MULTIPLE VECTOR SYSTEM AND USES THEREOF
20220002749 · 2022-01-06
Inventors
- Pasqualina Colella (Pozzuoli NA, IT)
- Alberto Auricchio (Pozzuoli NA, IT)
- Ivana Trapani (Pozzuoli NA, IT)
Cpc classification
A61P7/04
HUMAN NECESSITIES
C12N2840/44
CHEMISTRY; METALLURGY
A61P21/00
HUMAN NECESSITIES
C07K14/705
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N2800/40
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
C12N2840/445
CHEMISTRY; METALLURGY
A61P9/10
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to constructs, vectors, relative host cells and pharmaceutical compositions which allow an effective gene therapy, in particular of genes larger than 5 Kb.
Claims
1. A vector system to express the coding sequence of a gene of interest in a cell, said coding sequence comprising a first portion and a second portion, said vector system comprising: a) a first vector comprising: said first portion of said coding sequence (CDS1), a first reconstitution sequence; and b) a second vector comprising: said second portion of said coding sequence (CDS2), a second reconstitution sequence, wherein said first and second reconstitution sequences are selected from the group of: i] the first reconstitution sequence consists of the 3′ end of said first portion of the coding sequence and the second reconstitution sequence consists of the 5′end of said second portion of the coding sequence, said first and second reconstitution sequences being overlapping sequences; or ii] the first reconstitution sequence comprises a splicing donor signal (SD) and the second reconstitution sequence comprises a splicing acceptor signal (SA), optionally each one of first and second reconstitution sequence further comprises a recombinogenic sequence, characterized by the fact that either one or both of the first and second vector further comprises a nucleotide sequence of a degradation signal said sequence being located in case of i) at the 3′ end of the CDS1 and/or at the 5′ end of the CDS2 and in case of ii) in 3′ position relative to the SD and/or in 5′ position relative to the SA.
2. The vector system according to claim 1, wherein both of the first and second vector further comprise said nucleotide sequence of a degradation signal, wherein the nucleotide sequence of the degradation signal in the first vector is identical to or differs from that in the second vector.
3. The vector system according to claim 1, wherein the first reconstitution sequence comprises a splicing donor signal (SD) and a recombinogenic region in 3′ position relative to said SD, the second reconstitution sequence comprises a splicing acceptor signal (SA) and a recombinogenic sequence in 5′ position relative to the SA; wherein said nucleotide sequence of a degradation signal is localized at the 5′ end and/or at the 3′ end of the nucleotide sequence of the recombinogenic region of either one or both of the first and second vector.
4. The vector system according to claim 1, wherein the nucleotide sequence of the degradation signal is selected from: one or more protein ubiquitination signals, one or more microRNA target sequences, and/or one or more artificial stop codons.
5. The vector system according to claim 1, wherein the nucleotide sequence of the degradation signal comprises or consists of a sequence encoding a sequence selected from CL1 (SEQ ID No. 1), CL2 (SEQ ID No. 2), CL6 (SEQ ID No. 3), CL9 (SEQ ID No. 4), CL10 (SEQ ID No. 5), CL11 (SEQ ID No. 6), CL12 (SEQ ID No. 7), CL15 (SEQ ID No. 8), CL16 (SEQ ID No. 9), SL17 (SEQ ID No. 10), or a fragment or variant thereof, or PB29 (SEQ ID No. 14 or SEQ ID No. 15) or a fragment or variant thereof; or wherein the nucleotide sequence of the degradation signal comprises or consists of a sequence selected from miR-204 (SEQ ID No. 11), miR-124 (SEQ ID No. 12) or miR-26a (SEQ ID No. 13), or a fragment or variant thereof.
6. The vector system according to claim 1, wherein the nucleotide sequence of the degradation signal of the first vector comprises or consists of a sequence encoding CL1 (SEQ ID No. 1) or a fragment or variant thereof, or comprises or consists of SEQ ID No. 16 or a fragment or variant thereof, or comprises or consists of miR-204 (SEQ ID No. 11) and miR-124 (SEQ ID No. 12) or a fragment or variant thereof, or comprises or consists of miR-26a (SEQ ID No. 13) or a fragment or variant thereof.
7. The vector system according to claim 1, wherein the nucleotide sequence of the degradation signal of the second vector comprises or consists of a sequence encoding PB29 (SEQ ID No. 14 or SEQ ID No. 15) or a fragment or variant thereof or comprises or consists of SEQ ID No. 19 or SEQ ID No. 20 or a fragment or variant thereof.
8. The vector system according to claim 1, wherein the first vector further comprises a promoter sequence operably linked to the 5′end portion of said first portion of the coding sequence (CDS1).
9. The vector system according to claim 1, wherein both of the first vector and the second vector further comprise a 5′-terminal repeat (5′-TR) nucleotide sequence and a 3′-terminal repeat (3′-TR) nucleotide sequence.
10. The vector system according to claim 1, wherein the recombinogenic sequence is selected from the group consisting of: AK GGGATITTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAA ATTTAACGCGAATTTTAACAAAAT (SEQ ID No. 22) or a fragment or variant thereof, GGGATITTTCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAA ATTTAACGCGAATTTTAACAAAAT (SEQ ID NO. 23) or a fragment or variant thereof, AP1 (SEQ ID NO. 24), AP2 (SEQ ID NO. 25) or a fragment or variant thereof, and AP (SEQ ID NO. 26) or a fragment or variant thereof.
11. The vector system according to claim 1, wherein the coding sequence is split into the first portion and the second portion at a natural exon-exon junction.
12. The vector system according to claim 1, wherein the splicing donor signal comprises or consists essentially of a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95% or 100% identical to GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTC GAGACAGAGAAGACTCTTGCGTTTCT (SEQ ID No. 27) or a fragment or variant thereof.
13. The vector system according to claim 1, wherein the splicing acceptor signal comprises or consists essentially of a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95% or 100% identical to GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTCTCTCCACAG (SEQ ID No. 28) or a fragment or variant thereof.
14. The vector system according to claim 1, wherein the first vector further comprises at least one enhancer nucleotide sequence, operably linked to the coding sequence.
15. The vector system according to claim 1, wherein the coding sequence encodes a protein able to correct a retinal degeneration.
16. The vector system according to claim 1 wherein the coding sequence encodes a protein able to correct Duchenne muscular dystrophy, cystic fibrosis, hemophilia A and dysferlinopathies.
17. The vector system according to claim 1, wherein the coding sequence is the coding sequence of a gene selected from the group consisting of: ABCA4, MYO7A, CEP290, CDH23, EYS, PCDH15, CACNA1, SNRNP200, RP1, PRPF8, RP1L1, ALMS1, USH2A, GPR98, HMCN1.
18. The vector system according to claim 1, wherein the coding sequence is the coding sequence of a gene selected from the group consisting of: DMD, CFTR, F8 and DYSF.
19. The vector system according to claim 1, wherein the first vector does not comprise a poly-adenylation signal nucleotide sequence.
