PLASMID CONTAINING A SEQUENCE ENCODING AN MRNA WITH A SEGMENTED POLY(A) TAIL
20210348172 · 2021-11-11
Inventors
- Zeljka TREPOTEC (München, DE)
- Manish Kumar ANEJA (München, DE)
- Carsten Rudolph (Krailling, DE)
- Christian Plank (Wessling, DE)
- Ludwig Weiss (Kissing, DE)
Cpc classification
C12N2830/50
CHEMISTRY; METALLURGY
A61K48/0066
HUMAN NECESSITIES
International classification
Abstract
The present disclosure provides a DNA plasmid comprising a sequence which encodes an mRNA molecule and a modified poly(A) tail, wherein the part of the sequence that encodes the modified poly(A) tail is characterized in that it consists of at least two A elements each defined as a nucleotide sequence consisting of 55 to 65 T nucleotides and at least one S element each S element consisting of one nucleotide that is not a T nucleotide, or 2 to 10 nucleotides, preferably 6 nucleotides, wherein each of the two terminal nucleotides is not a T nucleotide, wherein the number of A elements is one more than the number of S elements, and wherein any two A elements are separated by one S element; said DNA plasmid exhibiting a reduced recombination during amplification in a bacterial host cell compared to the same DNA plasmid without said at least one S element.
Claims
1. A DNA plasmid comprising a DNA sequence which contains (i) a first nucleotide sequence which encodes an mRNA molecule and, located downstream thereof, (ii) a second nucleotide sequence which encodes a modified poly(A) tail, wherein said second nucleotide sequence is characterized in that it consists of (a) at least two A elements each defined as a nucleotide sequence consisting of 55 to 65 T nucleotides, and (b) at least one S element each S element consisting of (b1) one nucleotide that is not a T nucleotide, or (b2) 2 to 10 nucleotides, preferably 6 nucleotides, wherein each of the two terminal nucleotides is not a T nucleotide; wherein the total number of A elements is one more than the total number of S elements, and wherein any two A elements are separated by one S element.
2. The DNA plasmid of claim 1, wherein any one of said S elements consists of one C nucleotide or one A nucleotide, preferably of one C nucleotide.
3. The DNA plasmid of claim 1 or 2, wherein the number of A elements is two, three or four.
4. The DNA plasmid of any one of claims 1 to 3, wherein the number of A elements is four and wherein said nucleotide sequences of the four A elements together have an overall length of 240 nucleotides, preferably each A element having a length of 60 nucleotides.
5. The DNA plasmid of any one of claims 1 to 3, wherein the number of A elements is two and wherein said nucleotide sequences of the two A elements together have an overall length of 120 nucleotides, preferably each A element having a length of 60 nucleotides.
6. A bacterial host cell comprising the DNA plasmid of any one of claims 1 to 5.
7. The bacterial host cell of claim 6, which is an E. coli cell, preferably an E. coli recA.sup.− cell.
8. Use of a nucleotide sequence which encodes a modified poly(A) tail as defined in claim 1 (ii) and in claims 2 to 5 for preparing a DNA plasmid showing reduced recombination during amplification in a bacterial host cell, wherein said nucleotide sequence is located downstream of a nucleotide sequence which encodes an mRNA molecule.
9. Use of a nucleotide sequence which encodes a modified poly(A) tail as defined in claim 1 (ii) and in claims 2 to 5 for reducing recombination during amplification of a DNA plasmid in a bacterial host cell.
10. A method for reducing recombination of a DNA plasmid comprising a DNA sequence which encodes an mRNA molecule and, located downstream thereof, a poly(A) tail, during amplification in a bacterial host cell, wherein said reduction is achieved by replacing the part of the DNA sequence which encodes the poly(A) tail by a nucleotide sequence which encodes a modified poly(A) tail as defined in claim 1 (ii) and in claims 2 to 5.
