaining the components separate from one another can also increase the shelf life of certain embodied probes relative to probes that stored in a state wherein the polypeptide and gRNA are already assembled or relative other known probes.
(58) Additionally, the present probes and kits permit for a wide variety of customization and configuration of the probes. For instance, because each probe is not individually labeled, but instead the polypeptides can all be labeled in advance, different probes can be synthesized by conjugating the labeled polypeptides to different gRNA. Thus, a set of labeled polypeptides can be adapted for use as probes for a variety of different predetermined sequences with relative ease by altering the gRNA that is conjugated to the polypeptides. This can present significant cost savings over other known probes that are preassembled and are each individually labeled for specific DNA sequences.
(59) In some embodiments, the kit further includes a tag, as described herein. In some embodiments of the kit, the label is a tag for use in subsequent secondary labeling. In some embodiments, the tag comprises an antibody target and the kit further includes an antibody against the antibody target.
(60) In some embodiments, the kit also includes reagents for preparing a sample containing the target nucleic acid sequence. For example, the kit can include reagents for fixing the sample, as described herein, or by any method known in the art.
(61) The presently-disclosed subject matter further relates to methods for imaging nucleic acids using the presently-disclosed probes. As noted herein, such methods allow for detection and/or visualization of the target nucleic acid sequence and/or a sample containing the target nucleic acid sequence without denaturing the nucleic acid, e.g., without denaturing double-stranded, chromosomal DNA), which can be detrimental to morphology of cells, nuclei, and chromosomes. In this regard, the method can allow for subnuclear localization of sequences in a cell, and for visualizing thee three-dimensional organization of chromosomes in nuclei.
(62) In some embodiments the methods comprise contacting a sample that includes nucleic acid with a probe, and then detecting whether the probe has bound the target nucleic acid sequence. The presence of probe bound to a nucleic acid molecule indicates that the nucleic acid molecule comprises the target nucleic acid sequence to which the probe is targeted. Methods disclosed herein can also involve imaging the sample to determine the location and/or the relative copy number of the target nucleic acid sequence.
(63) The contacting step can also be performed by any known means that bring the probes into direct contact with the sample. In some embodiment, such as embodiments for imaging live cells, the present probes can be contacted to the live cells by delivering the probes using methods such as bead loading, microinjection, nanoparticle or lipid mediated transduction, and the like. Thus, live cell imaging can be performed by delivering probes on or into cells that are in a sample of interest.
(64) Any of the embodiments of the probes as described herein can be used in accordance with the methods of the presently disclosed subject matter, with benefits of the particular selection of the probe(s) being apparent to one of ordinary skill in the art upon study of this document and in view of the desired determination, sample, and target nucleic acid sequence. In some embodiments, the probe includes a Cas polypeptide and multiple gRNAs, each specific for one or more additional target nucleic acid sequence, wherein each gRNA is complexed with the Cas polypeptide; and the method involves detecting whether the probe binds each of the target nucleic acid sequences, wherein binding of the probe to the nucleic acids indicates the presence of the target nucleic acid sequences in the sample. In some embodiments, there is a series of probes, each probe comprising a gRNA complexed with a Cas polypeptide, each gRNA being specific for a distinct target nucleic acid sequence, and each probe including a label having a distinct emission color; and the method involves simultaneously detecting whether the probes bind each of the multiple target nucleic acid sequences. As desired, the method can include imaging the sample to determine the location and/or relative copy number of each of the multiple target nucleic acid sequences.
(65) The detecting and/or imaging step can be performed by any known means, including any known means currently used for fluorescent in situ hybridization imaging. In some embodiments the detecting step is performed with a process that includes magnetic resonance imaging (MRI), x-ray computed tomography (CAT), positron emission tomography (PET), or combinations thereof.
(66) Embodiments of the present probes have the superior and unexpected capability of detecting genomic or native nucleic acids. Known probes are commonly composed of nucleic acid sequences and require fixation and denaturization of DNA in order to detect certain sequences on the DNA. However, embodiments of the present probes are comprised of a polypeptide conjugated with gRNA, and, notwithstanding their relatively large size, are capable of penetrating native DNA to probe for specific predetermined genomic DNA sequences. Embodiments of the present probes can penetrate the nucleus and/or native DNA. In this respect, the polypeptides that comprise certain embodiments of present probes can be mutated to provide enhanced penetration and binding of native DNA sequences.
(67) Embodiments of the present probes can also expedite the entire imaging process because they include the novel characteristic of not requiring fixation and/or denaturization of a sample. For instance, some implementations of the present imaging methods can be performed in about 0.1 hours, 0.5 hours, 1.0 hours, 1.5 hours, 2.0 hours, 2.5 hours, or 3.0 hours. Of course, there may be difficult samples that are performed in longer time frames; however, one advantage of the presently disclosed subject matter is the relatively expeditious process.
(68) Additionally, in some instances a method for imaging is provided that includes providing two or more probes, wherein each probe is targeted to a different predetermined DNA sequence. The probes can be targeted to different nucleic acid sequences by forming the probes with different gRNA. Additionally, each probe that is targeted to a predetermined nucleic acid sequence can be labeled differently, either by using different types of labels on each type of probe or by using labels that emit different fluorescence on each type of probe. After contacting the sample with the two or more probes, one can identify whether any, some, or all of the different types of probes are bound to a nucleic acid sequence. By applying and imaging the different probes together, a “spectral barcode” that includes the point sources of signals from each of the respective types of probes can be created. This permits the visualization and characterization of two or more different predetermined DNA sequences within a sample. This method is referred to herein as two-color CASFISH or multicolor CASFISH.
(69) As described herein, embodiments of the present imaging methods can be provided for the purpose of studying and characterizing translocations within a genetic sample. Some embodiments that do not require fixation and/or denaturization of a nucleic acid sample advantageously can image native chromosomes, thereby permitting relatively easy identification of potential translocations within the sample.
