NOVEL MEANS TO MODULATE NMDA RECEPTOR-MEDIATED TOXICITY

Abstract

The present invention relates to the field of neurodegenerative processes and means to provide protection against the same. In particular, the present invention relates to polypeptides, fusion proteins, and other compounds interacting with the N-terminal domain of transient receptor potential melastatin subfamily member 4 (TRPM4), which are capable of interfering with NMDA receptor mediated neurotoxicity. The present invention also relates to nucleic acids encoding the aforementioned polypeptides or fusion proteins, compositions comprising the same and the use of said polypeptides, fusion proteins, and other compounds in methods for treating or preventing a disease of the human or animal body, for example in a method of treating diseases like Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), Huntington's disease (HD) or stroke.

Claims

1. A polypeptide comprising: i) an amino acid sequence according to SEQ ID NO:3, wherein the polypeptide is at most 685 amino acids long, preferably at most 200 amino acids long; ii) a derivative amino acid sequence of SEQ ID NO:3, wherein the derivative amino acid sequence has at least 80% sequence identity with SEQ ID NO:3, and wherein the polypeptide is at most 200 amino acids long; or iii) an amino acid sequence according to SEQ ID NO:4, wherein the polypeptide is at most 350 amino acids long, preferably at most 200 amino acids long.

2. A fusion protein comprising the polypeptide of claim 1 and at least one further amino acid sequence heterologous to the amino acid sequence of i), ii) or iii), respectively.

3. The fusion protein according to claim 2, wherein the heterologous polypeptide sequence is selected from one or more of the group consisting of a membrane anchoring polypeptide, a protein transduction domain and a tag.

4. The polypeptide according to claim 1, wherein the derivative amino acid sequence of the amino acid sequence according to SEQ ID NO:3 is: i) an amino acid sequence having at least 80% sequence identity with SEQ ID NO:3, or is ii) a sequence falling with the consensus sequence of SEQ ID NO:4, in particular SEQ ID NO:5, with the proviso that said derivative is not SEQ ID NO:3.

5. A nucleic acid encoding a polypeptide according claim 1.

6. A composition comprising a polypeptide according to claim 1, and further comprising a pharmaceutically acceptable carrier, diluent or excipient.

7. The composition according to claim 6, wherein the composition comprises a nanoparticle comprising said polypeptide according to claim 1 or 4, said fusion protein according to any one of claims 2, 3 and 4, and/or said nucleic acid according claim 5.

8. A compound for use in a method for treating or preventing a disease of the human or animal body, comprising administering a compound selected from the group consisting of: i) a polypeptide according to claim 1, ii) a polypeptide binding to SEQ ID NO:3 or a derivative thereof, wherein the derivative is i) a sequence having at least 80% sequence identity with SEQ ID NO:3, or ii) a sequence according to SEQ ID NO:4, and wherein the polypeptide is an antibody or anticalin, iii) a fusion protein according to any one of claims 2 and 3, iv) a nucleic acid according to claim 5, v) a compound according to the following formula: ##STR00020## wherein: R.sub.1 and R.sub.2 are each independently selected from hydrogen, alkyl.sub.(C≤12), and substituted alkyl.sub.(C≤12), and R.sub.3, R.sub.4 and Rs are each independently selected from hydrogen, hydroxy and halo; or a pharmaceutically acceptable salt, solvate, polymorph, tautomer, racemate, or enantiomer thereof, and vi) a compound selected from the group of compounds consisting of: ##STR00021## and a pharmaceutically acceptable salt, solvate, polymorph, tautomer, racemate, or enantiomer of any of these compounds.

9. A compound method for treating or preventing a disease of the human or animal body, comprising administering a compound that is an inhibitor of NMDA receptor/TRPM4 complex formation.

10. The method according to claim 9, wherein the compound is selected from the group consisting of: i) a polypeptide according to claim 1, ii) a polypeptide binding to SEQ ID NO:3 or a derivative thereof, wherein the derivative is i) a sequence having at least 80% sequence identity with SEQ ID NO:3, or ii) a sequence according to SEQ ID NO:4, and wherein the polypeptide is an antibody or anticalin, iii) a fusion protein according to any one of claims 2 and 3, iv) a nucleic acid according to claim 5, v) a compound according to the following formula: ##STR00022## wherein: R.sub.1 and R.sub.2 are each independently selected from hydrogen, alkyl.sub.(C≤12), and substituted alkyl.sub.(C≤12), and R.sub.3, R.sub.4 and R.sub.5 are each independently selected from hydrogen, hydroxy and halo; or a pharmaceutically acceptable salt, solvate, polymorph, tautomer, racemate, or enantiomer thereof, and vi) a compound selected from the group of compounds consisting of: ##STR00023## and a pharmaceutically acceptable salt, solvate, polymorph, tautomer, racemate, or enantiomer of any of these compounds.

11. The method of claim 8, wherein the compound is selected from the group consisting of: ##STR00024## and a pharmaceutically acceptable salt, solvate, polymorph, tautomer, racemate, or enantiomer of any of these compounds.

12. The method of claim 8, wherein the disease is a neurological disease, in particular a neurodegenerative disease.

13. The method of claim 8, wherein the disease is selected from the group consisting of stroke, Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), Huntington's disease (HD), traumatic brain injury, multiple sclerosis, glutamate induced excitotoxicity, dystonia, epilepsy, optic nerve disease, diabetic retinopathy, glaucoma, pain, particularly neuropathic pain, anti-NMDA receptor encephalitis, viral encephalopathy, vascular dementia, microangiopathy, Binswanger's disease, cerebral ischemia, hypoxia and Parkinson's disease, schizophrenia, depression, cerebral malaria, toxoplasmosis-associated brain damage, HIV infection-associated brain damage, Zika virus infection-associated brain damage and a brain tumour.

14. The method according to claim 1, wherein the compound is comprised in a nanoparticle.

15. Use of a polypeptide comprising or consisting of an amino acid sequence according to SEQ ID NO:3 or a derivative thereof, wherein the derivative is i) a sequence having at least 80% sequence identity with SEQ ID NO:3, or ii) a sequence according to SEQ ID NO4, in an in vitro protein-protein interaction assay.

