BARLEY STRIPE MOSAIC VIRUS-BASED GENE EDITING VECTOR SYSTEM

20210348176 · 2021-11-11

    Inventors

    Cpc classification

    International classification

    Abstract

    A Barley stripe mosaic virus-based gene editing vector system, comprising artificial plasmids separately containing Barley stripe mosaic virus RNAα, RNAβ, and RNAγ. The required sgRNA sequence is integrated in RNAβ or RNAγ. The Barley stripe mosaic virus-based gene editing vector system can perform efficient gene editing on genomes of dicotyledons such as Nicotiana benthamiana and monocotyledons such as wheat and maize. Using the gene editing vector system, users can directly obtain wheat seeds harboring targeted gene editing events simply by inoculating the Cas9-transgenic wheat, and the edited target gene is transmitted to progeny plants through the seeds, without the need for transformation, tissue culture and regeneration process

    Claims

    1. A Barley stripe mosaic virus-based gene editing vector system, comprising artificial plasmids separately containing Barley stripe mosaic virus RNAα, RNAβ, and RNAγ, wherein a required sgRNA sequence is integrated into RNAβ or RNAγ.

    2. The gene editing vector system according to claim 1, wherein the required sgRNA sequence is integrated at 5′ end or 3′ end of γb in RNAγ or at a middle part of the coding sequence of coat protein CP in RNAβ.

    3. The gene editing vector system according to claim 2, wherein sgRNA expression scaffold together with upstream and downstream sequences are subjected to insertion or substitution in the region between 74 bp and 435 bp of the coat protein CP coding sequence.

    4. The gene editing vector system according to claim 1, wherein the artificial plasmids contain a HDVRz ribozyme.

    5. The gene editing vector system according to claim 4, wherein the artificial plasmids include, but are not limited to pCB301 or pCass4-Rz.

    6. The gene editing vector system according to claim 1, wherein, the gene editing vector system can directly obtain wheat seeds harboring targeted gene editing events by inoculating the Cas9-transgenic wheat, and the edited target gene is transmitted to progeny plants through the seeds, without the need for transformation, tissue culture and regeneration process.

    7. A method for gene editing of plants, wherein the gene editing vector system according to claim 1 is used for gene editing.

    8. The method according to claim 7, wherein the plants are monocotyledons or dicotyledons.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0045] FIG. 1 is a schematic diagram of the β-CP-Tgcas-gNbPDS4 vector described in Example 1.

    [0046] FIG. 2 is a schematic diagram of the γ-gRNA-gNbPDS4 vector described in Example 2.

    [0047] FIG. 3 is a schematic diagram of the cDNA structure of BSMV RNAγ contained in the pT7-ge-BSγ-SmR-TaGASR7-T1 in Example 3.

    [0048] FIG. 4 is a diagram showing the result of enzymatic digestion of the NbPDS544 fragment in Experimental Example 1.

    [0049] FIG. 5 is a diagram showing the sequencing results of the NbPDS544 fragment cloned into the T-vector in Experimental Example 1.

    [0050] FIG. 6 is a diagram showing the result of enzymatic digestion of the NbPDS544 fragment in Experimental Example 1.

    [0051] FIG. 7 is a diagram showing the sequencing result of the NbPDS544 fragment cloned into the T-vector in Experimental Example 1.

    [0052] FIG. 8 is a diagram showing the results of enzymatic digestion of the TaGASR7-A1, TaGASR7-B1, and TaGASR7-D1 fragments in Experimental Example 2.

    [0053] FIG. 9 is a diagram showing the sequencing results of the TaGASR7-A1, TaGASR7-B1, and TaGASR7-D1 fragments cloned into the T-vector in Experimental Example 2.

    [0054] FIG. 10 is a diagram showing the results of enzymatic digestion of the ZmTMS5-994 fragment in Experimental Example 2.

    [0055] FIG. 11 is a diagram showing the sequencing results of the ZmTMS5-994 cloned into the T-vector in Experimental Example 2.

    [0056] FIG. 12 is a diagram showing the results of enzymatic digestion of the TaGASR7-A1, TaGASR7-B1, and TaGASR7-D1 fragments and the corresponding sequencing results in Experimental Example 3.

    [0057] FIG. 13 is a diagram showing the results of enzymatic digestion of the TaGASR7-A1, TaGASR7-B1, and TaGASR7-D1 fragments in Experimental Example 3.

    [0058] FIG. 14 is a diagram showing the sequencing results of the TaGASR7-A1, TaGASR7-B1, and TaGASR7-D1 fragments that cloned into the T-vector in Experimental Example 3.

    SPECIFIC MODES FOR CARRYING OUT THE EMBODIMENTS

    [0059] In the following, the present invention will be further explained in conjunction with Examples. It should be understood that the following Examples are given for illustrative purposes only, and are not intended to limit the scope of the present invention. A person skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

    [0060] The experimental methods used in the following Examples are conventional methods unless otherwise specified.

