Expression System

20210348205 · 2021-11-11

Assignee

Inventors

Cpc classification

International classification

Abstract

A perfect palindrome operator sequence-based protein expression system is provided. The expression system comprises a promoter; and a perfect palindrome operator sequence, wherein the promoter is not T7. The expression system is preferably employed for the production of recombinant proteins by fermentation.

Claims

1-16. (canceled)

17. A perfect palindrome operator sequence-based recombinant protein expression system for expression of proteins in E. coli cells comprising an E. coli host cell comprising an expression cassette comprising: (a) a T7A3 promoter; (b) a single operator sequence, said operator sequence being a perfect palindrome operator sequence, wherein the operator sequence is located downstream of the promoter; and a sequence encoding a protein.

18. An expression system according to claim 17, wherein the perfect palindrome operator sequence overlaps the transcriptional start point.

19. A method according to claim 17, wherein the perfect palindrome operator sequence has the nucleic acid sequence GGAATTGTGAGCGCTCACAATTCC (nucleotides 51-74 of SEQ ID NO: 3).

20. An E. coli host cell transformed with a plasmid, said plasmid comprising an expression cassette comprising: (a) a T7A3 promoter; (b) a single operator sequence, said operator sequence being a perfect palindrome operator sequence, wherein the operator sequence is located downstream of the promoter; and (c) a sequence encoding a protein.

21. An E. coli host cell according to claim 20, wherein the perfect palindrome operator sequence overlaps the transcriptional start point.

22. An E. coli host cell according to claim 20, wherein the perfect palindrome operator sequence has the nucleic acid sequence GGAATTGTGAGCGCTCACAATTCC (nucleotides 51-74 of SEQ ID NO: 3).

23. A method for the production of a recombinant protein in an E. coli host cell which comprises the step of expressing the expression system according to claim 17 in the E. coli host cell.

24. A method according to claim 23, wherein the perfect palindrome operator sequence overlaps the transcriptional start point.

25. A method for producing a protein, which comprises: (a) culturing an E. coli host cell according to claim 20; and (b) recovering the protein.

26. A method according to claim 25, wherein the perfect palindrome operator sequence overlaps the transcriptional start point.

27. A method according to claim 26, wherein the perfect palindrome operator sequence is a lac operator sequence.

28. A method according to claim 27, wherein the perfect palindrome operator sequence has the nucleic acid sequence GGAATTGTGAGCGCTCACAATTCC (nucleotides 51-74 of SEQ ID NO: 3).

29. A method according to claim 18, wherein the perfect palindrome operator sequence has the nucleic acid sequence GGAATTGTGAGCGCTCACAATTCC (nucleotides 51-74 of SEQ ID NO: 3).

30. An E. coli host cell according to claim 21, wherein the perfect palindrome operator sequence has the nucleic acid sequence GGAATTGTGAGCGCTCACAATTCC (nucleotides 51-74 of SEQ ID NO: 3).

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this application, illustrate embodiment(s) of the invention and together with the description serve to explain the principle of the invention. In the drawings:

[0027] FIG. 1 is a D1.3 Fab expression cassette according to an embodiment of the present invention;

[0028] FIG. 2 shows the result of the accumulation level of hTNFα according to Example 7;

[0029] FIG. 3 shows Western blot analysis for strain CLD038 according to Example 9;

[0030] FIG. 4 shows the hTNFα productivity profile for Strain CLD030 according to Example 11;

[0031] FIG. 5 shows the DNA sequence for a synthetic bispecific single chain tetravalent diabody (bsctDb) that was designed according to Example 15;

[0032] FIG. 6 shows SEQ ID NO: 23 according to Example 16;

[0033] FIG. 7 shows SEQ ID NO: 24 according to Example 16;

[0034] FIG. 8 shows SEQ ID NO: 25 according to Example 16;

[0035] FIG. 9 shows SEQ ID NO: 26 according to Example 17;

[0036] FIG. 10 shows the expression and accumulation of HadL protein according to Example 17;

[0037] FIG. 11 shows the growth of CLD075 and expression/accumulation of HadL protein following induction according to Example 18;

[0038] FIG. 12 shows SEQ ID NO: 33 according to Example 21;

[0039] FIG. 13 shows SEQ ID NO: 34 according to Example 21;

[0040] FIG. 14 shows the expression and secretion into the growth medium by the CHO cells of IgG Fc protein according to Example 21;

[0041] FIG. 15 shows SEQ ID NO: 35 according to Example 20;

[0042] FIG. 16 shows SEQ ID NO: 36 according to Example 20;

[0043] FIG. 17 shows the accumulation level of hTNF; and

[0044] FIG. 18 shows a plasmid map for pAVE013 according to an embodiment of the present invention.

[0045] 1. Generation of pAVE Series of Vectors
Vectors pAVE011, pAVE012 and pAVE013

[0046] The starting vector for the generation of pAVE011 was pZT7#2.0, prepared as described in U.S. Pat. No. 6,537,779. pZT7#2.0 has a pAT153 vector backbone, cer stability sequence, tet A/R, a single native lac operator sequence upstream of the gene of interest and an upstream T4 transcription terminator. A T7A3 promoter and dual perfect palindrome lac operators were cloned into this plasmid using synthetic oligonucleotide linkers by means of the Nco 1, EcoR I and Xba 1 restriction enzyme sites.

[0047] Linker 12.1 was prepared by annealing the oligonucleotides 1 and 2.1:

TABLE-US-00001 Oligonucleotide 1 (SEQ ID NO 1) 5′CATGTGGGAATTGTGAGCGCTCACAATTCCAAGAACAATCCTGCACG Oligonucleotide 2.1 (SEQ ID NO 2) 5′AATTCGTGCAGGATTGTTCTTGGAATTGTGAGCGCTCACAATTCCCA

[0048] The linker was then ligated to plasmid pZT7#2.0 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Nco 1/EcoR I fragment. Initial screening of transformants was by restriction digestion using Nco 1. The sequence was confirmed by sequencing. The resultant plasmid was named pAVE012.

[0049] The T7A3 promoter cassette was then cloned into pAVE012 by annealing oligonucleotides 3 and 4:

TABLE-US-00002 Oligonucleotide 3 (SEQ ID NO 3) 5′AATTCAAACAAAACGGTTGACAACATGAAGTAAACACGGTACGATGT ACCGGAATTGTGAGCGCTCACAATTCCCCA Oligonucleotide 4 (SEQ ID NO 4) 5′CTGGTGGGGGGTTGTGGGCGCTCGCGGTTCCGGTGCGTCGTGCCGT GTTTGCTTCGTGTTGTCGGCCGTTTTGTTTG
the annealed oligonucleotides being ligated to plasmid pAVE012 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba 1/EcoR I fragment. Initial screening was by restriction digest of plasmid DNA. The sequence was then confirmed by sequencing. The resultant plasmid was named pAVE011.

[0050] Human TNFα gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE013. A plasmid map for pAVE013 is presented in FIG. 18. This shows the arrangement of operators and promoter, and the restriction enzyme sites used in the construction. The operators are both perfect palindrome lac operators. RBS is the ribosomal binding site. The vector includes a pAT153 vector backbone, a cer stability sequence, an inducible tetracycline resistance gene (tet A/R), and an upstream T4 transcription terminator.

Vectors pAVE038 and pAVE041

[0051] The starting vector for the generation of pAVE038 was pZT7#2.0, prepared as described in U.S. Pat. No. 6,537,779. A tac promoter and single native lac operator were cloned into this plasmid using a synthetic oligonucleotide linker by means of the EcoR I and Xba I restriction enzyme sites.

[0052] Linker 1112 was made by annealing the oligonucleotides 11 and 12

TABLE-US-00003 Oligonucleotide 11 (SEQ ID NO 5) 5′AATTTTCTGAAATGAGCTGTTGACAATTAATCATCGGCTCGGATACTG TGTGGAATTGTGAGCGGATAACAATTCCCCA Oligonucleotide 12 (SEQ ID NO 6) 5′CTAGTGGGGAATTGTTATCCGCTCACAATTCCACACAGTATCCGAGCC GATGATTAATTGTCAACAGCTCATTTCAGAA

[0053] The linker was then ligated to plasmid pZT7#2.0 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba 1/EcoR I fragment. Initial screening of transformants was by restriction digestion using Nco 1. The sequence was confirmed by sequencing. The resultant plasmid was named pAVE038.

[0054] A human TNFα gene was cloned into this plasmid as an Nde I/Xho I fragment to generate plasmid pAVE041.

