Real-time fluorescence quantitative PCR detection method and kit based on metal ruthenium complex

20210348223 · 2021-11-11

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure discloses a real-time fluorescence quantitative polymerase chain reaction (PCR) detection method and kit based on a metal ruthenium complex. The present disclosure is capable of establishing the detection method for performing a real-time fluorescence quantitative PCR by using the metal ruthenium complex as fluorescence dye.

    Claims

    1. A real-time fluorescence quantitative PCR detection method based on a metal ruthenium complex, wherein the real-time fluorescence quantitative PCR detection method comprises the following steps: using a metal ruthenium complex as a dye component in a real-time fluorescence quantitative PCR reaction system; using multiple nucleic acid samples with different copy numbers as standard substances, using the each standard substance as an amplification template component in the real-time fluorescence quantitative PCR reaction system respectively, and performing a real-time fluorescence quantitative PCR according to a preset reaction program, after reaction is finished respectively, drawing a standard curve according to a cycle threshold of the each standard substance; using a nucleic acid sample with an unknown copy number as an amplification template component in the real-time fluorescence quantitative PCR reaction system, performing the real-time fluorescence quantitative PCR according to the reaction program, and calculating a DNA copy number of the sample according to the standard curve and a cycle threshold of the nucleic acid sample with the unknown copy number.

    2. The real-time fluorescence quantitative PCR detection method based on the metal ruthenium complex according to claim 1, wherein the metal ruthenium complex is selected from one of ruthenium polypyridine complexes or the metal ruthenium complexes which perform structure modification on ligands, and have nucleic acid molecule light switch behavior.

    3. The real-time fluorescence quantitative PCR detection method based on the metal ruthenium complex according to claim 1, wherein an extending phase of the real-time fluorescence quantitative PCR collects a fluorescence signal by using a certain channel, ranges of excitation wavelength and emission wavelength of the channel are 400-500 nm and 550-750 nm respectively, a cycle threshold of the standard substance or the nucleic acid sample with the unknown copy number is obtained according to the signal.

    4. The real-time fluorescence quantitative PCR detection method based on the metal ruthenium complex according to claim 1, wherein the nucleic acid sample is a DNA or a reverse-transcribed DNA by an extracted RNA.

    5. The real-time fluorescence quantitative PCR detection method based on the metal ruthenium complex according to claim 1, wherein the real-time fluorescence quantitative PCR detection method specifically comprises following steps: 1) designing a primer according to different detection purposes and samples, selecting a target sequence and designing the primer; 2) preparing a reaction system, wherein the reaction system comprises a thermostable DNA polymerase, the primer, dNTP, a template DNA and the metal ruthenium complex; 3) real-time fluorescence quantitative PCR according to the different target sequences and primers, setting a amplification program; using a DNA sample with a known initial concentration as a template, after performing initial denaturation on the template, circularly reacting according to the amplification program and performing fluorescence signal collection in an extending step of a circular reaction, wherein a collection channel of the fluorescence signal is: 400-500 nm of an excitation wavelength, and 550-750 nm of an emission wavelength; after the circular reaction is over, performing the extending again; and then according to the collected signal, establishing an amplification curve, and determining a cycle threshold of the DNA sample by the amplification curve; 4) repeating the step 3), to obtain the cycle threshold of each DNA sample with the different initial concentrations, and establishing a standard curve in combination with the concentration of the corresponding DNA sample; and 5) according to the step 3), amplifying a DNA sample with an unknown initial concentration, to obtain a corresponding cycle threshold and substituted into the standard curve obtained in the step 4), thereby acquiring an initial concentration of the DNA sample by calculating.

    6. The real-time fluorescence quantitative PCR detection method based on the metal ruthenium complex according to claim 5, wherein the amplification program is: performing heat-denaturation on the template after the initial denaturation, and renaturing a primer with a single-strand template obtained by thermal denaturation, then extending under the effect of a DNA polymerase.

    7. The real-time fluorescence quantitative PCR detection method based on the metal ruthenium complex according to claim 5, wherein the DNA sample with the unknown initial concentration is obtained by extraction and purification through a kit.

    8. The real-time fluorescence quantitative PCR detection method based on the metal ruthenium complex according to claim 1, wherein a final volume of the reaction system is 10-20 μL, and a final concentration of the metal ruthenium complex in the reaction system is 0.5-10 μM.

    9. A real-time fluorescence quantitative PCR detection kit based on a metal ruthenium complex, wherein the kit comprises a metal ruthenium complex served as nucleic acid dye.

