Composition and method for conferring and/or enhancing herbicide tolerance using variants of protoporphyrinogen IX oxidase from cyanobacteria

11219221 · 2022-01-11

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a technology for conferring enhanced tolerance and/or enhancing tolerance to a herbicide of a plant and/or algae by using amino acid variants of protoporphyrinogen IX oxidase derived from prokaryotes.

Claims

1. A polypeptide selected from the group consisting of: (a) a polypeptide comprising an amino acid sequence of modified SEQ ID NO: 1, wherein one or more amino acid residues selected from the group consisting of R85, F156, V160, A162, G163, V305, C307, F324, L327, L337, I340, and F360 of the amino acid sequence of SEQ ID NO: 1 are respectively and independently deleted or substituted with an amino acid selected from the group consisting of M(Met), V(Val), I(Ile), T(Thr), L(Leu), C(Cys), A(Ala), S(Ser), F(Phe), P(Pro), W(Trp), N(Asn), Q(Gln), G(Gly), Y(Tyr), D(Asp), E(Glu), R(Arg), H(His), and K(Lys), which is different from the amino acid at the corresponding position of SEQ ID NO: 1; (b) a polypeptide comprising an amino acid sequence of modified SEQ ID NO: 3, wherein one or more amino acid residues selected from the group consisting of R88, F160, V164, A166, G167, V304, C306, F323, L326, L336, I339, and F359 of the amino acid sequence of SEQ ID NO: 3 are respectively and independently deleted or substituted with an amino acid selected from the group consisting of M(Met), V(Val), I(Ile), T(Thr), L(Leu), C(Cys), A(Ala), S(Ser), F(Phe), P(Pro), W(Trp), N(Asn), Q(Gln), G(Gly), Y(Tyr), D(Asp), E(Glu), R(Arg), H(His), and K(Lys), which is different from the amino acid at the corresponding position of SEQ ID NO: 3; and (c) a polypeptide obtained by a chemical synthesis or recombination method and comprising an amino acid sequence with at least 95% identity with the amino acid sequence of the polypeptide (a) or (b), wherein the polypeptide (c) does not include the amino acid sequence of SEQ ID NO: 1 or 3.

2. The polypeptide of claim 1, which is selected from the group consisting of: (a) a polypeptide comprising an amino acid sequence of modified SEQ ID NO: 1, wherein one or more amino acid residues selected from the group consisting of R85, F156, V160, A162, G163, V305, C307, F324, L327, L337, I340, and F360 of the amino acid sequence of SEQ ID NO: 1 are respectively and independently deleted or substituted with an amino acid selected from the group consisting of M(Met), V(Val), I(Ile), T(Thr), L(Leu), C(Cys), S(Ser), and A(Ala), which is different from the amino acid at the corresponding position of SEQ ID NO: 1; (b) a polypeptide comprising an amino acid sequence of modified SEQ ID NO: 3, wherein one or more amino acid residues selected from the group consisting of R88, F160, V164, A166, G167, V304, C306, F323, L326, L336, I339, and F359 of the amino acid sequence of SEQ ID NO: 3 are respectively and independently deleted or substituted with an amino acid selected from the group consisting of M(Met), V(Val), I(Ile), T(Thr), L(Leu), C(Cys), S(Ser), and A(Ala), which is different from the amino acid at the corresponding position of SEQ ID NO: 3; and (c) a polypeptide obtained by a chemical synthesis or recombination method and comprising an amino acid sequence with at least 95% identity with the amino acid sequence of the polypeptide (a) or (b), wherein the polypeptide (c) does not include the amino acid sequence of SEQ ID NO: 1 or 3.

3. The polypeptide of claim 1, which is selected from the group consisting of: (a) a polypeptide comprising an amino acid sequence having modification to SEQ ID NO: 1, wherein the modification comprises at least one amino acid mutation selected from the group consisting of F360M, F360L, F360I, F360C, F360V, F360T, V305I, V305L, A162L, A162C, A162I, V305M, R85A, F156A, V160C, V160S, F324V, L327T, and I340T, in the amino acid sequence of SEQ ID NO: 1; (b) a polypeptide comprising an amino acid sequence of having modification to SEQ ID NO: 3, wherein the modification comprises at least one amino acid mutation selected from the group consisting of F359M, F359C, F359L, F359I, F359V, F359T, V304I, V304L, A166L, A166C, A166I, V304M, R88A, F160A, V164C, V164S, F323V, L326T, and I339T, in the amino acid sequence of SEQ ID NO: 3; (c) a polypeptide obtained by a chemical synthesis or recombination method and comprising an amino acid sequence with at least 95% identity with the amino acid sequence of the polypeptide (a) or (b), wherein the polypeptide (c) does not include the amino acid sequence of SEQ ID NO: 1 or 3.

4. The polypeptide of claim 3, which is selected from the group consisting of: (a) a polypeptide comprising an amino acid sequence having modification to SEQ ID NO: 1, wherein the modification is selected from the group consisting of amino acid mutations of F360M, F360L, F360I, F360C, F360V, F360T, V305I, V305L, A162L, A162C, A162I, V305M, R85A, F156A, V160C, V160S, F324V, L327T, I340T, R85A+F360M, R85A+F360V, R85A+F360I, F156A+F360M, V160C+F360M, V160C+F360I, V160C+F360V, A162C+F360M, A162C+F360I, A162C+F360V, A162L+F360M, A162L+F360I, A162L+F360V, V305M+F360M, V305M+F360I, V305M+F360V, F324V+F360M, L327T+F360M, L327T+F360I, L327T+F360V, I340T+F360M, R85A+V160C+F360I, R85A+A162L+F360M, R85A+V305M+F360I, R85A+L327T+F360M, V160C+A162L+F360I, V160C+V305M+F360M, V160C+L327T+F360I, A162L+V305M+F360M, A162C+L327T+F360M, V305M+L327T+F360M, A162C+V305M+F360M, A162I+V305M+F360M, V160C+A162C+F360M, V160C+A162L+F360M, R85A+V160C+A162L+F360I, R85A+V160C+V305M+F360M, R85A+V160C+L327T+F360I, R85A+A162C+L327T+F360M, R85A+A162L+V305M+F360M, R85A+V305M+L327T+F360M, V160C+A162L+V305M+F360I, V160C+A162C+L327T+F360M, A162C+V305M+L327T+F360M, R85A+V160C+A162C+L327T+F360M, R85A+V160C+A162L+V305M+F360M, V160C+A162C+V305M+L327T+F360M, and R85A+V160C+A162C+V305M+L327T+F360M, in the amino acid sequence of SEQ ID NO: 1; (b) a polypeptide comprising an amino acid sequence having modification to SEQ ID NO: 3, wherein the modification is selected from the group consisting of amino acid mutations of F359M, F359C, F359L, F359I, F359V, F359T, V304I, V304L, A166L, A166C, A166I, V304M, R88A, F160A, V164C, V164S, F323V, L326T, I339T, R88A+F359I, R88A+F359V, R88A+F359M, V164C+F359I, V164C+F359V, V164C+F359M, A166L+F359I, A166L+F359V, A166L+F359M, A166C+F359I, A166C+F359V, A166C+F359M, F160A+F359M, V304M+F359I, V304M+F359V, V304M+F359M, F323V+F359M, L326T+F359I, L326T+F359V, L326T+F359M, I339T+F359M, R88A+V164C+F359I, R88A+A166L+F359M, R88A+V304M+F359I, R88A+L326T+F359M, V164C+A166L+F359I, V164C+V304M+F359M, V164C+L326T+F359I, A166L+V304M+F359M, A166L+L326T+F359I, V304M+L326T+F359M, A166C+V304M+F359M, A166I+V304M+F359M, V164C+A166C+F359M, V164C+A166L+F359M, R88A+V164C+A166L+F359I, R88A+V164C+V304M+F359I, R88A+V164C+L326T+F359M, R88A+A166L+V304M+F359I, R88A+A166L+L326T+F359M, R88A+V304M+L326T+F359M, V164C+A166L+V304M+F359I, V164C+A166L+L326T+F359M, A166L+V304M+L326T+F359I, R88A+V164C+A166L+V304M+F359I, R88A+V164C+A166L+L326T+F359M, V164C+A166L+V304M+L326T+F359M, and R88A+V164C+A166C+V304M+L326T+F359M, in the amino acid sequence of SEQ ID NO: 3; a polypeptide obtained by a chemical synthesis or recombination method and comprising an amino acid sequence with at least 95% identity with the amino acid sequence of the polypeptide (a) or (b), wherein the polypeptide (c) does not include the amino acid sequence of SEQ ID NO: 1 or 3.