(70) In other embodiments, the present imaging methods can be provided for the purpose of diagnosing or prognosing certain diseases and conditions. Notably, because certain methods can be performed without fixation and hybridization protocols, some embodiments offer a relatively rapid assay for diagnosing or prognosing a subject. This rapidity can be particularly beneficial in time sensitive situations, such diagnostic methods that are performed during surgery to determine the diagnosis and immediate treatment required.
(71) In some embodiments, the target nucleic acid sequence is associated with a disease or condition. In this regard, the sample is obtained from a subject, and the method further involves identifying an increased likelihood of the subject having or developing the disease or condition if the target nucleic acid sequence is detected in the sample and/or the imaging of the sample in indicative of an increased likelihood of the subject having or developing the disease or condition. Although not necessary, in some embodiments, the method can include fixing the sample and/or obtaining a sample that is fixed, as is often common clinical practice.
(72) The terms “diagnosing” and “diagnosis” as used herein refer to methods by which the skilled artisan can estimate and even determine whether or not a subject is suffering from a given disease or condition. Along with diagnosis, making a “prognosis” or “prognosticating” can refer to predicting a clinical outcome (with or without medical treatment), selecting an appropriate treatment (or whether treatment would be effective), or monitoring a current treatment and potentially changing the treatment, based on the presence of a predetermined DNA sequence and/or particular gene in a sample associated with a subject.
(73) “Prognosticating” as used herein refers to methods by which the skilled artisan can predict the course or outcome of a condition in a subject. The term “prognosis” can refer to the ability to predict the course or outcome of a condition with up to 100% accuracy, or predict that a given course or outcome is more or less likely to occur. The term “prognosis” can also refer to an increased probability that a certain course or outcome will occur; that is, that a course or outcome is more likely to occur in a subject exhibiting a mutation, inversion, addition, and/or deletion in the gene, when compared to those individuals not exhibiting the mutation in the gene. In certain embodiments, a prognosis is about a 5% chance of a given expected outcome, about a 7% chance, about a 10% chance, about a 12% chance, about a 15% chance, about a 20% chance, about a 25% chance, about a 30% chance, about a 40% chance, about a 50% chance, about a 60% chance, about a 75% chance, about a 90% chance, or about a 95% chance. If an accurate prognosis can be made, appropriate therapy, and in some instances less severe therapy or more effective therapy, for the patient can be chosen.
(74) Furthermore, the term “subject” is inclusive of human, plant, animal, bacteria, virus other microorganisms, and any subject containing genetic material. Thus, veterinary uses are provided in accordance with the presently disclosed subject matter and the presently-disclosed subject matter provides methods for preventing oxidative damage in mammals such as humans, as well as those mammals of importance due to being endangered; of economic importance, such as animals raised on farms for consumption by humans; and/or animals of social importance to humans, such as animals kept as pets or in zoos. Examples of such animals include but are not limited to: carnivores such as cats and dogs; swine, including pigs, hogs, and wild boars; ruminants and/or ungulates such as cattle, oxen, sheep, giraffes, deer, goats, bison, and camels; and horses. Thus, also provided is the treatment of livestock, including, but not limited to, domesticated swine, ruminants, ungulates, horses, poultry, and the like.
(75) In this regard, diagnosis or prognosis can be accomplished by providing probes having gRNAs that are selective for nucleic acid sequences, including DNA sequences and/or genes, that are known to cause and/or are associated with a particular disease or condition, and/or are associated with an increased risk or likelihood of developing a particular disease or condition. The diseases and conditions that can be diagnosed or prognosed by the present methods are not particularly limited, and those of ordinary skill will recognize a multitude of known genes that can be probed to diagnose or prognose for a particular disease or condition. Such diseases and conditions can include, but are not limited to, various types of genetic abnormalities, cancer, and other diseases and conditions. Specific diseases and conditions that may be diagnosed or prognosed including, but not limited to, acute and chronic leukemia including chronic myelogenous leukemia and acute promyelocytic leukemia, lymphoma; multiple myeloma, breast cancer, lung cancer, colon cancer, prostate cancer, sarcomas and tumors of mesenchymal origin, brain tumors including oligodendroglioma, Alzheimer's disease, Parkinson's disease, epilepsy, amyotrophic lateral sclerosis, multiple sclerosis, stroke, autism, Cri du chat, lp36 deletion syndrome, Angelman syndrome, Prader-Willi syndrome, Velocardiofacial syndrome, Turner syndrome, Klinefelter syndrome, Edwards syndrome, Down syndrome, Patau syndrome, and trisomies 8, 9 and 16, and the like. Additional uses can be for detection of viral infection and integration and parasitic microorganisms (e.g. malaria causing Plasmodium). Use of the presently disclosed methods may also be used in genetic tests in agriculture, botanical studies, and breeding.
(76) Those of ordinary skill will recognize that the presently-disclosed imaging methods, which may be inclusive of methods for diagnosis or prognosis, can be further optimized and modified. In some instances the present probes and methods may be modified to be compatible with a broader range of sample types and application purposes. With respect to methods that include a fixation step, such optimizations can include, but are not limited to, varying the ratio of acetic acid and methanol, treatment time, permeablizing formide, and paraformaldehyde for fixing samples.
(77) The presently-disclosed subject matter also includes methods of assembling a probe, as described herein, including methods of assembling a probe in vitro. In some embodiments, the method of assembling a probe in vitro involves selecting a gRNA capable of targeting a nucleic acid sequence of interests, which is optionally labeled the gRNA; providing a Cas polypeptide, which is optionally labeled, wherein at least one of the gRNA and the Cas polypeptide is labeled; mixing and incubating the gRNA and the Cas polypeptide.
(78) The presently-disclosed subject matter further includes a probe, as disclosed herein, which is bound to or in complex with the target nucleic acid sequence(s) and/or wherein the probe is bound to the target nucleic acid sequence of each gRNA. The presently-disclosed subject matter further includes a series of probes, each bound to or in complex with the target nucleic acid sequence(s) and/or wherein each probe of the series is bound to the target nucleic acid sequence of each gRNA. As such, a sample including probe-bound nucleic acid sequences is inclusive of the presently-disclosed subject matter.