    10. A real-time fluorescence quantitative PCR detection system based on a metal ruthenium complex, wherein comprising a kit and a qPCR meter for preparing a real-time fluorescence quantitative PCR reaction system, the kit comprises a metal ruthenium complex served as nucleic acid dye, while the qPCR machine meter performs fluorescence signal collection in an extending step of a circular reaction, a used collection channel of a fluorescence signal is as follows: an excitation wavelength is 400-500 nm, and an emission wavelength is 550-750 nm.

    11. The real-time fluorescence quantitative PCR detection method based on the metal ruthenium complex according to claim 5, wherein a final volume of the reaction system is 10-20 μL, and a final concentration of the metal ruthenium complex in the reaction system is 0.5-10 μM.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0028] FIG. 1A is the stability of a fluorescence signal while a metal ruthenium complex is incubated in 95° C., herein Ru-bpy represents [Ru(bpy).sub.2(dppz)].sup.2+ and Ru-phen represents [Ru(phen).sub.2(dppz)].sup.2+.

    [0029] FIG. 1B is an inhibitory electrophoresis diagram of a PCR amplification reaction while the [Ru(bpy).sub.2(dppz)].sup.2+ is served as fluorescence dye, herein + represents an experiment group, and—resents a blank group.

    [0030] FIG. 1C is an amplification curve diagram while the [Ru(bpy).sub.2(dppz)].sup.2+ is served as the dye.

    [0031] FIG. 1D is a melting curve diagram while the [Ru(bpy).sub.2(dppz)].sup.2+ is served as the dye.

    [0032] FIG. 1E is an amplification curve diagram while the [Ru(phen).sub.2(dppz)].sup.2+ is served as the dye.

    [0033] FIG. 1F is a melting curve diagram while the [Ru(phen).sub.2(dppz)].sup.2+ is served as the dye.

    [0034] FIG. 2A is a template concentration gradient amplification curve diagram while the [Ru(bpy).sub.2(dppz)].sup.2+ is served as the dye.

    [0035] FIG. 2B is a template concentration gradient melting curve diagram while the [Ru(bpy).sub.2(dppz)].sup.2+ is served as the dye.

    [0036] FIG. 2C is a linear fitting schematic diagram of an amount of a Staphylococcus aureus template and a Ct value while the [Ru(bpy).sub.2(dppz)].sup.2+ is served as the dye.

    [0037] FIG. 3A is a template concentration gradient amplification curve diagram while the [Ru(phen).sub.2(dppz)].sup.2+ is served as the dye.

    [0038] FIG. 3B is a template concentration gradient melting curve diagram while the [Ru(phen).sub.2(dppz)].sup.2+ is served a s the dye.

    [0039] FIG. 3C is a linear fitting schematic diagram of the amount of the Staphylococcus aureus template and the Ct value while the [Ru(phen).sub.2(dppz)].sup.2+ is served as the dye.

    [0040] FIG. 4A is a Staphylococcus aureus and Enterobacter sakazakii real-time fluorescence double PCR detection amplification curve diagram while the [Ru(bpy).sub.2(dppz)].sup.2+ is served as the dye.

    [0041] FIG. 4B is a Staphylococcus aureus and Enterobacter sakazakii real-time fluorescence double PCR detection melting curve diagram while the [Ru(phen).sub.2(dppz)].sup.2+ is served as the dye.

    DETAILED DESCRIPTION OF THE EMBODIMENTS

    [0042] The present disclosure is further described in detail below in combination with the drawings and embodiments, the embodiments are only used to explain the present disclosure, rather than to limit the present disclosure.

    [0043] (I) Feasibility of Metal Ruthenium Complex Served as Fluorescence Dye in Real-Time Fluorescence Quantitative PCR

    [0044] A conserved sequence of a Staphylococcus aureus fem gene was used as an amplified target sequence, a design of an amplification primer was completed in August 2017, and the amplification primer was synthesized and purified by Sangon Biotech (Shanghai) Co., Ltd A specific sequence is as follows:

    TABLE-US-00001 pre-primer (5′-3′): TTTAACAGCTAAAGAGTTTGGT; and post-primer (5′-3′): TTTTCATAATCRATCACTGGAC.