5. A polynucleotide encoding the polypeptide of claim 1.

6. A recombinant vector comprising the polynucleotide of claim 5.

7. A recombinant cell comprising the recombinant vector of claim 6.

8. A composition for conferring or enhancing herbicide tolerance of a plant or algae, comprising one or more selected from the group consisting of: the polypeptide of claim 1; a polynucleotide encoding the polypeptide; a recombinant vector comprising the polynucleotide; and a recombinant cell comprising the recombinant vector.

9. The composition of claim 8, wherein the herbicide is an herbicide inhibiting protoporphyrinogen IX oxidase.

10. The composition of claim 8, wherein the herbicide is at least one selected from the group consisting of pyrimidinediones, diphenyl-ethers, phenylpyrazoles, N-phenylphthalimides, phenylesters, thiadiazoles, oxadiazoles, triazolinones, oxazolidinediones, pyraclonil, flufenpyr-ethyl, and profluazol.

11. The composition of claim 10, wherein the herbicide is at least one selected from the group consisting of butafenacil, saflufenacil, benzfendizone, tiafenacil, fomesafen, oxyfluorfen, aclonifen, acifluorfen, bifenox, ethoxyfen, lactofen, chlomethoxyfen, chlorintrofen, fluoroglycofen-ethyl, halosafen, pyraflufen-ethyl, fluazolate, flumioxazin, cinidon-ethyl, flumiclorac-pentyl, fluthiacet, thidiazimin, oxadiargyl, oxadiazon, carfentrazone, sulfentrazone, azafenidin, pentoxazone, pyraclonil, flufenpyr-ethyl, profluazol, phenopylate, carbamate analogues of phenopylate, and agriculturally acceptable salt thereof.

12. A method of preparing a transgenic plant or algae having herbicide tolerance, the method comprising introducing the polypeptide of claim 1 or a polynucleotide encoding the same into an alga, or a cell, protoplast, callus, hypocotyl, seed, cotyledon, shoot, or whole body of a plant.

13. A method of conferring or enhancing herbicide tolerance of a plant or algae, the method comprising introducing the polypeptide of claim 1 or a polynucleotide encoding the same into an alga, or a cell, protoplast, callus, hypocotyl, seed, cotyledon, shoot, or whole body of a plant.

14. A method of controlling weeds in a cropland, the method comprising: providing the cropland with a plant comprising the polypeptide of claim 1 or a polynucleotide encoding the same, and applying an effective dosage of protoporphyrinogen IX oxidase-inhibiting herbicide to the cropland or the plant.

15. The method of claim 14, wherein the step of applying an effective dosage of protoporphyrinogen IX oxidase-inhibiting herbicide to the cropland is performed by applying an effective dosage of two or more kinds of protoporphyrinogen IX oxidase-inhibiting herbicides sequentially or simultaneously.

16. The method of claim 14, wherein the plant further comprises a second herbicide-tolerant polypeptide or a gene encoding the same, and the step of applying an effective dosage of protoporphyrinogen IX oxidase-inhibiting herbicide to the cropland is performed by applying effective dosages of the protoporphyrinogen IX oxidase-inhibiting herbicide and a second herbicide are applied sequentially or simultaneously.

17. A method of removing an undesired aquatic organism from a culture media, the method comprising: providing a culture media with algae comprising the polypeptide of claim 1 or a polynucleotide encoding the same, and applying an effective dosage of protoporphyrinogen IX oxidase-inhibiting herbicide to the culture media.

18. A transformant of a plant or algae having herbicide tolerance, or a clone or progeny thereof, comprising the polypeptide of claim 1 or a polynucleotide encoding the same.

19. The transformant, clone, or progeny thereof of claim 18, wherein the transformant is an alga, or a cell, protoplast, callus, hypocotyl, seed, cotyledon, shoot, or whole body of a plant.

20. The transformant of claim 18, wherein the plant or algae further comprise a second herbicide-tolerant polypeptide or a gene encoding the same, and its tolerance to the second herbicide is conferred or enhanced.

21. The transformant of claim 20, wherein the second herbicide is selected from the group consisting of glyphosate, glufosinate, dicamba, 2,4-D (2,4-Dichlorophenoxyacetic acid), isoxaflutole, ALS (acetolactate synthase)-inhibiting herbicide, photosystem II-inhibiting herbicide, phenylurea-based herbicide, bromoxynil-based herbicide, and combinations thereof.

22. The transformant of claim 20, wherein the second herbicide-tolerant polypeptide is one or more selected from the group consisting of: glyphosate herbicide-tolerant EPSPS (glyphosate resistant 5-enolpyruvylshikimate-3-phosphate synthase), GOX (glyphosate oxidase), GAT (glyphosate-N-acetyltransferase) or glyphosate decarboxylase; glufosinate herbicide-tolerant PAT (phosphinothricin-N-acetyltransferase); dicamba herbicide-tolerant DMO (dicamba monooxygenase); 2,4-D (2,4-dichlorophenoxyacetic acid) herbicide-tolerant 2,4-D monooxygenase or AAD (aryloxyalkanoate dioxygenase); ALS (acetolactate synthase)-inhibiting sulfonylurea-based herbicide-tolerant ALS (acetolactate synthase), AHAS (acetohydroxyacid synthase) or AtAHASL (Arabidopsis thaliana acetohydroxyacid synthase large subunit); photosystem II-inhibiting herbicide-tolerant photosystem II protein D1; phenylurea herbicide-tolerant Cytochrome P450; plastid-inhibiting herbicide-tolerant HPPD (hydroxyphenylpyruvate dioxygenase); bromoxynil herbicide-tolerant nitrilase; and combinations thereof.

23. The transformant of claim 20, wherein the gene encoding the second herbicide-tolerant polypeptide is one or more selected from the group consisting of: glyphosate herbicide-tolerant cp4 epsps, mepsps, 2mepsps, goxv247, gat4601 or gat4621 gene; glufosinate herbicide-tolerant BAR or PAT gene; dicamba herbicide-tolerant dmo gene; 2,4-D(2,4-dichlorophenoxyacetic acid) herbicide-tolerant AAD-1 or AAD-12 gene; isoxaflutole herbicide-tolerant HPPDPF W336 gene; sulfonylurea herbicide-tolerant ALS, Csr1, Csr1-1, Csr1-2, GM-HRA, S4-HRA, Zm-HRA, SurA or SurB gene; photosystem II-inhibiting herbicide-tolerant psbA gene; phenylurea herbicide-tolerant CYP76B1 gene; bromoxynil herbicide-tolerant bxn gene; and combinations thereof.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a map of pET303-CT-His vector.

(2) FIG. 2 is a photograph showing cell growth level of PPO-deficient BT3 E. coli (BT3(ΔPPO)) transformant transformed with CyPPO16 wild type gene (indicated by CyPPO16WT), or various CyPPO16 mutant genes leading to a mutation of one amino acid, when treated with tiafenacil at a concentration of 0 μM(control), 10 μM, and 25 μM, respectively (upper), and saflufenacil at a concentration of 0 μM(control), 25 μM, and 50 μM, respectively (lower).

(3) FIG. 3 is a photograph showing cell growth level of BT3(ΔPPO) transformant transformed with CyPPO16WT, or various CyPPO16 mutant genes leading to a mutation of one amino acid, when treated with flumioxazin at a concentration of 0 μM(control), 10 μM, and 25 μM, respectively (upper), and sulfentrazone at a concentration of 0 μM(control), 50 μM, and 100 μM, respectively (lower).

(4) FIG. 4 is a photograph showing cell growth level of BT3(ΔPPO) transformant transformed with CyPPO16WT, or various CyPPO16 mutant genes leading to a mutation of one amino acid, when treated with fomesafen at a concentration of 0 μM(control), 50 μM, and 100 μM, respectively (upper), and acifluorfen at a concentration of 0 μM(control), 5 μM, and 10 μM, respectively (lower).