11. A method of producing a polyribonucleotide comprising a sequence encoding an amino acid sequence and a modified poly(A) tail as encoded by the nucleotide sequence as defined in claim 1 (ii) and in claims 2 to 5, said method comprising the step of producing said polyribonucleotide by in vitro transcription from a DNA plasmid of any one of claims 1 to 5.
12. The method of claim 11, wherein said polyribonucleotide is produced by in vitro transcription in the presence of unmodified and/or modified nucleotides.
13. A polyribonucleotide obtainable by the method of claim 11 or 12.
14. The polyribonucleotide of claim 13, wherein the polyribonucleotide comprises one or more types of modified nucleotides.
15. A pharmaceutical composition containing a polyribonucleotide of any one of claims 13 to 14 together with a pharmaceutically acceptable carrier.
Description
[0105]
[0106]
[0107]
[0108]
[0109]
[0110] Other aspects and advantages of the invention will be described in the following examples, which are given for purposes of illustration and not by way of limitation. Each publication, patent, patent application or other document cited in this application is hereby incorporated by reference in its entirety.
EXAMPLES
[0111] Methods and materials are described herein for use in the present disclosure; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting.
[0112] Abbreviations used herein and their respective descriptions are listed in Table 2.
TABLE-US-00002 TABLE 2 Abbreviation Description A Nucleotide with an adenine residue C Nucleotide with an cytosine residue ° C. Degree Celsius ELISA Enzyme-linked Immunosorbent Assay FA Fragment Analyzer G Nucleotide with an guanine residue h Hour(s) hIL-6 Human interleukin 6 min Minutes mRNA Messenger ribonucleic acid n Total number of clones with a particular poly(A) tail sequence n/a Not applicable ND NanoDrop nm Nanometer nt Nucleotide(s) poly(A).sub.120 Nucleotide sequence encoding a poly(A) tail without S element consisting of 120 A nucleotides poly(A).sub.3×40_6 Nucleotide sequence encoding a poly(A) tail consisting of three A elements each consisting of 40 A nucleotides with any two A elements separated by a 6 nt long S element as defined in Table 6 poly(A).sub.2×60_6 Nucleotide sequenceen coding a poly(A) tail consisting of two A elements consisting of 60 A nucleotides each and separated by a 6 nt long S element as defined in Table 6 poly(A).sub.2×60_C Nucleotide sequence encoding a poly(A) tail consisting of two A elements consisting of 60 A nucleotides each and separated by a C nucleotide poly(A).sub.2×60_G Nucleotide sequence encoding a poly(A) tail consisting of two A elements, consisting of 60 A nucleotides each and separated by a G nucleotide poly(A).sub.2×60_T Nucleotide sequence encoding a poly(A) tail consisting of two A elements consisting of 60 A nucleotides each and separated by a T nucleotide qPCR Quantitative real-time polymerase chain reaction RLU Relative light unit T Nucleotide with an thymine residue U Nucleotide with an uracile residue % Percent
[0113] Material and Methods
[0114] Materials, Devices, Software, and Test System Used
[0115] Materials are listed in Table 3.