Vector pAVE037 and pAVE040

[0055] The starting vector for the generation of pAVE037 was pZT7#2.0 prepared as described in U.S. Pat. No. 6,537,779. A tac promoter and single perfect palindrome lac operator were cloned into this plasmid using a synthetic oligonucleotide linker by means of the EcoR I and Xba 1 restriction enzyme sites.

[0056] Linker 1314 was made by annealing the oligonucleotides 13 and 14

TABLE-US-00004 Oligonucleotide 13 (SEQ ID NO 7) 5′AATTTTCTGAAATGAGCTGTTGACAATTAATCATCGGCTCGGATACTG TGTGGAATTGTGAGCGCTCACAATTCCCCA Oligonucleotide 14 (SEQ ID NO 8) 5′CTAGTGGGGAATTGTGAGCGCTCACAATTCCACACAGTATCCGAGCCG ATGATTAATTGTCAACAGCTCATTTCAGAA

[0057] The linker was then ligated to plasmid pZT7#2.0 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba 1/EcoR I fragment. Initial screening of transformants was by restriction digestion using Nco 1. The sequence was confirmed by sequencing. The resultant plasmid was named pAVE037.

[0058] A human TNFα gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE040.

Vector pAVE028 and pAVE030

[0059] The starting vector for the generation of pAVE028 was pAVE012. A T7A3 promoter cassette was cloned into pAVE012 by annealing oligonucleotides 5 and 6.

TABLE-US-00005 Oligonucleotide 5 (SEQ ID NO 9) 5′AATTCGAAACAAAACGGTTGACAACATGAAGTAAACACGGTACGATGT ACCGGAATTGTGAGCGCTCACAATTCCCCA Oligonucleotide 6 (SEQ ID NO 10) 5′CTGGTGGGGGGTTGTGGGCGCTCGCGGTTCCGGTGCGTCGTGCCGTGT TTGCTTCGTGTTGTCGGCCGTTTTGTTTCG
the annealed oligonucleotides being ligated to plasmid pAVE012 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba 1/EcoR I fragment. Initial screening was by restriction digest of plasmid DNA. The sequence was then confirmed by sequencing. The resultant plasmid was named pAVE028.

[0060] A human TNFα gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE030.

Vector pAVE007 and pAVE031

[0061] The starting vector for the generation of pAVE007 was pZT7#2.0 prepared as described in U.S. Pat. No. 6,537,779. A T7A3 promoter and single perfect palindrome lac operator was cloned into this plasmid using a synthetic oligonucleotide linker by means of the EcoR I and Xba 1 restriction enzyme sites.

[0062] The linker containing the T7A3 promoter was made up of oligonucleotides 3 and 4.

TABLE-US-00006 Oligonucleotide 3 (SEQ ID NO 3) 5′AATTCAAACAAAACGGTTGACAACATGAAGTAAACACGGTACGATGTA CCGGAATTGTGAGCGCTCACAATTCCCCA Oligonucleotide 4 (SEQ ID NO 4) 5′CTGGTGGGGGGTTGTGGGCGCTCGCGGTTCCGGTGCGTCGTGCCGTGT TTGCTTCGTGTTGTCGGCCGTTTTGTTTG

[0063] Oligonucleotides 3 and 4 were annealed, the linker formed was then ligated to plasmid pZT7#2.0 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba 1/EcoR I fragment. Initial screening was by restriction digest of plasmid DNA. The sequence was then confirmed by sequencing. The resultant plasmid was named pAVE007.

[0064] A human TNFα gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE031.

Vectors pAVE029 and pAVE027

[0065] The starting vector for the generation of pAVE029 was pZT7#2.0 prepared as described fully in U.S. Pat. No. 6,537,779. A λpL promoter and single perfect palindrome lac operator was cloned into this plasmid using synthetic oligonucleotide linker by means of the EcoR I and Xba 1 restriction enzyme sites.

[0066] Linker 78 was made by annealing the oligonucleotides 7 and 8

TABLE-US-00007 Oligonucleotide 7 (SEQ ID NO 11) 5′AATTATCTCTGGCGGTGTTGACATAAATACCACTGGCGGTGATACTGA GCGGAATTGTGAGCGCTCACAATTCCCCA Oligonucleotide 8 (SEQ ID NO 12) 5′CTAGTGGGGAATTGTGAGCGCTCACAATTCCGCTCAGTATCACCGCCA GTGGTATTTATGTCAACACCGCCAGAGAT

[0067] The linker was then ligated to plasmid pZT7#2.0 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba 1/EcoR I fragment. Initial screening of transformants was by restriction digestion using Nco 1. The sequence was confirmed by sequencing. The resultant plasmid was named pAVE029.

[0068] A human TNFα gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE027.

Vectors pAVE043 and pAVE044

[0069] The starting vector for the generation of pAVE043 was pAVE012. A tac promoter cassette was cloned into pAVE012 by annealing oligonucleotides 17 and 18:

TABLE-US-00008 Oligonucleotide 17 (SEQ ID NO 37) 5′AATTTTCTGAAATGAGCTGTTGACAATTAATCATCGGCTCGTATAATG TGTGGAATTGTGAGCGCTCACAATTCCCCA Oligonucleotide 18 (SEQ ID NO 38) 5′CTAGTGGGGAATTGTGAGCGCTCACAATTCCACACATTATACGAGCCG ATGATTAATTGTCAACAGCTCATTTCAGAA
the annealed oligonucleotides being ligated to plasmid pAVE012 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba 1/EcoR I fragment. Initial screening was by restriction digest of plasmid DNA. The sequence was then confirmed by sequencing. The resultant plasmid was named pAVE043.

[0070] A human TNFα gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE044.

Vectors pAVE034 and pAVE035

[0071] The starting vector for the generation of pAVE034 was pAVE012. A λpL promoter cassette was cloned into pAVE012 by annealing oligonucleotides 9 and 10:

TABLE-US-00009 Oligonucleotide 9 (SEQ ID NO 39) 5′AATTCATCTCTGGCGGTGTTGACATAAATACCACTGGCGGTGATACTG AGCGGAATTGTGAGCGCTCACAATTCCCCA Oligonucleotide 10 (SEQ ID NO 40) 5′CTAGTGGGGAATTGTGAGCGCTCACAATTCCGCTCAGTATCACCGCCA GTGGTATTTATGTCAACACCGCCAGAGATG
the annealed oligonucleotides being ligated to plasmid pAVE012 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba 1/EcoR I fragment. Initial screening was by restriction digest of plasmid DNA. The sequence was then confirmed by sequencing. The resultant plasmid was named pAVE034.

[0072] A human TNFα gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE035.

Vector pAVE020 and pAVE021

[0073] The starting vector for the generation of pAVE020 was pAVE012. A λpL promoter cassette was cloned into pAVE012 by annealing oligonucleotides 7 and 8.

TABLE-US-00010 Oligonucleotide 7 (SEQ ID NO 11) 5′AATTATCTCTGGCGGTGTTGACATAAATACCACTGGCGGTGATACTGA GCGGAATTGTGAGCGCTCACAATTCCCCA Oligonucleotide 8 (SEQ ID NO 12) 5′CTAGTGGGGAATTGTGAGCGCTCACAATTCCGCTCAGTATCACCGCCA GTGGTATTTATGTCAACACCGCCAGAGAT
the annealed oligonucleotides being ligated to plasmid pAVE012 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba 1/EcoR I fragment. Initial screening was by restriction digest of plasmid DNA. The sequence was then confirmed by sequencing. The resultant plasmid was named pAVE020.

[0074] A human TNFα gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE021.

Vectors pAVE016 and pAVE017

[0075] The starting vector for the generation of pAVE016 was pAVE012. A tac promoter cassette was cloned into pAVE012 by annealing oligonucleotides 15 and 16.

TABLE-US-00011 Oligonucleotide 15 (SEQ ID NO 13) 5′AATTCCTGAAATGAGCTGTTGACAATTAATCATCGGCTCGTATAATGT GTGGAATTGTGAGCGCTCACAATTCCCCA Oligonucleotide 16 (SEQ ID NO 14) 5′CTAGTGGGGAATTGTGAGCGCTCACAATTCCACACATTATACGAGCCG ATGATTAATTGTCAACAGCTCATTTCAGG
the annealed oligonucleotides being ligated to plasmid pAVE012 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba 1/EcoR I fragment. Initial screening was by restriction digest of plasmid DNA. The sequence was then confirmed by sequencing. The resultant plasmid was named pAVE016.