(5) FIG. 5 is a photograph showing cell growth level of BT3(ΔPPO) transformant transformed with CyPPO16WT, or various CyPPO16 mutant genes leading to a mutation of one amino acid, when treated with pentoxazone at a concentration of 0 μM(control), 5 μM, and 25 μM, respectively (upper), and pyraflufen-ethyl at a concentration of 0 μM(control), 5 μM, and 25 μM, respectively (lower).

(6) FIG. 6 is a photograph showing cell growth level of BT3(ΔPPO) transformant transformed with CyPPO16WT, or various CyPPO16 mutant genes leading to a mutation of one amino acid, when treated with pyraclonil at a concentration of 0 μM(control), 50 μM, and 100 μM, respectively.

(7) FIGS. 7 to 17 are photographs showing cell growth level of BT3(ΔPPO) transformants transformed with CyPPO16 wild type gene (indicated by CyPPO16WT), or various CyPPO16 mutant genes leading to mutations of two or more amino acids as shown in Table 8, when treated with tiafenacil at a concentration of 0 μM(control), 50 μM, and 200 μM, sulfentrazone at a concentration of 0 μM(control), 2000 μM, and 4000 μM, and flumioxazin at a concentration of 0 μM(control), 25 μM, and 50 μM, respectively.

(8) FIG. 18 is a photograph showing cell growth level of PPO-deficient BT3 E. coli (BT3(ΔPPO)) transformant transformed with CyPPO17 wild type gene (indicated by CyPPO17WT), or various CyPPO17 mutant genes leading to a mutation of one amino acid, when treated with tiafenacil at a concentration of 0 μM(control), 50 μM, and 100 μM, respectively (upper), and saflufenacil at a concentration of 0 μM(control), 50 μM, and 200 μM, respectively (lower).

(9) FIG. 19 is a photograph showing cell growth level of BT3(ΔPPO) transformant transformed with CyPPO17WT, or various CyPPO17 mutant leading to a mutation of one amino acid, when treated with flumioxazin at a concentration of 0 μM(control), 50 μM, and 100 μM, respectively (upper), and sulfentrazone at a concentration of 0 μM(control), 5 μM, and 25 μM, respectively (lower).

(10) FIG. 20 is a photograph showing cell growth level of BT3(ΔPPO) transformant transformed with CyPPO17WT, or various CyPPO17 mutant genes leading to a mutation of one amino acid, when treated with fomesafen at a concentration of 0 μM(control), 5 μM, and 25 μM, respectively (upper), and acifluorfen at a concentration of 0 μM(control), 5 μM, and 25 μM, respectively (lower).

(11) FIG. 21 is a photograph showing cell growth level of BT3(ΔPPO) transformant transformed with CyPPO17WT, or various CyPPO17 mutant genes leading to a mutation of one amino acid, when treated with pyraclonil at a concentration of 0 μM(control), 5 μM, and 25 μM, respectively (upper), and pentoxazone at a concentration of 0 μM(control), 5 μM, and 25 μM, respectively (lower).

(12) FIG. 22 is a photograph showing cell growth level of BT3(ΔPPO) transformant transformed with CyPPO17WT, or various CyPPO17 mutant genes leading to a mutation of one amino acid, when treated with pyraflufen-ethyl at a concentration of 0 μM(control), 5 μM, and 10 μM, respectively.

(13) FIGS. 23 to 33 are photographs showing cell growth level of BT3(ΔPPO) transformants transformed with CyPPO17 wild type gene (indicated by CyPPO17WT), or various CyPPO17 mutant genes leading to mutations of two or more amino acids as shown in Table 10, when treated with tiafenacil at a concentration of 0 μM(control), 50 μM, and 200 μM, sulfentrazone at a concentration of 0 μM(control), 200 μM, and 400 μM, and flumioxazin at a concentration of 0 μM(control), 100 μM, and 200 μM, respectively.

(14) FIG. 34 is a map of pMAL-c2X vector.

(15) FIG. 35 is a photograph showing results observed at the 3.sup.rd day after spraying luM of tiafenacil to A. thaliana (T.sub.2) transformed with wild type CyPPO16 gene or with wild type CyPPO17 gene.

(16) FIG. 36 is a photograph showing results observed at the 3.sup.rd day after spraying 5 μM of tiafenacil to A. thaliana (T.sub.2) transformed with wild type CyPPO16 gene, wild type CyPPO17 gene, or mutant genes thereof.

MODE FOR INVENTION

(17) Hereinafter, the present invention will be described in detail with reference to Examples. However, these Examples are for illustrative purposes only, and the invention is not intended to be limited by these Examples.

Example 1. Verification of Herbicide Tolerance of CyPPO16 and CyPPO17 Isolated from Prokaryotes

(18) PPO gene sequences were obtained from Genebank database of two strains, Spirulina subsalsa and Thermosynechococcus sp. NK55a, respectively. For encoding the PPO protein (CyPPO16; SEQ ID NO: 1) from Spirulina subsalsa, the PPO gene designated as CyPPO16 was isolated from Spirulina subsalsa, and optimized to have the nucleic acid sequence of SEQ ID NO: 7. For encoding the PPO protein (CyPPO17; SEQ ID NO: 3) from Thermosynechococcus sp. NK55a, the PPO gene designated as CyPPO17 was isolated from Thermosynechococcus sp. NK55a and optimized to have the nucleic acid sequence of SEQ ID NO: 8. In order to obtain the herbicide-binding structure of PPO protein, the herbicides including tiafenacil, saflufenacil, flumioxazin, and sulfentrazone and the PPO proteins including CyPPO16 and CyPPO17 were used. Homology models of CyPPO16 and CyPPO17 were constructed from CyPPO10 (the PPO protein originated from Thermosynechococcus elongatus BP-1; SEQ ID NO: 5) structure using SWISS-MODEL protein structure modelling server (https://swissmodel.expasy.org/).

(19) Herbicide-interacting structural information of each PPO protein was obtained after modelled structures of CyPPO16 and CyPPO17 were superimposed with CyPPO10 bound with herbicides (tiafenacil, saflufenacil, flumioxazin, and sulfentrazone).

(20) Herbicide-binding information of CyPPO10 was obtained by following procedures: CyPPO10 protein (SEQ ID NO: 5) and tiafenacil, saflufenacil, flumioxazin, and sulfentrazone were examined as the representative protein and herbicides, respectively. The gene encoding the CyPPO10 protein (SEQ ID NO: 6) was cloned to pET29b vector (Catalog Number: 69872-3; EMD Biosciences), and CyPPO10 protein was expressed in E. coli. The expressed CyPPO10 protein was purified through nickel affinity chromatography, to which tiafenacil, saflufenacil, flumioxazin or sulfentrazone was added respectively and herbicide-bound PPO crystals were obtained. Then, the crystals were used for X-ray diffraction by synchrotron radiation accelerator. X-ray diffraction data of the 2.4 Å resolution of CyPPO10-herbicide complex crystals was obtained, and the three-dimensional structure was determined. Binding information was obtained through analyzing the amino acid residues of CyPPO10 interacting with herbicides.

(21) Using the information of herbicide-interacting amino acids derived from the structure of CyPPO10-herbicide complexes, information of CyPPO16 and CyPPO17 amino acid residues which possibly lower the binding affinity of herbicides through mutations were determined.

(22) As results, amino acid residues including R85, F156, V160, A162, G163, V305, C307, F324, L327, L337, I340 and F360 of CyPPO16 protein (SEQ ID NO: 1) were involved to interact with PPO-inhibiting herbicides, and those including R88, F160, V164, A166, G167, V304, C306, F323, L326, L336, 1339 and F359 of CyPPO17 protein (SEQ ID NO: 3) were involved to interact with PPO-inhibiting herbicides.

Example 2. Construction of PPO Variants

(23) In order to enhance PPO-inhibiting herbicide tolerance of CyPPO16 and CyPPO17, a mutation(s) at the position interacting with herbicide obtained in the Example 1 was introduced, respectively. Each PPO gene was codon-optimized and synthesized (Cosmogenetech Co., Ltd.) for efficient herbicide tolerance test using BT3, a PPO-deficient E. coli stain.