    [0061] The materials and reagents used in the following Examples can be obtained from commercial sources unless otherwise specified.

    Example 1

    [0062] In this Example, the Nicotiana benthamiana PDS (NbPDS) gene was used as a target gene to illustrate the construction and application of a Barley stripe mosaic virus-based gene editing vector system.

    [0063] I. Construction

    [0064] 1. Three genomic RNAs of the Barley stripe mosaic virus were cloned into pCB301 vector through the StuI and BamHI restriction sites, and the products were called pCB301-BSMVα, pCB301-BSMVβ and pCB301-BSMVγ, respectively.

    [0065] 2. The sgRNA sequence contains at least two parts, the first part is the so-called spacer part at the 5′ end of the sequence, the length of which is about 20 bp, and the other part is the so-called sgRNA scaffold part. The scaffold part was synthesized and cloned into the pENTR4-gRNA7 vector by GENEWIZ Company.

    [0066] 3. Primers F1 and R1 were designed and synthesized by Invitrogen Company. The sequences of the primers were as follows:

    TABLE-US-00001 F1: ATACACAAGTTGTGGTGCAAgagaccGAATTCggtctcAGTTTTAGA GCTAGAAATAGC; R1: ATGGGTTAGTTGTGGCAAAAAAAGCACCGACTCGGTGCCAC.

    [0067] With the above pENTR4-gRNA7 vector as a template, the above F1 and R1 primers were used to amplify the sgRNA scaffold part, two BsaI restriction sites were added at upstream of the scaffold, for later insertion of the spacer part through the BsaI site, and 7 thymin nucleotides (T) were added to the downstream of the scaffold in the meanwhile, both ends of the amplified product also contained a sequence homologous to the Barley stripe mosaic virus vector for homologous recombination cloning, respectively, and the product was called the sgRNA expression scaffold.

    [0068] 4. Primers F2 and R2 were designed and synthesized by Invitrogen Company. The sequences of the primers were as follows:

    TABLE-US-00002 F2: GCCACAACTAACCCATCTCC; R2: CCACAACTTGTGTATCCCATTG.

    [0069] With the pCB301-BSMVβ as a template, the primers F2 and R2 were used to perform inverse PCR to linearize the pCB301-BSMVβ, the 74-393 nucleotide sequence of the CP open reading frame was deleted, and the obtained product was called β-CP.sub.Δ74-393.

    [0070] 5. The sgRNA expression scaffold obtained by PCR amplification and the linearized β-CP.sub.Δ74-393 were subjected for recombination reaction with the 2× Master Assembly Mix from Taihe Biotechnology Company. In the obtained product, the 74-393 nucleotide sequence of the BSMV CP was substituted with the sgRNA expression scaffold together with the upstream and downstream sequences (the total length of the CP was 597 bp. Experiments had shown that the 74-435 nucleotides of the CP were deleted, without affecting the movement of the virus, but when designing this gene editing vector, it was preferable to delete the 74-393 nucleotide sequence of the CP and insert the sgRNA expression scaffold therein). The product was called β-CP-gsca.

    [0071] 6. Primers F3 and R3 were designed and synthesized by Invitrogen Company. The sequences of the primers were as follows:

    TABLE-US-00003 F3: ATGGGATACACAAGTTGTGGGGTGCTTGATGCTTTGGATAAG; R3: ccGAATTCggtctcTTGCAACCACAGTAAGTACTTGTAGTTAAG.

    [0072] With the pCB301-BSMVγ as a template, the primers F3 and R3 were used to amplify a fragment with a length of 316 bp. This fragment contains a 277 bp subgenomic promoter of the RNAγ subgenome (the γb protein was translated from the subgenomic RNA of RNAγ. The 277 bp subgenomic promoter amplified by us actually covered the core promoter of the sgRNAγ, and a certain length of extension was made at both upstream and downstream thereof. Therefore, the length of this sequence of 277 bp was not absolute), and the product was called sgγP277.

    [0073] 7. Primers F4 and R4 were designed and synthesized by Invitrogen Company. The sequences of the primers were as follows:

    TABLE-US-00004 F4: TGCAAGAGACCGAATTCGGTC; R4: CCACAACTTGTGTATCCCATTG.

    [0074] With the β-CP-gsca as a template, the above primers were used to perform inverse PCR to linearize the β-CP-gsca, and the product was called linearized β-CP-gsca.

    [0075] 8. The above-mentioned sgγP277 and the above-mentioned linearized β-CP-gsca were subjected to recombination reaction with the 2× Master Assembly Mix from Taihe Biotechnology Company, so as to clone the sgγP277 into β-CP-gsca, and the obtained product was called β-CP-gcas.