16. A method for identifying a compound potentially interacting with a TRPM4 protein comprising or consisting of an amino acid sequence according to SEQ ID NO:3 or a derivative thereof, wherein the derivative is i) a sequence having at least 80% sequence identity with SEQ ID NO:3, or ii) a sequence according to SEQ ID NO:4, wherein the method comprises : i) computer-assisted virtual docking of a candidate compound to an amino acid sequence according to SEQ ID NO:3, or a derivative of said sequence, wherein the derivative is i) a sequence having at least 80% sequence identity with SEQ ID NO:3, or ii) a sequence according to SEQ ID NO:4, wherein said amino acid sequence is provided in a virtual 3-D structure of a polypeptide comprising said amino acid sequence, and ii) determining the docking score and/or internal strain for docking the candidate compound virtually to the amino acid sequence according to SEQ ID NO:3 or its derivative, and optionally iii) contacting in vitro or in vivo the candidate compound with a TRPM4 protein to determine whether the candidate compound modulates the activity of said TRPM4 protein or not.

17. A cell, in particular a non-neuronal cell, wherein said cell expresses a recombinant NMDA receptor, and wherein expression of TRPM4 in said cell is absent, knocked down or knocked-out.

18. A method for treating or preventing a disease of the human or animal body, wherein the disease is caused by NMDA receptor mediated excitotoxicity, comprising administering to said human or animal body an inhibitor of TRPM4.

Description

FIGURES

[0078] In the following a brief description of the appended figures will be given. The figures are intended to illustrate aspects of the present invention in more detail. However, they are not intended to limit the scope of the invention.

[0079] FIG. 1 illustrates that knockdown of TRPM4 protein by using RNA interference protects neurons from NMDA receptor mediated toxicity. Vehicle was water. shTRMP4-1 is depicted in SEQ ID NO:44, shTRMP4-2 is depicted in SEQ ID NO:45. All data are shown as mean±s.d. n=3 independent experiments. Two-Way ANOVA followed with Dunnett post hoc test. n.s. not significant. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0080] FIG. 2 illustrates that mouse TRPM4 contains a polypeptide element conferring protection against NMDA induced cell death. A) Neuroprotective effect of 4 different fragments of mouse TRPM4: Amino acid residues 1-346 (SEQ ID NO:46); amino acid residues 347-689 (SEQ ID NO:47); amino acid residues 690-1036 (SEQ ID NO:48); amino acid residues 1037-1213 (SEQ ID NO:49); Of these only SEQ ID NO:47 is neuroprotective. B) Neuroprotective effect of 4 different fragments of a polypeptide with the sequence according to SEQ ID NO:47: amino acid residues 347-467 (SEQ ID NO:50); amino acid residues 468-548 (SEQ ID NO:51); amino acid residues 536-648 (SEQ ID NO:52); amino acid residues 633-689 (SEQ ID NO:5). Of these only SEQ ID NO:5 is neuroprotective. All data are shown as mean±s.d. n=3 independent experiments. Two-Way ANOVA followed with Dunnett post hoc test. *p<0.05, **p<0.01, ***p<0.001.

[0081] FIG. 3 illustrates protective properties of various variants of the polypeptide with the sequence of SEQ ID NO:5. A) Analysis of NMDA induced neuronal death in neurons infected with rAAV and overexpressing SEQ ID NO:47 or SEQ ID NO:53. SEQ ID NO:53 corresponds to SEQ ID NO:47 but comprises additionally a membrane-anchor (GPI). The experiments showed that the GPI anchor increased the protective effects of the polypeptide according to SEQ ID NO:47, leading to less cell death. B) Analysis of NMDA induced neuronal death in in cultured neurons infected on DIV3 with the rAAVs expressing SEQ ID NO:5, SEQ ID NO:54 or SEQ ID NO:55 and challenged with 20 μM NMDA for 10 min on DIV17, with cell death assessed 24 h later. SEQ ID NO:54 is a derivative of SEQ ID NO:5, having a conservative substitution of two Y for two F. It is only slightly less effective in reducing NMDA receptor-mediated cell toxicity than SEQ ID NO:5. In contrast, a corresponding region deriving from related but different mouse protein TRPM5, SEQ ID NO:55, sharing only about 60% sequence identity with SEQ ID NO:5, is not capable of reducing NMDA receptor-mediated cell toxicity. All data are shown as mean±s.d. n=3 independent experiments. Two-Way ANOVA followed with Dunnett post hoc test. n.s. not significant. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0082] FIG. 4 illustrates the effect of preexposure of neurons to 1 and 10 μg of a fusion peptide comprising the peptide of SEQ ID NO:5 and a protein transduction domain (TAT, SEQ ID NO:42). The fusion protein (SEQ ID NO:5 +TAT) had the amino acid sequence according to SEQ ID NO:56. The experiments showed that the application of SEQ ID NO:56 protected neurons from NMDA excitotoxicity. Vehicle was water.

[0083] FIG. 5 illustrates infarct volumes in whole ischemic brains of mice subjected to stereotactic injection of recombinant adeno associated viruses (rAAVs) encoding SEQ ID NO:5 3 weeks before MCAO or sham surgery. PBS and GFP were used as control. The infarct size was determined 7 days after MCAO (mean±SD). Statistical analysis was determined by t-test; statistically significant differences are indicated with asterisks (n=5-8). **P<0.005, ***P<0.001.

[0084] FIG. 6 illustrates the preventive effect of polypeptides according to SEQ ID NO:5 and SEQ ID NO:54 against neuronal mitochondrial membrane potential break down in primary mouse hippocampal neurons. Addition of carbonylcyanide-p-trifluoromethoxyphenylhydrazone (FCCP) leads to breakdown of the mitochondrial membrane potential. A) Breakdown of the mitochondrial membrane in untransfected primary mouse hippocampal neurons; B) Delay of breakdown of mitochondrial membrane potential in presence of SEQ ID NO:5. Addition of the uncoupler FCCP at the end of the experiment leads to breakdown of the mitochondrial membrane potential; C) Comparison of the protective effect of three different polypeptides against neuronal mitochondrial membrane potential breakdown: Uni: Uninfected (negative control); SEQ ID NO:5, SEQ ID NO: 54 and SEQ ID NO: 55 (negative control). One-Way ANOVA followed with Tukey's post hoc test. n.s. not significant. ****p<0.0001.

[0085] FIG. 7 illustrates that the effects observed for SEQ ID NO:5 and SEQ ID NO: 54 are not affecting synaptic NMDA receptor signaling. In particular, synaptic NMDA receptor activation, which is boosted by the GABAA receptor antagonist Gabazine, mediated calcium influx into mitochondria are not affected by SEQ ID NO:5 and SEQ ID NO: 54. All data are shown as mean±s.d. n=10-12 from 3 independent experiments. One-Way ANOVA followed with Tukey's post hoc test. n.s. not significant. ****p<0.0001.