[0076] A human TNFα gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE017.

Vector pAVE049

[0077] The starting vector for the generation of pAVE049 was pAVE017. The tac promoter cassette was not altered. To increase the spacing between the two operators from 91 to 124 base pairs, an EcoR I linker was cloned in. This was made up of oligonucleotides 19 and 20.

TABLE-US-00012 Oligonucleotide 19 (SEQ ID NO 15) 5′AATTCACCGGTGTACAGTCATGTACAACCGGTG Oligonucleotide 20 (SEQ ID NO 16) 5′AATTCACCGGTTGTACATGACTGTACACCGGTG

[0078] Initial screening was by restriction digest of plasmid DNA. The sequence was then confirmed by sequencing. The resultant plasmid was named pAVE049.

Vector pAVE046

[0079] The starting vector for the generation of secretion vector pAVE046 was pAVE027. A D1.3 Fab expression cassette (FIG. 1, SEQ ID NO 17) was cloned as an Nde I-Bam HI fragment. Initial screening was by restriction digest of plasmid DNA. The sequence was then confirmed by sequencing. The resultant plasmid was named pAVE046.

TABLE-US-00013 TABLE 1 Summary of pAVE vectors Plasmid Promoter Operator System Comments pAVE041 tac Single native lac sequence pAVE017 tac Double perfect palindrome Operator spacing 91 sequences (DPPS) base pairs (DPPS91) pAVE040 tac Single perfect palindrome sequence (SPPS) pAVE049 tac Double perfect palindrome Operator spacing sequences 124 base pairs (DPPS 124) pAVE013 T7A3 Double perfect palindrome Operator spacing 91 sequences base pairs (DPPS91) pAVE030 T7A3 Double perfect palindrome Operator spacing 92 sequences base pairs (DPPS92) pAVE031 T7A3 Single perfect palindrome sequence pAVE021 λpL Double perfect palindrome Operator spacing 91 sequences base pairs (DPPS91) pAVE035 λpL Double perfect palindrome Operator spacing 92 sequences base pairs (DPPS92) pAVE027 λpL Single perfect palindrome sequence pAVE046 λpL Single perfect palindrome Secretion Vector sequence

2. Generation of Recombinant Strains

[0080] E. coli strains W3110 (available from the American Type Culture Collection as strain ATCC27325) and BL21 (available from EMD Biosciences Inc, San Diego, USA) were transformed by electroporation with the plasmids as described in Table 2 below. The resultant recombinant strains were purified and maintained in glycerol stocks at −80° C.

TABLE-US-00014 TABLE 2 Recombinant strains constructed Description (protein:promoter:operator Recombinant Host Plasmid system) Designation No ATCC27325 pAVE013 TNFα:T7A3:DPPS91 CLD018 ATCC27325 pAVE030 TNFα:T7A3:DPPS92 CLD026 ATCC27325 pAVE031 TNFα:T7A3:SPPS CLD032 ATCC27325 pAVE041 TNFα:tac:single native lacO CLD043 ATCC27325 pAVE017 TNFα:tac:DPPS91 CLD019 ATCC27325 pAVE040 TNFα:tac:SPPS CLD042 ATCC27325 pAVE049 TNFα:tac:DPPS124 CLD050 ATCC27325 pAVE021 TNFα:λpL:DPPS91 CLD021 ATCC27325 pAVE035 TNFα:λpL:DPPS92 CLD038 ATCC27325 pAVE027 TNFα:λpL:SPPS CLD030 BL21 pAVE013 TNFα:T7A3:DPPS91 CLD035 BL21 pAVE030 TNFα:T7A3:DPPS92 CLD028 ATCC27325 pAVE046 D1.3 Fab:λpL:SPPS CLD048

Comparison 1

[0081] The starting vector for the generation of a plasmid with the T7A3 promoter without any operator was pZT7#2.0. A T7A3 promoter was cloned into this plasmid using synthetic oligonucleotide Tinker by means of the EcoR I and Xba 1 restriction enzyme sites.

[0082] Linker 2122 was made by annealing the oligonucleotides 21 and 22

TABLE-US-00015 Oligonucleotide 21 (SEQ ID NO 18) 5′AATTCGAAACAAAACGGTTGACAACATGAAGTAAACACGGTACGATGT ACCACATGAAACGACAGTGAGTCA Oligonucleotide 22 (SEQ ID NO 19) 5′CTAGTGACTCACTGTCGTTTCATGTGGTACCTCGTACCGTGTTTACTT CATGTTGTCAACCGTTTTGTTTCG

[0083] The linker was then ligated to plasmid pZT7#2.0 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba I/EcoR I fragment. Initial screening was by restriction digest of plasmid DNA. The sequence was then confirmed by sequencing. Eighty-two clones were screened by restriction digest and sequencing.

[0084] No clones were identified with the correct T7A3 promoter sequence (all contained mutations in the sequence). This suggests that construction of plasmids containing this powerful constitutive promoter is problematic.

Comparison 2

[0085] The starting vector for the generation of a plasmid with the T7A3 promoter under the control of a single native Lac operator sequence was pZT7#2.0. A T7A3 promoter and native Lac operator (LacO) sequence was cloned into this plasmid using synthetic oligonucleotide Tinker by means of the EcoR I and Xba 1 restriction enzyme sites.

[0086] Linker 2324 was made by annealing the oligonucleotides 23 and 24

TABLE-US-00016 Oligonucleotide 23 (SEQ ID NO 20) 5′AATTCGAAACAAAACGGTTGACAACATGAAGTAAACACGGTACGATGT ACCGGAATTGTGAGCGGATAACAATTCCCCA Oligonucleotide 24 (SEQ ID NO 21) 5′CTAGTGGGGAATTGTTATCCGCTCACAATTCCGGTACATCGTACCGTG TTTACTTCATGTTGTCAACCGTTTTGTTTCG

[0087] The linker was then ligated to plasmid pZT7#2.0 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba I/EcoR I fragment. Initial screening was by restriction digest of plasmid DNA. The sequence was then confirmed by sequencing. Ninety-four clones were screened by restriction digestion and sequencing. Again no clones were identified with the correct sequence. However, one clone was found to have a near intact sequence. This clone contained an additional ‘G’ in the sequence approximately at position −37. It is difficult to assign exact position of the mutation since the expected sequence contains -GG- in this region. Human TNFα gene was cloned into the plasmid with the near intact sequence as an Nde I/Xho I fragment. Twenty colonies from the cloning host strain XL-Blue MR (Stratagene) were screened. One was positive clone with no mutations (other than the additional ‘G’ described above). This plasmid was transformed into a production host (ATCC27325) and the plasmid re-sequenced.

[0088] This indicated that the plasmid contained gross mutations in both the T7A3 promoter and the human TNFα sequences indicating that the use of the T7A3 promoter, even under the control of the native lac operator sequence, results in plasmid instability.

EXAMPLE 3

[0089] A vial of CLD032 was removed from the −80° C. freezer and allowed to thaw. 10 μl of the thawed glycerol stock was inoculated into 5 ml Luria Broth (LB, 5 g/L yeast extract (Oxoid), 10 g/L tryptone (Oxoid), and 5 g/L sodium chloride) supplemented with tetracycline (10 μg/ml) and glucose (1 g/L). This was incubated at 37° C. in an orbital shaker for 16 h. 500 μl of this culture was then used to inoculate two 250 ml Erlenmeyer flasks containing 50 ml of Luria Broth (composition as described above). The flasks were incubated at 37° C., at 200 rpm in an orbital shaker. Growth was monitored until OD.sub.600=0.5-0.7. At this point one flask was induced with IPTG (isopropyl-β-D-1-thiogalactopyranoside) to a final concentration 0.05 mM whilst the second flask was left un-induced to monitor basal expression. The incubation was continued, under the conditions described above, during which samples were taken for measurement of growth, accumulation of hTNFα within the bacterial cells. The accumulation level of hTNFα was determined using densitometry scanning of Colloidal Blue stained SDS-PAGE gels of whole cell lysates of the sampled bacteria. The results are summarised below in Table 3.