    [0076] 9. Primers F5 and R5 were designed and synthesized by Invitrogen Company. The sequences of the primers were as follows:

    TABLE-US-00005 F5: AGAGACCGAATTCGGTCTCAG; R5: ACATCAGGACCTAGAGTTCACC.

    [0077] With the above β-CP-gcas as a template, the above F5 and R5 primers were used to perform inverse PCR, to delete a sequence with a length of 85 bp from the 3′ end of the sgγP277. After treating with a T4 Polynucleotide Kinase (T4 PNK) and ligating with a T4 ligase, a product called β-CP-Tgcas was obtained.

    [0078] 10. Primers F6 and R6 were designed and synthesized by Invitrogen Company. The sequences of the primers were as follows:

    TABLE-US-00006 F6: GACTCCATGGTTTTAGAGCTAGAAATAGCAAG; R6: GCTACTACCAAACATCAGGACCTAGAGTTC.

    [0079] With the above β-CP-Tgcas as a template, the above primers were used to perform inverse PCR, and self-ligation was performed after treating with T4 PNK provided by NEB Company, so as to cyclize the PCR product. The product was called BSMV β-CP-Tgcas-gNbPDS4 (also referred to as β-CP-Tgcas-gNbPDS4).

    [0080] The BSMV β-CP-Tgcas-gNbPDS4 already contained a spacer of 20 bp, wherein a NcoI restriction site was contained, thus inserting a complete sgRNA sequence and a subgenomic promoter of the subgenomic RNAγ with a length of 277 bp into the pCB301-BSMVβ. The structure of the obtained BSMV VMGE vector is shown in FIG. 1.

    [0081] The BSMV β-CP-Tgcas-gNbPDS4 was designed for the PDS (phytoene desaturase) gene of Nicotiana benthamiana, and therefore, the 20 bp spacer was homologous to the PDS gene. The spacer itself can be substituted as needed, and its length can also be adjusted. In addition, other methods can also be used to obtain the same cloned product.

    [0082] II. Application

    [0083] 1. Preparation of experimental reagents for Agrobacterium-mediated transient expression

    [0084] For reagents preparation and inoculation methods, please refer to Li Zhenggang's doctoral dissertation (Functional analysis of Barley stripe mosaic virus TGB1 protein in nuclear-cytoplasmic trafficking and hijacking of the nucleolar protein fibrillarin, Li Zhenggang, Doctoral Dissertation, China Agricultural University, 2017).

    [0085] The reagents used include: 1 M MES (Morpholineethanesulfonic acid), 50 mM As (Acetosyringone) and 1 M MgCl.sub.2. They were diluted to a final concentration of 10 mM MES, 10 mM MgCl.sub.2 and 150 μM As to obtain the Infiltration Buffer.

    [0086] 2. Agrobacterium-mediated infiltration (Agroinfiltration) method was used to inoculate Nicotiana benthamiana plants:

    [0087] The pCB301-BSMVα, BSMVβ-CP-Tgcas-gNbPDS4, pCB301-BSMVγ and pHSE401 were transformed into Agrobacterium strain EHA105, respectively. Single colonies were picked and grown overnight in the LB liquid medium harboring antibiotics at 28° C. with constant shaking. Centrifuge was performed at 4000 rpm for 10 min, the supernatant was discarded, and the Infiltration Buffer was used to resuspend the cells in the pellet. The OD.sub.600 of the suspension was measured with a UV spectrophotometer, and adjusted to OD.sub.600 of 0.3 for the BSMV VMGE vector harboring Agrobacterium and OD.sub.600 of 0.5 for the Agrobacterium transformed with pHSE401, using the Infiltration Buffer and mix well. The Agrobacterium mixture was incubated in a 28° C. incubator for 2 to 4 h, and infiltrated into the Nicotiana benthamiana leaves of 4 to 6 weeks old with a sterilized needleless syringe.

    Example 2

    [0088] In this Example, the Nicotiana benthamiana PDS gene was used as the target gene to illustrate the construction and application of a BSMV-based gene editing vector system.

    [0089] I. Construction

    [0090] The templates involved in the following steps were related to Example 1. The specific steps were as follows:

    [0091] 1. Primers F7 and R7 were designed and synthesized by Invitrogen Company. The sequences of the primers were as follows:

    TABLE-US-00007 F7: AAAAAAAAAAAAATGTTTGATCAGATCATTCAAATCTGATGGTGCCC ATC; R7: TTACTTAGAAACGGAAGAAGAATCATCACATCCAACAGAAT.

    [0092] With the above-mentioned pCB301-BSMVγ as a template, the primers F7 and R7 were used to linearize the pCB301-BSMVγ by inverse PCR, and the obtained product was called linearized pCB301-BSMVγ.