[0086] FIG. 8 illustrates the neuroprotective effect of compounds identified in a virtual screen as potentially interacting with SEQ ID NO:5 in mouse TRPM4. DMSO was used as negative control. Glibenclamide, a TRPM4 inhibitor, was used as positive control. A) baseline level of cell death in HEK293 cells without induction of NMDA receptor mediated excitotoxicity; B) cell death mediated by GRIN1+GRIN2A receptor complexes; C) cell death mediated by GRIN1+ GRIN2B receptor complexes. All data are shown as mean±s.d. n=3 independent experiments. One way ANOVA followed with Tukey's post hoc test. n.s. not significant. *p<0.05, p<0.01, ***p<0.001, ****p<0.0001.

[0087] FIG. 9 illustrates the neuroprotective effect of compound P4 and compound P15 against neuronal mitochondrial membrane potential breakdown in primary mouse hippocampal neurons. 30 min prior to recording, P4 and P15 were applied to cultured neurons. After a 1 min recording of baseline, excitotoxicity leading to mitochondrial membrane potential breakdown was induced with bath application of 20 μM NMDA. After 10 minutes, the mitochondrial uncoupler, carbonylcyanide-p-trifluoromethoxyphenylhydrazone (FCCP) was added. Addition of FCCP leads to breakdown of the mitochondrial membrane potential. MK-801, a non-competitive, general NMDA receptor inhibitor, was used as positive control. A) Delay of breakdown of mitochondrial membrane potential in presence of DMSO, P4, P15 or MK-801; B) Quantitative comparison of protective effect of DMSO, P4 and P15 against neuronal mitochondrial membrane potential break down. The results showed that P4 and P15 were able to significantly protect mitochondrial membrane potential from NMDA excitotoxicity, respectively. All data are shown as mean±s.d. n=6 from 2 independent experiments. One-way ANOVA followed with Tukey's post hoc test. n.s. not significant. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0088] FIG. 10 illustrates the neuroprotective effect of compound P4 and derivatives of compound P4 (compounds 401 to 409) against NMDA excitotoxicity in primary mouse hippocampal neurons. Neurons were pre-treated for 30 min with 10 μM of the indicated compound and then challenged with NMDA (20 μM) for 10 min (Transient NMDA toxicity, FIG. 10A) or with NMDA (20 μM) for 24 hours (Chronic NMDA toxicity, FIG. 10B). Cell death was assessed 24 hours after the NMDA challenge. For assessment of cell death, neurons were fixed with 4% paraformaldehyde, 4% sucrose in PBS for 15 min, washed with PBS, and counterstained with Hoechst 33258 (1 μg/ml) for 10 min. The cells were mounted in Mowiol 4-88 and examined by fluorescence microscopy. The dead neurons were identified by amorphous or shrunken nuclei. All data are shown as mean±s.d. n=3-5 from 2-5 independent experiments. One-way ANOVA followed with Dunnett's post hoc test, vs vehicle group. *p<0.05, ***p<0.001, ****p<0.0001.

[0089] FIG. 11 illustrates the capacity of GRIN2A and GRIN2B to induce—in presence of GRIN1—cell death in wild type HEK293 cells (A) and TRPM4 knock-out HEK293 cells (B) at the indicated time points after transfection.

[0090] FIG. 12 illustrates the effects of compound P4, compound P15 or MK-801 on NMDA-induced calcium influx during a 6 min NMDA (20 μM) application. Provided is a quantitative analysis of baseline (FIG. 12A), amplitude (FIG. 12B), and area under the curve (AUC, FIG. 12C). Unlike the classical NMDA receptor blocker, MK-801, which completely blocked NMDA-induced calcium transients, neither compound P4 nor P15 reduced NMDA-induced calcium transients in hippocampal neurons. The compounds do thus not affect NMDA induced calcium influx per se.

[0091] FIG. 13 provides a quantitative analysis of the ratios of GRIN2B and TRPM4 obtained by co-immunoprecipitation of the NMDA receptor/TRPM4 death complex from cortical lysates obtained from control mice and from mice 2 h, 6 h and 24 h following intraperitoneal injection of compound P4 (40 mg/kg). The NMDA receptor/TRPM4 complex was immunoprecipitated with an anti-TRPM4 antibody. A reduction in NMDA receptor/TRPM4 complex formation of 51% at 2 h and 61% at 6 h after a single intraperitoneal (i.p.) injection of 40 mg/kg of compound P4 occurs, thereby demonstrating that compound P4 effectively interfered with such complex formation. 24 h after i.p. injection of compound P4 the NMDA receptor/TRPM4 complex had reformed.

[0092] FIG. 14 provides a quantitative analysis of Brn3a-positive retinal ganglion cell (RGC) degeneration after intravitreal injection of mice with NMDA (20 nmol). The analysis is based on whole-mount retinas stained with antibodies to Brn3a 1 week after intravitreal injection of NMDA to mark live RGCs in mice receiving vehicle or compound P4. All data shown as mean±s.d. Compound P4 reduces retinal ganglion cell (RGC) degeneration after intravitreal injection of mice with NMDA (20 nmol).

[0093] FIG. 15 illustrates the effects of compound P4 and compound P15 on TRPM4 channel function in the prostate cancer cell line PC3. TRPM4 currents are characterized by their calcium dependence and outward rectification. Summary histogram shows the parameters for individual cells patched with either 0 or 10 μM free Ca.sup.2+ in the intracellular solution and pre-incubated at 37° C. for 30-60 min and recorded in either control solution or 10 μM P4 or P15. The results indicate that 10 μM Ca.sup.2+ activates a TRPM4-like outwardly rectifying current in PC3 cells and this current is not affected by P4 or P15. Data shown as mean±s.d. n=10-17 per group from 3 independent experiments. n.s. not significant.

EXAMPLES

[0094] In the following specific examples illustrating embodiments and aspects of the invention are presented. However, the present invention shall not to be limited in scope by the specific examples described herein. Indeed, various modifications of the invention in addition to those described herein will become readily apparent to those skilled in the art from the foregoing description and the example below. All such modifications fall within the scope of the appended claims.

Example 1: Methods and Materials

[0095] The following methods and materials were used by the inventors in the subsequent examples, unless indicated otherwise.

HEK293 Cell Culture

[0096] HEK293 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM, Gibco™, 41965-039) supplement with 10% Fetal Bovine Serum (FBS, Gibco™, 10270), 1% Sodium Pyruvate (Gibco™, 11360070), 1% MEM NEAA (Gibco™, 11140035) and 0.5% Penicillin-Streptomycin (P-S; Sigma, P0781) and Passage15-25 were used for experiments.