20. The vector system according to claim 1 wherein: a) the first vector comprises in a 5′-3′ direction: a 5′-inverted terminal repeat (5′-ITR) sequence; a promoter sequence; a 5′ end portion of a coding sequence of a gene of interest (CDS1), said 5′ end portion being operably linked to and under control of said promoter; a nucleotide sequence of a splicing donor signal; a nucleotide sequence of a recombinogenic region; and a 3′-inverted terminal repeat (3′-ITR) sequence; and b) the second vector comprises in a 5′-3′ direction: a 5′-inverted terminal repeat (5′-ITR) sequence; a nucleotide sequence of a recombinogenic region; a nucleotide sequence of a splicing acceptor signal; the 3′end of the coding sequence (CDS2); a poly-adenylation signal nucleotide sequence; and a 3′-inverted terminal repeat (3′-ITR) sequence, characterized by further comprising a nucleotide sequence of a degradation signal, said sequence being localized at 5′ end or 3′ end of the nucleotide sequence of the recombinogenic region of either one or both of the first and second vector.
21. The vector system according to claim 1 wherein said first and second vector is independently a viral vector.
22. The vector system according to claim 1 further comprising a third vector comprising a third portion of said coding sequence (CDS3) and a reconstitution sequence, wherein the second vector comprises two reconstitution sequences, each reconstitution sequence located at each end of CDS2.
23. The vector system of claim 22 wherein the third vector further comprises at least one nucleotide sequence of a degradation signal.
24. The vector system according to claim 1, wherein the second vector further comprises a poly-adenylation signal nucleotide sequence linked to the 3′end portion of said coding sequence (CDS2).
25. A host cell transformed with the vector system according to claim 1.
26. (canceled)
27. (canceled)
28. (canceled)
29. (canceled)
30. (canceled)
31. (canceled)
32. A pharmaceutical composition comprising the vector system according to claim 1 and a pharmaceutically acceptable vehicle.
33. A method for treating and/or preventing a pathology or disease characterized by a retinal degeneration comprising administering to a subject in need thereof an effective amount of the vector system according to claim 1.
34. A method for treating and/or preventing Duchenne muscular dystrophy, cystic fibrosis, hemophilia A or dysferlinopathies comprising administering to a subject in need thereof an effective amount of the vector system according to claim 1.
35. (canceled)
36. A method for decreasing expression of a protein in truncated form comprising inserting a nucleotide sequence of a degradation signal in one or more vector of a vector system.
37. The method of claim 33, wherein the retinal degeneration is inherited.
38. The method of claim 33, wherein the pathology or disease is selected from the group consisting of: retinitis pigmentosa (RP), Leber congenital amaurosis (LCA), Stargardt disease (STGD), Usher disease (USH), Alstrom syndrome, congenital stationary night blindness (CSNB), macular dystrophy, occult macular dystrophy, a disease caused by a mutation in the ABCA4 gene.
39. A pharmaceutical composition comprising the host cell according to claim 25 and a pharmaceutically acceptable vehicle.
40. The vector system according to claim 1 wherein said first and second vector is independently an adeno viral vector or adeno-associated viral (AAV) vector.
Description
[0188] The present invention will now be illustrated by means of non-limiting examples in reference to the following drawings.
[0189]
[0190]
[0191]
(a) Alkaline Southern blot analysis of DNA extracted from 3×1010 GC of both 5′- and 3′-ABCA4-half vectors with either homologous (2:2) or heterologous (5:2 or 2:5) ITR, and of a control AAV preparation with homologous ITR2 (CTRL). The expected size of each genome is depicted below each lane. The molecular weight marker (kb) is depicted on the left 5′: 5′-half vector; 3′: 3′-half vector. (b-d) Representative Western blot analysis and quantification of HEK293 cells infected with dual AAV2/2 hybrid ABCA4 vectors with either heterologous ITR2 and ITR5 or homologous ITR2 at m.o.i. based on either the ITR2 (b and c) or the transgene (b and d) titre. The Western blot images (b) are representative of n=3 independent experiments; the quantifications (c and d) are from n=3 independent experiments. (b) The upper arrow indicates full-length ABCA4 protein, the lower arrow indicates truncated proteins; the molecular weight ladder is depicted on the left. The micrograms of proteins loaded are depicted below the image. α-3×flag: Western blot with anti-3×flag antibodies, α-Filamin A: Western blot with anti-Filamin A antibodies, used as loading control. (c and d) Quantification of full-length and truncated ABCA4 protein bands from Western blot analysis of cells infected with a dose of vector based on either the ITR2 (c) or the transgene (d) titre. The histograms show either the intensity of the full-length and truncated protein bands divided by that of the Filamin A bands or the intensity of the full-length protein bands divided by that of the truncated protein bands in the corresponding lane. Representative Western blot analysis and quantification of HEK293 cells infected with dual AAV2 (AAV serotype 2) hybrid vectors with either heterologous ITR2 and ITR5 or homologous ITR2 encoding for MYO7A (e, f), the Western blot images (e) are representative of and the quantifications (f) are from n=3 independent experiments. (e) The upper arrows indicate full-length proteins, the lower arrows indicate truncated proteins, the molecular weight ladder is depicted on the left. The micrograms of proteins loaded are depicted below the image. (f) Quantification of MYO7A protein bands from Western blot analysis.
[0192] The mean value is depicted above the corresponding bar. Values are represented as: mean±s.e.m. *p Student's t test ≤0.05.
[0193] 2:2 2:2: cells infected with dual AAV hybrid vectors with homologous ITR from AAV2; 5:2 2:5: cells infected with dual AAV hybrid vectors with heterologous ITR from AAV2 and AAV5: neg: cells infected with EGFP-expressing vectors, as negative controls.
[0194]
[0195] Representative Western blot analysis of HEK293 cells infected with dual AAV2/2 (AAV serotype 2) hybrid vectors encoding for ABCA4, containing miR target sites for either miR-let7b (left panel), miR-204+124 (central panel) or miR-26a (right panel). The upper arrow indicates full-length ABCA4 proteins, the lower arrow indicates truncated proteins; the molecular weight ladder is depicted on the left. The micrograms of proteins loaded are depicted below the image, 5′+3′: cells co-infected with 5′-half vectors without miR target sites and 3′-half vectors; 5′+3′+scrumble: cells co-infected with 5′-half vectors without miR target sites and 3′-half vectors in the presence of scramble miR mimics, 5′mir+3′: cells co-infected with 5′-half vectors containing miR target sites and 3′-half vectors; 5′mir+3′+scramble: cells co-infected with 5-half vectors containing miR target sites and 3′-half vectors in the presence of scramble miR mimics; 5′mir+3′+mimic let7b: cells co-infected with 5′-half vectors containing miR target sites and 3′-half vectors in the presence of mir-let7b mimics; 5′: cells infected with 5′-half vectors without miR target sites; 5′mir: cells infected with 5′-half vectors containing miR target sites in the presence of scramble miR mimics; 5′mir+mimic let7b: cells infected with 5′-half vectors containing miR target sites in the presence of mir-let7b mimics; neg: control cells infected with either the 3′-half vectors or EGFP-expressing vectors; 5′mir+3′+mimic 204+124: cells co-infected with 5′-half vectors containing miR target sites and 3′-half vectors in the presence of mir-204 and 124 mimics; 5′mir+mimic 204+124: cells infected with 5′-half vectors containing miR target sites in the presence of mir-204 and 124 mimics; 5′mir+3′+mimic 26a: cells co-infected with 5′-half vectors containing miR target sites and 3′-half vectors in the presence of mir-26a mimics; 5′mir+mimic 26a: cells infected with 5′-half vectors containing miR target sites in the presence of mir-26a mimics. α-3×flag: Western blot with anti-3×flag antibodies; α-Filamin A, Western blot with anti-Filamin A antibodies, used as loading control
[0196] Scramble sequence correspond to sequence of a different miRNA, for instance in the experiment with mir-let7b mimics the scramble sequence was that of miR26a.