(24) Detailed experimental procedure was as follows:

(25) Using primers listed in Table 2, PCR was carried out to amplify PPO genes under following condition.

(26) PCR reaction mixture

(27) Template (synthetic DNA of CyPPO16 or CyPPO17) 1 μl

(28) 10× buffer 5 μl

(29) dNTP mixture (10 mM each) 1 μl

(30) Forward primer (10 μM) 1 μl

(31) Reverse primer (10 μM) 1 μl

(32) DDW 40 μl

(33) Pfu-X (Solgent, 2.5 units/μl) 1 μl

(34) Total 50 μl

(35) TABLE-US-00002 TABLE 1 PCR reaction condition 94° C. 4 min. 1 cycle 94° C. 30 sec. 25 cycles 56° C. 30 sec. 72° C. 1.5 min. 72° C. 5 min. 1 cycle  4° C. 5 min. 1 cycle

(36) TABLE-US-00003 TABLE 2 Primer list for cloning of CyPPO16 and CyPPO17 in pET303-CT His vector SEQ ID Strain Primer Sequence NO. Spirulina CyPPO16_XbaI CCCCTCTAGAATGCTAGA 9 subsalsa F CTCCCTGATTGT CyPPO16_XhoI CCCCCTCGAGCTCCCTGC 10 R TTCTAATTTTTTG Thermo- CyPPO17_XbaI CCCCTCTAGAATGGAGGT 11 synechococcus  F CGATGTTGCAAT sp. NK55a CyPPO17_XhoI CCCCCTCGAGGGATTGCC 12 R CCCCACTCAGGT

(37) Amplified PCR products above and pET303-CT His vector (VT0163; Novagen; FIG. 1) were digested with Xbal and Xhol restriction enzymes, and ligated to construct pET303-CyPPO16 and pET303-CyPPO17 plasmids using T4 DNA ligase (RBC, 3 units/μl).

(38) CyPPO16 and CyPPO17 genes cloned in pET303-CT His vector were mutated through site-directed mutagenesis using primers listed in Tables 4 and 5, respectively.

(39) PCR reaction mixture

(40) Template 1 μl

(41) 10× buffer 5 μl

(42) dNTP mixture (10 mM each) 1 μl

(43) Forward primer (10 μM) 1 μl

(44) Reverse primer (10 μM) 1 μl

(45) DDW 40 μl

(46) Pfu-X (Solgent, 2.5 units/μl) 1 μl

(47) Total 50 μl

(48) TABLE-US-00004 TABLE 3 PCR reaction condition 94° C. 2 min. 1 cycle 94° C. 30 sec. 17-25 cycles 65° C. 40 sec. 72° C. 3.5 min. 72° C. 5 min. 1 cycle  4° C. 5 min. 1 cycle

(49) TABLE-US-00005 TABLE 4 Primer list for mutagenesis of CyPPO16 gene SEQ CyPPO16  ID mutation Primer sequence (5′->3′) NO F360M F CATCTGCTGACCAATATGATCGGCGGCGCAACG 13 R CGTTGCGCCGCCGATCATATTGGTCAGCAGATG 14 F360L F GACCAATTTGATCGGCGGCGCAACGGACCCTG 15 R CGCCGATCAAATTGGTCAGCAGATGCTCACCC 16 F360I F CATCTGCTGACCAATATCATCGGCGGCGCAACG 17 R CGTTGCGCCGCCGATGATATTGGTCAGCAGATG 18 F360C F TGACCAATTGCATCGGCGGCGCAACGGACCCTG 19 R CGCCGATGCAATTGGTCAGCAGATGCTCACCC 20 F360V F CTGACCAATGTCATCGGCGGCGCAACGGACCC 21 R GCCGATGACATTGGTCAGCAGATGCTCACCCTC 22 F360T F CATCTGCTGACCAATACCATCGGCGGCGCAACG 23 R CGTTGCGCCGCCGATGGTATTGGTCAGCAGATG 24 V305L F TATCCTCCGCTAGCCTGCGTAGTCCTAGCATAC 25 R CGCAGGCTAGCGGAGGATAGTAAATTTCCTTG 26 A162L F GTCTCCGGTGTGTATCTTGGCGACGTTGATCAA 27 R TTGATCAACGTCGCCAAGATACACACCGGAGAC 28 A162C F GTCTCCGGTGTGTATTGTGGCGACGTTGATCAA 29 R TTGATCAACGTCGCCACAATACACACCGGAGAC 30 V305M F ATTTACTATCCTCCGATGGCCTGCGTAGTCCTA 31 R TAGGACTACGCAGGCCATCGGAGGATAGTAAAT 32 R85A F GACAGACGTCTACCGGCGTTTGTGTATTGGAAC 33 R GTTCCAATACACAAACGCCGGTAGACGTCTGTC 34 F156A F CGTTTAGTCGCACCAGCGGTCTCCGGTGTGTAT 35 G R CATACACACCGGAGACCGCTGGTGCGACTAAAC 36 G V160C F CCATTTGTCTCCGGTTGCTATGCTGGCGACGTT 37 G R CAACGTCGCCAGCATAGCAACCGGAGACAAATG 38 G F324V F CGTCCATTGGAAGGTGTGGGTCATCTTATACCC 39 R GGGTATAAGATGACCCACACCTTCCAATGGACG 40 L327T F GAAGGTTTTGGTCATACCATACCCAGGAATCAG 41 R CTGATTCCTGGGTATGGTATGACCAAAACCTTC 42 I340T F AGGACTCTTGGTACAACCTGGTCCTCCTGTCTC 43 R GAGACAGGAGGACCAGGTTGTACCAAGAGTCCT 44 V160C + F TGTCTCCGGTTGCTATTGTGGCGACGTTGATCA 45 A162C AC R GTTGATCAACGTCGCCACAATAGCAACCGGAGA 46 CA V160C + F CGCACCATTTGTCTCCGGTTGCTATCTTGGCGA 47 A162L CGTTGATCAACTATC R GATAGTTGATCAACGTCGCCAAGATAGCAACCG 48 GAGACAAATGGTGCG

(50) TABLE-US-00006 TABLE 5 Primer list for mutagenesis of CyPPO17 gene SEQ CyPPO17 ID mutation Primer sequence (5′->3′) NO F359M F CAAGTTTTTACTTCAATGATCGGTGGAGCAACA 49 R TGTTGCTCCACCGATCATTGAAGTAAAAACTTG 50 F359C F CCACCGATGCATGAAGTAAAAACTTGCCACCC 51 R TTTACTTCATGCATCGGTGGAGCAACAGATCCG 52 F359L F TCCACCGATCAATGAAGTAAAAACTTGCCACCC 53 R TTACTTCATTGATCGGTGGAGCAACAGATCCGG 54 F359I F CAAGTTTTTACTTCAATCATCGGTGGAGCAACA 55 R TGTTGCTCCACCGATGATTGAAGTAAAAACTTG 56 F359V F CAAGTTTTTACTTCAGTCATCGGTGGAGCAACA 57 R TGTTGCTCCACCGATGACTGAAGTAAAAACTTG 58 F359T F CAAGTTTTTACTTCAACCATCGGTGGAGCAACAG 59 R CTGTTGCTCCACCGATGGTTGAAGTAAAAACTTG 60 V304L F TATCCAACACTGGCCTGTGTAGTACTCGCC 61 R CACAGGCCAGTGTTGGATACGGAATGGCCGC 62 A166L F GTCTCTGGCGTGTATCTGGGAGATCCCCAGCAA 63 R TTGCTGGGGATCTCCCAGATACACGCCAGAGAC 64 A166C F GTCTCTGGCGTGTATTGCGGAGATCCCCAGCAA 65 R TTGCTGGGGATCTCCGCAATACACGCCAGAGAC 66 V304M F ATTCCGTATCCAACAATGGCCTGTGTAGTACTC 67 R GAGTACTACACAGGCCATTGTTGGATACGGAAT 68 R88A F GATCGACATCTACCGGCGTACATTTATTGGCGAG 69 R CTCGCCAATAAATGTACGCCGGTAGATGTCGATC 70 F160A F CGTCTGGTGGCACCTGCGGTCTCTGGCGTGTATG 71 R CATACACGCCAGAGACCGCAGGTGCCACCAGACG 72 V164C F CCTTTCGTCTCTGGCTGCTATGCGGGAGATCCC 73 R GGGATCTCCCGCATAGCAGCCAGAGACGAAAGG 74 F323V F GTCAGTACGACCAGGCGTGGGCGTCCTTATACCC 75 R GGGTATAAGGACGCCCACGCCTGGTCGTACTGAC 76 L326T F GGCTTTGGCGTCACTATACCCCGTGGCCAAGGTA 77 TCCGTACA R GCCACGGGGTATAGTGACGCCAAAGCCTGGTCGT 78 ACTGACCT I339T F CGTACACTCGGCACTACCTGGTCTAGCTGCTTA 79 R TAAGCAGCTAGACCAGGTAGTGCCGAGTGTACG 80 V164C + F CCTTTCGTCTCTGGCTGCTATCTGGGAGATCCC 81 A166L CAGCAA R TTGCTGGGGATCTCCCAGATAGCAGCCAGAGAC 82 GGAAAG V164C + F TTCGTCTCTGGCTGCTATTGCGGAGATCCCCAG 83 A166C R CTGGGGATCTCCGCAATAGCAGCCAGAGACGAA 84