TABLE-US-00017 TABLE 3 Accumulation Level of hTNFα Time (hours) (% TCP*) 3 2 4 18 6 25 8 33 24 42 24 (basal, 13 no IPTG) *TCP = Total Cell Protein

[0090] Taken together the data presented in Comparisons 1 and 2, and Example 3, show that effective control of the powerful T7A3 promoter was surprisingly achieved using a single perfect palindrome operator sequence. This was totally un-expected given that the use of the single native operator (Comparison 2) did not provide sufficient basal control to allow a stable recombinant production strain to be established. High product accumulation levels were achieved with the single perfect palindrome control system using relatively low concentration of inducer for induction. Although basal expression (in the absence of inducer) was observed it was evident only after significantly extended incubation (24 h).

EXAMPLE 4

[0091] Vials of CLD018 was removed from the −80° C. freezer and allowed to thaw. 10 μl of the thawed glycerol stock was inoculated into 5 ml Luria Broth (LB, 5 g/L yeast extract (Oxoid), 10 g/L tryptone (Oxoid), and 5 g/L sodium chloride) supplemented with tetracycline (10 μg/ml) and glucose (1 g/L). The seed culture was incubated at 37° C. in an orbital shaker for 16 h. 500 μl of the seed culture was then used to inoculate 250 ml Erlenmeyer flasks containing 50 ml of Luria Broth (composition as described above). The flasks were incubated at 37° C., at 200 rpm in an orbital shaker. Growth was monitored until OD.sub.600=0.5-0.7. At this point flasks were induced with IPTG (isopropyl-β-D-1-thiogalactopyranoside) to a final concentration 0.05 mM and 1 mM. A flask was also left un-induced and the incubation of the flasks continued, under the conditions described above, during which samples were taken for measurement of growth, accumulation of hTNFα within the bacterial cells. The accumulation level of hTNFα was determined using densitometry scanning of Colloidal Blue stained SDS-PAGE gels of whole cell lysates of the sampled bacteria. The results are summarised below in Table 4.

TABLE-US-00018 TABLE 4 Accumulation Level of hTNFα (% TCP) 0.05 mM IPTG Time (hours) 3 2 4 5 6 8 8 13 24 19 24 (basal, no IPTG) Not detected 1 mM IPTG Time (hours) 5 7 6 12 8 19 24 26

[0092] This data demonstrated that further control of the powerful T7A3 promoter could be realised using two perfect palindrome operator sequences spaced at 91 bp apart. Basal expression (in the absence of inducer) has been reduced significantly from that achieved using a single perfect palindrome operator to control repression. The control of basal expression achieved using the dual perfect palindrome sequences was un-expected when compared to the T7 system of U.S. Pat. No. 6,537,779 where control of basal expression requires two different control elements. In this example control of basal expression was achieved in a high background of E. coli RNA polymerase.

EXAMPLE 5

[0093] Vials of CLD026 was removed from the −80° C. freezer and allowed to thaw. 10 μl of the thawed glycerol stock was inoculated into 5 ml Luria Broth (LB, 5 g/L yeast extract (Oxoid), 10 g/L tryptone (Oxoid), and 5 g/L sodium chloride) supplemented with tetracycline (10 μg/ml) and glucose (1 g/L). This was incubated at 37° C. in an orbital shaker for 16 h. 500 μl of this culture was then used to inoculate 250 ml Erlenmeyer flasks containing 50 ml of Luria Broth (composition as described above). The flasks were incubated at 37° C., at 200 rpm in an orbital shaker. Growth was monitored until OD.sub.600=0.5-0.7. At this point flasks were induced with IPTG (isopropyl-β-D-1-thiogalactopyranoside) to a final concentration 0.05 mM and 0.005 mM. A flask was also left un-induced and the incubation continued, under the conditions described above, during which samples were taken for measurement of growth, accumulation of hTNFα within the bacterial cells. The accumulation level of hTNFα was determined using densitometry scanning of Colloidal Blue stained SDS-PAGE gels of whole cell lysates of the sampled bacteria. The results are summarised below in Table 5.

TABLE-US-00019 TABLE 5 Accumulation Level of hTNFα (% TCP) 0.005 mM IPTG induction Time (hours)  8 15 24 (basal, no IPTG) Not detected 0.05 mM IPTG induction Time (hours) 8 17

[0094] The results demonstrated that changing the spacing between the two perfect palindrome operator sequences by 1 bp (from 91 to 92 bp) did not adversely influence performance both in terms of basal expression and final accumulation level achieved. Unexpectedly, reducing the IPTG concentration 10 fold (from 0.05 mM to 0.005 mM) did not significantly reduce induced productivity.

EXAMPLE 6

[0095] Vials of CLD042 and CLD043 were removed from the −80° C. freezer and allowed to thaw. 10 μl of each of the thawed glycerol stock was inoculated separately into each of 2×5 ml Luria Broth (LB, 5 g/L yeast extract (Oxoid), 10 g/L tryptone (Oxoid), and 5 g/L sodium chloride) supplemented with tetracycline (10 μg/ml) and glucose (1 g/L). These were incubated at 37° C. in an orbital shaker for 16 h. 500 μl of these cultures were then used to separately inoculate 250 ml Erlenmeyer flasks containing 50 ml of Luria Broth (composition as described above). The flasks were incubated at 37° C., at 200 rpm in an orbital shaker. Growth was monitored until OD.sub.600=0.5-0.7. At this point flasks were induced with IPTG (isopropyl-β-D-1-thiogalactopyranoside) to a final concentration 0.5 mM. Flasks containing a culture of each strain were also left un-induced and the incubation continued, under the conditions described above, during which samples were taken for measurement of growth, accumulation of hTNFα within the bacterial cells. The accumulation level of hTNFα was determined using densitometry scanning of Colloidal Blue stained SDS-PAGE gels of whole cell lysates of the sampled bacteria. The basal accumulation level of hTNFα in the un-induced cultures of CLD042 and CLD043 after 20 hours incubation was compared by Western blot analysis (using anti-hTNFα antibody) following SDS-PAGE of the sampled bacteria. The blots were scanned and the data normalised to enable comparison. The results are summarised below in Table 6.

TABLE-US-00020 TABLE 6 Accumulation Level of hTNFα Time (hours) (% TCP) CLD043: tac promoter, single native lac operator - 0.5 mM IPTG induction 3 6 12 23 20 25 Western Blot: scan intensity* 20 (Basal, 1 no IPTG) CLD042: tac promoter, single perfect palindrome operator - 0.5 mM IPTG induction 3 2 12 18 20 21 Western Blot: scan intensity* 20 (Basal, 0.25 no IPTG) *= scan of hTNFα band on Western blot. Intensity scan data for CLD042 normalised against the intensity scan data for CLD043.

[0096] The results demonstrated that the single perfect palindrome operator sequence can be used to reduce basal expression (in the absence of inducer) four fold without adversely influencing the induced productivity of the tac promoter system.

EXAMPLE 7

[0097] A vial of CLD019 was removed from the −80° C. freezer and allowed to thaw. 10 μl of the thawed glycerol stock was inoculated into 5 ml Luria Broth (LB, 5 g/L yeast extract (Oxoid), 10 g/L tryptone (Oxoid), and 5 g/L sodium chloride) supplemented with tetracycline (10 μg/ml) and glucose (1 g/L). This was incubated at 37° C. in an orbital shaker for 16 h. 500 μl of this culture was then used to inoculate 250 ml Erlenmeyer flasks containing 50 ml of Luria Broth (composition as described above). The flasks were incubated at 37° C., at 200 rpm in an orbital shaker. Growth was monitored until OD.sub.600=0.5-0.7. At this point the flasks were induced with IPTG (isopropyl-β-D-1-thiogalactopyranoside) to a final concentration 0.5 mM, 0.1 mM, 0.05 mM and 0.005 mM. A flask was also left un-induced and the incubation continued, under the conditions described above, during which samples were taken for measurement of growth, and accumulation of hTNFα within the bacterial cells. The accumulation level of hTNFα was determined using densitometry scanning of Colloidal Blue stained SDS-PAGE gels of whole cell lysates of the sampled bacteria. The results are presented in FIG. 2.

[0098] The data presented in FIG. 2 demonstrated that the combination of the tac promoter with dual perfect palindrome operator sequences lead to a system in which the expression rate can be modulated directly by the concentration of IPTG used for induction. Such systems may be exploited to modulate expression of heterologous proteins, for example, to maximise accumulation of proteins in a soluble form or to circumvent the problem of the deleterious effect that heterologous protein secretion can have on the growth and productivity of recombinant cells.