TABLE-US-00003 TABLE 3 Material Supplier Cat# pUC57-Kanamycin vector GenScript n/a Oligonucleotides IDT n/a Annealing buffer Ethris GmbH n/a Tris HCl Roth 9090.1 NaCl Roth 9265.1 EDTA Roth 8040.1 Phusion High-fidelity PCR master mix Thermo Fisher Scientific F531S MgCl.sub.2 Roth KK36.2 DMSO Sigma Aldrich 67-68-5 NucleoSpin Gel and PCR Clean-Up Macherey-Nagel 740609.250 Mini prep kit Macherey-Nagel 740588.250 Maxi Prep kit Macherey-Nagel 740414.10 Agarose Sigma Aldrich A9539 BgIII Thermo Fisher Scientific FD0083 Nhel Thermo Fisher Scientific FD0973 BstBl Thermo Fisher Scientific FD0124 Chloroform Sigma Aldrich 288306 Firefly luciferase coding region Promega n/a d2EGFP coding region Clontech n/a hEPO coding region Pubmed n/a Ethanol Roth 5054.1 T7 RNA polymerase Thermo Fisher Scientific EP0111 Transcription buffer II Ethris GmbH n/a RiboLock Rnase inhibitor Thermo Fisher Scientific EO0381 Inorganic pyrophosphatase 1 Thermo Fisher Scientific EF0221 Ribonucleotides Jena Biosciences NU-1010-NU-1013 DNase I Thermo Fisher Scientific EN0525 Ammonium acetate Applichem 131114.1210 aqua ad injectabilia B. Braun 3703444 Vaccinia Virus Capping Enzyme NEB M2080S 1x capping buffer NEB M2080 GTP Jena Biosciences NU-1012 S-Methyladenosine NEB B9003S mRNA Cap 2'-o-Methyltransferase NEB M0366S Minimum Essential Media GlutaMAX Gibco Life 11095-080 Technologies Glutamax Gibco/Life Technologies 35050061 Fetal bovine serum Gibco/Life Technologies 10500064 Penicillin/streptomycin Gibco/Life Technologies 15140122 Lipofectamine ® 2000 Thermo Fisher Scientific 11668027 PBS Gibco/Life Technologies 10010023 TritonX-100 Sigma Aldrich 9002-93-1 BioRad protein assay dye Bio-Rad 5000006 reagent concentrate Bovine serum albumin Sigma Aldrich A2058 Propidium iodide Sigma Aldrich 11348639001 TrypLE Gibco/Life Technologies 12604-013 Single Shot Cell Lysis kit Bio-Rad 1725080 iScript Select cDNA Synthesis kit Bio-Rad 1708896 Universal Probe Library #29 Roche 4687612001
[0116] Devices are listed in Table 4.
TABLE-US-00004 TABLE 4 Device Supplier Roche Light Cycler 96 Roche Diagnostics NanoDrop2000C Thermo Fisher Scientific Fragment Analyzer Advanced Analytical Humidified 5% CO2 incubator Sanyo InfiniteR 200 PRO Tecan Attune Acoustic Focusing Cytometer Life Techologies Gene Pulser II Biorad
[0117] Software is listed in Table 5.
TABLE-US-00005 TABLE 5 Software Provider GraphPad Prism software (version 6) GraphPad Software Inc. Attune Cytometric Software (version 2.1) Life Technologies FlowJo (version 10) FlowJo LightCycler ® 96 (version 1.1) Roche PROSize 3.0 Advanced analytical
[0118] The test system is listed in Table 6.
TABLE-US-00006 TABLE 6 Test System Species Strain Cell line E. coli E. coli DH10B strain Cell line Human A549 (ACC-107) Cell line Human HEK293 (ACC-305) Thawed Used passage passage no. no. Supplier — — — 4-7 Up to 15 DSMZ 4-7 Up to 15 DSMZ
[0119] Plasmid Preparation
[0120] Synthetic poly(A) tail sequences were introduced to the pUC57-Kanamycin vector backbone either as annealed complementary oligonucleotides or fragments created by PCR-based strategy. A specific set of complementary oligonucleotides was designed for sequences comprising poly(A).sub.2×60_6 constructs and poly(A).sub.3×40_6 constructs and annealed. The synthetic poly(A) constructs of poly(A).sub.120, Poly(A).sub.2×60_C, poly(A).sub.2×60_G, and poly(A).sub.2X60_T were created by PCR.
[0121] The two sets of complementary oligonucleotides were annealed in the following way: 100 μM of each oligonucleotide were mixed with 40 μl annealing buffer and incubated for 5 min at 95° C. (10 mM Tris HCl, 50 mM NaCl, 1 mM EDTA, pH 7.5). After the reaction, the mixture was let to cool down to room temperature before proceeding with restriction digestion (BgIII-BstBI).