    [0045] 1. Fluorescence Signal Stability of Metal Ruthenium Complex Incubated in High Temperature

    [0046] Metal ruthenium complexes [Ru(bpy).sub.2(dppz)].sup.2+ and [Ru(phen).sub.2(dppz)].sup.2+ were respectively incubated in a high temperature of 95° C. in Tirs buffer solution with pH 8.0, fluorescence intensity signal detection was performed every a certain time (for example, 0.5 h), a result was as shown in FIG. 1A, a fluorescence signal was only fluctuated within a small range during 3 hours, and there was no apparent drop, it was indicated that the metal ruthenium complex might keep the fluorescence intensity stable in a PCR alkaline amplification condition and a high temperature denaturation step.

    [0047] 2. Real-Time Fluorescence Quantitative PCR Amplification

    [0048] 1) Bacteria culture amplification and DNA extraction: after an LB culture medium was used to perform bacteria enrichment treatment, a kit is used to extract a genomic DNA.

    [0049] 2) Establishment of qPCR reaction system: a reaction system is 10 μL, herein a DNA template extracted in the previous step was 1.0 μL (200 ng/μL), 2×Taq PCR Mastermix was 5.0 μL, each of the forward primer and reverse primer was 1.0 μL (4 μM), 20 μM of the metal ruthenium complex [Ru(bpy).sub.2(dppz)].sup.2+ was 1.5 μL, water has been used to make up the final volume of the sample, and NTC (no template control) was performed.

    [0050] 3) Three-step PCR reaction program used by qPCR: 95° C. of initial denaturation was performed for 5 min; 95° C. of denaturation was performed for 15 s, 57° C. of annealing was performed for 15 s, 68° C. of extending was performed for 30 s and a fluorescence signal was collected, ranges of excitation and emission wavelengths of a signal channel are 400-500 nm and 550-750 nm respectively, it was 30 cycles in total; and 68° C. of the extending was performed again for 5 min. A melting curve was in 60-95° C., and the signal was measured once every 0.5° C., a initial temperature increasing rate was 5° C. Is.

    [0051] 4) Experiment Result:

    [0052] The extracted DNA was used as a template, a specific primer was added, and a real-time fluorescence quantitative PCR amplification experiment was performed, to obtain the amplification curve as shown in FIG. 1C and a characteristic melting peak of the amplification sequence as shown in FIG. 1D, and the length of product was verified by agarose gel electrophoresis so the feasibility of the metal ruthenium complex served as the fluorescence dye in the real-time fluorescence quantitative PCR was proved.

    [0053] The real-time fluorescence quantitative PCR amplification was performed on another metal ruthenium complex [Ru(phen).sub.2(dppz)].sup.2+ by using the same method, to obtain the amplification curve and the melting curve as shown in FIG. 1E and FIG. 1F, it had the same performance as using the [Ru(bpy).sub.2(dppz)].sup.2+.

    [0054] 3. Inhibitory Effect of Dye Concentration on PCR Reaction

    [0055] the metal ruthenium complex [Ru(bpy).sub.2(dppz)].sup.2+ with different final concentrations (2, 3, 4, 5, and 6 μM) was added to the PCR reaction system for the amplification, 2% agarose-gel electrophoresis detection was performed, and the NTC was performed, a result was as shown in FIG. 1B, an experiment group (+, amplification target sequence) had bands of amplification products at all concentrations, it was indicated that the metal ruthenium complex had almost no inhibitory effect on the PCR amplification within a certain concentration range (1-10 μM), and could be suitable for the real-time fluorescence quantitative PCR, but the apparent inhibition would occur if it exceeded this range. It could be observed from a blank group (−, no template control) that targeted amplification fragments were not found, so it is indicated that cross-contamination did not occur. A volume of the typical reaction system was 10-20 μL.

    [0056] (II) Linear Range and Sensitivity Analysis of Real-Time Fluorescence Quantitative PCR by Using Metal Ruthenium Complex [Ru(Bpy).sub.2(Dppz)].sup.2+

    [0057] 1) Bacteria culture and template DNA extraction were the same as (I).

    [0058] 2) Primer synthesis was the same as (I).

    [0059] 3) Template DNA stock solution (1×10.sup.7 copies/μL) was diluted into 1×10.sup.6 copies/μL, 1×10.sup.5 copies/μL, 1×10.sup.4 copies/μL, 1×10.sup.3 copies/μL, 1×10.sup.2 copies/μL and 1×10.sup.1 copies/μL in 10 times of a gradient.

    [0060] 4) A qPCR reaction system was the same as (I).

    [0061] 5) A qPCR reaction program was the same as (I).