(79) The presently-disclosed subject matter is further illustrated by the following specific but non-limiting examples. The following examples may include compilations of data that are representative of data gathered at various times during the course of development and experimentation related to the present invention.
EXAMPLES
(80) The following examples use fluorescently labeled nuclease-deficient Cas9 (dCas9) protein assembled with various single-guide RNA (sgRNA), to demonstrate rapid and robust labeling of repetitive DNA elements in pericentromere, centromere, G-rich telomere, and coding gene loci. Assembling dCas9 with an array of sgRNAs tiling arbitrary target loci, enable the visualization of nonrepetitive genomic sequences. As provided in the following examples, the dCas9/sgRNA binary complex is stable and binds its target DNA with high affinity, allowing sequential or simultaneous probing of multiple targets. The examples provided herein also demonstrate CASFISH assays using differently colored dCas9/sgRNA complexes that allow multicolor labeling of target loci in cells.
(81) Materials and Methods
(82) Sd dCas9 Constructs and Purification.
(83) The S. pyogenes Cas9 gene containing the double nuclease mutation (D10A and H840A; dCas9) was cloned into PET302/N (Invitrogen) with an N-terminal hexahistidine affinity tag and a C-terminal Halo tag. A construct with an additional N-terminal aldehyde tag was generated for aldehyde-specific Cy5 labeling (13). All dCas9 fusion proteins were expressed and purified through a three-step FPLC purification protocol as described herein.
(84) dCas9 FPLC.
(85) All dCas9 fusion proteins were expressed and purified through a three-step FPLC purification protocol, as described (20), with the following modifications. Briefly, the protein was expressed in E. coli BL21 (DE3) (Agilent Technologies) and was grown in LB medium at 16° C. overnight following induction with 1 mM isopropyl β-d-1-thiogalactopyranoside (IPTG). Cells were lysed in 50 mM sodium phosphate (pH 7.0) and 300 mM NaCl. Clarified lysate was applied to a 1-mL HisTALON (Clontech) affinity column. The bound protein was eluted in 50 mM sodium phosphate (pH 7.0) and 300 mM NaCl by increasing the imidazole concentration to 150 mM and was exchanged into buffer [50 mM Hepes (pH 7.5), 100 mM KCl, 1 mM TCEP] by a 50,000-MWCO centrifugal filter (Millipore Amicon). The protein was purified further with cation ion exchange chromatography (HiTrap SP HP; GE Healthcare) and was eluted with a linear gradient of buffers containing 0.1-1.0 M KCl. The eluted protein was purified further by gel filtration chromatography on a Superdex 200 16/60 column (GE Healthcare) in buffer containing 50 mM Hepes (pH 7.5), 150 mM KCl, and 1 mM TCEP. Protein was stored at −80° C. with additional 20% glycerol.
(86) Live-Cell Imaging of Pericentromeres.
(87) MEFs were transfected with mammalian expression plasmids containing dCas9-Halo and sgMajSat. At 48 h posttransfection, cells were incubated with 300 nM of JF549-Halo ligands for 15 min at 37° C. in a cell incubator. Cells subsequently were washed twice with warm PBS, incubated with fresh and warm medium for another 30 min, washed twice with warm PBS, and changed to fresh medium before imaging.
(88) Immunofluorescence Staining.
(89) The cells were blocked in 1% BSA/10% normal goat serum/0.3 M glycine in 0.1% PBS-Tween 20 for 1 h and then were incubated with Alexa 488-conjugated anti-HP1α antibody (ab185018; Abcam) at a working dilution of 1:50 overnight at 4° C. The cells were washed with PBS and stained with DAPI before imaging. Alexa 488 labeling was imaged using a white light excitation system (SOLA light engine; Lumencor) in conjunction with the proper filter cube sets (CFP-A-Basic-NTE; Semrock).
(90) dCas9 Fluorescent Labeling.
(91) For Halo domain labeling, fluorescent Halo ligands (JF549 and JF646) were mixed in protein samples at ratio of 8:1 and reacted at room temperature for 30 min followed by incubation at 4° C. overnight. The dCas9-Halo with an aldehyde tag was fluorescently labeled with Cy5 hydrazide (GE Healthcare) as described (13). The excessive unreacted fluorescent Halo ligand or Cy5 hydrazide was removed using 40-K molecular weight cut off (MWCO) Zeba spin desalting columns (Thermo Scientific). Protein was eluted in storage buffer containing 50 mM Hepes (pH 7.5), 150 mM KCl, 1 mM Tris(2-carboxyethyl)phosphine (TCEP), and 10% (vol/vol) glycerol, snap frozen in liquid nitrogen, and stored at −80° C. Protein concentration and labeling efficiency were calculated from absorption spectrum and extinction coefficients according to Beer's laws.
(92) sgRNA Synthesis.
(93) The DY547-labeled sgMaj Sat was generated by splint ligation of two fragments: 36 synthetic nucleotides 5′ of sgMaj Sat with DY547 (GE Dharmacon), and 77 nucleotides 3′ of sgMaj Sat transcribed and purified with T7. The unlabeled sgRNAs were synthesized in vitro by T7 RNA polymerase (MEGAshortscript T7 Kit; Life Technologies) using DNA templates with the following sequence, 5′-TAATACGACTCACTATAGGN17-28GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGT TATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3′ (SEQ ID NO: 8). The template contains a T7 promoter-binding sequence (underlined), the sgRNA target (GGN17-28) (bold), and the sgRNA backbone as reported (6). The T7 template DNA was synthesized by either gBlock (Integrated DNA Technologies) or PCR reactions. Produced sgRNAs were purified by MEGAclear Transcription Clean-Up Kit (Life Technologies), and the quality was verified by 10% denaturing PAGE. Related sequences are listed in Tables 1-3.