[0122] For the high performance of PCR reaction, Phusion High-fidelity PCR master mix was used. In addition to the master mix which contains 2× Phusion DNA Polymerase, nucleotides and optimized reaction buffer including MgCl.sub.2, 0.5 μM of forward and reverse primer, 3% DMSO and 100 ng of template DNA were added to the reaction. The total volume of 25 μl per reaction was initially denatured at 98° C. for 30 sec, following by 30 cycles at 98° C. for 10 sec, annealing at 72° C. for 30 sec and extension at 72° C. for 30 sec/kb. The final extension was performed at 72° C. for 10 min. The size of the PCR product was confirmed on 1% agarose gel and the desired band was purified using NecleoSpin Gel and PCR clean up kit. Purified PCR product was digested with Nhel-BstBI and stored at −20° C. till further use. After restriction enzyme digestion of annealed oligonucleotides (BgIII-BstBI) and PCR fragments (Nhel-BstBI), the poly(A) tail constructs were cloned into accordingly digested pUC57-Kanamycin vectors comprising the coding region of choice (firefly luciferase, hEPO, d2EGFP).
[0123] A list of segmented poly(A) sequences and corresponding cloning strategy with PCR primer sets or oligonucleotides is shown in Table 7.
TABLE-US-00007 TABLE 7 Construct Strategy PCR primer forward/Oligo I PCR primer reverse/Oligo II A120 PCR GTGACTGCTAGCTAATACGACTCACTAT AGTCACTTCGAATTTTTTTTTTTTTTTTT AGGGAG (SEQ ID No: 1) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTAGATCTTTACACGGC GATCTTGCCGCCCTTC (SEQ ID No: 2) 2x60_6 Oligonucleotides GTGACTAGATCTAAAAAAAAAAAAAAAAA AGTCACTTCGAATTTTTTTTTTTTTTTTT AAAAAAAAAAAAAAAAAAAAAAAAAAAAA TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT AAAAAAAAAAAAAAATGCATAAAAAAAAA TTTTTTTTTTTTTATGCATTTTTTTTTTTT AAAAAAAAAAAAAAAAAAAAAAAAAAAAA TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT AAAAAAAAAAAAAAAAAAAAAATTCGAAG TTTTTTTTTTTTTTTTTTTAGATCTAGTC TGACT (SEQ ID No: 3) AC (SEQ ID No: 4) 3x40_6 Oligonucleotides GTGACTAGATCTAAAAAAAAAAAAAAAAA AGTCACTTCGAATTTTTTTTTTTTTTTTT AAAAAAAAAAAAAAAAAAAAAAAATGCAT TTTTTTTTTTTTTTTTTTTTTTTGATATCT AAAAAAAAAAAAAAAAAAAAAAAAAAAAA TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT AAAAAAAAAAAGATATCAAAAAAAAAAAA TTTTTTTTTATGCATTTTTTTTTTTTTTTT AAAAAAAAAAAAAAAAAAAAAAAAAAAAT TTTTTTTTTTTTTTTTTTTTTTTTTAGATC TCGAAGTGACT (SEQ ID No: 5) TAGTCAC (SEQ ID No: 6) 2x60_C PCR GTGACTGCTAGCTAATACGACTCACTAT AGTCACTTCGAATTTTTTTTTTTTTTTTT AGGGAG (SEQ ID No: 1) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTGTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTAGATCTTTACACGG CGATCTTGCCGCCCTTC (SEQ ID No: 7) 2x60_G PCR GTGACTGCTAGCTAATACGACTCACTAT AGTCACTTCGAATTTTTTTTTTTTTTTTT AGGGAG (SEQ ID No: 1) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTCTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTAGATCTTTACACGG CGATCTTGCCGCCCTTC (SEQ ID No: 8) 2x60_T PCR GTGACTGCTAGCTAATACGACTCACTAT AGTCACTTCGAATTTTTTTTTTTTTTTTT AGGGAG (SEQ ID No: 1) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTATTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTAGATCTTTACACGG CGATCTTGCCGCCCTTC (SEQ ID No: 9)
[0124] Cloning into E. coli
[0125] The ligations were purified using chloroform-ethanol precipitation and electroporated into DH10B strain of E. coli. For electroporation, Gene Pulser II from Biorad was used. Electroporation conditions followed were: 25 μF, 200 ohms, 1.8 kV. Post electroporation, the bacteria were grown in 2 mL of LB-Medium at 30° C. for 1.5 hours. Subsequently, the culture was centrifuged at 5000 rpm for 10 min at room temperature. Supernatant was discarded and the pellet was resuspended in 200 μL of fresh LB-Medium. From this, 100 μL were plated in LB-Agar plates containing the appropriate antibiotic (Kanamycin at a final concentration of 50 μg/mL or Ampicillin at a final concentration of 100 μg/mL). The plates were incubated overnight at 30° C.