EXAMPLE 8

[0099] A vial of CLD030 was removed from the −80° C. freezer and allowed to thaw. 10 μl of the thawed glycerol stock was inoculated into 5 ml Luria Broth (LB, 5 g/L yeast extract (Oxoid), 10 g/L tryptone (Oxoid), and 5 g/L sodium chloride) supplemented with tetracycline (10 μg/ml) and glucose (1 g/L). This was incubated at 37° C. in an orbital shaker for 16 h. 500 μl of this culture was then used to inoculate 250 ml Erlenmeyer flasks containing 50 ml of Luria Broth (composition as described above). The flasks were incubated at 37° C., at 200 rpm in an orbital shaker. Growth was monitored until OD.sub.600=0.5-0.7. At this point a flask was induced with IPTG (isopropyl-β-D-1-thiogalactopyranoside) to a final concentration 0.05 mM whilst the other flask was left un-induced and the incubation continued, under the conditions described above, during which samples were taken for measurement of growth, accumulation of hTNFα within the bacterial cells. The accumulation level of hTNFα was determined using densitometry scanning of Colloidal Blue stained SDS-PAGE gels of whole cell lysates of the sampled bacteria. The results are summarised below in Table 7.

TABLE-US-00021 TABLE 7 Accumulation Level of hTNFα Time (hours) (% TCP) 4 2 6 5 8 9 24 12 24 (basal, Not detected no IPTG)

[0100] The data presented in Table 7 clearly show that control of the very powerful λpL promoter can be surprisingly achieved using a single perfect palindrome operator sequence. High product accumulation levels can be achieved using the single perfect palindrome control system.

EXAMPLE 9

[0101] Vials of CLD021 and CLD038 were removed from the −80° C. freezer and allowed to thaw. 10 μl of each of the thawed glycerol stock was inoculated separately into 5 ml Luria Broth (LB, 5 g/L yeast extract (Oxoid), 10 g/L tryptone (Oxoid), and 5 g/L sodium chloride) supplemented with tetracycline (10 μg/ml) and glucose (1 g/L). These were incubated at 37° C. in an orbital shaker for 16 h. 500 μl of this culture was then used to inoculate 250 ml Erlenmeyer flasks containing 50 ml of Luria Broth (composition as described above). The flasks were incubated at 37° C., at 200 rpm in an orbital shaker. Growth was monitored until OD.sub.600=0.5-0.7. At this point a flask was induced with IPTG (isopropyl-β-D-1-thiogalactopyranoside) to a final concentration 1 mM whilst a second flask was left un-induced and the incubation continued, under the conditions described above, during which samples were taken for measurement of growth, accumulation of hTNFα within the bacterial cells. The accumulation of hTNFα was determined using Colloidal Blue stained SDS-PAGE gels and Western blot analysis (using anti-hTNFα antibody) following SDS-PAGE of whole cell lysates of the sampled bacteria. The data are summarised in Table 8. The Western blot analysis for strain CLD038 is presented in FIG. 3.

TABLE-US-00022 TABLE 8 hTNFα hTNFα Accumulation - Accumulation - CLD021 CLD038 Analysis (λpL:DPPS91) (λpL:DPPS92) Colloidal Blue Not detected Not detected SDS-PAGE (post IPTG induction) Western blot Positive Positive (post IPTG (see FIG. 2) induction) Colloidal Blue Not detected Not detected SDS-PAGE (Basal no IPTG induction, 24 h) Western blot Not detected Not detected (Basal no IPTG induction, 24 h)

[0102] These results demonstrated that the combination of dual perfect palindrome operator sequences with the λpL promoter with either the 91 bp or 92 bp spacing resulted in very tight repression. Western blots indicate that no basal expression of the target protein was detected. On induction low-level expression level was achieved. These results were totally unexpected given that the λpL promoter is an extremely powerful promoter. Such a system may, for example, be used to direct the expression of proteins of high toxicity to the host cell. It can be used when controlled expression is advantageous, for example, for the expression and insertion of membrane proteins.

EXAMPLE 10

[0103] Vials of CLD028 and CLD035 were removed from the −80° C. freezer and allowed to thaw. 10 μl of each of the thawed glycerol stock was inoculated separately into each of 2×5 ml Luria Broth (LB, 5 g/L yeast extract (Oxoid), 10 g/L tryptone (Oxoid), and 5 g/L sodium chloride) supplemented with tetracycline (10 μg/ml) and glucose (1 g/L). These were incubated at 37° C. in an orbital shaker for 16 h. 500 μl of these cultures were then used to separately inoculate 250 ml Erlenmeyer flasks containing 50 ml of Luria Broth (composition as described above). The flasks were incubated at 37° C., at 200 rpm in an orbital shaker. Growth was monitored until OD.sub.600=0.5-0.7. At this point flasks were induced with IPTG (isopropyl-β-D-1-thiogalactopyranoside) to a final concentration 1 mM and the incubation continued, under the conditions described above, during which samples were taken for measurement of growth, accumulation of hTNFα within the bacterial cells. The accumulation level of hTNFα was determined using densitometry scanning of Colloidal Blue stained SDS-PAGE gels of whole cell lysates of the sampled bacteria. The results are summarised below in Table 9.

TABLE-US-00023 TABLE 9 Time (hours) Accumulation post IPTG Level of hTNFα induction (% TCP) CLD035: T7A3 promoter, dual perfect palindrome operators with 91 bp spacing 2 7 4 14 20 27 CLD028: T7A3 promoter, dual perfect palindrome operators with 92 bp spacing 2 10 4 15 20 23

[0104] These data taken together with the data presented in Examples 4 and 5 previously indicated that both E. coli K-12 and B strains can be used.

EXAMPLE 11

[0105] Fermentation inocula were raised by adding 200 μl of glycerol stock of each of the strains described below to a 2.0 L baffled shake flask containing 200 mL of Luria Broth (LB, 5 g/L yeast extract (Oxoid), 10 g/L tryptone (Oxoid), and 5 g/L sodium chloride) supplemented with 15 μg/ml of tetracycline. Inocula were grown for 12 h at 37° C. in a shaker-incubator with an agitation of 250 rpm. 200 ml shake flask inoculum was used to inoculate a 15 L working volume fermenter containing 10 L of batch growth medium. Fermentations were carried out under the operating conditions described below. Temperature was controlled at 37° C. and pH at 6.8, controlled by automatic addition of 35% (w/v) ammonium hydroxide. The dissolved oxygen tension (dOT) set point was 30% of air saturation and was controlled by automatic adjustment of the fermenter stirrer speed, from a minimum of 250 rpm up to a maximum of 1500 rpm, and automatic supplementation of oxygen to the inlet gas stream. Airflow to the fermenter vessel was 10 L/min throughout. Pressure in the fermenter was maintained between 50 and 200 mbar.

[0106] Fermentations were performed in batch mode until depletion of the carbon source (i.e. glycerol) which occurred ca. 10 h post inoculation and was characterized by a sharp rise in dOT. Fed-batch fermentation was initiated at the point of carbon source exhaustion by the addition of a glycerol/magnesium chloride feed at a feed rate of 11 g of glycerol per L of medium per h. Induction was carried out by addition of IPTG to a final concentration of 0.5 mM once the biomass level in the fermentation reached OD.sub.600=50-60. The fed-batch phase was continued for 12 h post induction. Samples were taken to determine biomass level (OD.sub.600) and hTNFα accumulation (% TCP)/hTNFα titre (g/L) at harvest (Colloidal Blue stained SDS-PAGE gels).

[0107] The composition of the batch growth medium is provided in Table 10.

TABLE-US-00024 TABLE 10 Final concentration [g/L], mg/L] and [ml/L] of Component purified water (NH.sub.4).sub.2SO.sub.4 14.0 Glycerol 35.0 Yeast extract (Becton Dickinson) 20.0 KH.sub.2PO.sub.4 2.0 K.sub.2HPO.sub.4 16.5 Citric acid 7.5 MgSO.sub.4•7H.sub.2O 2.47 H.sub.3PO.sub.4 1.5 ml/L CaCl.sub.2•2H.sub.2O 0.294 Antifoam AF204 0.2 ml/L Tetracycline 15 mg/L FeSO.sub.4•7H.sub.2O 114 mg/L ZnSO.sub.4•7H.sub.20 29 mg/L MnSO.sub.4•H.sub.20 17 mg/L Na.sub.2MoO.sub.4•2H.sub.2O 9 mg/L CuSO.sub.4•5H.sub.2O 4 mg/L H.sub.3•BO.sub.3 12 mg/L

[0108] The composition of the glycerol/magnesium chloride feed is provided in Table 11.