(94) TABLE-US-00001 TABLE 1 Synthesis of DY547-labeled sgMajSat by splint ligation 5′-sgMajSat DY547-CCAUAUUCCACGUCCUACAGGUUUAAGAGCUAUGCU (SEQ ID NO: 9) 3′-sgMajSat GGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUC- AACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (SEQ ID NO: 10) sgMajSat-bridge AAACTTGCTATGCTGTTTCCAGCATAGCTCTTAAACCTGT (SEQ ID NO: 11)
(95) TABLE-US-00002 TABLE 2 Synthesis of DNA template for T7 transcription of sgRNA: T7 transcription template sequences synthesized by gBlock gBlock_sgMajSat GGTGACACTATAGAACTCGAGCAGCTGGATCCTAATACGACTCACTATAGGCCATAT (SEQ ID NO: 12) TCCACGTACAGGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCT AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC gBlock_sgTelomere GGTGACACTATAGAACTCGAGCAGCTGGATCCTAATACGACTCACTATAGGGTTAGG (SEQ ID NO: 13) GTTAGGGTTAGGGTTAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATA AGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC gBlock_sgMinSat GGTGACACTATAGAACTCGAGCAGCTGGATCCTAATACGACTCACTATAggATCTAT (SEQ ID NO: 14) TATGTTCTACAGTGGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAG GCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC gBlock_sgMBS GGTGACACTATAGAACTCGAGCAGCTGGATCCTAATACGACTCACTATAGGTCGACT (SEQ ID NO: 15) CTAGAAAACATGGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGC TAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC Design of the T7 transcription template (TAATACGACTCACTATAGGN17-28GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC)(SEQ ID NO: 8). Lowercase “g” denotes additional guanines that are not complementary to sgRNA targets
(96) TABLE-US-00003 TABLE 3 T7 transcription template synthesized by PCR Table 3 Sequence name Sequence Design of the forward TAATACGACTCACTATAGGN.sub.17-28GTTTAAGAGCTATGCTGG primers (SEQ ID NO: 16) sgRNA backbone TAATACGACTCACTATAGGGTTTAAGAGCTATGCTGG (SEQ ID NO: 17) sgMUC4-I1 TAATACGACTCACTATAgGAGGTGACACCGTGGGCTGGGGGTTTAAGAGCTATGCTGG (SEQ ID NO: 18) sgMUC4-E2 TAATACGACTCACTATAgGAAGTGTCGACAGGAAGAGTTTAAGAGCTATGCTGG (SEQ ID NO: 19) sgMUC1-E2 TAATACGACTCACTATAgGAAGGTATGGGTGTGGAAGGTATGTTTAAGAGCTATGCTGG (SEQ ID NO: 20) sgMUC4-tiling forward primers sgMUC4_01 TAATACGACTCACTATAgGAAGAGTGGAGGCCGTGCGCGGGTTTAAGAGCTATGCTGG (SEQ ID NO: 21) sgMUC4_02 TAATACGACTCACTATAgGACCTCAGGTGATCTCCTGCCTGTTTAAGAGCTATGCTGG (SEQ ID NO: 22) sgMUC4_03 TAATACGACTCACTATAgGTATATTTAGTAGAGACGGTTTAAGAGCTATGCTGG (SEQ ID NO: 23) sgMUC4_04 TAATACGACTCACTATAgGAGTAGCTGGAATTACAGGTGGTTTAAGAGCTATGCTGG (SEQ ID NO: 24) sgMUC4_05 TAATACGACTCACTATAgGCTCACTGCAACCTCCACCTCCCGTTTAAGAGCTATGCTGG (SEQ ID NO: 25) sgMUC4_06 TAATACGACTCACTATAgGACAGAGTCTCGCTCTCTCTCCCGTTTAAGAGCTATGCTGG (SEQ ID NO: 26) sgMUC4_07 TAATACGACTCACTATAgGAAGAGGAGAAAAGTGGGGAAGGTTTAAGAGCTATGCTGG (SEQ ID NO: 27) sgMUC4_08 TAATACGACTCACTATAgGAACAGAGGGCCAGAGAGCAGCCGTTTAAGAGCTATGCTGG (SEQ ID NO: 28) sgMUC4_09 TAATACGACTCACTATAgGTCTTTCTCTCTGCGAGTAAGCCTGTTTAAGAGCTATGCTGG (SEQ ID NO: 29) sgMUC4_10 TAATACGACTCACTATAgGTACACCCTTGTGTACAGAGCTGTTTAAGAGCTATGCTGG (SEQ ID NO: 30) sgMUC4_11 TAATACGACTCACTATAgGAAAACTCATGTAAAGCTGCAGTTTAAGAGCTATGCTGG (SEQ ID NO: 31) sgMUC4_12 TAATACGACTCACTATAgGCAAGCAAGGGAAGCGACAAGGGTTTAAGAGCTATGCTGG (SEQ ID NO: 32) sgMUC4_13 TAATACGACTCACTATAGGAGGCGGCCAGGGCGCAGAGTTTAAGAGCTATGCTGG (SEQ ID NO: 33) sgMUC4_14 TAATACGACTCACTATAgGCTTTTAAACCCGAGCTCAGGTTTAAGAGCTATGCTGG (SEQ ID NO: 34) sgMUC4_15 TAATACGACTCACTATAgGTAGCCCCGGCATTGGCCTTGTTTAAGAGCTATGCTGG (SEQ ID NO: 35) sgMUC4_16 TAATACGACTCACTATAgGCCTGTGGGAGATGTTCCCTCGTTTAAGAGCTATGCTGG (SEQ ID NO: 36) sgMUC4_17 