    [0093] 2. Primers F8 and R8 were designed and synthesized by Invitrogen Company. The sequences of the primers were as follows:

    TABLE-US-00008 F8: TCTTCTTCCGTTTCTAAGTAAGGTGCTTGATGCTTTGGATAAGGC; R8: GAATGATCTGATCAAACATTTTTTTTTTTTTAAAAAAAGCACCGACT CGGTGCC.

    [0094] With the above-mentioned β-CP-gcas as a template, the primers F8 and R8 were used to perform PCR, the amplified product contained a complete sgRNA scaffold and also contained two oppositely arranged BsaI restriction sites. The obtained product was called sgRNA-cas.

    [0095] 3. The above-mentioned linearized pCB301-BSMVγ and the sgRNA-cas were subjected to recombination reaction with the 2× Master Assembly Mix from Taihe Biotechnology Company, and the obtained product was called γ-gcas.

    [0096] 4. Primers F9 and R9 were designed and synthesized by Invitrogen Company. The sequences of the primers were as follows:

    TABLE-US-00009 F9: GACTCCATGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC; R9: GCTACTACCAATTACTTAGAAACGGAAGAAGAATCATCACATC.

    [0097] After the primers F9 and R9 were used to perform inverse PCR with the above-mentioned γ-gcas as a template, the product was subjected to treatment with a T4 PNK enzyme and then ligated with T4 ligase, after which the above-mentioned sgγP277 sequence was removed while the complete sgRNA sequence was maintained in the product. The 20 bp spacer contained in the obtained product was homologous to the Nicotiana benthamiana PDS gene. The obtained product was called pCB301-BSMV γ-gRNA-gNbPDS4 (also referred to as γ-gRNA-gNbPDS4). The structure of the obtained gene editing vector was shown in FIG. 2.

    [0098] For other gene targets, F9 and R9 can be designed according to needs to substitute the spacer with a required sequence, so as to be used to edit different genes and different targets.

    [0099] II. Application

    [0100] Agrobacterium-mediated infiltration method was used to inoculate Nicotiana benthamiana:

    [0101] The pCB301-BSMVα, pCB301-BSMVβ and pCB301-BSMVγ-gRNA-gNbPDS4 were transformed into Agrobacterium strain EHA105. Single colonies were picked and grown overnight in the LB liquid medium harboring antibiotics at 28° C. with constant shaking. Centrifuge was performed at 4,000 rpm for 10 min, the supernatant was discarded, and the Infiltration Buffer was used to resuspend the cells in the pellet. The OD.sub.600 of the suspension was measured with a UV spectrophotometer, and adjusted to OD.sub.600 of 0.3 for the Agrobacterium harboring BSMV VMGE vector and OD.sub.600 of 0.5 for the Agrobacterium containing with pHSE401 using the Infiltration Buffer and mix well. The Agrobacterium mixture was incubated at room temperature for 2 to 4 h followed by infiltration into the Nicotiana benthamiana leaves of 4 to 6 weeks old with a sterilized needleless syringe.

    Experimental Example 1

    [0102] This Experimental Example is used to illustrate the editing effect of Example 1 (due to the integration of sgRNA in the vector containing the RNAβ, using the characteristic vector β-CP-Tgcas-gNbPDS4 in the Figures and hereinafter of Example 1 to represents the complete vector system, i.e. the pCB301-BSMVα, BSMVβ-CP-Tgcas-gNbPDS4, pCB301-BSMVγ) and Example 2 (due to the integration of sgRNA in the vector containing the RNAγ, using the characteristic vector γ-gRNA-gNbPDS4 in the Figures and hereinafter of Example 2 to represents the complete vector system, i.e. the pCB301-BSMVα, pCB301-BSMVβ and pCB301-BSMVγ-gRNA-gNbPDS4) to the target gene (Nicotiana benthamiana PDS gene).

    [0103] The BSMV gene editing vector was inoculated by Agrobacterium-mediated infiltration and the Cas9 protein was also transiently expressed by Agrobacterium-mediated infiltration, with a concentration of the OD.sub.600=0.3 for β-CP-Tgcas-gNbPDS4 or γ-gRNA-gNbPDS4 vectors, and a concentration of the OD.sub.600=0.5 for the Cas9 protein expression vector pHSE401. At 4 and 7 days post inoculation (dpi), genomic DNA from the inoculated leaves was extracted with the CTAB method, and the extracted genomic DNA was used as a template to amplify a 544 bp DNA fragment that containing the target site, which harboring a NcoI restriction site, the product was called NbPDS544. After NcoI digestion, results of gel-electrophoresis showed that, compared with the NbPDS544 product amplified from the DNA extracted from healthy leaves, the digested products showed that a NcoI-resistant band was present in the samples for both the ge-BSMVβ-gNbPDS and the ge-BSMVγ-gNbPDS-infiltrated leaves, suggesting that mutations occurred at the target sites (as shown in FIG. 4).