[0126] Plasmid Preparation Using Mini-Prep Kit
[0127] Clones were inoculated in LB-Medium containing the appropriate antibiotic (Kanamycin at a final concentration of 50 μg/mL or ampicillin at a final concentration of 100 μg/mL) and grown at 30° C. overnight in a bacterial shaker (250 rpm). Subsequently plasmids were isolated from the overnight cultures using Mini-Prep kit. Plasmids were tested for insert using restriction digestion and confirmed via sequencing. For the correct clones, glycerol stocks were prepared by adding 200 μL autoclaved glycerol to 800 μL of overnight bacterial culture. Glycerol stocks were stored at −80° C.
[0128] Plasmid Preparation Using Maxi-Prep Kit
[0129] Plasmid for RNA production was prepared using the Maxi-Prep kit. Glycerol stock from the desired clone(s) was inoculated in 5 mL of LB-Medium containing appropriate antibiotics (Kanamycin at final concentration of 50 μg/mL or Ampicillin at a final concentration of 100 μg/mL) and the culture was grown overnight at 30° C. in a bacterial shaker (250 rpm). 3 mL from this starter culture were used to inoculate 300 mL of LB-Medium containing appropriate antibiotic (Kanamycin at a final concentration of 50 μg/mL or Ampicillin at a final concentration of 100 μg/mL) which was subsequently incubated overnight at 30° C. in a bacterial shaker (250 rpm).Overnight culture was centrifuged at 5000 rpm, 4° C. for 30 min. Supernatant was discarded and the bacterial pellet was used to isolate the plasmid.
[0130] Generation of mRNA
[0131] To generate in vitro transcribed mRNA, plasmids were linearized by BstBI digestion and purified by chloroform extraction and ethanol precipitation. Purified linear plasmids were used as a template for in vitro transcription. Plasmid templates (0.5 μg/μl) were subjected to in vitro transcription using 3 U/μl T7 RNA polymerase, transcription buffer II, 1 U/μl RiboLock Rnase inhibitor, 0.015 U/μl inorganic pyrophosphatase 1 with a defined choice of ribonucleotides. The complete IVT-mix was incubated at 37° C. for 2 h. Afterwards, 0.01 U/μl DNase I was added for additional 45 min at 37° C. to remove the plasmid template. RNA was precipitated with ammonium acetate at a final concentration of 2.5 mM, followed by two washing steps with 70% ethanol. The pellet was re-suspended in aqua ad injectabilia. A C1-m7G cap structure was added enzymatically by 0.5 mM Vaccinia Virus Capping Enzyme to the 5′ end of the previously denaturated transcript (1 mg/ml) at 80° C. for 5 min. The capping reaction mix also contained 1× capping buffer, 0.5 mM GTP, 0.2 mM S-Methyladenosine, 2.5 U/μl Mrna Cap 2′-o-Methyltransferase and 1 U/μl RiboLock Rnase Inhibitor. The capping mixture was incubated for 60 min at 37° C., followed by RNA precipitation with ammonium acetate at a final concentration of 2.5 mM and two washing steps with 70% ethanol. The pellet was re-suspended in aqua ad injectabilia.
[0132] RNA quality and concentration were measured spectrophotometrically on a NanoDrop2000C. Its correct size and purity were determined via automated capillary electrophoresis.