TAATACGACTCACTATAgGTCCTGAAGCCAGAGGGACAGCCGTTTAAGAGCTATGCTGG (SEQ ID NO: 37) sgMUC4_18 TAATACGACTCACTATAgGAGTCTTTGGGGGAGAGTCTGTTTAAGAGCTATGCTGG (SEQ ID NO: 38) sgMUC4_19 TAATACGACTCACTATAgGCTCCTGCCCTGCCTCTCAGCGTTTAAGAGCTATGCTGG (SEQ ID NO: 39) sgMUC4_20 TAATACGACTCACTATAgGCATATTTGAGGAGCTTCCTGTTTAAGAGCTATGCTGG (SEQ ID NO: 40) sgMUC4_21 TAATACGACTCACTATAGGCTGCAAGAGAAGCCATGCGTTTAAGAGCTATGCTGG (SEQ ID NO: 41) sgMUC4_22 TAATACGACTCACTATAgGATGTTTCAGGACTAGGCTGAGTTTAAGAGCTATGCTGG (SEQ ID NO: 42) sgMUC4_23 TAATACGACTCACTATAgGCTGGAGGGTGGGGAGGTGTAGTTTAAGAGCTATGCTGG (SEQ ID NO: 43) sgMUC4_24 TAATACGACTCACTATAGGTGGGATGAGCACTGGAGCGTTTAAGAGCTATGCTGG (SEQ ID NO: 44) sgMUC4_25 TAATACGACTCACTATAgGCCCTGCAGATGTGGTTGAGTTTAAGAGCTATGCTGG (SEQ ID NO: 45) sgMUC4_26 TAATACGACTCACTATAgGAGGCTGGGGCTTGGGGCGCCGTTTAAGAGCTATGCTGG (SEQ ID NO: 46) sgMUC4_27 TAATACGACTCACTATAgGTCTTTGCCGTGAACTGTTCGTTTAAGAGCTATGCTGG (SEQ ID NO: 47) sgMUC4_28 TAATACGACTCACTATAgGACCGGGGCCCTGGGGAGACACGTTTAAGAGCTATGCTGG (SEQ ID NO: 48) sgMUC4_29 TAATACGACTCACTATAgGCTGGACACTCAGCTCCATGGTTTAAGAGCTATGCTGG (SEQ ID NO: 49) sgMUC4_30 TAATACGACTCACTATAgGAGCGCAGAGGGGCAAGACCTGTTTAAGAGCTATGCTGG (SEQ ID NO: 50) sgMUC4_31 TAATACGACTCACTATAgGAGAAGGAGTGAAGGACTGTGTTTAAGAGCTATGCTGG (SEQ ID NO: 51) sgMUC4_32 TAATACGACTCACTATAgGCTCCACGACATGCCTAGCTTCTTCGTTTAAGAGCTATGCTGG (SEQ ID NO: 52) sgMUC4_33 TAATACGACTCACTATAgGAGCTGGGCCAGGAGAGGAGAGTTTAAGAGCTATGCTGG (SEQ ID NO: 53) sgMUC4_34 TAATACGACTCACTATAgGACCGGGCATGACCAGGGCCTGTTTAAGAGCTATGCTGG (SEQ ID NO: 54) sgMUC4_35 TAATACGACTCACTATAGGGCAGCCCCCACCCCCACAGTTTAAGAGCTATGCTGG (SEQ ID NO: 55) sgMUC4_36 TAATACGACTCACTATAgGTTCCTTTTGGCTCCCTGAAGGTTTAAGAGCTATGCTGG (SEQ ID NO: 56) sgMUC4_37 TAATACGACTCACTATAGGGTCTGTTTGCACACTTGCGTTTAAGAGCTATGCTGG (SEQ ID NO: 57) sgMUC4_38 TAATACGACTCACTATAgGCCCAGGCCAGAGGAAAAACACAGTTTAAGAGCTATGCTGG (SEQ ID NO: 58) sgMUC4_39 TAATACGACTCACTATAgGTTTCCTTAAGGAACAGCCCGTTTAAGAGCTATGCTGG (SEQ ID NO: 59) sgMUC4_40 TAATACGACTCACTATAgGCAGACAGAGGTGGGCTAGACAGTTTAAGAGCTATGCTGG (SEQ ID NO: 60) sgMUC4_41 TAATACGACTCACTATAgGCCCCAGGCAGGAATGACTCAGAGTTTAAGAGCTATGCTGG (SEQ ID NO: 61) sgMUC4_42 TAATACGACTCACTATAgGACCCAGTTGCCTTTCCCTGGTTTAAGAGCTATGCTGG (SEQ ID NO: 62) sgMUC4_43 TAATACGACTCACTATAgGACCCCAGGGAGGTGACAGGCGTTTAAGAGCTATGCTGG (SEQ ID NO: 63) sgMUC4_44 TAATACGACTCACTATAgGCCACAGCGCACTCCACGGGGAAGTTTAAGAGCTATGCTGG (SEQ ID NO: 64) sgMUC4_45 TAATACGACTCACTATAgGTCCCAGACTGACAGATAGACCGTTTAAGAGCTATGCTGG (SEQ ID NO: 65) sgMUC4_46 TAATACGACTCACTATAgGAGGGGTCTGTGGAGAGTTTGTTTAAGAGCTATGCTGG (SEQ ID NO: 66) sgMUC4_47 TAATACGACTCACTATAgGTCCAGCATCAGCGACGCCCTGTTTAAGAGCTATGCTGG (SEQ ID NO: 67) sgMUC4_48 TAATACGACTCACTATAgGCCTAAGACTCCAGAGCCAAAGTTTAAGAGCTATGCTGG (SEQ ID NO: 68) sgMUC4_49 TAATACGACTCACTATAgGCTACTACGTAGGGTTGTCATGGTTTAAGAGCTATGCTGG (SEQ ID NO: 69) sgMUC4_50 TAATACGACTCACTATAgGTAAAGTAGAAAAGGCATAAAGTTTAAGAGCTATGCTGG (SEQ ID NO: 70) sgMUC4_51 TAATACGACTCACTATAgGCACTTTTGGAGGCCCAGGCGTTTAAGAGCTATGCTGG (SEQ ID NO: 71) sgMUC4_52 TAATACGACTCACTATAgGTGGAGACAGGGTTGGCCAAGCGTTTAAGAGCTATGCTGG (SEQ ID NO: 72) sgMUC4_53 TAATACGACTCACTATAgGCTCCCTGCAACCTCTGCCTCCCGTTTAAGAGCTATGCTGG (SEQ ID NO: 73) sgMUC4_54 TAATACGACTCACTATAgGCCTCTTTCTCAAACACGTCTTTAGTTTAAGAGCTATGCTGG (SEQ ID NO: 74) sgMUC4_55 TAATACGACTCACTATAgGAACCCGGAATGGCACTTGTGTGTTTAAGAGCTATGCTGG (SEQ ID NO: 75) sgMUC4_56 TAATACGACTCACTATAGGTGGCTTTTTAGAGGCACGGTTTAAGAGCTATGCTGG (SEQ ID NO: 76) sgMUC4_57 TAATACGACTCACTATAGGCTTGGTGTATTCAGAATGGTTTAAGAGCTATGCTGG (SEQ ID NO: 77) sgMUC4_58 TAATACGACTCACTATAgGCACTGCCAGGCCAGCCTCTGCCGTTTAAGAGCTATGCTGG (SEQ ID NO: 78) sgMUC4_59 