TABLE-US-00025 TABLE 11 Amount required Component of Feed [g/L] of purified water Glycerol 714 MgSO.sub.4•7H.sub.2O 7.4

[0109] The results are summarised in Table 12. The hTNFα productivity profile for Strain CLD030 is presented in FIG. 4.

TABLE-US-00026 TABLE 12 hTNFα hTNFα OD600 accumulation titre Expression vector at (% TCP) at (mg/L) at Strain description harvest harvest harvest CLD018 T7A3 promoter, dual 147 29 8400 perfect palindrome with 91 bp spacing CLD026 T7A3 promoter, dual 204 34 11400 perfect palindrome with 92 bp spacing CLD032 T7A3 promoter, single 194 41 12500 perfect palindrome sequence CLD019 tac promoter, dual 196 22 8300 perfect palindrome sequence with 91 bp spacing CLD030 λpL promoter with 167 7 2600 single perfect palindrome sequence

[0110] The data clearly demonstrate the utility of the systems for the manufacture of heterologous proteins. High product titres were achieved using a simple generic un-optimised fermentation and induction processes. The control characteristics of plasmid pAVE027, as demonstrated by productivity profile exemplified in FIG. 4, can be exploited to maximize the production of heterologous proteins, particularly proteins that require control of expression to maximize secretion.

EXAMPLE 12

[0111] A vial of CLD050 was removed from the −80° C. freezer and allowed to thaw. 10 μl of the thawed glycerol stock was inoculated into 5 ml Luria Broth (LB, 5 g/L yeast extract (Oxoid), 10 g/L tryptone (Oxoid), and 5 g/L sodium chloride) supplemented with tetracycline (10 μg/ml) and glucose (1 g/L). This was incubated at 37° C. in an orbital shaker for 16 h. 500 μl of this culture was then used to inoculate 250 ml Erlenmeyer flasks containing 50 ml of Luria Broth (composition as described above). The flasks were incubated at 37° C., at 200 rpm in an orbital shaker. Growth was monitored until OD.sub.600=0.5-0.7. At this point a flask was induced with IPTG (isopropyl-β-D-1-thiogalactopyranoside) to a final concentration 0.05 mM whilst another flask was left uninduced and the incubation continued, under the conditions described above, during which samples were taken for measurement of growth, accumulation of hTNFα within the bacterial cells. The accumulation level of hTNFα was determined using densitometry scanning of Colloidal Blue stained SDS-PAGE gels of whole cell lysates of the sampled bacteria. The results are summarised below in Table 13.

TABLE-US-00027 TABLE 13 Time post Accumulation induction Level of hTNFα (hours) (% TCP) 4 16 24 (basal, Not detected no IPTG)

[0112] Surprisingly the dual perfect palindrome operator sequence worked when the spacing was increased. The spacing of the dual perfect palindrome can be altered, for example, to achieve effective control of other promoters.

EXAMPLE 13

[0113] A vial of CLD048 was removed from the −80° C. freezer and allowed to thaw. 10 μl of the thawed glycerol stock was inoculated into 5 ml Luria Broth (LB, 5 g/L yeast extract (Oxoid), 10 g/L tryptone (Oxoid), and 5 g/L sodium chloride) supplemented with tetracycline (10 μg/ml) and glucose (1 g/L). This was incubated at 37° C. in an orbital shaker for 16 h. 500 μl of this culture was then used to inoculate a 250 ml Erlenmeyer flask containing 50 ml of Luria Broth (composition as described above). The flask was incubated at 37° C., at 200 rpm in an orbital shaker. Growth was monitored until OD.sub.600=0.5-0.7. At this point the flask was induced with IPTG (isopropyl-β-D-1-thiogalactopyranoside) to a final concentration of 0.1 mM and the incubation continued, under the conditions described above for a further 2 h. The cells and residual cell free growth medium were then harvested. The harvested cells were further subjected to osmotic shock cell fractionation to isolate the cellular fraction containing proteins that had partitioned in the soluble E. coli periplasmic fraction. The accumulation of biologically active D1.3 Fab in the soluble periplasmic extract and residual growth medium was estimated by determining the binding of D1.3 Fab to lysozyme (antigen) in an ELISA assay by reference to a standard curve prepared with purified active D1.3 Fab. The accumulation of biologically active D1.3 Fab in the periplasm of E. coli and in the residual growth medium (due to leakage of material from the periplasm to the growth medium) is presented in Table 14. The accumulation of D1.3 Fab in the periplasm and residual growth medium was normalised as “μg active material per litre of culture per unit of biomass (OD.sub.600).

TABLE-US-00028 TABLE 14 Biologically active D1.3 Fab Fraction (μg/L culture/OD) Residual growth medium 460 Periplasm 4020 Total (residual growth 4480 medium + periplasm)

[0114] The utility of the control provided by this system to enable high level secretion of heterologous proteins particularly those requiring complex disulphide bond formation is clearly exemplified by the secretion and accumulation of high levels of biologically active D1.3 Fab in the periplasm of E. coli. Additionally, it will be evident to those skilled in the art how fed-batch fermentation (for example, as described previously in Example 11 or below in Example 14) can be used to manufacture such proteins at high yield.

EXAMPLE 14

[0115] The fermentation process described in Example 11 was repeated using CLD048. Induction was carried out by addition of IPTG to a final concentration of 0.15 mM once the biomass level in the fermentation reached OD.sub.600=ca. 50. The fed-batch phase was continued for 35-45 h post induction. The cells and residual cell free growth medium were then harvested. The harvested cells were further subjected to osmotic shock cell fractionation to isolate the cellular fraction containing proteins that had partitioned in the soluble E. coli periplasmic fraction. The accumulation of biologically active D1.3 Fab in the soluble periplasmic extract and residual growth medium was estimated by determining the binding of D1.3 Fab to lysozyme (antigen) in an ELISA assay by reference to a standard curve prepared with purified active D1.3 Fab. The accumulation of D1.3 Fab in the periplasm and residual growth medium was normalised as “mg active material per litre of culture”.

[0116] The accumulation of biologically active D1.3 Fab in the periplasm of E. coli and in the residual growth medium (due to leakage of material from the periplasm to the growth medium) is presented in Table 15.

TABLE-US-00029 TABLE 15 Biologically active D1.3 Fab Fraction (mg/L culture) Residual growth medium 525 Periplasm 57 Total (residual growth 582 medium + periplasm)

[0117] High level secretion of biologically active D1.3 Fab is demonstrated using the expression system.

EXAMPLE 15

[0118] A synthetic bispecific single chain tetravalent diabody (bsctDb) was designed, in which the variable light and variable heavy regions from D1.3 (anti-lysozyme) and A5B7 (anti-CEA (carcinoembryonic antigen)), were linked on a single polypeptide chain. The DNA sequence for this molecule is shown in FIG. 5 (SEQ ID NO 22). This was cloned as an Nde I/Not I fragment into pAVE046 which had been digested with Nde I and Not I. Recombinant plasmids were screened by restriction digest and confirmed by sequencing. The resultant plasmid was named pAVE078. pAVE078 was transformed into E. coli W3110 to make CLD073, which was purified and maintained in glycerol stocks at −80° C.

[0119] A vial of CLD0073 was removed from the −80° C. freezer and allowed to thaw. 10 μl of the thawed glycerol stock was inoculated into 5 ml Luria Broth (LB, 5 g/L yeast extract (Oxoid), 10 g/L tryptone (Oxoid), and 5 g/L sodium chloride) supplemented with tetracycline (10 μg/ml) and glucose (1 g/L). This was incubated at 37° C. in an orbital shaker for 16 h. 500 μl of this culture was then used to inoculate two 250 ml Erlenmeyer flasks containing 50 ml of Luria Broth (composition as described above). The flasks were incubated at 37° C., at 200 rpm in an orbital shaker. Growth was monitored until OD.sub.600=0.5-0.7. At this point the flasks were induced with IPTG to a final concentration of either 0.5 mM or 0.1 mM and the incubation continued, under the conditions described above for a further 20 hours. The cells and residual cell free growth medium were then harvested. The harvested cells were further subjected to osmotic shock cell fractionation to isolate the cellular fraction containing proteins that had partitioned in the soluble E. coli periplasmic fraction. The expression, secretion, folding and accumulation of biologically active D1.3-A5B7 bsctDb in the periplasmic extract and residual growth medium was estimated by determining the inhibition of binding of an anti-CEA monoclonal antibody to CEA (antigen) in a competitive ELISA assay and by the binding of an anti-lysozyme Fab antibody fragment to lysozyme (antigen) in a competitive ELISA assay.