Luminescent Cytotoxicity Assay

[0097] To test the cytotoxicity of compounds according to the present invention, HEK293 cells (70-80% confluent) were transfected 24 hours after plating with both GRIN1 and GRIN2A or GRIN2B, respectively (1:1, 0.2 mg/cm.sup.2) with Lipofectamine 2000 according to manufacturer's instructions. The relative number of dead cells in the population at the indicated time points after transfection was measured with the CytoTox-Glo™ Cytotoxicity assay (Promega, G9290) according to manufacturer's instruction with minor modification. Briefly, 10% of total medium were mixed with 10 μL AAF-amino luciferin to reach a final volume at 200 μL with water, the dead cell relative luminescence units (DRLU) was measured by GloMax (Promega) in a 96 well white bottom polystyrene microplate (Corning Costar®, 3912). After all the measurements, lysis reagents have been added to the cells and 10% of lysate was used for the total cell relative luminescence units (TRLU) measurement. Cell death was calculated by the following equations:

[00001]$\mathrm{Cell}\mathrm{death}\left(\%\right)=\frac{10*DRLU}{10*TRLU+DRLU}*100$

[0098] For drug testing, P4, P8, P9, P13 and P15 were added to the medium at indicated concentration 6 h after transfection. DRLU, TRLU and cell death were measured and calculated 48 h after transfection.

Primary Neuronal Cultures

[0099] Primary mouse hippocampal and cortical neurons were prepared and maintained as known. Briefly, hippocampi or cerebral cortex from PO C57B1/6NCr1 mice were dissociated and plated at a density of 1.2*105/cm.sup.2 in Growth Medium (GM), consisting of Neurobasal A medium (Gibco™, 10888022), 2% serum free B27™ Supplement (Gibco™, 17504044), 1% rat serum (Biowest, S2150), 0.5 mM L-Glutamine (Sigma, G7513) and 0.5% P-S. Cytosine β-D-arabinofuranoside (AraC; Sigma, C1768; 2.8 μM) was added on DIV3 to prevent the proliferation of glial cells. From DIVE, half of the medium was replaced by GM without Rat serum every 48 h until being used for experiments. 24h before experiments, GM was replaced with transfection medium (10 mM HEPES, pH 7.4, 114 mM NaCl, 26.1 mM NaHCO3, 5.3 mM KCl, 1 mM MgCl.sub.2, 2 mM CaCl.sub.2, 30 mM glucose, 1 mM glycine, 0.5 mM C.sub.3H.sub.3NaO.sub.3, and 0.001% phenol red and 10% of phosphate-free Eagle's minimum essential medium, supplemented with 7.5 μg/ml insulin, 7.5 μg/ml transferrin and 7.5 ng/ml sodium selenite (ITS Liquid Media Supplement, Sigma-Aldrich Cat #13146)). Primary hippocampal neurons were used in live cell imaging, cell death experiments, while cortical neurons were used for mRNA and protein extraction analysis.

Recombinant Adeno-associated Viruses (rAAVs) and Constructs

[0100] All viral particles were produced and purified as known in the art. All TRPM4 derived peptides (comprising SEQ ID NO:5, or any of SEQ ID NO:46 to SEQ ID NO:56) were cloned into rAAV backbone by PCR. shRNA against mouse TRPM4 were designed by BLOCK-iT™ RNAi Designer from Thermofisher to target: ggacatcgcccaaagtgaact (SEQ ID NO:44, shTRPM4-1) and gcatccagagagggttcattc (SEQ ID NO:45, shTRPM4-2). Scramble shRNA (shSCR) has been tested and proven to have no known targets in mice. GPI anchor (LENGGTSLSEKTVLLLVTPFLAAAWSLHP, e.g. used in SEQ ID NO:53) sequences were synthesized by Eurofins Genomics (Ebersberg, Germany). All primers were synthesized and all plasmids were confirmed by sequencing by Eurofins Genomics.

Mitochondrial Imaging

[0101] Coverslips with primary cultured neurons (DIV15-DIV17) were used to examine mitochondrial membrane potential (Ψm) and mitochondrial calcium signalling, which was performed at room temperature in CO.sub.2-independent culture medium (CICM) containing: 10 mM HEPES, 140 mM NaCl, 2.5 mM KCl, 1.0 mM MgCl.sub.2, 2.0 mM CaCl.sub.2, 1.0 mM Glycine, 35.6 mM Glucose and 0.5 mM Na-pyruvate. All images were obtained by a cooled-CCD camera (iXon 887, Andor) on an upright microscope (BX51WI, Olympus). Fluorescence excitation was provided by a xenon arc lamp in combination with an excitation filter wheel (MT-20, Olympus). Data were collected using Cell{circumflex over ( )}R software (Olympus), analysed using ImageJ and quantified using Igor Pro (WaveMetrics). was detected with the small molecule fluorescence indicator Rhodamine 123 (Rh123; Molecular Probe™, R302). Primary cultured neurons were loaded with 4.3 μM Rh123 in CICM at 37° C. for 30 min, then washed and left in CICM for another 30 min before recording. At the end of each experiment, the mitochondrial uncoupler FCCP (5 μM, Sigma-Aldrich, Cat #C2920) was applied to the cells to reach the maximal Rh123 fluorescence intensity. Rh123 was imaged with 470±20 nm excitation and 525±25 nm emission wavelengths using a 20× objective. Rh123 fluorescence intensity was measured in the nucleus to minimize contamination from cytosolic mitochondrial signal and Rh123 fluorescence intensity was normalized to the maximum FCCP signal for each region of interest.

[0102] Gabazine induced mitochondrial Ca.sup.2+ response in primary cultured neurons is recorded and analysed as described in a previous study (Qiu et al, Nat Commun. 2013; 4:2034, incorporated herewith by reference) using a FRET calcium indicator 4mtD3cpv that specifically located to mitochondria. Briefly, mitochondrial Ca.sup.2+ levels were detected with FRET-based and mitochondrial targeted Ca.sup.2+ indicator 4mtD3cpv. 4mtD3cpv were excited at 430±12 nm (CFP) and 500±10 nm (YFP), and emission of CFP (470±12 nm) and YFP (535±15 nm) were separated and filtered using a DualView beam splitter (AHF Analysentechnik and MAG Biosystems), and all fluorescence images were recorded through a 20× water-immersion objective at 1 Hz.