[0197]
[0198] Representative Western blot analysis of either (a) HEK293 cells infected with dual AAV212 (AAV serotype 2, with homologous ITR from AAV2) hybrid vectors or (b) pig eyes (RPE+retina) one month post-injection of dual AAV2/8 (AAV serotype 8, with homologous ITR from AAV2) hybrid vectors encoding for ABCA4 and containing or not the CL1 degradation signal. The upper arrows indicate the full-length ABCA4 protein, the lower arrows indicate the truncated protein from the 5′-half vector; the molecular weight ladder is depicted on the left. The micrograms of proteins loaded are depicted below each image. 5′+3′: cells co-infected or eyes co-injected with 5′-half vectors without CL1 and 3′-half vectors; 5′-CL1+3′: cells co-infected or eyes co-injected with 5′-half vectors containing CL1 and 3′-half vectors; 5′: cells infected with 5′-half vectors without CL1; 5′-CL1: cells infected with 5′-half vectors containing CL1; neg: control cells infected or control eyes injected with either the 3′-half vectors or EGFP expressing vectors, as negative controls; α-3×flag: Western blot with anti-3×flag antibodies; α-Filamin A: Western blot with anti-Filamin A antibodies, used as loading control; α-Dysferlin: Western blot with anti-Dysferlin antibodies, used as loading control. (a) The Western blot image is representative of n=3 independent experiments. (b) The Western blot image is representative of n=5 eyes injected with 5′+3′ vectors, n=2 eyes injected with 5′-CL1+3′ vectors and n=5 of eyes injected with either the 3′-half vectors or EGFP expressing vectors as negative controls.
[0199]
[0200] Representative Western blot analysis of HEK293 cells infected with dual AAV2/2 hybrid vectors encoding for ABCA4 and containing different degradation signals. The upper arrow indicates the full-length ABCA4 protein, the lower arrow indicates truncated protein products; the molecular weight ladder is depicted on the left. The micrograms of proteins loaded are depicted below each image. 5′+3′: cells co-infected with 5′- and 3′-half vectors without degradation signals; 5′: cells infected with 5′-half vectors; 3′ (no label): cells infected with 3′-half vectors without degradation signals; stop: cells infected with 3′-half vectors containing stop codons; PB29: cells infected with 3′-half vectors containing the PB29 degradation signal; 3×PB29: cells infected with 3′-half vectors containing 3 tandem copies of the PB29 degradation signal; Ubiquitin: cells infected with 3′-half vectors containing the ubiquitin degradation signal. α-3×flag: Western blot with anti-3×flag antibodies; α-Filamin A: Western blot with anti-Filamin A antibodies, used as loading control.
[0201]
[0202]
[0203]
(b) Mean b-wave amplitudes (μV) in scotopic, maximal response, photopic and flicker ERG tests in pigs 1-month post-injection of either dual AAV hybrid ABCA4 vectors (AAV5′+3′) or PBS. n=5 eyes injected with dual AAV hybrid ABCA4 vectors; n=4 injected with PBS; *: n=2.
[0204]
[0205]
[0206]
[0207]
(B) Schematic representation of a vector system consisting of three vectors, according to preferred embodiments of the invention: a first vector comprises a first portion (CDS1 portion) of the coding sequence, a second vector comprises a second portion (CDS2 portion) of the coding sequence and a third vector comprises a third portion (CDS3 portion) of the coding sequence. (B1) the reconstitution sequences of the vector system consist in overlapping ends of the coding sequence portions (3′ end of CDS1 overlapping with 5′ end of CDS2; 3′ end of CDS2 overlapping with 5′ end of CDS3). (B2) the reconstitution sequence of the first vector consists in a splicing donor, the reconstitution sequence of the first vector consists in a splicing donor; the second vector comprises a first reconstitution sequence at the 5′ end of CDS2 and a second reconstitution sequence at the 3′ end of CDS2, the first reconstitution sequence being a splicing acceptor and the second being a splicing donor; the reconstitution sequence of the third vector consists in a splicing acceptor. (B3) each reconstitution sequence comprises the splicing donor/acceptor arranged as in B2 and further comprises a recombinogenic region. A degradation signal is comprised in at least one of the vectors. The figure shows for each vector all the potential positions of the one or more degradation signals of the vector system, according to preferred non-limiting embodiments of the invention.
[0208] CDS, coding sequence; SD, splicing donor signal; RR: recombinogenic regions; Deg Sig; degradation signals (see Table 2); SA, splicing acceptor signal.
[0209]
DETAILED DESCRIPTION OF THE INVENTION
[0210] Materials and Methods
[0211] Generation of Plasmids
[0212] The plasmids used for AAV vector production were all derived from the dual hybrid AK vector plasmids encoding either the human ABCA4, the human MYO7A or the EGFP reporter protein containing the inverted terminal repeats (ITR) of AAV serotype 2.sup.14.
[0213] The AK recombinogenic sequence.sup.14 contained in the vector plasmids encoding ABCA4 was replaced with three different recombinogenic sequences derived from the alkaline phosphatase gene: AP (NM_001632, bp 823-1100,.sup.14); AP1 (XM_005246439.2, bp1802-1516.sup.20); AP2 (XM_005246439.2, bp 1225-938.sup.20).
[0214] Dual AAV vector plasmids bearing heterologous ITR from AAV serotype 2 (ITR2) and ITR from AAV serotype 5 (ITR5) in the 5:2-2:5 configuration were generated by replacing the left ITR2 in the 5′-half vector plasmid and the right ITR2 in the 3′-half vector plasmids, respectively, with ITR5 (NC_006152.1, bp 1-175). Dual AAV vector plasmids bearing heterologous ITR2 and ITR5 in the 2:5 or 5:2 configurations were generated by replacing either the right or the left ITR2 with the ITR5, respectively. The pAAV5/2 packaging plasmid containing Rep5 (NC_006152.1, bp 171-2206) and the AAV2 Cap (AF043303 bp2203-2208) genes (Rep5Cap2), was obtained from the pAAV2/2 packaging plasmid, containing the Rep (AF043303 bp321-1993) and Cap (AF043303 bp2203-2208) genes from AAV2 (Rep2Cap2), by replacing the Rep2 gene with the Rep5 open reading frame from AAV5 (NC_006152.1, bp 171-2206).
[0215] The pZac5:5-CMV-EGFP plasmid containing the EGFP expression cassette with the ITR5 was generated from the pAAV2.1-CMV-EGFP plasmid, containing the ITR2 flanking the EGFP expression cassette a.