TAATACGACTCACTATAgGCTAAGGACAAGAGGCAATGAGGTTTAAGAGCTATGCTGG (SEQ ID NO: 79) sgMUC4_60 TAATACGACTCACTATAgGACTCAATTTCTCAGAACATGCTGGTTTAAGAGCTATGCTGG (SEQ ID NO: 80) sgMUC4_61 TAATACGACTCACTATAgGACAGAGTTTCTCTCTGTCCCCCGTTTAAGAGCTATGCTGG (SEQ ID NO: 81) sgMUC4_62 TAATACGACTCACTATAGGGGTTTCACCATGTTGGCCGTTTAAGAGCTATGCTGG (SEQ ID NO: 82) sgMUC4_63 TAATACGACTCACTATAgGCTCGCCTCGGCTCCCAAAGTGCGTTTAAGAGCTATGCTGG (SEQ ID NO: 83) sgMUC4_64 TAATACGACTCACTATAGGGCATTTGTGTTGCACGTGGTTTAAGAGCTATGCTGG (SEQ ID NO: 84) sgMUC4_65 TAATACGACTCACTATAgGAGTGGAGCTGCGGGCAACCCGTTTAAGAGCTATGCTGG (SEQ ID NO: 85) sgMUC4_66 TAATACGACTCACTATAgGTAGAGATGCCGCCCCGCCCGTTTAAGAGCTATGCTGG (SEQ ID NO: 86) sgMUC4_67 TAATACGACTCACTATAgGTCCAGTGGCCAGTGGATTTTGGTTTAAGAGCTATGCTGG (SEQ ID NO: 87) sgMUC4_68 TAATACGACTCACTATAgGAGGCAGCTGGGACTAGAACCCGTTTAAGAGCTATGCTGG (SEQ ID NO: 88) sgMUC4_69 TAATACGACTCACTATAgGTCGGTGGGCTGGGCTGGTTGTTTAAGAGCTATGCTGG (SEQ ID NO: 89) sgMUC4_70 TAATACGACTCACTATAgGAATGAATGGCTGTCTCAGCAGTTTAAGAGCTATGCTGG (SEQ ID NO: 90) sgMUC4_71 TAATACGACTCACTATAgGAAACAGACGTGGCCCAGTCTCTGTTTAAGAGCTATGCTGG (SEQ ID NO: 91) sgMUC4_72 TAATACGACTCACTATAgGCTGAGAGCTGCATTTCGAAGTTTAAGAGCTATGCTGG (SEQ ID NO: 92) sgMUC4_73 TAATACGACTCACTATAgGACAAGTCAGGAAGGGCCCTGTGGTTTAAGAGCTATGCTGG (SEQ ID NO: 93) PCR template: GCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCATAGCTCTTAAAC (SEQ ID NO: 94); reverse primer: GCACCGACTCGGTGCCACTT (SEQ ID NO: 95). Lowercase “g” denotes additional guanines that are not complementary to sgRNA targets.
(97) Cell Culture and Brain Section Preparation.
(98) MEFs and HeLa cells were cultured in DMEM without Phenol-red (Gibco) supplemented with 10% FBS and 1% penicillin/streptomycin. Cytogenetic analysis of MEF cells was performed by Cell Line Genetics. Cryostat sections were prepared from freshly frozen adult mouse brain with a slice thickness of ˜20 μM.
(99) CASFISH Protocol
(100) Unless indicated, the standard CASFISH protocol is as follows: Cells cultured on 35-mm MatTek dishes or tissue sections were fixed at −20° C. for 20 min in a prechilled solution of methanol and acetic acid at a 1:1 ratio. Samples were washed three times (5 min each washing) with PBS with gentle shaking, followed by incubation for 15 min at 37° C. in blocking/reaction buffer [20 mM Hepes (pH 7.5), 100 mM KCl, 5 mM MgCl2, freshly added 1 mM DTT, 5% (vol/vol) glycerol, 1% BSA, and 0.1% TWEEN-20]. To assemble CASFISH probes, fluorescently labeled dCas9 protein (5-25 nM) was mixed with labeled or unlabeled sgRNA at molar ratio of 1:1 or 1:4, respectively, in blocking/reaction buffer and was incubated at room temperature for 10 min and stored on ice before the next step. Five nM of fluorescent dCas9 protein was used for CASFISH against MUC4 repetitive DNA elements. For all other CASFISH experiments, 25 nM dCas9 protein was used. The assembled dCas9/sgRNA was applied on preblocked cells and incubated for 5-30 min at 37° C. The reaction was terminated by the removal of the dCas9/sgRNA solution and washing three times with blocking/reaction buffer. CASFISH samples of sgMUC4-tiling were washed further in buffer containing 20 mM Hepes (pH 7.5), 300 mM NaCl, 3 M urea, and 1.1% (vol/vol) Nonidet P-40. The short CASFISH protocol was modified to the following procedures: Cells were fixed for 5 min at −20° C., rinsed three times with PBS, subjected to the preincubated (5 min) dCas9 and sgRNA mixture for 5 min at 37° C., and again rinsed three times with PBS. All samples were stained with 0.5 μg/mL DAPI for 5 min before imaging.
(101) EMSA Assay.