    [0104] The NcoI-digested NbPDS544 was then ligated into a T-vector for sequencing. It can be seen that different types of mutations occurred at the target sites, including base insertions, base deletions, and base substitutions, which confirmed that targeted gene editing indeed occurred at the target sites, and these mutations were not present in the control group (as shown in FIG. 5).

    [0105] The gene editing results of β-CP-Tgcas-gNbPDS4 and γ-gRNA-gNbPDS4 on the target gene (Nicotiana benthamiana PDS gene) in the systemic leaf are shown in FIG. 8. Nicotiana benthamiana was inoculated with the wild-type BSMV or the BSMV-based VMGE vectors containing β-CP-Tgcas-gNbPDS4 and γ-gRNA-gNbPDS4, respectively. After systemic infection, the Cas9 protein was transiently expressed in the systemic leaves via Agrobacterium-mediated infiltration. Three days later, genomic DNA of the infected systemic leaves transiently expressing the Cas9 protein was extracted by the CTAB method, and the extracted genomic DNA was used as a template to amplify a 544 bp DNA fragment that containing the target site, which harboring a NcoI restriction site, and the product was called NbPDS544. After NcoI digestion, results of gel-electrophoresis showed that, compared with the NbPDS544 product amplified from the DNA templated that extracted from the healthy leaves and the wild type BSMV-infected leaves, the digested products showed that a NcoI-resistant band was present in the samples for both the ge-BSMVβ-gNbPDS and the ge-BSMVγ-gNbPDS-infected systemic leaves, suggesting that targeted gene editing occurred at the target sites (as shown in FIG. 6).

    [0106] The NbPDS544 fragment amplified from the systemic leaves was then ligated into a T-vector for sequencing. It can be seen that different types of mutations occurred at the target sites, including base insertions, base deletions, and base substitutions, which confirmed that targeted gene editing indeed occurred at the target sites, and these mutations were not present in the control groups (as shown in FIG. 7).

    Example 3

    [0107] In this example, wheat TaGASR7 gene and maize ZmTMS5 gene were used as target genes to illustrate the construction of a BSMV-based VMGE vector system and its application in wheat and maize.

    [0108] I. Construction

    [0109] To inoculate wheat and maize, in vitro transcripts of the BSMV VMGE vectors were used to rub-inoculate the of the leaves. The basic vectors involved include pT7-α.sub.ND, pT7-β.sub.ND, and pT7-γ.sub.ND (Petty, I. T. D., Hunter, B. G., Wei, N. & Jackson, A. O. (1989). Infectious Barley stripe mosaic virus RNA transcribed in vitro from full-length genomic cDNA clones. Virology, 171, 342-349) provided by Professor Andrew O. Jackson and the pT7-β.sub.G404E vector which is obtained by mutating amino acid G (glycine) at position 404 of TGB1 in pT7-β.sub.ND into amino acid E (glutamic acid).

    [0110] 1. Primers F10 and R10 were designed and synthesized by Invitrogen Company. The sequences of the primers were as follows:

    TABLE-US-00010 F10: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC; R10: TTACTTAGAAACGGAAGAAGAATCATCACATCC.

    [0111] With the above-mentioned pCB301-BSMVγ-gRNA-gNbPDS4 as a template and F10 and R10 as primers, high-fidelity PCR amplification was performed, and the obtained product was called linearized pCB301-ge-BSγ.

    [0112] 2. A double-stranded DNA fragment called SmR861 with a length of 861 bp was synthesized. This fragment contains two Sap I restriction sites arranged in opposite directions. The 5′.fwdarw.3′ sequence of this DNA fragment is as follows:

    TABLE-US-00011 GGATGTGATGATTCTTCTTCCGTTTCTAAGTAACGAAGAGCatgggggaag cggtgatcgccgaagtatcgactcaactatcagaggtagttggcgtcatcg agcgccatctcgaaccgacgttgctggccgtacatttgtacggctccgcag tggatggcggcctgaagccacacagtgatattgatttgctggttacggtga ccgtaaggcttgatgaaacaacgcggcgagctttgatcaacgaccttttgg aaacttcggcttcccctggagagagcgagattctccgcgctgtagaagtca ccattgttgtgcacgacgacatcattccgtggcgttatccagctaagcgcg aactgcaatttggagaatggcagcgcaatgacattcttgcaggtatcttcg agccagccacgatcgacattgatctggctatcttgctgacaaaagcaagag aacatagcgttgccttggtaggtccagcggcggaggaactctttgatccgg ttcctgaacaggatctatttgaggcgctaaatgaaaccttaacgctatgga actcgccgcccgactgggctggcgatgagcgaaatgtagtgcttacgttgt cccgcatttggtacagcgcagtaaccggcaaaatcgcgccgaaggatgtcg ctgccgactgggcaatggagcgcctgccggcccagtatcagcccgtcatac ttgaagctagacaggcttatcttggacaagaagaagatcgcttggcctcgc gcgcagatcagttggaagaatttgtccactacgtgaaaggcgagatcacca aggtagtcggcaaataaGCTCTTCGGTTTTAGAGCTAGAAATAGC.