[0216] Degradation signals were cloned in dual AAV hybrid AK vectors encoding for ABCA4 as follows: in the 5′-half vector plasmids between the AK sequence and the right ITR2; in the 3′-half vector plasmids between the AK sequence and the splice acceptor signal. Details on degradation signal sequences can be found in Table 2.
TABLE-US-00006 TABLE 2 Degradation signals used in this study SIZE DEGRADATION SIGNAL NUCLEOTIDE SEQUENCE (bp) REFS 5′-half vectors CL1 Gcctgcaagaactggttcagcagcctgagccacttcgtgatccacctg 48 31, 32 (SEQ ID No. 16) 3x204 + 3x124 Aggcataggatgacaaagggaacgataggcataggatgacaaagggaa 158 30 aattaggcataggatgacaaagggaaggtaccagatctggcattcacc gcgtgccttacgatggcattcaccgcgtgccttaaagcttggcattca ccgcgtgcctta (SEQ ID No. 17) 4xlet7b Aaccacacaacctactacctcacgataaccacacaacctactacctca 102 26, 27, 28 aagcttaaccacacaacctactacctcatcacaaccacacaacctact acctca (SEQ ID No. 41) 4x26a Agcctatcctggattacttgaacgatagcctatcctggattacttgaa 102 28, 29 aagcttagcctatcctggattacttgaatcacagcctatcctggatta cttgaa (SEQ ID No. 18) 3′-half vectors 3xSTOP Tgaatgaatga (SEQ ID No. 51) 11 PB29 Atgcacagctggaacttcaagctgtacgtcatgggcagcggc 42 35 (SEQ ID No. 19) 3xPB29 Atgcacagctggaacttcaagctgtacgtcatggcagcggcggggtac 136 catgcacagctggaacttcaagctgtacgtcatgggcagcggcggatg cacagctggaacttcaagctgtacgtcatgggcagcggc (SEQ ID No. 21) Ubiquitin Atgcagatcttcgtaagactctgactggtaagaccatcaccctcgagg 228 33, 34 tggagcccagtgacaccatcgagaatgtcaaggcaaagatccaagata aggaaggcattcctcctgatcagcagaggttgatctttgccggaaaac agctggaagatggtcgtaccctgtctgactacaacatccagaaagagt ccaccttgcacctggtactccgtctcagaggtggg (SEQ ID No. 78)
[0217] The sequences underlined correspond to the degradation signals; for degradation signals including repeated sequences, not underlined nucleotides are shown which have been included inbetween repeated sequences for cloning purposes.
[0218] The ABCA4 protein expressed from dual AAV vectors is tagged with 3×flag at both N- (amino acidic position 590) and C-termini for the experiments shown in
[0219] Dual AAV hybrid vectors sets encoding for ABCA4 used in this study included either the ubiquitous CMV.sup.46 or the PR-specific human G protein-coupled receptor kinase 1 (GRK1).sup.47 promoters, while dual AAV hybrid vectors encoding for MYO7A included the ubiquitous CBA promoter.sup.39.
[0220] AAV Vector Production and Characterization
[0221] The AAV vector large preparations were produced by the TIGEM AAV Vector Core by triple transfection of HEK293 cells followed by two rounds of CsCl2 purification. AAV vectors bearing homologous ITR2 were obtained as previously described.sup.48.
[0222] To obtain AAV vectors bearing heterologous ITR2 and ITR5 a suspension of 1.1×10.sup.9 low-passage HEK293 cells was quadruple-transfected by calcium phosphate with 500 μg of pDeltaF6 helper plasmid which contains the Ad helper genes.sup.49, 260 μg of pAAV cis-plasmid and different amounts of Rep2Cap2 and Rep5 packaging constructs. The amount of Rep2Cap2 and Rep5 packaging constructs was as follows:
(i) PROTOCOL A: 130 μg of each Rep5 and Rep2Cap2 (ratio 1:1)
(ii) PROTOCOL B: 90 μg of Rep5 and 260 μg of Rep2Cap2 (ratio 1:3)
(iii) PROTOCOL C: 26 μg of Rep5 and 260 μg of Rep2Cap2 (ratio 1:10)
[0223] Each AAV preparation was then purified according to the published protocol.sup.48.
[0224] The protocols described below were used for the Rep competition experiments:
[0225] 1—to assess Rep5 competition with Rep2 for production of AAV vectors with ITR2, HEK293 cells were either quadruple-transfected by calcium phosphate with pDeltaF6, pAAV2.1-CMV-EGFP cis, the Rep2Cap2 and Rep5Cap2 constructs at a weight ratio of 2:1:1.5:1.5 or, as a control, quadruple-transfected with the pDeltaF6, pAAV2.1-CMV-EGFP, the Rep2Cap2 packaging construct and a control irrelevant plasmid at a weight ratio of 2:1:1.5:1.5;
[0226] 2—to assess Rep2 competition with Rep5 for production of AAV vectors with ITR5, HEK293 cells were either quadruple-transfected by calcium phosphate with pDeltaF6, pZac5:5-CMV-EGFP, the Rep5Cap2 and Rep2Cap2 constructs at a weight ratio of 2:1:1.5:1.5 or, as a control, quadruple-transfected with pDeltaF6, pZac5:5-CMV-EGFP, the Rep5 construct and a control irrelevant plasmid at a weight ratio of 2:1:1.5:1.5.
[0227] For the large-scale AAV vector preparations physical titres [genome copies (GC)/mL] were determined by averaging the titre achieved by PCR quantification using TaqMan (Applied Biosystems, Carlsbad, Calif., USA).sup.48 with a probe annealing on ITR2 and that obtained by dot-blot analysis.sup.50 with a probe annealing within 1 kb from ITR2. For the large-scale AAV vector preparations produced with different Rep5:Rep2Cap2 weight ratio, physical titres [genome copies (GC)/mL] were determined by PCR quantification using TaqMan with a probe annealing on ITR2. For the AAV vector preparations used in the competition experiments physical titres [genome copies (GC)] were determined by PCR quantification using TaqMan with a probe annealing on the bovine growth hormone (BGH) polyadenilation signal, included in the EGFP-expressing cassette packaged in the AAV vectors.
[0228] AAV Infection of HEK293 Cells
[0229] AAV infection of HEK293 cells was performed as previously described.sup.14. AAV2 vectors bearing heterologous ITR2 and ITR5 and produced according to Protocol C were used to infect HEK293 cells with a multiplicity of infection (m.o.i) of 1×10.sup.4 GC/cell of each vector (2×10.sup.4 total GC/cell when the inventors used dual AAV vectors at a 1:1 ratio) calculated considering the lowest titre achieved for each viral preparation. Infections with AAV2/2 bearing recombinogenic regions and degradation signals were carried out with a m.o.i of 5×10.sup.4 GC/cell of each vector (1×10.sup.5 total GC/cell in the case of dual AAV vectors at 1:1 ratio) calculated considering the average titre between TaqMan and dot-blot.