(51) One μl of Dpnl (NEB) was treated to each 10 μl of PCR products, and incubated at 37° C. for 30 minutes. DH5alpha competent cell (Biofact Co., Ltd.) was transformed with reaction solution through heat shock method, and was cultured in LB agar media containing carbenicillin (Gold Biotechnology Co., Ltd.). After plasmids were prepared from transformed E. coli, they were sequenced (Cosmogenetech, Co., Ltd.) and confirmed to have correct mutations.

Example 3. Verification of PPO-Inhibiting Herbicide Tolerance of PPO Variants (Test in E. coli)

(52) The mutated CyPPO gene obtained from the Example 2 was transformed to BT3 (ΔPPO) strain which is deficient of PPO activity and cultured in LB media with PPO-inhibiting herbicide, thereby examining whether growth of transformed BT3 was not inhibited.

(53) BT3 (ΔPPO) strain was provided by Hokkaido University (Japan) and it is an E. coli strain which is deficient in hemG-type PPO and has kanamycin resistance (refer to “Watanabe N, Che F S, Iwano M, Takayama S, Yoshida S, Isogai A. Dual targeting of spinach protoporphyrinogen IX oxidase II to mitochondria and chloroplasts by alternative use of two in-frame initiation codons, J. Biol. Chem. 276(23):20474-20481, 2001; Che F S, Watanabe N, Iwano M, Inokuchi H, Takayama S, Yoshida S, Isogai A. Molecular Characterization and Subcellular Localization of Protoporphyrinogen IX oxidase in Spinach Chloroplasts, Plant Physiol. 124(1):59-70, 2000”).

(54) Detailed experimental procedure was as follows:

(55) BT3 competent cells were transformed with the pET303-CyPPO16 and pET303-CyPPO17 plasmids and those with a mutation(s) constructed in Example 2 respectively, and were cultured in LB agar media containing carbenicillin (Gold Biotechnology, Co., Ltd.).

(56) Single colony of E. coli transformed with each CyPPO gene was cultured in 3 ml of LB broth containing carbenicillin overnight, and then was subcultured until absorbance (0D600) reached 0.5 to 1. Then, it was diluted with LB broth to OD.sub.600=0.5. Again, the diluted solution was serially diluted 4 times by a factor of one tenth.

(57) The LB agar media (LB 25 g/l, Bacto agar 15 g/l) containing carbenicillin (100 μg/ml) and 0 to 4,000 μM of various herbicides dissolved in DMSO was prepared. Next, 10 μl of each diluted solution was dropped on the plate and cultured at 37° C. under light (Tables 7 and 9, FIGS. 2 to 6, and 18 to 22) or dark (Tables 8 and 10, FIGS. 7 to 17, and 23 to 33) for 16 to 20 hours. Then, extent of tolerance was evaluated. PPO-inhibiting herbicides used in the experiments were listed in Table 6:

(58) TABLE-US-00007 TABLE 6 PPO-inhibiting herbicides used in the experiments Family Herbicide Pyrimidinedione tiafenacil saflufenacil Diphenyl ether fomesafen acifluorfen N-phenylphthalimides flumioxazin Triazolinones sulfentrazone Oxazolidinediones pentoxazone Phenylpyrazoles pyraflufen-ethyl Others pyraclonil

(59) The extent of herbicide tolerance of the mutated genes was evaluated by comparing that of mutated genes with that of wild type. The relative tolerance was represented with “+” as a factor of 10 times. Evaluation result was listed in Tables 7 to10 and FIGS. 2 to 33:

(60) TABLE-US-00008 TABLE 7 Herbicide tolerance evaluation of mutated CyPPO16 Mutation No. site tiafenacil saflufenacil flumioxazin sulfentrazone fomesafen 1 A162C + +++ ++ + ++ (AC) 2 A162L + +++ +++ + ++ (AL) 3 V305M + +++ + N.T ++ (VM) 4 F360V +++ +++ +++ + + (FV) 5 F360C ++ +++ + ++ ++ (FC) 6 F360L +++ +++ +++ + +++ (FL) 7 F360M +++ +++ +++ + +++ (FM) 8 F360I +++ +++ +++ ++ + (FI) WT − − − − − Mutation pyraflufen- No. site acifluorfen pentoxazone ethyl pyraclonil 1 A162C ++ ++ +++ ++ (AC) 2 A162L ++ ++ +++ ++ (AL) 3 V305M ++ + +++ + (VM) 4 F360V + + ++ + (FV) 5 F360C ++ ++ +++ ++ (FC) 6 F360L + + ++ + (FL) 7 F360M + + ++ + (FM) 8 F360I + + ++ + (FI) WT − − − − N.T (Not tested)

(61) TABLE-US-00009 TABLE 8 Herbicide tolerance evaluation of mutated CyPPO16 No. Mutation site tiafenacil flumioxazin sulfentrazone 1 R85A + F360I +++++ +++++ +++ 2 R85A + F360V +++ +++ +++ 3 R85A + F360M +++ +++ +++ 4 V160C + F360I +++ ++++ +++ 5 V160C + F360V +++ +++ +++ 6 V160C + F360M +++ ++++ +++ 7 A162L + F360I ++++ ++++ + 8 A162L + F360V ++++ ++++ ++++ 9 A162L + F360M +++++ +++++ +++ 10 A162C + F360I ++++ +++ +++ 11 A162C + F360V ++++ ++++ +++ 12 A162C + F360M +++++ +++++ ++++ 13 V305M + F360I +++++ +++++ ++ 14 V305M + F360V ++++ ++++ + 15 V305M + F360M +++ ++++ + 16 L327T + F360I +++++ +++++ +++ 17 L327T + F360V ++++ ++++ +++++ 18 L327T + F360M ++++ ++++ ++ 19 R85A + V160C + F360I +++++ +++++ ++++ 20 R85A + A162L + F360M +++++ +++++ ++++ 21 R85A + V305M + F360I +++++ +++++ ++++ 22 R85A + L327T + F360M +++++ +++++ ++++ 23 V160C + A162L + F360I ++++ ++++ +++ 24 V160C + V305M + F360M +++++ +++++ +++ 25 V160C + L327T + F360I +++++ +++++ ++++ 26 A162L + V305M + F360M +++++ +++++ ++++ 27 A162C + L327T + F360M +++++ +++++ ++++ 28 V305M + L327T + F360M +++++ +++++ ++++ 29 R85A + V160C + A162L + F360I +++++ +++++ +++++ 30 R85A + V160C + V305M + F360M +++++ +++++ ++++ 31 R85A + V160C + L327T + F360I +++++ +++++ +++++ 32 R85A + A162L + V305M + F360M +++++ +++++ ++++ 33 R85A + V305M + L327T + F360M +++++ +++++ +++++ 34 V160C + A162L + V305M + F360I +++++ +++++ +++++ 35 V160C + A162C + L327T + F360M +++++ +++++ +++++ 36 A162C + V305M + L327T + F360M +++++ +++++ ++++ 37 R85A + V160C + A162L + V305M + F360M +++++ +++++ +++++ 38 V160C + A162C + V305M + L327T + F360M +++++ +++++ +++++ WT − − −