Quantification and Statistics

[0103] All statistics work was performed by Prism (GraphPad). All plotted data represent Mean±s.d. Two-Way ANOVA analysis were used for statistical analyses unless otherwise indicated.

Reagents

[0104] Following reagents were used in this study MK-801 maleate (BN338, Biotrend). DL-APV (BN0858, Biotrend), NMDA (BN0385, Biotrend).

Example 2: Knockdown of TRPM4 Protects Neurons from NMDA Receptor-Mediated Toxicity

[0105] In order to investigate the role of TRPM4 in NMDA receptor mediated excitotoxicity, the inventors used RNA interference strategies to knock down TRPM4. Cultured primary mouse hippocampus neurons were infected on day 3 in vitro (DIV3) with recombinant adeno-associated viruses (rAAVs) providing for expression of a scramble control (shSCR), shTRPM4-1 (SEQ ID NO:44) or shTRPM4-2 (SEQ ID NO:45). On DIV15-16, neurons were challenged with N-methyl-D-aspartate (NMDA, 20 μM) for 10 min. After NMDA wash out, neurons were kept in the culture medium for another 24 h before analysis. Knockdown of TRPM4 by both shRNAs against TRPM4 significantly protected neurons from NMDA induced excitotoxicity. Evidently, TRPM4 is thus involved in the process of NMDA receptor mediated excitotoxicity.

Example 3: The N-Terminal Domain of Mouse TRPM4 Contains a Sequence which is Neuroprotective if Expressed in HEK293 Cells

[0106] In a next step, the inventors tried to identify regions in the mouse TRPM4 protein potentially involved in NMDA receptor mediated excitotoxicity. For this purpose, polypeptide fragments of mouse TRPM4 protein were generated and their impact on NMDA induced excitotoxicity analysed. To do so, primary neuron cultures were infected with respective rAAVs on DIV3, challenged with NMDA (20 μM) for 10 min on DIV17 and cell death assessed 24 hours later.

[0107] The first series of fragmentation experiments (comprising SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48 and SEQ ID NO:49, respectively) revealed, that the N-terminal domain of mouse TRPM4 (SEQ ID NO:47) contains a neuroprotective element, which can prevent NMDA receptor induced cell death, if expressed in hippocampal neurons. In a further series of fragmentation experiments of SEQ ID NO:47 conducted in analogous manner as set out above, the inventors narrowed down the amino acid motif conferring the neuroprotective effect. The polypeptides comprising the following fragments were tested: SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:5. As a result, only the most C-terminal part of the N-terminus of mouse TRPM4, aa 433-489, is surprisingly neuroprotective (SEQ ID NO:5), if expressed in hippocampal neurons.

Example 4: Addition of a Membrane Anchor Increases Neuroprotective Effect of the Peptide According to SEQ ID NO:5

[0108] The sequence of SEQ ID NO:5 in TRPM4 is located in vivo just beneath the plasma membrane. Therefore, the inventors reasoned that a near-membrane location of a polypeptide comprising SEQ ID NO:5 might increase the neuroprotective effect of said polypeptide. To test this hypothesis, the inventors created a fusion protein comprising SEQ ID NO:5 and a GPI anchor, SEQ ID NO:57. The sequence of the fusion is given in SEQ ID NO:53. Neurons infected with rAAV and expressing SEQ ID NO:47 (control) or SEQ ID NO:53 were exposed to NMDA (20 μM) for 10 min on DIV15-16, with cell death assessed after 24 h. As a result it was shown that a membrane-anchor like GPI can increase the ability to protect neurons from excitotoxicity.

Example 5: A Variant of the Sequence of SEQ ID NO:5 also Reduces NMDA Receptor-Mediated Cell Toxicity

[0109] In a next step, the inventors created a mutant of SEQ ID NO:5, in which two adjacent phenylalanine residues where substituted by tyrosine residues (SEQ ID NO: 54). Furthermore, the inventors also assessed whether a region corresponding to SEQ ID NO:5 in mouse TRPM5 would also provide a neuroprotective effect. TRPM5 is a protein related to but nonetheless distinct to TRPM4. The region in TRPM5 corresponding to SEQ ID NO:5, SEQ ID NO:55, shares only about 60% sequence identity with SEQ ID NO:5. Neurons were infected on DIV3 with rAAVs expressing SEQ ID NO: 5, SEQ ID NO: 54 or SEQ ID NO:55 and exposed to NMDA (20 μM) for 10 min on DIV17, with cell death assessed 24 h later. As a result it was shown that the conservative double mutation harbouring the two tyrosine residues was only slightly less effective in reducing NMDA receptor-mediated cell toxicity than SEQ ID NO:5, while the more distantly related TRPM5 sequence of SEQ ID NO: 55 did not reduce NMDA receptor-mediated cell toxicity.

Example 6: Exposure of Neurons to a Fusion Protein Comprising SEQ ID NO:5 Fused to a Protein Transduction Domain Protects Against NMDA Receptor-Mediated Cell Toxicity

[0110] In a further experiment, the inventors tested the fusion of SEQ ID NO:5 and protein transduction domain TAT (SEQ ID NO:42). The resulting fusion protein is referenced herein in SEQ ID NO:56. Cultured neurons were incubated with DMSO (vehicle), 1 μg SEQ ID NO:56 or 10 μg SEQ ID NO:56 for 1 h before exposed to NMDA (20 μM) for 10 min on DIV15-16, with cell death assessed 24 h later. As a result, the fusion protein according to SEQ ID NO:56 protected neurons from NMDA excitotoxicity.

Example 7: Viral Vector Mediated Expression of SEQ ID NO:5 in the Mouse Cortex Protects Against Middle Cerebral Artery Occlusion (MCAO)-Induced Brain Damage

[0111] Given the robust protective effect of SEQ ID NO:5 in cultured neurons, the inventors next analysed its neuroprotective potential in vivo using the middle cerebral artery occlusion (MCAO) mouse stroke model. This acute neurodegenerative disease was chosen because NMDA receptor-induced excitotoxicity contributes significantly to brain injury after induction of ischemic conditions. rAAVs containing expression cassettes for SEQ ID NO:5 were stereotactically delivered to the mouse cortex three weeks prior to MCAO and brain damage was quantified 7 days post-injury. The infarct volume of mice expressing SEQ ID NO:5 in the cortex was significantly smaller than that of the control mice injected intracerebrally with PBS.