[0230] For the experiments using 5′-half vectors containing miR target sites, cells were transfected using calcium phosphate 4 hours prior to infection with the corresponding miR mimics (50 nM; miRIDIAN microRNA mimic hsa-let-7b-5p, hsa-miR-204-5p, hsa-miR-124-3p and hsa-miR-26α-5p; Dharmacon, Lafayette, Colo., USA).
[0231] Subretinal Injection of AAV Vectors in Mice and Pigs
[0232] Mice were housed at the Institute of Genetics and Biophysics animal house (Naples, Italy), maintained under a 12-h light/dark cycle (10-50 lux exposure during the light phase). C57BL/6 mice were purchased from Harlan Italy SRL (Udine, Italy). Pigmented Abca4−/− mice were generated through successive crosses of albino Abca4−/− mice.sup.14 with Sv129 mice and maintained inbred; breeding was performed crossing heterozygous mice with homozygous mice.
[0233] Albino Abca4−/− mice were generated through successive crosses and backcrossed with BALB/c mice (homozygous for Rpe65 Leu450) and maintained inbred; breeding was performed crossing heterozygous mice with homozygous mice. C57BL/6 (5 week-old), pigmented Abca4−/− (5.5 month-old) and albino Abca4−/− (2.5-3-month old) mice were anesthetized as previously described.sup.61, then 1 μl of either PBS or AAV2/8 vectors was delivered subretinally to the temporal side of the retina via a trans-scleral trans-choroidal approach as described by Liang et al.sup.62. AAV2/5-VMD2-human Tyrosinase.sup.63 (dose: 2×10.sup.8 GC/eye) was added to the AAV2/8 vector solution that was subretinally delivered to albino Abca4−/− mice (
[0234] The Large White Female pigs used in this study were registered as purebred in the LW Herd Book of the Italian National Pig Breeders' Association. Pigs were housed at the Cardarelli hospital animal house (Naples, Italy) and maintained under 12-hour light/dark cycle (10-50 lux exposure during the light phase). This study was carried out in accordance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research and with the Italian Ministry of Health regulation for animal procedures. All procedures were submitted to the Italian Ministry of Health; Department of Public Health, Animal Health, Nutrition and Food Safety. Surgery was performed under anesthesia and all efforts were made to minimize suffering. Animals were sacrificed as previously described.sup.39. Subretinal delivery of AAV vectors to 3 month-old pigs was performed as previously described.sup.39. All eyes were treated with 100 μl of either PBS or AAV2/8 vector solution. The AAV2/8 dose was 1×10.sup.11 GC of each vector/eye therefore co-injection of dual AAV vectors at a 1:1 ratio resulted in a total dose of 2×10.sup.11 GC/eye.
[0235] For the animal studies included in
[0236] Western Blot Analysis
[0237] For Western blot analysis HEK293 cells, mouse and pig retinas were lysed in RIPA buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1% NP40, 0.5% Na-Deoxycholate, 1 mM EDTA pH 8.0, 0.1% SDS). Lysis buffers were supplemented with protease inhibitors (Complete Protease inhibitor cocktail tablets, Roche) and 1 mM phenylmethylsulfonyl. After lysis, samples of cells containing MYO7A were denatured at 99° C. for 5 min in 1× Laemli sample buffer; samples containing ABCA4 were denatured at 37° C. for 15 min in 1× Laemli sample buffer supplemented with 4 M urea. Lysates were separated by 6-7% (ABCA4 and MYO7A samples, respectively) or 8% (WB in
[0244] Southern Blot Analysis
[0245] Three×10.sup.10 GC of viral DNA were extracted from AAV particles. To digest unpackaged genomes, the vector solution was resuspended in 240 μl of PBS pH 7.4 19 (GIBCO; Invitrogen S.R.L., Milan, Italy) and then incubated with 1 U/μl of DNase I (Roche) in a total volume of 300 μl containing 40 mM TRIS-HCl, 10 mM NaCl, 6 mM MgCl2, 1 mM CaCl2) pH 7.9 for 2 h at 37° C. The DNase I was then inactivated with 50 mM EDTA, followed by incubation with proteinase K and 2.5% N-lauroyl-sarcosil solution at 50° C. for 45 min to lyse the capsids. The DNA was extracted twice with phenol-chloroform and precipitated with two volumes of ethanol 100 and 10% sodium acetate (3 M, pH 7). Alkaline agarose gel electrophoresis and blotting were performed as previously described (Sambrook & Russell, 2001 Molecular Cloning). Ten microlitres of the 1 kb DNA ladder (N3232L; New England Biolabs, Ipswich, Mass., USA) were loaded as molecular weight marker. Two different double strand DNA fragments were labelled with digoxigenin-dUTP using the DIG high prime DNA labelling and detection starter kit (Roche) and used as probes. The 5′ probe (768 bp) was generated by double digestion of the pZac2.1-CMV-ABCA4_5′ plasmid with SpeI and NotI; the 3′ probe (974 bp) was generated by double digestion of the pZac2.1-ABCA4_3′_3×flag_SV40 plasmid with ClaI and MfeI. Prehybridization and hybridization were performed at 65° C. in Church buffer (Sambrook & Russel, 2001 Molecular cloning) for 1 h and overnight, respectively. Then, the membrane (Whatman Nytran N, charged nylon membrane; Sigma-Aldrich. Milan, Italy) was first washed for 30 min in SSC 29-0.1% SDS, then for 30 min in SSC 0.59-0.1% SDS at 65° C., and then for 30 min in SSC 0.19-0.1% SDS at 37° C. The membrane was then analyzed by chemiluminescence detection by enzyme immunoassay using the DIG DNA Labeling and Detection Kit (Roche).
[0246] Histological Analysis
[0247] Mice were euthanized, and their eyeballs were then harvested and fixed overnight by immersion in 4% paraformaldehyde (PFA). Before harvesting the eyeballs, the temporal aspect of the sclerae was marked by cauterization, in order to orient the eyes with respect to the injection site at the moment of the inclusion. The eyeballs were cut so that the lens and vitreous could be removed while leaving the eyecup intact. Mice eyecups were infiltrated with 30% sucrose for cryopreservation and embedded in tissue-freezing medium (O.C.T. matrix; Kaltek, Padua, Italy). For each eye, 150-200 serial sections (10 μm thick) were cut along the horizontal plane and the sections were progressively distributed on 10 slides so that each slide contained 15 to 20 sections, each representative of the entire eye at different levels. The sections were stained with 4′,6′-diamidino-2-phenylindole (Vectashield; Vector Lab, Peterborough. United Kingdom) and were monitored with a Zeiss Axiocam (Carl Zeiss, Oberkochen, Germany) at different magnifications.
[0248] Pigs were sacrificed, and their eyeballs were harvested and fixed overnight by immersion in 4% PFA. The eyeballs were cut so that the lens and vitreous could be removed, leaving the eyecups in place. The eyecups were gradually dehydrated by progressively infiltrating them with 10%, 20%, and 30% sucrose. Tissue-freezing medium (O.C.T. matrix; Kaltek) embedding was performed. Before embedding, the swine eyecups were analyzed with a fluorescence stereomicroscope (Leica Microsystems GmbH, Wetzlar, Germany) in order to localize the transduced region whenever an EGFP-encoding vector was administered. For each eye, 200-300 serial sections (12 μm thick) were cut along the horizontal meridian and the sections were progressively distributed on glass slides so that each slide contained 6-10 sections. Section staining and image acquisition were performed as described for mice.