(62) TABLE-US-00010 TABLE 9 Herbicide tolerance evaluation of mutated CyPPO17 Mutation No. site tiafenacil saflufenacil flumioxazin sulfentrazone fomesafen 1 A166C + +++ ++ + + (AC) 2 A166L ++ +++ ++ ++ ++ (AL) 3 V304M ++ +++ ++ N.T ++ (VM) 4 V304L + + N.T N.T N.T (VL) 5 F359M ++ +++ ++ ++ ++ (FM) 6 F359I ++ +++ ++ ++ + (FI) 7 F359L ++ +++ ++ ++ + (FL) 8 F359C ++ +++ ++ + + (FC) 9 F359V ++ +++ ++ ++ + (FV) WT − − − − − Mutation pyraflufen- No. site acifluorfen pyraclonil pentoxazone ethyl 1 A166C +++ N.T + ++ (AC) 2 A166L +++ + ++ ++ (AL) 3 V304M +++ N.T + + (VM) 4 V304L N.T N.T N.T N.T (VL) 5 F359M +++ + ++ ++ (FM) 6 F359I + + ++ ++ (FI) 7 F359L + + + ++ (FL) 8 F359C + + + + (FC) 9 F359V + + ++ ++ (FV) WT − − − − N.T (Not tested)

(63) TABLE-US-00011 TABLE 10 Herbicide tolerance evaluation of mutated CyPPO17 No. Mutation site tiafenacil flumioxazin sulfentrazone 1 R88A + F359I ++ ++ ++ 2 R88A + F359V ++ ++ ++ 3 R88A + F359M ++++ ++++ ++++ 4 V164C + F359I ++ +++ +++ 5 V164C + F359V ++ +++ +++ 6 V164C + F359M ++ ++ ++ 7 A166L + F359I ++++ ++++ +++ 8 A166L + F359V ++++ +++ +++ 9 A166L + F359M ++++ ++++ +++ 10 A166C + F359I ++++ ++++ ++++ 11 A166C + F359V +++ +++ ++++ 12 A166C + F359M +++ +++ +++ 13 V304M + F359I +++ +++ ++ 14 V304M + F359V +++ +++ ++ 15 V304M + F359M +++ +++ ++ 16 L326T + F359I ++++ ++++ +++ 17 L326T + F359V ++++ ++++ +++ 18 L326T + F359M ++++ ++++ +++ 19 R88A + V164C + F359I ++++ ++++ ++++ 20 R88A + A166L + F359M +++++ +++++ ++++ 21 R88A + V304M + F359I ++++ ++++ +++ 22 R88A + L326T + F359M +++++ +++++ ++++ 23 V164C + A166L + F359I +++++ +++++ ++++ 24 V164C + V304M + F359M ++++ ++++ +++ 25 V164C + L326T + F359I ++++ ++++ +++ 26 A166L + V304M + F359M ++++ ++++ +++ 27 A166L + L326T + F359I +++++ +++++ ++++ 28 V304M + L326T + F359M ++++ ++++ +++ 29 R88A + V164C + A166L + F359I +++++ +++++ ++++ 30 R88A + V164C + V304M + F359I +++++ +++++ ++++ 31 R88A + V164C + L326T + F359M +++++ +++++ ++++ 32 R88A + A166L + V304M + F359I +++++ +++++ +++ 33 R88A + A166L + L326T + F359M +++++ +++++ ++++ 34 R88A + V304M + L326T + F359M +++++ +++++ ++++ 35 V164C + A166L + V304M + F359I +++++ +++++ ++++ 36 V164C + A166L + L326T + F359M +++++ +++++ ++++ 37 A166L + V304M + L326T + F359I +++++ +++++ ++++ 38 R88A + V164C + A166L + V304M + F359I +++++ +++++ ++++ 39 R88A + V164C + A166L + L326T + F359M +++++ +++++ ++++ 40 V164C + A166L + V304M + L326T + F359M +++++ +++++ ++++ 41 R88A + V164C + A166C + V304M + L326T + F359M +++++ +++++ ++++ WT − − −

(64) In Tables 7 to 10, tolerance level was presented as of tolerance of wild type and of variants equivalent to that of wild type, and was done as ‘+’ per each 10 fold resistance until ‘+++++’ as maximal resistance. (Tolerance level was evaluated by relative growth level of variants to that of wild type in the media containing highest concentration of herbicide; ‘+’=1-9 fold higher tolerance, ‘++’=10-99 fold higher tolerance, ‘+++’=100-999 fold higher tolerance, ‘++++’=1,000-9,999 fold higher tolerance, ‘+++++’=more than 10,000 fold higher tolerance)

(65) FIGS. 2 to 17 show the tolerance of CyPPO16 wild type and its variants, and FIGS. 18 to 33 show that of CyPPO17 wild type and its variants. The concentrations of herbicides were written above the photographs of tolerance test. A dilution series (0D600=0.5, 0.05, 0.005, 0.0005, 0.00005) was made and spotted on LB agar plates supplemented with herbicides.

(66) As shown in Tables 7 to 10 and FIGS. 2 to 33, all of BT3 strains transformed with variants of CyPPO16 or CyPPO17 showed higher tolerance level than that of wild type against various PPO-inhibiting herbicides.

Example 4: Measurement of PPO Enzyme Activity and ICso Value for Herbicides

(67) The enzyme activities of variants wherein amino acids of certain position of PPO protein mutated were measured and inhibition assay with the PPO-inhibiting herbicides was conducted.

(68) Although the solubility of PPO protein is markedly low in aqueous condition, it was greatly increased when maltose binding protein (MBP) was fused to PPO protein. Thus, PPO proteins of wild type and variants were expressed as fused to MBP and were used for experiments.

(69) In order to express wild type and variant proteins of CyPPO16 and CyPPO17, those genes were introduced into pMAL-c2x vector (refer to FIG. 34), respectively.

(70) Detailed experimental procedure was as follows:

(71) Using primers listed in Table 12, PCR was carried out to amplify PPO genes under following condition.

(72) PCR reaction mixture

(73) Template (synthetic DNA of CyPPO16 or CyPPO17) 1 μl

(74) 10× buffer 5 μl

(75) dNTP mixture (10 mM each) 1 μl

(76) Forward primer (10 μM) 1 μl

(77) Reverse primer (10 μM) 1 μl

(78) DDW 40 μl

(79) Pfu-X (Solgent, 2.5 units/μl) 1 μl

(80) Total 50 μl

(81) TABLE-US-00012 TABLE 11 PCR reaction condition 94° C. 4 min. 1 cycle 94° C. 30 sec. 27 cycles 56° C. 30 sec. 72° C. 5 min. 72° C. 5 min. 1 cycle  4° C. 5 min. 1 cycle

(82) TABLE-US-00013 TABLE 12 Primer list for cloning of CyPPO16 and CyPPO17 in pMAL-c2x SEQ ID Strain Primer Sequence NO Spirulina CyPPO16_BamHIF CCCCGGATCCATGCTA 85 subsalsa GACTCCCTGATTGT CyPPO16_SalIR CCCCGTCGACTCACTC 86 CCTGCTTCTAATTTTT TG Thermo- CyPPO17_BamHIF CCCCGGATCCATGGAG 87 synechococcus GTCGATGTTGCAAT sp. NK55a CyPPO17_SalIR CCCCGTCGACTCAGGA 88 TTGCCCCCCACTCAGG T

(83) Amplified PCR products and pMAL-c2x vector (NEB, FIG. 34) were digested with BamHI and Sall restriction enzymes, and ligated to construct pMAL-c2x-CyPPO16 and pMAL-c2x-CyPPO17 plasmids using T4 DNA ligase (RBC, 3 units/μl).

(84) CyPPO16 and CyPPO17 genes cloned in pMAL-c2x vector were mutated through site-directed mutagenesis using primers listed in Tables 4 and 5, respectively.