    [0113] 3. The linearized pCB301-ge-BSMVγ and the SmR861 were subjected to recombination reaction with the 2× Master Assembly Mix from Taihe Biotechnology Company, and the obtained product was called pCB301-ge-BSγ-SmR.

    [0114] 4. Primers F11 and R11 were designed and synthesized by Invitrogen Company. The sequences of the primers were as follows:

    TABLE-US-00012 F11: AAAAAAAAAAAAATGTTTGATCAGATCATTCAAATCTGATGGTGCC CATC; R11 (i.e., R7): TTACTTAGAAACGGAAGAAGAATCATCACATCCAA CAGAAT.

    [0115] With the above-mentioned pT7-γ.sub.ND as a template and F11 and R11 as primers, high-fidelity PCR amplification was performed, and the obtained product was called linearized pT7-γ.sub.ND.

    [0116] 5. Primers F12 and R12 were designed and synthesized by Invitrogen Company. The sequences of the primers were as follows:

    TABLE-US-00013 F12: TTCTTCTTCCGTTTCTAAGTAACGAAGAGCatgggggaagcggtga t; R12 (i.e.. R8): GAATGATCTGATCAAACATTTTTTTTTTTTTAAAA AAAGCACCGACTCGGTGCC.

    [0117] With the above-mentioned pCB301-ge-BSγ-SmR as a template and F12 and R12 as primers, high-fidelity PCR amplification was performed, and the obtained product was called ge-BSγ-SmR.

    [0118] 6. The above-mentioned linearized pT7-γ.sub.ND and the ge-BSγ-SmR were subjected to recombination reaction with the 2× Master Assembly Mix from Taihe Biotechnology Company, and the obtained product was called pT7-ge-BSγ-SmR.

    [0119] 7. Primers F15 and R15 were designed and synthesized by Invitrogen Company. The sequences of the primers were as follows:

    TABLE-US-00014 F15: TAATTGTTGCCGTAGGTGCCCGG; R15: AACCCGGGCACCTACGGCAACAA.

    [0120] 8. F15 and R15 were diluted to a concentration of 100 μM, respectively. F15 and R15 were treated with T4 PNK, and the 50 μL reaction mix was as follows: F15 20 μL, R15 20 μL, 10×T4 ligase buffer (NEB) 5 μL, ddH.sub.2O 4 μL, T4 PNK (NEB) 1 μL. Reaction was performed in a 37° C. incubator for 45 min.

    [0121] 9. The reaction mix was then transferred into a PCR tube, and double strand annealing was performed in a PCR instrument to allow spontaneously base-pairing of F15 and R15 to form a double-stranded DNA fragment. The reaction conditions were as follows:

    [0122] Denaturation at 95° C. for 5 min and gradually chilled to 25° C. with 1° C. drops per minute. A final step was performed by maintaining the samples at 16° C. for 10 min. After the reaction was completed, the product was taken out in time and placed on ice for use in the subsequent reaction or stored at −20° C. The product was called Oligo-TaGASR7-T1.

    [0123] 10. The pT7-ge-BSγ-SmR was digested with the SapI restriction endonuclease produced by NEB with a final concentration of 20 ng/μL. The product was called SapI linearized pT7-ge-BSγ-SmR.

    [0124] 11. Ligation. The T4 ligase produced by NEB was used to ligate the Sap I linearized pT7-ge-BSγ-SmR and Oligo-TaGASR7-T1. The 20 μL reaction mix was as follows: Oligo-TaGASR7-T1 10 μL, 10×T4 ligase buffer (NEB) 2 μL, SapI-linearized pT7-ge-BSγ-SmR 1 μL, ddH.sub.2O 6 μL, T4 ligase (NEB) 1 μL. Ligation was performed at room temperature (about 20° C.) for 2 h or more, or ligation was performed at 16° C. overnight.

    [0125] 12. The ligation product was transformed into Escherichia coli strain JM109. After culturing, positive colonies were screened to extract the plasmid and sequencing was performed. The correct clone was screened, called pT7-ge-BSγ-SmR-TaGASR7-T1.

    [0126] 13. To construct the pT7-ge-BSγ-SmR-ZmTMS5-T2, the F15 and R15 were substituted with the follows:

    TABLE-US-00015 F17: TAAGGTGAAGCAGAAGCTTAAGC; R17: AACGCTAAGCTTCTGCTTCACC.