[0249] Cone Immunofluorescence Staining
[0250] Frozen retinal sections were washed once with PBS and then permeabilized for 1 hr in PBS containing 0.1% Triton X-100. Blocking solution containing 10% normal goat serum (Sigma-Aldrich) was applied for 1 hr. Primary antibody [anti-human CAR.sup.66,67, which also recognises the porcine CAR (“Luminaire founders”-hCAR, 1:10.000; kindly provided by Dr. Cheryl M. Craft, Doheny Eye Institute, Los Angeles, Calif.)] was diluted in PBS and incubated overnight at 4° C. The secondary antibody (Alexa Fluor 594, anti-rabbit, 1:1,000: Molecular Probes, Invitrogen, Carlsbad, Calif.) was incubated for 45 min. Sections stained with the anti-CAR antibodies were analyzed at 63× magnification using a Leica Laser Confocal Microscope System (Leica Microsystems GmbH), as previously described.sup.64. Briefly, for each eye six different z-stacks from six different transduced regions were taken. For each z-stack, images from single plans were used to count CAR+/EGFP+ cells. In doing this, the inventors carefully moved along the Z-axis to distinguish one cell from another and thus to avoid to count twice the same cell. For each retina the inventors counted the CAR-positive (CAR+)/EGFP-positive (EGFP+) cells on total CAR+ cells. The inventors then calculated the average number of CAR+/EGFP+ cells of the three eyes of each experimental group.
[0251] EGFP Quantification
[0252] Fluorescence intensity in PR was rigorously and reproducibly quantified in an unbiased manner as previously described.sup.64. Individual color channel images were taken using a Leica microscope (Leica Microsystems GmbH). TIFF images were gray-scaled with image analysis software (LAS AF lite; Leica Microsystems GmbH). Six images of each eye were analyzed at 20× magnification by a masked observer. PR (outer nuclear layer+OS) were selectively outlined in every image, and the total fluorescence for the enclosed area was calculated in an unbiased manner using the image analysis software. The fluorescence in PR was then averaged from six images collected from separate retinal sections from each eye. The inventors then calculated the average fluorescence of the three eyes of each experimental group.
[0253] Quantification of Lipofuscin Autofluorescence
[0254] For lipofuscin fluorescence analysis, eyes were harvested from pigmented Abca4+/− and Abca4−/− mice at 3 months after AAV injection. Mice were dark-adapted over-night and sacrificed under dim red-light. For each eye, four overlapping pictures from the temporal side of three sections from different regions of the eye were taken using a Leica DM5000B microscope equipped with a TX2 filter (excitation: 560±40 nm; emission: 645±75).sup.71-75 and under a 20× objective. The four images for each section were then combined in a single montage used for further fluorescence analysis. Intensity of lipofuscin fluorescence (red signal) in each section was automatically calculated using the ImageJ software and was then normalized for the length of the RPE underlying the area of fluorescence.
[0255] Transmission Electron Microscopy
[0256] For electron microscopy analyses eyes were harvested from albino Abca4−/− and Abca4+/+ mice at 3 months after AAV injection. Eyes were fixed in 0.2% glutaraldehyde-2% paraformaldehyde in 0.1 M PHEM buffer pH 6.9 (240 mM PIPES, 100 mM HEPES, 8 mM MgCl2, 40 mM EGTA) overnight and then rinsed in 0.1 M PHEM buffer. Eyes were then dissected under light microscope to select the tyrosinase-positive portions of the eyecups. The transduced portion of the eyecups were subsequently embedded in 12% gelatin, infused with 2.3 M sucrose and frozen in liquid nitrogen. Cryosections (50 nm) were cut using a Leica Ultramicrotome EM FC7 (Leica Microsystems) and extreme care was taken to align PR connecting cilia longitudinally. To avoid bias in the attribution of morphological data to the various experimental groups, counts of lipofuscin granules were performed by a masked operator (Dr. Roman Polishchuk) using the iTEM software (Olympus SYS, Hamburg, Germany). The ‘Touch count’ module of the iTEM software was used to count the number of lipofuscin granules in 25 μm.sup.2 areas (at least 40) distributed randomly across the RPE layer. The granule density was expressed as number of granules per 25 μm.sup.2.
[0257] Electroretinogram Recordings
[0258] Electrophysiological recordings in mice and pigs were performed as detailed in (68) and in (69), respectively.
[0259] Statistical Analysis
[0260] p-values ≤0.05 were considered statistically significant. One-way ANOVA (R statistical software) with post-hoc Multiple Comparison Procedure was used to compare data depicted in
[0261] Results
[0262] Dual AAV Hybrid Vectors which Include the AP1, AP2 or AK Recombinogenic Regions Show Efficient Transduction
[0263] The inventors evaluated several multiple vector strategies as depicted in
[0264] In particular, they evaluated in parallel the transduction efficacy of dual AAV hybrid vectors with different regions of homology. For this purpose the inventors generated dual AAV2/2 hybrid vectors that include the ABCA4-3×flag coding sequence, under the control of the ubiquitous CMV promoter, and either the AK.sup.14, AP.sup.14, AP1 or AP2.sup.20 regions of homology (
[0265] Inclusion of Heterologous ITR in AAV Vectors Affects their Production Yields and does not Reduce Levels of Truncated Protein Products
[0266] To test if the use of heterologous ITR improve the productive directional concatemerization of dual AAV vectors, the inventors generated dual AAV2/2 hybrid AK vectors that included either ABCA4-3×flag or MYO7A-HA coding sequences with heterologous ITR2 and ITR5 in either the 5:2 (left ITR from AAV5 and right ITR from AAV2) or the 2:5 (left ITR from AAV2 and right ITR from AAV5) configuration (
TABLE-US-00007 TABLE 3 Yields of AAV5:2/2 vectors in the presence of various ratios of Rep5 and Rep2 packaging constructs ITR2 TITRE ID REP5/REP2 (GC/ml) 2202 1:1 1.4E+10 2220 1:1 9.0E+10 2060 1:3 1.1E+11 2222 1:3 2.2E+11 2059 1:10 2.0E+12 2221 1:10 3.4E+12 ID: identification number of AAV5:2/2 vectors; GC: genome copies.
[0267] These results confirmed the competition of Rep5 with Rep2 during the production of vectors with ITR2 and led us to follow Protocol C for the production of AAV vectors with heterologous ITR2 and ITR5. However, several AAV preparations obtained with this strategy revealed: (i) up to 6-fold lower titres determined on ITR2 than titres determined on a transgenic sequence in between the ITR (Table 4) which could suggest that the integrity of ITR2 is compromised and (ii) a mean reduction of about 6-fold in the total yields of AAV vectors with heterologous ITR2 and ITR5 compared to those containing homologous ITR2 (Table 4).