Methods:

[0112] Stereotactic intracerebral injection to the cortex of mice: C57BL/6N male mice (8 weeks±5 days old) weighing 25±1 g were randomly grouped and anaesthetized with a mixture of Sedin©, Midazolam and Fentanyl®-Janssen and placed on a rodent stereotactic frame on a heat pad temperature controlled by a ATC1000 DC rectal thermometer (World Precision Instruments, Berlin). rAAV-SEQ ID NO:5) was infused into the left cortex (coordinates relative to Bregma: first site: AP 0.2 mm; ML 2.0; DV -2.0; second site: AP 0.2; ML 2.0; DV −1.8; third site: AP 0.2; ML 3.0; DV −4.0; forth site: AP 0.2; ML 3.0; DV −3.5.) using a Ultra Micro Pump III (World Precision Instruments, Berlin) to drive a 10 μl Nanofil syringe (World Precision Instruments, Berlin). A total volume of 2 μ1 containing 1-2×10.sup.9 genomic particles of rAAV was injected at a rate of 200 nl/min, after which the needle was left in place at each injection site for 2 minutes to prevent backflow before needle withdrawal. Control mice were injected with the same volume of PBS using the same method. After stereotactic injections, mice were allowed to recover from anaesthesia by subcutaneous application of a mixture with ATIPAZOLE, Flumazenil and Naloxon and were returned to their home cages when they were fully awaken. Three weeks after stereotactic delivery of rAAVs animals were subjected to middle cerebral artery occlusion (MCAO).

[0113] MCAO: Middle cerebral artery occlusion (MCAO) induced a permanent distal occlusion of the middle cerebral artery (MCA). C57BL/6N male mice (8 weeks±5 days old) were anesthetized by intraperitoneal injection of 500 μl Tribromethanol (250 mg/kg bodyweight) and placed in a recumbent position. The animals were allowed to breathe spontaneously and were not ventilated. An incision was made from the left eye to the ear. When the temporal muscle was removed by electrocoagulation, the left MCA was visible through the semitranslucent temporal surface of the skull. After a small burr hole was made in the temporal bone with dental drill, the inner layer of the skull was removed with fine forceps, and the dura mater was opened carefully to expose the MCA. Care was taken to avoid damage to the brain tissue. NaCl solution (0.9%) was present in the area surrounding the MCA. A microbipolar electrocoagulator ERBE ICC 200 (Erbe Elektromedizin GmbH, Tubingen) was used to permanently occlude the MCA. During surgical procedures, rectal temperature was maintained at 37±0.5° C. with an ATC1000 DC temperature-controlled heat plate (World Precision Instruments, Berlin). After the incision was closed, mice were allowed to recover from anesthesia and returned to their home cages where the temperature was maintained at 37° C. by placing the cage on a HT 50 S heat plate (Minitüb, Tiefenbach). In these conditions, animals were maintained homeothermic until fully recovery from anaesthesia. Sham-operated mice were subjected to identical procedures without the MCA occlusion. On day 7 after MCAO, animals were sacrificed under deep anaesthesia with Narcoren® and perfused intracardially with 20 ml NaCl solution (0.9%). The brains were removed from the skull and were immediately frozen on dry ice. Six consecutive 20 μm thick coronal cryo-sections were cut every 400 μm and subjected determination of total infarct volume using a standard silver staining technique. The silver stained sections were scanned at 1200 dpi and infarct area was measured by using ImageJ software (NIH Image). Surgery was performed and ischemic damage was measured by an investigator who had no knowledge of the treatment group, rAAV or recombinant protein was applied by stereotactic injection or intranasal delivery.

[0114] As a result, expression of a polypeptide comprising the sequence of SEQ ID NO:5 effectively reduced the infarct volumes, thereby protecting against middle cerebral artery occlusion (MCAO)-induced brain damage.

Example 8: The Peptide Comprising the Sequence of SEQ ID NO:5 and a Variant Thereof Protect Against NMDA Receptor Induced Mitochondrial Membrane Potential Break Down

[0115] Mitochondrial dysfunction is a hallmark of NMDA receptor excitotoxicity and an early event en-route to neuronal death. A parameter that is often used to assess mitochondrial integrity is the mitochondrial membrane potential. A breakdown of the mitochondrial membrane potential can be observed after exposure of hippocampal or cortical neurons to NMDA and indicates excitotoxicity-associated mitochondrial dysfunction. Therefore, the inventors investigated the effect of polypeptides comprising the sequence of SEQ ID NO:5 or SEQ ID NO: 54 as well as of the control TRMPS sequence (SEQ ID NO: 55) on mitochondrial membrane potential break down in primary mouse hippocampal neurons. Excitotoxicity leading to mitochondrial membrane potential break down was induced with bath application of 20 μM NMDA. After 11 minutes, the mitochondrial uncoupler, carbonylcyanide-p-trifluoromethoxyphenylhydrazone (FCCP) was added. Addition of FCCP leads to break-down of the mitochondrial membrane potential and served as a control of the test system.

[0116] As a result, polypeptides comprising the sequence of SEQ ID NO: 5 and SEQ ID NO: 54, respectively, were both capable of preventing NMDA receptor induced mitochondrial membrane potential breakdown, while the more distantly related TRPM5 sequence of SEQ ID NO: 55 was not capable of preventing NMDA receptor induced mitochondrial membrane potential breakdown.

Example 9: The Peptides According to SEQ ID NO:5 and SEQ ID NO: 54 Do Not Affect Synaptic NMDA Receptor Signaling

[0117] In a further experiment the inventors assessed the impact of the polypeptide comprising the sequence of SEQ ID NO:5 and SEQ ID NO: 54, respectively, on Gabazine induced calcium influx (mitochondria), a measure of synaptic NMDA receptor signalling. The experiment was carried out in primary cultured neurons as described above. As a result, neither the polypeptide comprising the sequence of SEQ ID NO:5 nor the polypeptide comprising the sequence of SEQ ID NO: 54 did interfere with Gabazine induced calcium influx into mitochondria, indicating that neither of these polypeptides affects synaptic NMDA receptor signalling.

Example 10: Virtual Screening for Compounds Potentially Binding to SEQ ID NO:5 in Mouse TRPM4

[0118] In a next step, the inventors tried to identify small molecule compounds capable of interacting with the above identified important domain of TRPM4 with the aim to identify compounds potentially capable of abrogating NMDA receptor-induced toxicity.