(102) dCas9 protein and sgRNA were incubated together at room temperature for 10 min to examine the binary complex and subsequently were incubated with target DNA at 37° C. for 15 min to examine the tertiary complex. For the competition assay, an additional binary or tertiary complex reaction was performed after the addition of the competitor molecules. Resulting reaction mixtures were subjected to electrophoresis of 1% agarose gel in 1×Tris/borate/EDTA buffer containing 5 mM MgCl2 and were imaged with GE Typhoon Trio+ Imagers.
(103) Microscopy and Image Analysis.
(104) All CASFISH samples were imaged on an inverted microscope (Nikon Eclipse Ti) equipped with a 100× oil-immersion objective (Nikon CFI Plan Apo VC 100× Oil, NA 1.4) and an EM CCD (Andor iXon Ultra 897). DAPI, JF549, or JF646 labeling was imaged using a white light excitation system (SOLA light engine; Lumencor) in conjunction with the proper filter cubes sets (DAPI-1160B-NTE-Zero, LF561/LP-A-NTE, or Cy5-3040C-NTE-Zero, respectively; Semrock). JF549 or JF646 labeling also was imaged using laser excitation [561 nm (Cobolt Jive) or 637 nm (Vortran Stradus), respectively] in conjunction with a multiband dichroic (Di01-R405/488/561/635; Semrock). Proper emission filters for JF549 or JF6464 (FF01-593/40 or FF01-676/37; Semrock) were placed in front of the camera. Z-stacks were collected at step size of 0.2 μm for 30-40 slices to image the entire nucleus. Images were processed using ImageJ (21).
Example 1: Fluorescently Labeled dCas9 Protein
(105) To produce fluorescently labeled dCas9 protein, we constructed a dCas9 fusion protein that contains a hexahistidine affinity tag at the N terminus and a Halo tag at the C terminus. The Halo tag can be labeled efficiently and covalently by Halo ligands conjugated to a variety of organic fluorescent dyes for different imaging purposes (10). We purified recombinant dCas9 fusion protein expressed in Escherichia coli and labeled the protein with Halo ligands conjugated with Janelia Fluor 646 (JF646) (11). (All fluorochromes are listed in Table 1.)
(106) TABLE-US-00004 TABLE 1 Spectral properties of fluorochromes Absorption Emission Emission Fluorochrome maximum, nm maximum, nm color Alexa 488 495 519 Green DY547 557 574 Orange Cy5 650 670 Red JF549 549 571 Orange JF646 646 664 Red
(107) The presently disclosed strategy was tested on the highly repetitive major satellite (MajSat) sequences at murine pericentromeric regions and thus generated a 5′-DY547 (Cy3 alternative)-labeled sgRNA (sgMajSat) (
Example 2: Halo Tag Labeling
(108) The synthesis of fluorochrome-conjugated sgRNA probes (˜110 nt) is costly, whereas labeling of the Halo tag is efficient and cost-effective; thus this example describes the strategy of assembling fluorescent dCas9-Halo and unlabeled sgRNA for CASFISH. Specifically, we labeled dCas9-Halo protein through Halo ligands providing flexibility in the choice of fluorochromes and used T7 polymerase to synthesize sgRNA in vitro, a solution combining low cost and scalability for multiplexing. dCas9-Halo proteins labeled with both tested fluorochromes [JF549 and JF646 (11)] retained their activity, as demonstrated by successful CASFISH imaging and specific binding to target DNA in vitro (see below). Assembling labeled dCas9-Halo with T7-synthesized sgRNA, we successfully stained various DNA targets including telomeres, minor satellites, and a gene array containing repeated MS2-binding sequences (
Example 3 CASFISH for Multiple DNA Targets
(109) Simultaneous imaging of multiple chromatin domains or genes is critical for studying chromatin interactions. To explore the possibility of using CASFISH to detect multiple DNA targets simultaneously, we first investigated the binding of CASFISH probes to target DNA by electrophoretic mobility shift assays (EMSA). Using fluorescently labeled dCas9 protein, sgMaj Sat, and its target DNA, we found that dCas9 protein formed a binary complex with sgMaj Sat and a tertiary complex upon the addition of target DNA. These two complexes migrated on the gel as distinct bands away from free dCas9, free sgMaj Sat, or free target DNA (
Example 5: One Step MultiColor Imaging
(110) To explore the possibility of applying multiple dCas9/sgRNA species in one step for multicolor imaging, we assessed the stability of the binary complex by sgRNA competition assay. We found that increasing amounts of competitor unlabeled sgRNA up to 100-fold did not displace the DY547-sgRNA from preassembled fluorescent dCas9/sgRNA, as indicated by the unchanged DY547 fluorescence intensity of the dCas9 complex (
Example 6: CASFISH Sensitivity
(111) The major satellite and telomere sequences contain hundreds to thousands of repeats for sgRNA targeting. To assess the sensitivity of CASFISH, we tested sgRNAs against DNA substrates with lower copy numbers at the level of tens to hundreds. The human mucin 4 (MUC4) and mucin 1 (MUC1) genes contain repetitive sequences that have been imaged successfully in live cells with dCas9-EGFP (6). CASFISH using sgRNA against the ˜400 copies of the target in exon 2 of the MUC4 gene (sgMUC4-E2) and ˜45 copies of the target in intron 3 (sgMUC4-I1) detected prominent fluorescent puncta in all examined HeLa cell nuclei using either JF549- or JF646-labeled dCas9 protein (
Example 7: CASFISH in Tissue
(112) This example shows how a diagnostic procedure would be facilitated by a rapid and robust assay for genomic sequences present in tissue. To test whether CASFISH can be applied to tissue sections, we prepared cryostat sections of adult mouse brain and proceeded with CASFISH assays against pericentromeres and telomeres. The dCas9/sgRNA probes penetrated to 15 μm of the brain sections and efficiently labeled their targets in all examined cells (
SUMMARY
(113) The CASFISH assay is rapid, cost-effective, and convenient (Table 4).