    [0127] Then go back to step 9 to step 12 to obtained the pT7-ge-BSγ-SmR-ZmTMS5-T2.

    Experimental Example 2

    [0128] The present experimental example was used to illustrate the editing effect of Example 3 on the target genes (wheat TaGASR7 gene and maize ZmTMS5 gene).

    [0129] Inoculating the wheat and maize with in vitro transcripts of the BSMV vectors mentioned above. The wheat line used was provided by Researcher Sientist Xia Lanqin from Institute of Crop Science, Chinese Academy of Agricultural Sciences, and the maize used was provided by Dr. Zhao Haiming from China Agricultural University. The wheat and maize lines used were transformed to express the Cas9 protein. For in vitro transcription, pT7-ge-BSγ-SmR-TaGASR7-T1, pT7-ge-BSγ-SmR-ZmTMS5-T2 and pT7-α.sub.ND were linearized with MluI. While pT7-β.sub.ND and pT7-β.sub.G404E were linearized with SpeI. 200-400 ng of linearized plasmids were used as template for transcription, and the following reagents were added: 6 μL 5× Trans Buffer, 3 μL 100 mM DTT, 30 U (unit) HPRI, 2 μL rNTP (ATP, UTP and CTP were each 10 mM, GTP was 1 mM) (Shanghai Sangon Biotech), 10 U T7 RNA polymerase (Promega), 5 mM Ribo m.sup.7G Cap Analog (Promega), and DEPC treated ddH.sub.2O was added to a final volume of 30 μl. 2 μl products were taken for electrophoresis analysis for quality control after 3 to 5 h reaction at 37° C. in an incubator. The remaining in vitro transcripts were mixed according to the ratio of 1:1:1 (for RNAα, RNAβ and RNAγ of the BSMV VMGE vectors), 2×FES buffer of the same volume was added and mixed with the in vitro transcripts to mechanically inoculate the leaves of wheat of and maize that grown to the two-leaf stage.

    [0130] At 14- and 30-days post inoculation, leaves were collected, respectively, and the genomic DNA was extracted for mutation analysis.

    [0131] Analysis Methods:

    [0132] The extracted genomic DNA from wheat and maize leaves were used as PCR templates. For wheat, the following primers were used: primer F16: CCTTCATCCTTCAGCCATGCAT, paired with primer R16-A: CCACTAAATGCCTATCACATACG, primer R16-B: AGGGCAATTCACATGCCACTGAT and primer R16-D: CCTCCATTTTTCCACATCTTAGTCC, respectively.

    [0133] High-fidelity PCR amplification was performed to obtain the target sites-containing DNA fragments with lengths of 560 bp, 569 bp, and 582 bp, respectively, called TaGASR7-A1, TaGASR7-B1, and TaGASR7-D1. The target sites of these three fragments all contained a BcnI restriction site. After BcnI digestion, gel-electrophoresis showed that, compared with the TaGASR7-A1, TaGASR7-B1 and TaGASR7-D1 products amplified from the DNA template extracted from healthy leaves, the digested products showed that a BcnI-resistant band was present in the samples from both the ge-BSMVβ-gNbPDS and the pT7-ge-BSγ-SmR-TaGASR7-T1-inoculated leaves, suggesting that mutations occur at the target sites (as shown in FIG. 8). The sequencing results for the TaGASR7-A1, TaGASR7-B1, and TaGASR7-D1 that cloned into the T-vector are shown in FIG. 9. For maize, high-fidelity PCR amplification was performed with primers F18: TCAAGAGACTTGCGTCATCTTCCC and R18: GCATGCTCAACTGAAATTGAGTCGTC to obtain a target site-containing DNA fragment with a length of 994 bp, i.e., ZmTMS5-994. The target site of this fragment contained an Afl II restriction site. After AflII digestion, gel-electrophoresis showed that, compared with the ZmTMS5-994 product amplified from the DNA template extracted from healthy leaves, the digested products showed that a AflII-resistant band was present in the samples from the pT7-ge-BSγ-SmR-ZmTMS5-T2-inoculated leaves, suggesting that targeted mutations occur at the target sites (as shown in FIG. 10).

    [0134] The AflII-digested ZmTMS5-994 was then cloned into a T-vector for sequencing. It can be seen that different types of mutations occurred at the target sites, including some base insertions, base deletions, and base substitutions, which confirmed that targeted mutations indeed occurred at the target sites, and these mutations were not present in the control (as shown in FIG. 11).

    Experimental Example 3

    [0135] The present Experimental Example was used to illustrate the editing effect of the BSMV gene editing vector on wheat pollen, and the following effect can be obtained: wheat seeds containing edited target gene can be obtained by inoculation and the edited target gene can be transmitted to progeny wheat plants.