[0120] The data obtained indicated that the majority of D1.3-A5B7 bsctDb partitioned in the residual growth medium (leakage from the periplasm) at the end of the induction. This data (binding of bsctDb in competitive ELISA) is shown in Table 16. The data obtained demonstrates that the residual growth medium sample from the culture induced with 0.5 mM IPTG completely inhibits the binding of both the anti-CEA and anti-lysozyme antibodies in the competition ELISA assays. The residual growth medium sample from the culture induced with 0.1 mM IPTG shows a reduced level of inhibition indicating a lower accumulation level of biologically active D1.3-A5B7 bsctDb in this sample.

TABLE-US-00030 TABLE 16 % Inhibition in % Inhibition in CEA Competition D1.3 Competition Sample ELISA ELISA Control None None (No D1.3-A5B7 bsctDb) Supernatant from culture 100 100 induced with 0.5 mM IPTG Supernatant from culture Partial Partial induced with 0.1 mM IPTG

[0121] Using the new expression system it is possible to produce complex multi-chain heterologous proteins which have been difficult to produce using E. coli. This has been exemplified by demonstrating that bispecific single chain tetravalent diabodies in a biologically active form can be produced in E. coli using the new expression system. This further exemplifies the utility of the expression system.

EXAMPLE 16

[0122] The glutathione-S-transferase-3C proteinase fusion (GST-3C) gene was cloned as an Nde I/Xho I fragment into pAVE011 digested with Nde I and Xho I. The sequence of the insert is shown in FIG. 6 (SEQ ID NO 23). Recombinant plasmids were screened by restriction digest and confirmed by sequencing. The resultant plasmid was named pAVE052. pAVE052 was transformed into E. coli BL21 to make CLD054, which was purified and maintained in glycerol stocks at −80° C.

[0123] The human Interferon α2 (IFNα2) gene was cloned as an Nde I/Xho I fragment into pAVE011 digested with Nde I and Xho I. The DNA sequence of the insert is shown in FIG. 7 (SEQ ID NO 24). Recombinant plasmids were screened by restriction digest and confirmed by sequencing. The resultant plasmid was named pAVE058. pAVE058 was transformed into E. coli W3110 to make CLD059, which was purified and maintained in glycerol stocks at −80° C.

[0124] The human erythropoietin (EPO) gene, which had been codon optimised for expression in E coli, was cloned as an Nde I/Xho I fragment into pAVE011 digested with Nde I and Xho I. The DNA sequence of the insert is shown in FIG. 8 (SEQ ID NO 25). Recombinant plasmids were screened by restriction digest and confirmed by sequencing. The resultant plasmid was named pAVE061. pAVE061 was transformed into E. coli W3110 to make CLD060, which was purified and maintained in glycerol stocks at −80° C.

[0125] Fed-batch fermentations using CLD054, CLD059 and CLD060 were carried out using the media and process conditions described in Example 11. Fermentations were maintained at 30° C. or 37° C. as described in Table 19. Fermentations were performed in batch mode until depletion of the carbon source (i.e. glycerol). Fed-batch fermentation was initiated at this point by the addition of a feed containing glycerol (714 g/L) and magnesium sulphate (30 g/L). Induction was carried out by addition of IPTG once the biomass level in the fermentation reached OD.sub.600=50-60. The IPTG concentrations used are described in Table 17. The fed-batch phase was continued for 12-15 h post induction. Samples were taken throughout the fermentations to determine biomass level (OD.sub.600) and protein product ((GST-3C, IFNα2 and EPO) titre (g/L), using Colloidal Blue stained SDS-PAGE gels of whole cell lysates of the sampled bacteria).

TABLE-US-00031 TABLE 17 Protein and Induction Prod- Expression Ferm IPTG uct E. coli Vector Temp Conc Titre Strain Host Description ° C. (mM) OD600 (g/L) CLD054 BL21 GST-3C 37 0.50 100 8 T7A3:DPPS91 CLD059 W3110 IFNα2 37 0.10 120 9 T7A3:DPPS91 37 0.25 150 14 37 0.50 160 14 CLD060 W3110 EPO 37 0.10 100 >13 T7A3:DPPS91 30 0.50 90 >13

[0126] The data presented in Table 17 further demonstrate the utility of the systems for the manufacture of a wide range of heterologous proteins. High product titres are achieved using a simple generic fermentation process coupled with manipulation of only the concentration of IPTG used for induction. This is particularly beneficial to reduce the process development timelines for therapeutically useful heterologous proteins.

EXAMPLE 17

[0127] The L-2-haloalkanoate dehalogenase (hadL) gene from Pseudomonas putida was cloned using Nde I and Spe I sites that had been engineered using PCR. The gene sequence is shown in FIG. 9 (SEQ ID NO 26). Plasmid pAVE011 was digested with Nde I and Spe I and the band was gel extracted. The hadL gene was digested with Nde I and Spe I and the hadL gene was gel extracted and ligated to pAVE011 to produce pAVE075. The Pseudomonas savastanoi origin of replication was copied using the PCR from Plasmid pCN60 (ATCC 77101; Nieto C, et al. (1990) Gene 87: 145-149).

[0128] The primers used were:

TABLE-US-00032 F37A: Sequence: (SEQ ID NO 27) 5′ AGATCTACGCTTATGGGTGCCTTTCC, and B29a: Sequence: (SEQ ID NO 28) 5′ AGATCTAATACGCAAACCGCCTCTCC.

[0129] The PCR product was cloned initially into TOPO TA pCR2.1 (Invitrogen) and then into pAVE075 by Bgl II digestion. The resultant plasmid, pAVE086 was transformed into Pseudomonas putida NCIMB 12018, via electroporation to make CLD075, which was purified and maintained in glycerol stocks at −80° C. A vial of CLD075 was removed from a −80° C. freezer and allowed to thaw. 10 μl of the thawed glycerol stock was inoculated into 5 ml Luria Broth (LB, 5 g/L yeast extract (Oxoid), 10 g/L tryptone (Oxoid), and 5 g/L sodium chloride) supplemented with tetracycline (10 μg/ml). This was incubated at 30° C. in an orbital shaker for 16 h. 500 μl of this culture was then used to separately inoculate two 250 ml Erlenmeyer flasks containing 50 ml of Luria Broth (composition as described above). The flasks were incubated at 30° C., at 200 rpm in an orbital shaker. Growth was monitored until OD.sub.600=0.5-0.7. At this point one flask was induced with IPTG to a final concentration 0.5 mM whilst the second flask was left un-induced to monitor basal expression. The incubation was continued, under the conditions described above, during which samples were taken for measurement of growth and accumulation of HadL protein within the bacterial cells. The accumulation level of HadL was determined using densitometry scanning of Colloidal Blue stained SDS-PAGE gels of whole cell lysates of the sampled bacteria.

[0130] The expression and accumulation of HadL protein is presented in FIG. 10. The data indicate that the T7A3:DPPS91 expression system functioned in another prokaryotic host system. Surprisingly, the expression system performed with the same efficiency in Pseudomonas putida as that observed when using E. coli as the host system. Basal expression was not detected even following 23 h incubation in the absence of inducer. High level protein expression and accumulation was achieved in Pseudomonas putida following induction using IPTG.

EXAMPLE 18

[0131] Fed-batch fermentation using Pseudomonas putida CLD075 was carried out using the generic E. coli media and process conditions described in Example 11. Fermentations were maintained at 30° C. and pH 7.0 (controlled with 25% ammonium hydroxide and 10% phosphoric acid). Fermentations were performed in batch mode until depletion of the carbon source (i.e. glycerol). Fed-batch fermentation was initiated at this point by the addition of a feed containing glycerol (714 g/L) and magnesium sulphate (30 g/L). Induction was carried out by addition of 1 mM IPTG (final concentration) once the biomass level in the fermentation reached OD.sub.600=50. The fed-batch phase was continued for 12-15 h post induction. Samples were taken throughout the fermentation to determine biomass level (OD.sub.600) and HadL protein accumulation ((% TCP) Colloidal Blue stained SDS-PAGE gels of whole cell lysates of the sampled bacteria). The growth of CLD075 and expression/accumulation of HadL protein following induction are presented in FIG. 11.

[0132] High levels of protein expression and accumulation (>40% TCP) were achieved using the expression system in Pseudomonas putida even by just using a generic growth medium designed for use with E. coli.