TABLE-US-00008 TABLE 4 Low yields and differences between ITR2 and transgene titres of AAV2 with heterologous ITR2 and ITR5 ITR ITR2 TITRE TRANSGENE TITRE YIELDS ID CONFIGURATION (GC/ml) (GC/ml) (GC × 3.5 ml) 2101 5:2 2.0E+12 2.5E+12 7.9E+12 2136 5:2 2.4E+11 6.0E+11 1.5E+12 2137 5:2 4.4E+11 2.5E+12 5.1E+12 2140 5:2 5.2E+10 1.5E+11 3.5E+11 2102 2:5 4.2E+11 1.2E+12 2.8E+12 2135 2:5 1.5E+12 2.5E+12 7.0E+12 2138 2:5 6.8E+11 1.2E+12 3.3E+12 2139 2:5 4.8E+11 2.5E+12 5.2E+12 AAV2/2 2:2 (8.5 ± 3.7)E+12.sup.a (5.9 ± 2)E+12.sup.a (2.5 ± 0.9)E+13.sup.a (n = 8) ID: identification number of AAV vectors; GC: genome copies. .sup.aValues represent mean ± SEM. However, Southern blot analysis of AAV preparation with heterologous ITR revealed no evident alteration of genome integrity (FIG. 3a).
[0268] To test if the inclusion of heterologous ITR in dual AAV hybrid AK vectors enhanced the formation of tail-to-head productive concatemers and full-length protein transduction while reducing the production of truncated proteins, the inventors infected HEK293 cells with dual AAV hybrid vectors encoding for either ABCA4 or MYO7A with either heterologous ITR2 and ITR5 (in the 5:2/2:5 configuration) or homologous ITR2 (
[0269] Given the difference between the ITR2 and transgene titres for vectors with heterologous but not homologous ITR (Table 4), the inventors infected cells with 10.sup.4 genome copies (GC)/cell of each vector based on either ITR2 or transgene titres. Western blot analysis of HEK293 cells infected with dual AAV vectors based on ITR2 titers, using anti-3×flag (to detect ABCA4-3×flag,
[0270] CL1 Degron in the 5′-Half Vector Decreases the Production of Truncated Protein Products
[0271] To selectively reduce the levels of truncated protein products produced by each 5′- and 3′-half of dual AAV hybrid vectors 14, the inventors placed putative degradation sequences in the 5-half vector after the splicing donor signal between AK and the right ITR, and in the 3′-half vector between AK and the splicing acceptor signal (
[0272] Notably, as shown in
[0273] Among the degradation signals tested in the 3′-half vector the inventors identified three (PB29, 3×PB29 and ubiquitin) that reduced both the levels of truncated protein products and of full-length proteins (
TABLE-US-00009 TABLE 5 Quantification of full-length ABCA4 relative to truncated protein expression from Western blot analysis of HEK293 cells infected with dual AAV hybrid vectors including miR target sites in the 5′-half vector. FULL-LENGTH ABCA4/TRUNCATED miR TARGET PROTEIN SITES +SCRAMBLE +miR 5′-miR-let7b + 3′ 1.2 ± 0.3 0.8 ± 0.3 5′-miR-204 + 124 + 3′ 1.8 ± 0.5 2.7 ± 0.9 5′-miR-26a + 3′ 1.9 ± 0.8 2.5 ± 1.1 Values represent mean ± s.e.m. of the ratios (from three independent experiments) between the intensity of full-length ABCA4 and truncated protein bands in the presence of either the corresponding mimic or a scramble mimic. Ratios in the presence of either the scramble or the corresponding mimic for each pair of vectors were compared using Student's ttest and no significant differences were found.
TABLE-US-00010 TABLE 6 Quantification of full-length ABCA4 and truncated protein expression from Western blot analysis of HEK293 cells infected with dual AAV hybrid vectors including degradation signals in the 3′-half vector. FULL-LENGTH ABCA4/TRUNCATED PROTEIN 5′ + 3′ 5′ + 3′ + DEGRADATION NO DEGRADATION DEGRADATION SIGNALS SIGNAL SIGNAL 3xSTOP 5.9 ± 1.8 4.9 ± 1.1 PB29 5.3 ± 1.1 3xPB29 .sup. 1 ± 0.3 ubiquitin 0.6 ± 0.2 Values represent mean ± s.e.m. of the ratios (from three independent experiments) between the intensity of the full-length ABCA4 and truncated protein bands from vectors either with or without the degradation signals. More details on the statistical analysis including specific statistical values can be found in the Statistical analysis paragraph of the Materials and Methods section
[0274] Subretinal Administration of Improved Dual AAV Vectors Reduces Lipofuscin Accumulation in the Abca4−/− Retina
[0275] Based on our findings improved dual AAV hybrid-ABCA4 vectors should include homologous ITR2, the AK region of homology and the CL1. As ABCA4 is expressed in both rod and cone photoreceptors in humans.sup.70, the inventors identified a suitable promoter for ABCA4 delivery by comparing the PR transduction properties of single AAV2/8 vectors encoding EGFP from either the human GRK1 (G protein-coupled receptor kinase 1) or IRBP (interphotoreceptor retinoid binding protein) promoters, which have been both described to drive high levels of combined rod and cone PR transduction in various species.sup.53-55. Taking advantage of the pig retinal architecture which include a streak-like region with a cone:rod=1:3.sup.56 similar to the human macula, the inventors injected subretinally 1×10.sup.11 GC/eye of either AAV2/8-GRK1- or IRBP-EGFP vectors in 3 month-old Large White pigs. Four weeks after the injection, the inventors analysed the corresponding retinal cryosections under a fluorescence microscope. EGFP fluorescence quantification in the PR cell layer (
[0276] Improved Dual AAV Vectors are Safe Upon Subretinal Administration to the Mouse and Pig Retina
[0277] To investigate the safety of improved dual AAV2/8 hybrid ABCA4 vectors, the inventors injected them subretinally in both wild-type C57BL/6 mice and Large White pigs (dose of each vector/eye: 3×10.sup.9 and 1×10.sup.11 GC, respectively). One month post-injection the inventors measured retinal electrical activity by Ganzfeld electroretinogram (ERG) and found that both the a- and b-wave amplitudes were not significantly different between mouse eyes that were injected with dual AAV hybrid ABCA4 vectors and eyes injected with either negative control AAV vectors or PBS (
Discussion
[0278] AAV restricted packaging capacity represents one of the main obstacles to the widespread application of AAV for gene therapy of IRDs. However, recently, several groups have independently reported that dual AAV vectors effectively expand AAV cargo capacity in both the mouse and pig retina.sup.14, 17, 19, 41 thus extending AAV applicability to IRDs due to mutations in genes that would not fit in a single canonical AAV vector. Here the inventors set-up to overcome some limitations associated with the use of dual AAV vectors, namely their relatively low efficiency when compared to a single vector, and the production of truncated proteins which may raise safety concerns.