[0119] Protein Structure

[0120] The protein structure used for this work was the 2.88 Å cryo-electron microscopy structure of mouse TRPM4 deposited in the Protein Data Bank (PDB ID: 6BCO). An alternative would be a human structure, such as 5WP6, 6BQR, 6BQV etc.). Prior to other activities, the structure was subjected to the Maestro Protein Preparation Wizard (Schrodinger Release 2017-3: Maestro, Schrödinger, LLC, New York, N.Y., 2017) to remove potential artifacts, add hydrogen atoms, and assign residue protonation states according to a pH of 7.0. Following preparation, all atoms not belonging to the protein (e.g. ATP molecules) were removed.

[0121] Binding Site Definition

[0122] The region used for molecular docking was defined in 4 Å proximity to TRPM4 residues as considered relevant for protein activity (6BCO residues 633-650, 654, 655, 657, 664-668). See also amino acid residues 1 to 36 of SEQ ID NO:5.

[0123] Molecular Docking

[0124] Docking to the protein structure was performed with Schrödinger Glide (Schrodinger Release 2017-3: Glide, Schrödinger, LLC, New York, N.Y., 2017). Initial compounds were docked in high-throughput virtual screening (HTVS) mode. Hits from HTVS (docking score of −5 kcal/mol or better required) were passed on to the more accurate and computationally expensive SP docking mode. SP hits with docking scores of −6 kcal/mol or better were subjected to a ligand strain calculation (energy difference between the pose and a minimum-energy solution conformation) with the OPLS3 force-field. Strains below 7 kcal/mol were generally desired with the exception of molecules with a large amount of rotatable bonds. Final compound selection was done on basis of docking scores, strain values, and visual inspection of the docked pose. Corresponding images were generated with the PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC.

[0125] Results

[0126] The screen yielded the following promising compounds:

TABLE-US-00002 TABLE 2 Promising candidate compounds obtained from docking Internal Docking score strain # Compound [kcal/mol] [kcal/mol] P4 [00008] −7.05 0.03 P8 [00009] −6.78 3.52 P9 [00010] −6.76 5.53 P13 [00011] −6.66 3.05 P15 [00012] −6.62 4.46

Example 11: Small Molecules According to the Present Invention Protect Against NMDA Receptor Induced Cell Toxicity

[0127] In this experiment the following compounds where tested for their suitability to protect HEK293 cells against NMDA receptor induced cytotoxicity:

TABLE-US-00003 # Compound P4 [00013] P8 [00014] P9 [00015] P13 [00016] P15 [00017] [00018]

[0128] The experiment was carried out as described above. As a result, compounds P4, P8, P9, P13, and P15 reduced the level of NMDA receptor induced cell death. Glibenclamide is a known blocker of TRPM4 function and served as a positive control. The effect observed with these substances confirms the utility of virtual screening for identifying suitable candidate compounds for inhibiting NMDA receptor-mediated cell toxicity and the importance of the inventive TRPM4 motif for NMDA receptor-mediated cell toxicity.

Example 12: Further Small Molecules According to the Present Invention

[0129] In view of the results obtained for compound P4 of example 11 above, the following additional nine variants thereof have been tested as essentially described above:

##STR00019##

[0130] The experiment was carried out as described above. Briefly, neurons were pre-treated for 30 min with 10 μM of the indicated compound and then challenged with NMDA (20 μM) for 10 min (transient NMDA toxicity) or with NMDA (20 μM) for 24 hours (chronic NMDA toxicity). Cell death was assessed 24 hours after the NMDA challenge. For assessment of cell death, neurons were fixed with 4% paraformaldehyde, 4% sucrose in phosphate buffered saline (PBS) for 15 min, washed with PBS, and counterstained with Hoechst 33258 (1 μg/ml) for 10 min. The cells were mounted in Mowiol 4-88 and examined by fluorescence microscopy. The dead neurons were identified by amorphous or shrunken nuclei. As a result, the variants of compound P4, i.e. compounds P401 to P409, reduced the level of NMDA receptor induced cell death.

Example 13: NMDA Receptor-Mediated Toxicity in TRPM4 Knock-Out HEK293 Cells

[0131] In a further experiment, the impact of a TRPM4 knock-out on NMDA receptor-mediated toxicity in HEK293 cells is was assessed. Briefly, HEK293 cells (both wild type line and TRPM4 knock-out line) (Ozhathil et al., British Journal of Pharmacology 175, 2504-2519) were cultured in Dulbecco's Modified Eagle Medium (DMEM, Gibco™, 41965-039) supplement with 10% Fetal Bovine Serum (FBS, Gibco™, 10270), 1% Sodium Pyruvate (Gibco™, 11360070), 1% MEM NEAA (Gibco™, 11140035) and 0.5% Penicillin-Streptomycin (P-S; Sigma, P0781) and Passage 15-25 were used for experiments. To test the cytotoxicity of compounds according to the present invention, HEK293 cells (70-80% confluent) were transfected 24 hours after plating with both GRIN1 and GRIN2A or GRIN2B, respectively (1:1, 0.2 mg/cm2) with Lipofectamine 2000 according to manufacturer's instructions. The relative number of dead cells in the population at the indicated time points after transfection was measured with the CytoTox-Glo™ Cytotoxicity assay (Promega, G9290) according to manufacturer's instruction with minor modification. Briefly, 10% of total medium were mixed with 10 μL AAF-amino luciferin to reach a final volume at 200 μL with water, the dead cell relative luminescence units (DRLU) was measured by GloMax (Promega) in a 96 well white bottom polystyrene microplate (Corning Costar®, 3912). After all the measurements, lysis reagents have been added to the cells and 10% of lysate was used for the total cell relative luminescence units (TRLU) measurement. Cell death was calculated by the following equations:

[00002]$\mathrm{Cell}\mathrm{death}\left(\%\right)=\frac{10*DRLU}{10*TRLU+DRLU}*100$

[0132] As a result NMDA receptor-mediated toxicity was much reduced in the TRPM4 knock-out HEK293 cells as compared to wild type HEK293 cells. This aligns with the results reported in Example 2.