EXAMPLE 19

[0133] A synthetic Gal repressor gene (E. coli) was cloned into vector pZen042 (as described in EP 0 502 637) as a PstI fragment into the PstI site. Clones were identified with the Gal repressor gene in both clockwise and anticlockwise orientations. A clone with anticlockwise orientation was selected to generate pAVE071.

[0134] Construction of the Gal promoter and operator sequences was initiated in plasmid pZT7#2.0, prepared as described in U.S. Pat. No. 6,537,779. pZT7#2.0 has a pAT153 vector backbone, cer stability sequence, tet A/R, a single native lac operator sequence upstream of the gene of interest and an upstream T4 transcription terminator. The native Gal operator sequence was modified to produce a perfect palindromic operator sequence. This was cloned into the plasmid described above using synthetic linkers by means of EcoRI and XbaI restriction enzyme sites. The linker GalB was prepared by annealing the oligonucleotides GalB1 and GalB2:

TABLE-US-00033 GalB1 (SEQ ID NO 29) 5′AATTCATACCATAAGCCTAATTCTACGAATTATCAGAGTTCTGGTTAC CGGTGTAAGCGCTTACACTGT GalB2 (SEQ ID NO 30) 5′CTAGACAGTGTAAGCGCTTACACCGGTAACCAGAACTCTGATAATTCG TAGAATTAGGCTTATGGTATG

[0135] The linker was then ligated to plasmid pZT7#2.0 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an EcoR I/Xba I fragment. Initial screening of transformants was by restriction digestion using AgeI. The sequence was confirmed by sequencing. The hTNFα gene was cloned into this plasmid as a NdeI/XhoI fragment.

[0136] The hTNFα gene and partial Gal perfect palindromic operator sequence were cloned by digesting with XmaI and MscI and ligating into pAVE071 digested with XmnI and XmaI. Clones were screened for the presence of the hTNFα gene by restriction digestion.

[0137] Upstream perfect palindromic Gal operator and Gal promotor were each cloned into this plasmid using synthetic linkers by means of StuI and EcoRI sites. Linker GalA was prepared by annealing the oligonucleotides GalA1 and GalA2:

TABLE-US-00034 GalA1 (SEQ ID NO 31): 5′CAATTGTGTAAGCGCTTACACAACTTTATTCCATGTCACACTTTTCGC ATCTTTGTTATGCTATGGTG Ga1A2 (SEQ ID NO 32) 5′AATTCACCATCGCATAACAAGGATGCGAAAAGTGTGACATGGAATAAA GTTGTGTAAGCGCTTACACAATTG

[0138] The presence of the linker was detected with digestion with MfeI and confirmed by sequencing. This plasmid was transformed into E. coli strain W3110 to generate CLD085, which was purified and maintained in glycerol stocks at −80° C.

[0139] A vial of CLD085 was removed from the −80° C. freezer and allowed to thaw. 10 μl of the thawed glycerol stock was inoculated into 5 ml Luria Broth (LB, 5 g/L yeast extract (Oxoid), 10 g/L tryptone (Oxoid), and 5 g/L sodium chloride) supplemented with tetracycline (10 μg/ml). This was incubated at 37° C. in an orbital shaker for 16 h. 500 μl of this culture was then used to inoculate a 250 ml Erlenmeyer flask containing 50 ml of Luria Broth (composition as described above). The flask was incubated at 37° C., at 200 rpm in an orbital shaker. Growth was monitored until OD.sub.600=0.5-0.7. At this point the flask was induced with galactose to a final concentration 10.0 mM. The incubation was continued, under the conditions described above, during which samples were taken for measurement of growth, accumulation of hTNFα within the bacterial cells. The accumulation level of hTNFα was determined using Western blot analysis (using anti-hTNFα antibody) following SDS-PAGE of the sampled bacteria. The data are presented in FIG. 17. This demonstrates that using perfectly palindromic gal operator sequences in combination with a gal repressor gene leads to very tight repression of the gal promoter in the absence of inducer whilst surprisingly still maintaining the capacity for induction when the inducer galactose is added.

EXAMPLE 20

[0140] A non-integrating yeast vector was constructed as follows:

[0141] 1) Clone Sequence 1 (E. coli Lac I downstream of a Saccharomyces cerevisiae CYC1 promoter) as a Xho I fragment into Xho I digested pCR2.1 (Invitrogen). Clone Sequence 1 is shown in FIG. 15 (SEQ ID NO 35).

[0142] 2) Clone Sequence 2 (which consists of the Saccharomyces cerevisiae MF-α1 gene promoter with perfect palindromic lac operator sequences either side of the MF-α1 promoter region, with the gene sequence for the protein elafin with a C-terminal c-myc tag (elafin-cmyc) positioned downstream) as a Hind III fragment (made by PCR) into Hind III digested plasmid constructed in Step 1 to produce plasmid 2. Clone Sequence 2 is shown in FIG. 16 (SEQ ID NO 36).

[0143] 3) Clone the Spe I fragment from YEp13 (ATCC37115), containing the LEU2 (selection marker gene) and the yeast 2μ origin of replication, into SpeI digested plasmid 2 to generate pAVE091.

[0144] pAVE091 plasmid DNA was transformed into Saccharomyces cerevisiae XS95-6C (ATCC 204688) by electroporation and positive colonies selected on yeast drop-out medium without leucine (Kaiser C, Michaelis S and Mitchel A (Methods in Yeast Genetics, Cold Spring Harbor Laboratory Manual, 1994)). Shake flask growth studies to determine elafin-cmyc protein expression were carried out using the same medium. The flasks were incubated at 30° C., at 200 rpm in an orbital shaker. The clones were grown to an OD of ˜3 and induced with 0.5 mM IPTG (final concentration). The incubation was continued for a further 16 h, under the conditions described above, during which samples were taken for measurement of growth and secretion of elafin-cmyc protein into the growth medium. The secretion of elafin-cmyc into the residual growth medium was determined using an elastase inhibition enzyme assay, as described in Wiedow O, et al, J Biol Chem. (1990) 265(25):14791-5. After 4 hours of IPTG induction there was 30 mg/L of active elafin protein in the growth medium. This demonstrates that the expression systems of the present invention are effective in yeasts.

EXAMPLE 21

[0145] A DNA fragment was synthesised which contained the constitutive human Cytomegalovirus (hCMV) promoter flanked by dual perfect palindromic lac operator sequences. This was cloned into an expression vector, which expressed IgG Fc protein. The resulting plasmid was named pAVE081, and is derived from pCMV-Script (Stratagene) and contains the hCMV promoter flanked by dual perfect palindromic lac operator sequences on a Nde I/Nhe I fragment, with the IgG Fc DNA sequence in the multiple cloning site of the vector. The DNA sequence of the hCMV promoter and dual perfect palindromic lac operators is shown in FIG. 12 (SEQ ID NO 33). The DNA sequence of the IgG Fc protein is shown in FIG. 13 (SEQ ID NO 34). Transient co-transfections of pAVE081 expressing IgG Fc protein and pCMVlacI (Stratagene) which expresses lac repressor were carried out, as is well described in the art, to determine whether IgG Fc protein could be expressed under the control an IPTG inducible hCMV promoter-dual perfect palindromic lac operator expression system.

[0146] 2 ml of Chinese Hamster Ovary (CHO cell line ECACC 85050302 adapted to suspension growth in serum free medium) suspension culture at 1.5×10.sup.5 viable cells per ml was added to each well of 6-well tissue culture plates. The 6-well tissue culture plates were then incubated overnight (16 h) in a humidified 37° C. incubator with 5% CO.sub.2 before transfection mixes were prepared containing 2 μg of pAVE081 DNA with an equal quantity of pCMVlacI (Stratagene) DNA, 6 μl of transfection reagent and 94 μl of growth medium per well. 100 μl of transfection mix was added to each well containing the CHO cells. The 6-well tissue culture plates were then incubated in humidified 37° C. incubator with 5% CO.sub.2. To determine the level of expression/secretion of IgG Fc protein into the growth medium a set of wells (day 2) were induced with 5 mM IPTG (final concentration) and set of wells left un-induced. On day three the set of wells induced with IPTG and those left un-induced were sampled (post IPTG induction and un-induced). The expression and secretion into the growth medium by the CHO cells of IgG Fc protein was determined by ELISA as is well established in the art. The data obtained are shown in FIG. 14.

[0147] The data clearly demonstrates the broad utility of the expression system. The expression system can be used to control powerful constitutive promoters typically used with mammalian cell systems, such as the hCMV promoter, to express proteins in mammalian cells in a controllable, inducible manner.