    [0136] With the same inoculation method as in Experimental Example 2, the pT7-α.sub.ND, pT7-β.sub.ND and pT7-ge-BSγ-SmR-TaGASR7-T1 described in Experimental Example 2 were used to inoculate Cas9 transgenic wheat. The Cas9 transgenic wheat can be inoculated at the vegetative growth stage or the reproductive growth stage, which can be before or after the heading stage of wheat. Preferably, the wheat in the vegetative growth stage was used for inoculation in the present Experimental Example. The BSMV gene editing vector system was inoculated, after systemic infection and flowering of the inoculated wheat, anthers were collected to extract genomic DNA, and the effect of gene editing was tested by BcnI digestion and sequencing. Refer to Experimental Example 2 for the method. In brief, after extracting genomic DNA from the anthers, primer F16: CCTTCATCCTTCAGCCATGCAT were used in combination with primers R16-A: CCACTAAATGCCTATCACATACG, R16-B: AGGGCAATTCACA TGCCACTGAT, and R16-D: CCTCCATTTTTCCACATCTTAGTCC, respectively, to amplify DNA fragments of 560 bp, 569 bp, and 582 bp in length containing the target sites (called TaGASR7-A1, TaGASR7-B1, and TaGASR7-D1, respectively) from three subgenomes of wheat by high-fidelity PCR. The target sites of these three fragments all contained a BcnI restriction site. After BcnI digestion, gel-electrophoresis showed that, compared with the TaGASR7-A1, TaGASR7-B1 and TaGASR7-D1 products amplified from the DNA template extracted from uninoculated healthy wheat leaves, the digested products showed that a BcnI-resistant band was present in the samples from the pT7-ge-BSγ-SmR-TaGASR7-T1-inoculated leaves, suggesting that mutations occurred at the target sites (as shown in FIG. 12A). The amplified TaGASR7-A1, TaGASR7-B1, and TaGASR7-D1 were subjected to sequencing, and the results further proved that different types of mutations occurred in the target genes (as shown in FIG. 12B), which proved that the BSMV-based gene editing vector system can directly perform gene editing on wheat anthers in vivo.

    [0137] Furthermore, the seeds of the Cas9 transgenic wheat inoculated with pT7-α.sub.ND, pT7-β.sub.ND and pT7-ge-BSγ-SmR-TaGASR7-T1 were harvested, and after the seeds were sown, the genomic DNA of the grown progeny seedlings was extracted. With the same manner as above, the target sites-containing DNA fragments with lengths of 560 bp, 569 bp, and 582 bp (called TaGASR7-A1, TaGASR7-B1, and TaGASR7-D1, respectively) were amplified from three subgenomes of wheat progenies by high-fidelity PCR. The target sites of these three fragments all contained a BcnI restriction site. After BcnI digestion, gel-electrophoresis showed that, compared with the TaGASR7-A1, TaGASR7-B1 and TaGASR7-D1 products amplified from the DNA template extracted from uninoculated healthy wheat leaves, the digested products showed that a BcnI-resistant band was present in the genomic DNA extracted from the pT7-ge-BSγ-SmR-TaGASR7-T1-inoculated progeny seedlings leaves, suggesting that mutations occurred at the target sites (as shown in FIG. 13). The amplified TaGASR7-A1, TaGASR7-B1, and TaGASR7-D1 were cloned into the T vector and sequencing was performed. The results further proved that different types of editing occurred in the target genes (as shown in FIG. 14), which proved that wheat seeds containing edited target gene can be directly obtained after inoculating with the BSMV-based gene editing vector system, and the edited target gene can be transmitted to progeny plants through the seeds, without the need for transformation, tissue culture and regeneration process.

    [0138] It should be understood that, after the number of reagents or raw materials used in the above examples is expanded or reduced in equal proportion, the technical solutions are substantially the same as those of the above examples.

    [0139] Although the general description and specific embodiments have been used to describe the present invention in detail above, it is obvious to those skilled in the art that some modifications or improvements can be made on the basis of the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention fall within the protection scope of the present invention.

    INDUSTRIAL APPLICABILITY

    [0140] The present invention provides a Barley stripe mosaic virus-based gene editing vector system. The gene editing vector system comprises artificial plasmids separately containing Barley stripe mosaic virus RNAα, RNAβ, and RNAγ. The required sgRNA sequence is integrated in RNAβ or RNAγ. The Barley stripe mosaic virus-based gene editing vector system can achieve efficient gene editing on genomes of dicotyledons such as Nicotiana benthamiana and monocotyledons such as wheat and maize, and can directly obtain wheat seeds containing edited target gene by inoculating the Cas9-transgenic wheat, and the gene editing events can be transmitted to progeny plants through the seeds, without the need for transformation, tissue culture and regeneration processer. Thus, the present application shows good application prospects for basic research and crop improvement.