    [0062] 6) Experiment result:

    [0063] A result is as shown in FIG. 2A, FIG. 2B and FIG. 2C, the DNA with different dilutions was used as a template, and 1×10.sup.2 copies/μL of the template concentration could be detected while a real-time fluorescence quantitative PCR amplification experiment is performed, it was indicated that the detection system has higher detection sensitivity and wider dynamic range. In addition, a linearly correlation coefficient R.sup.2 was greater than 0.99, it was indicated that the linearity of the real-time fluorescence quantitative PCR was better within this concentration range, a target gene could be accurately quantified. Therefore, the [Ru(bpy).sub.2(dppz)].sup.2+ had the better applicability while applied to the amplification experiment of the real-time fluorescence quantitative PCR.

    [0064] (III) Linear Range and Sensitivity Analysis of Real-Time Fluorescence Quantitative PCR by Using Metal Ruthenium Complex [Ru(Phen).sub.2(Dppz)].sup.2+

    [0065] 1) Bacteria culture and template DNA extraction were the same as (I).

    [0066] 2) Primer synthesis was the same as (I).

    [0067] 3) Template DNA stock solution (1×10.sup.7 copies/μL) was diluted into 1×10.sup.6 copies/μL, 1×10.sup.5 copies/μL, 1×10.sup.4 copies/μL, 1×10.sup.3 copies/μL, 1×102 copies/μL and 1×101 copies/μL in 10 times of a gradient.

    [0068] 4) A qPCR reaction system was the same as (I).

    [0069] 5) A qPCR reaction program was the same as (I).

    [0070] 6) Experiment result:

    [0071] A result was as shown in FIG. 3A, FIG. 3B and FIG. 3C, the DNA with different dilutions was used as a template, and 1×10.sup.2 copies/μL of the template concentration could be detected while a real-time fluorescence quantitative PCR amplification experiment was performed, it was indicated that the detection system had higher detection sensitivity and wider dynamic range. In addition, a linearly correlation coefficient R.sup.2 was greater than 0.98, it was indicated that the linearity of the real-time fluorescence quantitative PCR was better within this concentration range, a target gene could be accurately quantified. Therefore, the [Ru(phen).sub.2(dppz)].sup.2+ had the better applicability while applied to the amplification experiment of the real-time fluorescence quantitative PCR.

    [0072] (IV) Multiple Real-Time Fluorescence PCR Detection Based on Metal Ruthenium Complex [Ru(Bpy).sub.2(Dppz)].sup.2+

    [0073] A primer used for Staphylococcus aureus was the same as (I);

    [0074] A conserved sequence of an Enterobacter sakazakii Esa16S gene was used as an amplified target sequence, a design of an amplification primer was completed in November 2017, and the amplification primer was synthesized and purified by Sangon Biotech (Shanghai) Co., LtdA specific sequence is as follows:

    TABLE-US-00002 pre-primer (5′-3′)-2: TCCGCAGGAGTTGAAGAGG; and post-primer (5′-3′)-2: CAGCAGCGTGTCTGTTTCA.

    [0075] 1) Bacteria culture and template DNA extraction were the same as (I).

    [0076] 2) qPCR reaction system:

    [0077] It was operated in a sterile environment, two groups of the pre-primer and the post-primer of Staphylococcus aureus and Enterobacter sakazakii were added at the same time, the final concentration of each primer in the reaction system was 0.2 μM, 2×Taq PCR Mastermix was 5.0 μL, 20 μM of the metal ruthenium complex [Ru(bpy).sub.2(dppz)].sup.2+ or [Ru(phen).sub.2(dppz)].sup.2+ was 1.5 μL and served as the fluorescence dye, and four groups of samples of a Staphylococcus aureus template (Staphylococcus aureus group), an Enterobacter sakazakii template (Enterobacter sakazakii group), a Staphylococcus aureus and Enterobacter sakazakii template (Staphylococcus aureus+Enterobacter sakazakii group) and NTC (blank group) were respectively set.

    [0078] 3) qPCR reaction program: 95° C. of initial denaturation was performed for 5 min; 95° C. of denaturation was performed for 15 s, 55° C. of annealing was performed for 15 s, 68° C. of extending was performed for 30 s and a fluorescence signal was collected, ranges of excitation and emission wavelengths of a signal channel were 400-500 nm and 550-750 nm respectively, it was 30 cycles in total; and 68° C. of the extending was performed again for 5 min. A melting curve was in 60-95° C., and the signal was measured once every 0.1° C., a temperature increasing rate was 5° C. Is.