(85) PCR reaction mixture

(86) Template 1 μl

(87) 10× buffer 5 μl

(88) dNTP mixture (10 mM each) 1 μl

(89) Forward primer (10 μM) 1 μl

(90) Reverse primer (10 μM) 1 μl

(91) DDW 40 μl

(92) Pfu-X (Solgent, 2.5 units/μl) 1 μl

(93) Total 50 μl

(94) Then, BL21 CodonPlus(DE3) E. coli was transformed with constructs.

(95) The transformed E. coli were cultured under the following conditions to express PPO proteins:

(96) Induction: OD.sub.600=0.2, addition of IPTG to 0.3 mM final concentration;

(97) Culture temperature: 23° C., 200 rpm shaking culture;

(98) Culture time: 16 hrs;

(99) Culture volume: 200 ml/1,000 ml flask.

(100) After harvesting the cells, cell lysis and protein extraction were performed by the following process:

(101) Extraction buffer: Column buffer (50 mM Tris-C1, pH 8.0, 200 mM NaCl) 5 ml buffer/g cell;

(102) Sonication: SONICS&MATERIALS VCX130 (130 watts);

(103) 15 sec ON, 10 sec OFF for 5 min on ice;

(104) Centrifugation at 4° C. for 20 minutes (20,000x g); and the supernatant obtained after the centrifugation was diluted at the ratio of 1:6 with column buffer.

(105) The following process for purification of PPO protein was performed in a 4° C. cold room. Amylose resin (NEB) was packed to 1.5×15 cm column (Bio-Rad, Econo Columns 1.5×15 cm, glass chromatography column, max. vol), and the obtained protein extracts were loaded to the column at a flow rate of 0.2 ml/min. The column was washed with 3 column volumes of buffer and the presence of protein in the washing solution was examined. When the protein was no longer detected, the washing procedure was terminated. Then, the MBP-PPO protein was eluted with approximately 2 column volumes of buffer containing 20 mM maltose. The protein concentration of each eluent was determined and the elution was stopped when the protein was no longer detected. Ten microliter of each fraction was investigated for protein quantification and SDS-PAGE analysis. The highly pure fractions of PPO protein variants were used for the enzyme assay.

(106) Since protoporphyrinogen IX, a substrate of PPO protein, was not commercially available, it was chemically synthesized in the laboratory. Overall process was performed in dark under nitrogen stream. Nine micrograms of protoporphyrin IX was dissolved in 20 ml of 20% (v/v) EtOH, and stirred under dark condition for 30 minutes. The obtained protoporphyrin IX solution was put into a 15 ml screw tube in an amount of 800 μl, and flushed with nitrogen gas for 5 minutes. To this, 1.5 g of sodium amalgam was added and vigorously shaken for 2 minutes. The lid was opened to exhaust hydrogen gas in the tube. Thereafter, the lid was closed and incubated for 3 minutes. The protoporphyrinogen IX solution was filtered using syringe and cellulose membrane filter. To 600 μl of the obtained protoporphyrinogen IX solution, approximately 300 μl of 2M MOPS [3-(N-morpholino) propanesulfonic acid] was added to adjust pH to 8.0. To determine the enzyme activity of PPO protein, a reaction mixture was prepared with the following composition (based on 10 ml): 50 mM Tris-Cl (pH 8.0); 50 mM NaCl; 0.04% (v/v) Tween 20; 40 mM glucose (0.072 g); 5 units glucose oxidase (16.6 mg); and 10 units catalase (1 μl).

(107) Hundred and eighty microliters of a reaction mixture containing the purified PPO protein were placed in 96 well plates and 20 μl of purified PPO proteins were added. After 50 μl of the mineral oil was layered, the reaction was initiated by adding the substrate, protoporphyrinogen IX solution, to a final concentration of 50 μM. The reaction proceeded at room temperature for 30 min and the fluorescence of protoporphyrin IX was measured using Microplate reader (Sense, Hidex) (excitation: 405 nm; emission: 633 nm). To calculate the PPO enzyme activity, the protoporphyrinogen IX solution was kept open in the air overnight to oxidize the solution. To this, 2.7 N HCl was added, and the absorbance at 408 nm was measured. A standard curve was generated using standard protoporphyrin IX, and PPO activity was measured by calibration of protoporphyrin IX using the standard curve of protoporphyrin IX.

(108) The enzyme activities of the obtained PPO wild type and variants were shown in Tables 14 to 15. Activities of variants were presented relatively compared to that of wild type.

(109) Meanwhile, the maximal velocity (Vmax) values of each enzyme were determined in order to evaluate the kinetic characteristics of CyPPO16 and CyPPO17. The initial reaction velocity was measured where the reaction velocity was proportional to concentration by varying the substrate concentration. The amount of produced protoporphyrin IX, the enzyme reaction product, was measured by time course at room temperature for 20 minutes. Vmax values were calculated with the enzyme kinetics analysis program by Michaelis-Menten equation. The wild type AtPPO1 was used as a control. The result was shown in Table 13:

(110) TABLE-US-00014 TABLE 13 Vmax values of CyPPO16 and CyPPO17 CyPPO16 CyPPO17 AtPPO1 Vmax (nmole mg protein.sup.−1 min.sup.−1) 336 378 135

(111) From the above results, Vmax values of CyPPO16 and CyPPO17 were more than two times higher than that of AtPPO1. This indicates that CyPPO16 and CyPPO17 proteins possess better ability as PPO enzyme than the plant-derived AtPPO1.

(112) In addition, the concentration of the PPO-inhibiting herbicides that inhibits the PPO enzyme activity of each PPO wild type and variants by 50% (IC.sub.50) was measured for each herbicide. The final concentrations of each herbicide were as follows: tiafenacil, flumioxazin and sulfentrazone: 0, 10, 50, 100, 250, 500, 1000, 2500, 5000, 10000 nM

(113) The IC.sub.50 value, the concentration of the herbicide inhibiting the PPO enzyme activity to 50%, was calculated by adding the herbicide of the above concentrations.

(114) The IC.sub.50 value for each herbicide was shown in the following Tables 14 and 15.

(115) TABLE-US-00015 TABLE 14 Determination of IC.sub.50 of CyPPO16 wild type and mutants against various herbicides Activity tiafenacil flumioxazin sulfentrazone No. Mutation site (%) (nM) (nM) (nM) 1 WT 100 26 14 245 2 R85A 94 119 59 1,036 3 F156A 57 60 N.T N.T 4 V160C 96 45 57 584 5 A162C 80 79 N.T N.T 6 A162L 69 193 578 1,096 7 V305M 72 43 38 305 8 F324V 23 103 N.T N.T 9 L327T 68 40 780 1,827 10 I340T 22 230 N.T N.T 11 F360M 83 168 472 1,203 12 F360I 74 1,738 835 1,363 13 F360V 69 939 667 1,962 14 F360T 25 2,500 N.T N.T 15 R85A + F360M 63 1,022 567 >10,000 16 F156A + F360M 18 237 N.T N.T 17 V160C + F360M 67 405 1,002 4,371 18 A162C + F360M 56 2,162 N.T N.T 19 A162L + F360M 45 >5,000 4,058 >10,000 20 V305M + F360M 35 476 1,182 3,631 21 F324V + F360M 13 4,056 N.T N.T 22 L327T + F360M 21 3,763 5,000 >10,000 23 I340T + F360M 16 >5,000 N.T N.T 24 A162C + L327T + F360M 17 3,915 >5,000 >10,000 25 R85A + A162C + L327T + F360M 15 4,683 >5,000 >10,000 26 R85A + V160C + A162C + L327T + F360M 15 >5,000 >5,000 >10,000 27 R85A + V160C + A162C + V305M + L327T + F360M 13 >5,000 >5,000 >10,000 N.T (Not tested)