(114) TABLE-US-00005 TABLE 4 Comparison of CASFISH with DNA FISH and live Cas9 imaging DNA FISH Live Cas9 imaging CASFISH Probe Nucleic acid Genetically In vitro probe coded dCas9/sgRNA assembled dCas9/sgRNA Difficulty Reliable Variable Reliable of probe synthesis and time- synthesis generation consuming Experiment Hours to days Immediately Minutes to 1 h duration Color Multicolor One color Multicolor per CRISPR per CRISPR system system High- Yes Challenging Yes throughput multiplexing Global DNA Yes No No denaturation Fixed cell Yes No Yes imaging Live cell No Yes Possible imaging Tissue Yes Possible Yes imaging
(115) First, CASFISH takes advantage of the CRISPR-based mechanism for rapid DNA hybridization. This enzymatic probe is more efficient than the nuclei-acid-only probe of DNA FISH that requires heat and formamide treatment to denature dsDNA. Thus, while DNA FISH takes hours or longer, CASFISH can be as fast as 15 min under optimized conditions. Second, the mild conditions of CASFISH (room temperature and 37° C.) can better preserve cell morphology and DNA structure, and thus CASFISH can be a useful tool for studying genome organization combined with single-molecule superresolution imaging. Third, the two-component nature of CASFISH probes provides great potential for multiplexing and room for further engineering (
(116) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the presently-disclosed subject matter belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the presently-disclosed subject matter, representative methods, devices, and materials are now described.
(117) Following long-standing patent law convention, the terms “a”, “an”, and “the” refer to “one or more” when used in this application, including the claims. Thus, for example, reference to “a cell” includes a plurality of such cells, and so forth.
(118) Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about”. Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and claims are approximations that can vary depending upon the desired properties sought to be obtained by the presently-disclosed subject matter.
(119) As used herein, the term “about,” when referring to a value or to an amount of mass, weight, time, volume, concentration or percentage is meant to encompass variations of in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1% from the specified amount, as such variations are appropriate to perform the disclosed method.
(120) As used herein, ranges can be expressed as from “about” one particular value, and/or to “about” another particular value. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
(121) All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference, including the references set forth in the following list:
REFERENCES
(122) 1. Hübner M R, Eckersley-Maslin M A, Spector D L (2013) Chromatin organization and transcriptional regulation. Curr Opin Genet Dev 23(2):89-95. 2. Levsky J M, Singer R H (2003) Fluorescence in situ hybridization: Past, present and future. J Cell Sci 116(Pt 14):2833-2838. 3. Beliveau B J, et al. (2012) Versatile design and synthesis platform for visualizing genomes with Oligopaint FISH probes. Proc Natl Acad Sci USA 109(52):21301-21306. Abstract/FREE Full Text 4. Sternberg S H, Doudna J A (2015) Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell 58(4):568-574. 5. Mali P, Esvelt K M, Church G M (2013) Cas9 as a versatile tool for engineering biology. Nat Methods 10(10):957-963. 6. Chen B, et al. (2013) Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155(7):1479-1491. 7. Tanenbaum M E, Gilbert L A, Qi L S, Weissman J S, Vale R D (2014) A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell 159(3):635-646. 8. Ma H, et al. (2015) Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci USA 112(10):3002-3007. 9. Sternberg S H, Redding S, Jinek M, Greene E C, Doudna J A (2014) DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature. 10. Encell L P, et al. (2012) Development of a dehalogenase-based protein fusion tag capable of rapid, selective and covalent attachment to customizable ligands. Curr Chem Genomics 6:55-71. 11. Grimm J B, et al. (2015) A general method to improve fluorophores for live-cell and single-molecule microscopy. Nat Methods 12(3):244-250, 3, 250. 12. Ziegler-Birling C E L, Miyanari Y, Torres-Padilla M-E (2013) Live visualization of chromatin dynamics with fluorescent TALEs. Nat Struct Mol Biol 20:1321-1324. 13. Shi X, et al. (2012) Quantitative fluorescence labeling of aldehyde-tagged proteins for single-molecule imaging. Nat Methods 9(5):499-503. 14. Zijlmans J M, et al. (1997) Telomeres in the mouse have large inter-chromosomal variations in the number of T2AG3 repeats. Proc Natl Acad Sci USA 94(14):7423-7428. 15. O'Connell M R, et al. (2014) Programmable RNA recognition and cleavage by CRISPR/Cas9. Nature. 16. Beliveau B J, et al. (2015) Single-molecule super-resolution imaging of chromosomes and in situ haplotype visualization using Oligopaint FISH probes. Nat Commun 6:7147. 17. Chen K H, Boettiger A N, Moffitt J R, Wang S, Zhuang X (2015) RNA imaging. Spatially resolved, highly multiplexed RNA profiling in single cells. Science 348(6233):aaa6090. 18. Hsu P D, et al. (2013) DNA targeting specificity of RNA-guided Cas9 nucleases. Nat
(123) Biotechnol 31(9):827-832. 19. Esvelt K M, et al. (2013) Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods 10(11):1116-1121. 20. Jinek M, et al. (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337(6096):816-821. 21. Schneider C A, Rasband W S, Eliceiri K W (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9(7):671-675. 22. Janicki S M, et al. (2004) From silencing to gene expression: Real-time analysis in single cells. Cell 116(5):683-698. 23. Gilbert et al., CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes, Cell, 2013 vol. 154(2) pp. 442-51. 24. Anton, et al., (2014) “Visualization of specific DNA sequences in living mouse embryonic stem cells with a programmable fluorescent CRISPR/Cas system,” Nucleus 5(2): 163-72. 25. Van der Oost, et al., (2014) “Unravelling the structural and mechanistic basis of CRISPR-Cas systems,” Nat Rev Microbiol, 12(7): 479-92. 26. Wright, et al., (2015) “Rational design of a split-Cas9 enzyme complex,” Proc Natl Acad Sci USA, 112(10): 2984-89. 27. U.S. Pat. No. 8,697,359 to Zhang for “CRISPR-Cas systems and methods for altering expression of gene products.”
(124) It will be understood that various details of the presently disclosed subject matter can be changed without departing from the scope of the subject matter disclosed herein. Furthermore, the foregoing description is for the purpose of illustration only, and not for the purpose of limitation.