    [0079] 4) Experiment result:

    [0080] As shown in FIG. 4A and FIG. 4B, after the amplification, the melting curve was analyzed, and it was discovered that: a melting curve peak of the single Staphylococcus aureus DNA appeared in about 86° C.; a melting curve peak of the amplification product of the single Enterobacter sakazakii DNA appeared in about 91° C., while the template DNAs of two types of the bacteria were added to be amplified at the same time, the amplification products thereof respectively generated one melting curve peak in 84° C. and 90° C. It was indicated from the above result that the fluorescence dye, namely the metal ruthenium complex, used in the present disclosure and the duplex real-time fluorescence PCR detection method established on the basis of this dye could accurately analyze the different DNA sequences in the system. The metal ruthenium complex could be acted as the fluorescence dye for the multiple PCR detection.

    [0081] (V) Preparation of Real-Time Fluorescence Quantitative PCR Detection Kit

    [0082] 1.0 μL of 10×PCR buffer solution, 0.125 μL of Taq Polymerase (5U/μL), 2.0 μL of dNTP (2.5 mM), 0.375 μL of MgCl.sub.2 (100 mM), 1.25 μL of KCl (1M), 0.254 of Tris-HCl (1M pH8.3) and 0.75 μL of the metal ruthenium complex dye (100 μM) were packaged together, to obtain a real-time fluorescence quantitative PCR detection kit. In use, the primers and the templates and ddH.sub.2O were added to replenish until 25 μL according to the needs of the experiment samples.

    [0083] It is indicated from the above embodiment that: the metal ruthenium complex fluorescence dye used in the present disclosure is high in sensitivity, and excellent in stability, and can be applied in a real-time fluorescence quantitative PCR technology as a type of nucleic acid dye.

    [0084] In conclusion, the metal ruthenium complex with the unique nucleic acid molecule “light switch” property can satisfy the requirements of the real-time PCR amplification detection, through the research on the properties thereof and the application in the real-time fluorescence quantitative PCR, it is discovered that it has the following advantages:

    [0085] 1) The metal ruthenium complex can maintain the stable properties under PCR high temperature and acid-base environments; (2) after the metal ruthenium complex is combined with a DNA double-strand of the qPCR amplification product, the fluorescence signal is remarkably enhanced, and in the excitation and emission wavelengths of the signal channel selected by the present disclosure, through monitoring a change of the fluorescence signal of the ruthenium complex dye in real time, a qPCR amplification curve is obtained; (3) within the wider concentration range, there is no inhibitory effect on the qPCR amplification reaction, and the high concentration of the ruthenium complex can be used, to make fluorescence reach the higher signal intensity; (4) after the qPCR amplification is completed, the melting curve can be obtained by using a real-time qPCR machine and used for distinguishing specific and non-specificamplification products; (5) under optimized experiment conditions, the detection sensitivity is comparable to the commercial dye SYBR Green I and EvaGreen; and (6) through designing an optimized primer sequence, PCR products with apparently different Tm values are generated, and the melting curve analysis can be used to achieve multiple real-time qPCR analysis, so as to achieve purposes of saving reagents and samples and improving sample throughput.

    [0086] Although there is much fluorescence DNA-binding dye, not all of the fluorescence dye is suitable for the real-time qPCR, such as EB (ethidium bromide). The DNA fluorescence dye suitable for the real-time qPCR needs to meet the following conditions: (1) it is compatible with PCR amplification conditions (such as high temperature resistance and pH resistance); (2) it does not inhibit the PCR amplification reaction; and (3) it has enough high detection sensitivity, and the real-time amplification curve for quantification can be obtained. It can only be determined by experiments whether these conditions are satisfied, and cannot be speculated by theories. However, it is discovered through the experiments by the present disclosure that, the metal ruthenium complex nucleic acid molecule “light switch” is compatible with the PCR amplification experiment conditions; in addition, the amplification reaction of the PCR is not inhibited while the metal ruthenium complex is added to PCR reaction solution; and it has enough high detection sensitivity, and the conditions, such as the real-time amplification curve for the quantification, can be obtained. Therefore, the inorganic ruthenium metal complex can be served as a type of novel real-time qPCR binding dye, have the excellent properties which are not processed by the organic molecule DNA-binding dye such as SYBRGreen I and Eva Green, and have the wide application potential.