(116) TABLE-US-00016 TABLE 15 Determination of IC.sub.50 of CyPPO17 wild type and mutants against various herbicides Activity tiafenacil flumioxazin sulfentrazone No. Mutation site (%) (nM) (nM) (nM) 1 WT 100 44 26 326 2 R88A 70 152 95 4,426 3 F160A 63 115 N.T N.T 4 V164C 73 87 58 920 5 A166C 77 219 N.T N.T 6 A166L 70 1,129 2,828 >10,000 7 V304M 82 102 63 1,089 8 F323V 16 152 N.T N.T 9 L326T 96 194 139 >10,000 10 I339T 48 122 N.T N.T 11 F359M 90 1,189 379 696 12 F359I 92 1,531 825 >10,000 13 F359V 84 932 2,052 >10,000 14 F359T 56 >5,000 N.T N.T 15 R88A + F359M 53 1,284 690 >10,000 16 F160A + F359M 56 3,927 N.T N.T 17 V164C + F359M 71 2,737 576 1,281 18 A166C + F359M 72 >5,000 N.T N.T 19 A166L + F359M 65 >5,000 >5,000 >10,000 20 V304M + F359M 68 >5,000 486 4,536 21 F323V + F359M 8 4,247 N.T N.T 22 L326T + F359M 74 4,792 933 >10,000 23 I339T + F359M 44 >5,000 N.T N.T N.T (Not tested)

(117) As shown in the Tables 14 and 15, it was demonstrated that variants of CyPPO16 and CyPPO17 proteins showed the significantly increased IC.sub.50 values against each herbicide compared to the wild type. Such results indicate that herbicide tolerance was increased by amino acid substitutions at specified positions of PPO protein. Although the data showed that CyPPO16 and CyPPO17 protein variants possess reduced enzyme activity compared to the wild type, it might be caused by the difference between the chloroplast environment where PPO functions and in vitro assay condition. Thus, when PPO variants are properly assembled and expressed to chloroplasts in plants, the enzyme activity would not be affected drastically.

Example 5. Generation of Arabidopsis thaliana Transformants Using CyPPO Variants and PPO-Inhibiting Herbicide Tolerance Test

(118) 5-1. Construction of A. thaliana Transformation Vectors and Generation of A. thaliana Transformants

(119) A. thaliana was transformed with a binary vector having ORF of a selectable marker, Bar gene (glufosinate-tolerant gene), and ORF of each mutant gene of CyPPO16 and CyPPO17. The transgenic plant was examined for cross-tolerance towards glufosinate and PPO-inhibiting herbicides. The bar gene was also used to examine whether the transgene was stably inherited during generations. NOS promoter and E9 terminator were used for bar gene expression.

(120) In order to express proteins of CyPPO16, CyPPO16 variants, CyPPO17, and CyPPO17 variants in plants, a CaMV35S promoter and a NOS terminator were used. Encoding genes of CyPPO16, CyPPO16 variants, CyPPO17, and CyPPO17 variants were introduced into binary vector using Xhol and BamHI restriction enzymes. Furthermore, for confirmation of the protein expression, hemagglutinin (HA) tag was fused to the C-terminal region of PPO protein coding gene using BamHI and Sad restriction enzymes. In addition, in order to transit protein to chloroplast, transit peptide (TP) gene (SEQ ID NO: 90) of AtPPO1 gene (SEQ ID NO: 89) was fused to N-terminal region of PPO protein coding gene using Xbal and Xhol restriction enzymes.

(121) Each constructed vector was transformed to Agrobacterium tumefaciens GV3101 competent cell by freeze-thaw method. Agrobacterium GV3101 competent cells were prepared by following procedures, Agrobacterium GV3101 strain was cultured in 5 ml LB media at 30° C., 200 rpm for 12 hrs. The cells were subcultured in 200 ml of LB media at 30° C., 200 rpm for 3 to 4 hrs, and centrifuged at 3,000×g at 4° C. for 20 minutes. The cell pellet was washed with sterile distilled water, and then resuspended in 20 ml of LB media. Snap frozen 200 μl aliquots with liquid nitrogen were stored in a deep freezer.

(122) Each transformed Agrobacterium was screened in spectinomycin-containing LB media. The screened colony was cultured in LB broth. After Agrobacterium cell was harvested from the culture media, it was resuspended in the solution containing 5% sucrose (w/v) and 0.05% Silwet L-77 (v/v) (Momentive Performance Materials Co., Ltd.) at an absorbance (OD.sub.600) of 0.8. By floral dipping method, A. thaliana wild type (Col-0 ecotype) was transformed, and then the T.sub.1 seeds were harvested after 1 to 2 months.

(123) Transgenic plants were screened with glufosinate tolerance which was conferred by Bar gene expression in the binary vector. The obtained T.sub.1 seeds were sown in 1/2 MS media (2.25 g/l MS salt, 10 g/l sucrose, 7 g/l Agar) supplemented with 50 μM glufosinate, and the surviving plants were selected 7 days after sowing. They were, then, transplanted into soil and grown to obtain T.sub.1 plants.

(124) In order to examine PPO-inhibiting herbicide tolerance of the transgenic plants, 4-week-old plants were evenly sprayed with herbicide (100 ml of 1 μM tiafenacil and 0.05% Silwet L-77 (v/v)) in 40×60 cm area (0.24 m.sup.2). While wild type A. thaliana (Col-0 ecotype) completely died within 7 days after treatment, each transgenic plant showed no damage to PPO-inhibiting herbicide treatment.

(125) The T.sub.2 seeds were harvested from T.sub.1 transgenic plant and were sown to 1/2 MS media (2.25 g/l MS salt, 10 g/l sucrose, 7 g/l Agar) supplemented with 50 μM glufosinate. One week later, surviving plants were transplanted to soil.

(126) 5-2. Verification of Herbicide Tolerance of Transformed Arabidopsis Plants (T.sub.2)

(127) Arabidopsis plants (T.sub.2) transformed with genes including CyPPO16, CyPPO16 variants (F360I, F360M, F360V, A162C+F360M), CyPPO17, or CyPPO17 variants (F359I, F359M, F359V, V304M+F359I) were tested for their tolerance against herbicides.

(128) In order to examine PPO-inhibiting herbicide tolerance of the transgenic plants, transgenic plants of CyPPO16 wild type or CyPPO17 wild type were evenly sprayed with herbicide (100 ml of 1 μM tiafenacil and 0.05% Silwet L-77 (v/v)) in 40×60 cm area (0.24 m.sup.2). Herbicide tolerance was evaluated 3 days after treatment. Wild type Arabidopsis plant (Col-0 ecotype) was used as a control.

(129) The evaluated transgenic Arabidopsis (T.sub.2) plants after 1 μM tiafenacil treatment were shown in FIG. 35.

(130) In order to examine PPO-inhibiting herbicide tolerance of the transgenic plants, transgenic plants of CyPPO16 variants or CyPPO17 variants were evenly sprayed with herbicide (100 ml of 5 μM tiafenacil and 0.05% Silwet L-77 (v/v)) in 40×60 cm area (0.24 m.sup.2). Herbicide tolerance was evaluated 3 days after treatment. Wild type Arabidopsis plant (Col-0 ecotype) and transgenic plants of CyPPO16 wild type or CyPPO17 wild type were used as controls.

(131) The transgenic Arabidopsis (T.sub.2) plants after 5 μM tiafenacil treatment were shown in FIG. 36.

(132) Based on the results above (FIGS. 35 and 36), herbicide tolerance of transgenic plants was evaluated with Injury index defined in Table 16.

(133) TABLE-US-00017 TABLE 16 Injury index definition Injury index Symptom 0 No damage 1 Dried leaf tip 2 Over 20% and less than 30% of the plant was scorched 2.5 Over 30% and less than 50% of the plant was scorched 3 Over 50% and less than 70% of the plant was scorched 4 Over 70% of the plant was scorched 5 The whole plant was dried and died

(134) The tolerance levels of transgenic plants were evaluated according to the injury index definition and were shown in Tables 17 to 19.

(135) TABLE-US-00018 TABLE 17 Injury index of transgenic plants of CyPPO16 wild type and CyPPO17 wild type after 1 μM tiafenacil treatment Col-0 CyPPO16 wild type CyPPO17 wild type Injury index 5 2 2

(136) TABLE-US-00019 TABLE 18 Injury index of transgenic plants of CyPPO16 variants after 5 μM tiafenacil treatment CyPPO16 A162C + Col-0 Wild type F360I F360M F360V F360M Injury 5 4 2 2 2 2 index

(137) TABLE-US-00020 TABLE 19 Injury index of transgenic plants of CyPPO17 variants after 5 μM tiafenacil treatment CyPPO17 V304M + Col-0 Wild type F359I F359M F359V F359I Injury 5 4 1 2 1 1 index