[0133] Cell Culture
[0134] A549 (ACC-107) and HEK293 (ACC-305) cells were purchased from DSMZ. All cells were cultivated in Minimum Essential Media (MEM) with Glutamax. Media were supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 1 penicillin/streptomycin. Cells were cultured in a humidified 5% CO.sub.2 incubator at 37° C.
[0135] In Vitro Transfection Both cell lines, A549 and HEK293, were transfected with 250 ng mRNA per well. A549 and HEK293 cells were seeded at the density of 2×10.sup.4 cells/well and 4×10.sup.4 cells/well, respectively, in a 96 well plate, for the purpose of firefly luciferase and hEPO ELISA assay. 24 hours post-seeding, cells were transfected using the commercial transfection reagent Lipofectamine® 2000. Complexes were prepared at a ratio of 2 μl Lipofectamine® 2000 per 1 μg mRNA.
[0136] The mRNA was diluted 1:20 in water, and Lipofectamine® 2000 1:10 separately in a serum-free MEM. mRNA was added to the Lipofectamine® 2000 solution followed by 20 min incubation time at RT. The concentration of the final mRNA/Lipofectamine® 2000 solution was 25 ng/μl, and a serial dilution 1:2 was performed. 10 μl of the complex solution was added to the cells and cells were incubated for 24 and 48 h, respectively. For every mRNA construct, replicates of three or six were prepared.
[0137] Flow Cytometry Analysis for d2EGFP
[0138] Cells were washed with PBS, detached with TrypLE, and re-suspended in flow cytometry buffer (PBS supplemented with 10% FBS). Shortly before measurement, cells were stained with propidium iodide for discrimination between live and dead cells (1 μg/mL). Live cells (>97%) were further gated to discriminate between d2EGFP-expressing cells and those that did not express. Analysis was performed on an Attune Acoustic Focusing Cytometer with Attune Cytometric Software (version 2.1) and FlowJo (version 10).
[0139] Firefly Luciferase Assay
[0140] For detection of firefly luciferase activity, the assay was performed 24 h post-transfection. At the appropriate time point, cells were washed with PBS, followed by addition of 100 μl of lysis buffer (25 mM Tris-HCl, 0.1% TritonX-100, pH 7.4). Cells were shaken for 20 min at room temperature. After lysation, 50 μl of the cell lysate was used to measure luciferase activity via photon luminescence emission for 5 s using InfiniteR 200 PRO. The protein amount in each sample was quantified in 5 μl of the cell lysate with BioRad protein assay, using bovine serum albumin as a standard. Luciferase values were normalized to the protein concentration.
[0141] RNA Isolation and Reverse Transcription
[0142] In order to determine the actual mRNA amount 24 h post-transfection, the cultured cells (A549, HEK293) were lysed and RNA was isolated according to the manufacturer's protocol using Single Shot Cell Lysis kit. From the lysates (1 μg of RNA), cDNA was synthesized using iScript Select cDNA Synthesis kit with oligo(dT) primers following the manufacturer's instructions. The synthesized cDNA was stored at −20° C.
[0143] Quantitative Real-Time Polymerase Chain Reaction (qPCR)
[0144] Real-time qPCR was performed with short hydrolysis probes for d2EGFP and luciferase targets (Universal Probe Library #37 and #29) on a Roche Light Cycler 96. The following primers for d2EGFP were used: 5′-cctgaagttcatctgcacca-3′ and 5′-ctcgtgaccaccctgacc-3′; and for the luciferase target: 5′-acgccgagtacttcgagatg-3′ and 5′-attcagcccatagcgcttc-3′. Absolute mRNA values were calculated by interpolation from the standard curve.
[0145] Statistical Analysis
[0146] Each experiment was performed with at least three technical replicates per sample. Results are shown as means±SD unless otherwise stated. Statistical analysis was performed using GraphPad Prism software (version 6). Data was tested for normal distribution using D'Agostino-Pearson omnibus normality test. Multiple comparisons were conducted by two-way ANOVA, followed by Sidak's test (pairwise comparison) or Dunett's test (many-to-one comparison). A p-value ≤0.05 was considered statistically significant.