Example 14: Impact of Compound P4 and P15 on NMDA-Induced Calcium Transients

[0133] In a further experiment, the impact of P4 and P15 on NMDA-induced calcium transients was assessed. Briefly, for calcium imaging, primary hippocampal neurons on coverslips were loaded with the cell-permeable, high-affinity ratiometric calcium indicator Fura2-AM (Invitrogen™ F1221), at 1 μM in CO.sub.2-independent culture medium (CICM; CICM contains: 10 mM HEPES, 140 mM NaCl, 2.5 mM KCl, 1.0 mM MgCl.sub.2, 2.0 mM CaCl.sub.2, 1.0 mM Glycine, 35.6 mM Glucose and 0.5 mM Na-pyruvate) for 30 min at 37° C., then washed and left in CICM for another 30 min to allow for de-esterification. Fura2 was excited at 340/11 nm and 380/11 nm, and fluorescence emission was obtained from a 40× UV compatible objective (LUMPLFLN, Olympus) through a 510/20 nm emission filter. For quantification, ImageJ was used to calculate average background-subtracted fluorescence intensities for 340 and 380 nm excitation (F.sub.340 and F.sub.380) from each neuron. Intracellular calcium levels were plotted as F.sub.340/F.sub.380 ratios over time, from which the NMDA response amplitude and area under the curve (AUC) was calculated to quantify NMDA-induced calcium influx.

[0134] Strikingly, unlike the classical NMDA receptor blocker, MK-801, which completely blocked NMDA-induced calcium transients, neither compound P4 nor compound P15 reduced NMDA-induced calcium transients in hippocampal neurons. Thus, P4 and P15 block NMDA receptor excitotoxicity, but without compromising NMDA receptor calcium channel function, which is essential for the physiological role of NMDA receptors in synapse-to-nucleus signaling, gene regulation, and cognitive functions, including learning and memory.

Example 15: Impact of Compound P4 on NMDA Receptor/TRPM4 Complex Immunoprecipitation

[0135] In a further experiment it was assessed whether compound P4 has any impact on NMDA receptor/TRPM4 complex formation. For this purpose, co-immunoprecipitation experiments using brain lysates from the mouse cortex where carried out. Briefly, cortical lysates were obtained from control mice and from mice 2 h, 6 h and 24 h following intraperitoneal injection of compound P4 (40 mg/kg) in immunoprecipitation buffer (10 mM Tris, pH 8.0, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 10% glycerol with Protease Inhibitor Cocktail, Roche) for 60 min. The lysate was then centrifuged for 12 min at 1200 g to remove cell debris and nuclei. The mixture of supernatant was incubated with anti-TRPM4 antibodies overnight. Pierce™ Protein A Magnetic Beads were added to the mixture and mixed another 12 h, followed by 3 washes with immunoprecipitation buffer. The precipitates were subsequently boiled in protein loading buffer and separated in 7.5% SDS-PAGE.

[0136] The inventors found a reduction in NMDA receptor/TRPM4 complex formation of 51% at 2 h and 61% at 6 h after a single intraperitoneal (i.p.) injection of 40 mg/kg of compound P4. 24 h after i.p. injection of compound P4 the NMDA receptor/TRPM4 complex had reformed.

Example 16: Impact of Compound P4 on NMDA-Induced Degeneration of Retinal Ganglion Cells (RGCs)

[0137] The inventors also assessed, whether compound P4 can protect retinal ganglion cells against NMDA-induced degeneration. For this purpose, 28 C57BL/6J mice (25±3.5 g) were randomly allocated to two groups. All mice received vehicle (sunflower oil containing 5% ethanol) or P4 (40 mg/kg, dissolved in sunflower oil containing 5% ethanol) through intraperitoneal injection at −16 h, −3 h, 0 h, +3 h and +24 h in a volume of 50 μL each injection. At 0 h, mice received 20 nmol of NMDA (total volume 2.0 μL) by intravitreal injection in the left eye and saline (total volume 2.0 μL) in the right eye. Both eyes were removed from euthanized mice 7 days after intravitreal injections and fixed in formalin for 15 min before retinas were dissected and processed for whole mount immunostaining. Retinas were incubated in blocking solution (10% FBS, 1% Triton-X 100 in PBS) for 6 h, followed by 24 h incubation with anti-Brn3a antibody in blocking solution at 4 □. Retinas were washed 3 times with PBS and incubated with Donkey anti-rabbit Alexa Fluor-594 for 24 h at room temperature. Retinas were washed again, cut and mounted onto slides. For each retina, images were obtained from eight fields (554 μm×554 μm) around the peripheral retina (two from each quadrant and located at ˜600 μm or ˜1400 μm to macular hole) to minimize the location-associated variability in RGCs density. All images were obtained using Las X software via an HC PL APO 20× objective on a Leica TCS SP8LIA in a DM6 CFS upright confocal microscope. Brn3a-positive cells were identified and counted with a macro in Cellprofiler. The data analysis was performed on a single-blind basis without knowledge of treatment.

[0138] The inventors found that compound P4 reduced retinal ganglion cell (RGC) degeneration after intravitreal injection of mice with NMDA (20 nmol).

Example 17: Impact of Compound P4 and Compound P15 on TRPM4 Channel Function

[0139] To assess any direct impact of compound P4 and compound P15 on TRPM4 channel function independent of NMDA receptors, the inventors used the prostate cancer cell line PC3 and patch clamp recordings. PC3 cells are known to express TRPM4 channels (C. Holzmann et al., Oncotarget. 6, 41783-93 (2015)). TRPM4 currents in turn are characterized by their calcium dependence and outward rectification (P. Launay et al., Cell. 109, 397-407 (2002)). Briefly, whole-cell patch clamp recordings were made from PC3 cells plated on 12 mm round coverslips secured with a platinum ring in a recording chamber (OAC-1, Science Products GmbH) mounted on a fixed-stage upright microscope (BX51WI, Olympus). Coverslips were submerged with continuously flowing (3 ml/min) 32-35° C. extracellular solution (in mM: NaCl, 156; MgCl.sub.2, 2; CaCl.sub.2, 1.5; HEPES, 10; glucose, 10). Patch electrodes (3-4 MΩ) were made from 1.5 mm borosilicate glass and filled with cesium-based solutions (in mM: CsCl, 145; NaCl, 8; HEPES, 10; MgCl.sub.2, 1; plus either EGTA, 0.2 for a free Ca.sup.2+ concentration of zero; or EGTA, 10 and CaCl.sub.2, 9.4 for a calculated free Ca.sup.2+ concentration of 10 ρM; Maxchelator, Stanford University). Recordings were made with a Multiclamp 700B amplifier, digitized through a Digidata 1550B and acquired and analyzed using pClamp 10 software (Molecular Devices). Access resistance (range: 10-20 MΩ) was monitored regularly during voltage clamp recordings and data was rejected if changes greater than 20% occurred.

[0140] As a result, 10 μM Ca.sup.2+ activated a TRPM4-like outwardly rectifying current in PC3 cells and this current was not affected by P4 or P15. Thus, neither P4 nor P15 compromises TRPM4 channel function per se.