[0147] Segmented Poly(A) Tails Drastically Reduce Bacterial Recombination
[0148] It was examined whether the use of segmented poly(A) tails affected the recombination of plasmids post transformation into E. coli. To test this, open reading frame sequences of different genes (luciferase, d2EGFP, hEPO) were combined with either of the three poly(A) constructs poly(A).sub.120, poly(A).sub.2×60_6, and poly(A).sub.3×40_6 and cloned into a pUC57-Kanamycin vector. Post transformation into E. coli, clones were screened for insert and positive clones containing the desired insert were additionally screened for the length of the respective poly(A) tail. For each of the three poly(A) tail constructs, the poly(A) tail was digested with restriction enzymes and the digestions were resolved on Fragment Analyzer (capillary gel electrophoresis) to measure the size of the respective poly(A) tail. Recombination in the poly(A)-tail was observed for more than 50% of the clones containing the homologous poly(A) tail poly(A).sub.120. By splitting the poly(A) tail into either poly(A).sub.3×40_6 or poly(A).sub.2×60_6, recombination in E. coli could be significantly reduced with most stable clones (<20% recombination) obtained with plasmids containing poly(A).sub.2×60_6 (
TABLE-US-00008 TABLE 8 Target genes Poly(A) Luc2 d2EGFP EPO Poly(A).sub.2×60_6 56 10 15 Poly(A).sub.3×40_6 10 10 — Poly(A).sub.120 11 10 16
[0149] Effect of a One Nucleotide Long Spacer within a Poly(A) Tail on Recombination
[0150] The effect of a one nucleotide long spacer in a poly(A).sub.2×60 construct (C, T or G) on recombination in E. coli was examined by investigating clones comprising the open reading frame sequence of the firefly luciferase and the respective poly(A).sub.2×60_C, poly(A).sub.2×60_G, or poly(A).sub.2×60_T construct. Interestingly, the constructs comprising G as a spacer in the poly(A) tail, did not recombine at all. A spacer with a single T recombined in 10% of cases, and the one with a C as a spacer nucleotide recombined in 50% of cases (
TABLE-US-00009 TABLE 9 Recombination Poly(A) Figure n rate Poly(A).sub.2×60_6 1 81 19% Poly(A).sub.3×40_6 1 20 35% Poly(A).sub.120 1 37 54% Poly(A).sub.2×60_G 2 16 0% Poly(A).sub.2×60_T 2 10 10% Poly(A).sub.2×60_C 2 10 50%
[0151] Effect of a Six Nucleotide Long Spacer on mRNA and Protein Levels
[0152] Luciferase protein and mRNA decay was investigated in A549 cells at 24 h post-transfection with luciferase mRNA, containing either a poly(A).sub.2×60_6, poly(A).sub.3×40_6 or poly(A).sub.120 construct. Use of the segmented poly(A).sub.2×60_6 construct significantly increased protein levels post-transfection when compared to the poly(A).sub.120 benchmark (
[0153] Further, the effects of poly(A) segmentation on transcription and translation of a physiological target was tested using human erythropoietin (hEPO) as a prototype of secretory proteins and short mRNAs (0.9 kb). The codon optimized sequence encoding hEPO was cloned into a pUC57-Kanamycin vector upstream of either a poly(A).sub.120 or a poly(A).sub.2×60_6 construct. hEPO protein concentrations were determined via ELISA 24 h post-transfection (
[0154] Effect of a One Nucleotide Long Spacer on mRNA and Protein Levels
[0155] The effect of a single spacer nucleotide within a poly(A).sub.2×60-tail on protein expression and mRNA productivity was tested. Luciferase mRNA expression and protein activity was determined by transfecting A549 cells with mRNA constructs containing a single C, T, or G spacer nucleotide within the respective poly(A).sub.2×60-tail. As a benchmark, the standard poly(A).sub.120 construct was used. Between all three single nucleotide spacer constructs, there was no significant difference in protein expression, but all of them resulted in significantly more protein compared to the poly(A).sub.120 construct (