[0279] Strategies aiming at increasing dual AAV genome tail-to-head concatemerization should in theory increase the levels of full-length and reduce those of truncated proteins from free single half-vectors. The inventors set to improve tail-to-head dual AAV hybrid genome concatemerization by including either optimal regions of homology or heterologous ITR. In a side-by-side evaluation of previously described regions of homology, the inventors have found that the AP1 and AP2 sequences recently published by Lostal et al..sup.20 and the AK sequence from the F1 phage.sup.14 drive overall similar levels of protein expression in vitro with dual AAV hybrid AK vectors driving more consistent ABCA4 expression in the mouse retina. Independently, the availability of different regions of homology is useful to direct proper concatemerization of triple AAV vectors to further expand AAV cargo capacity.sup.20, 42 Heterologous ITR2 and ITR5 have been successfully included in dual.sup.24, 25 and triple.sup.42 AAV vectors. The inventors found that the yields of AAV vectors with heterologous ITR2 and ITR5 are lower than those with homologous ITR2. The inventors also detected less vector genomes with heterologous ITR when the inventors probe their ITR2 than when the inventors probe a different region of their genome. As the inventors show that Rep5 interferes with production of vectors with ITR2, this suggests anomalies at the level of ITR2 included in AAV vectors with heterologous ITR, which are produced in the presence of Rep5, but not in AAV vectors with homologous ITR2, which are produced only in the presence of Rep2 and that showed similar titres whether the inventors probe ITR2 or a different region of the genome. These results partly differ from those previously reported where dual AAV vectors with heterologous ITR2 and ITR5 had higher transduction efficiency than vectors with homologous ITRs and apparently no production issues.sup.24, 25. Besides the different packaging constructs and production protocols, in this study the inventors used dual AAV hybrid vectors which included regions of homology between the two half-vectors as opposed to the trans-splicing system used in the previous reports which simply relies on the ITR for concatemerization.sup.24, 25. As in dual AAV hybrid vectors the reconstitution of the full-length gene is mainly mediated by the region of homology included in the vectors.sup.16 which direct concatemer formation, this may account for the smaller increase in transgene expression the inventors observed with vectors with heterologous ITR compared to the previous studies that used trans-splicing vectors.sup.24-25. In addition, the inventors may have overestimated the efficiency of the vectors with heterologous ITR as the inventors used them based on a titre calculated on ITR2 which is 3-6-fold lower than the one calculated on the transgenic sequence for MYO7A- and ABCA4-expressing vectors, respectively. As both titres calculated on ITR2 and on the transgenic sequence are similar between the corresponding dual AAV vectors with homologous ITR2, the inventors have used them at a 3-6-fold lower volume than those with the heterologous ITR2 and ITR5. This may explain the apparently higher levels of both full-length and truncated protein products from dual AAV vector with heterologous than with homologous ITR.
[0280] In the inventors' previous studies the inventors did not observe signs of local toxicity up to 8 months after subretinal administration of dual AAV vectors.sup.14, however, the production of truncated protein products from single half-vectors of dual AAV might raise safety concerns. The inclusion of miR target sites in the transcript of a gene has been shown to be an effective strategy to restrict transgene expression in various tissues, including the retina.sup.30. However in vitro the inventors achieved a partial reduction of truncated protein production only when the inventors included target sites for miR-204+124 and 26a. Indeed, features of the mRNA external to the miR target sites may affect the efficiency of the silencing.sup.43, 44. Along this line, since the truncated protein products that derive from the 5′-half is produced from a vector that is not endowed with a canonical polyadenilation signal, it may be possible that the resulting mRNA can not undergo an efficient miR-mediated silencing. Importantly, the inventors achieved complete degradation of the truncated protein product from the 5′-half vector by inclusion of the CL1 degron. The inventors showed that this signal is effective both in vitro and in the pig retina, indicating that the enzymes of the degradative pathway required for CL1 activity are expressed in various cell types. As the truncated protein product from the 3′-half vector is less abundant than that produced by the 5′-half vector (
[0281] Notably, the inventors found that subretinal administration of improved dual AAV vectors, under the control of the GRK1 promoter, which provides high levels of combined rod and cone transduction, results in effective ABCA4 delivery in mice, although at variable levels. This could be due to both the inherent variability of the subretinal injection in the small murine eye and the overall lower efficacy of the dual AAV system compared to a single AAV vector.sup.14. Despite this variability, the inventors found that dual AAV mediated ABCA4 delivery results in significant lipofuscin reduction in the Abca4−/− retina suggesting that a wide range of transgene expression levels can similarly contribute to therapeutic efficacy. This was observed using two independent techniques, however, more pronounced improvement of the phenotype was observed when the inventors dissected and analysed the AAV transduced area of the retina that indeed showed normalization of the number of lipofuscin granules. In conclusion, the invention provides multiple vectors with improved features suitable for clinical application, in particular for the therapy of retinal diseases. In addition, the invention improves the safety and efficacy of multiple vectors which further expand cargo capacity.sup.20, 42.
REFERENCES
[0282] 1. Trapani, I, et al (2014). Progress in retinal and eye research 43: 108-128. [0283] 2. Boye, S E, Boye, S L, Lewin, A S, and Hauswirth, W W (2013). Molecular therapy: the journal of the American Society of Gene Therapy 21: 509-519. [0284] 3. Bainbridge, J W, et al. (2008). The New England journal of medicine 358: 2231-2239. [0285] 4. Maguire, A M, et al. (2009). Lancet 374: 1597-1605. [0286] 5. Maguire, A M, et al. (2008). The New England journal of medicine 358: 2240-2248. [0287] 6. Cideciyan, A V, et al. (2009). Human gene therapy 20; 999-1004. [0288] 7. Simonelli, F, et al. (2010). Molecular therapy: the journal of the American Society of Gene Therapy 18: 643-650. [0289] 8. Allikmets, R, et al. (1997). Nature genetics 15: 236-246. [0290] 9. Molday, R S, and Zhang, K (2010). Progress in lipid research 49: 476-492. [0291] 10. Millan, J M, et al. (2011). Journal of ophthalmology 2011: 417217. [0292] 11. Hasson, T, et al. (1995). PNAS 92: 9815-9819. [0293] 12. Liu, X, Ondek, B, and Williams, D S (1998). Nature genetics 19: 117-118. [0294] 13. Gibbs. D, et al. (2010). Investigative ophthalmology & visual science 51: 1130-1135. [0295] 14. Trapani, I, Colella, P, Sommella, A, Iodice, C. Cesi, G, de Simone, S, et al. (2014). Effective delivery of large genes to the retina by dual AAV vectors. EMBO molecular medicine 6: 194-211. [0296] 15. Duan, D. Yue, Y, and Engelhardt, J F (2001). Molecular therapy: the journal of the American Society of Gene Therapy 4: 383-391. [0297] 16. Ghosh, A, Yue, Y, Lai, Y, and Duan, D (2008). Molecular therapy: the journal of the American Society of Gene Therapy 16: 124-130. [0298] 17. Dyka, F M, et al., (2014). Human gene therapy methods 25: 166-177. [0299] 18. Lopes, V S, et al. (2013). Gene Ther. [0300] 19. Colella, P, et al. (2014). Gene Ther 21: 450-456. [0301] 20. Lostal, W, Kodippili, K, Yue, Y, and Duan, D (2014). Human gene therapy 25: 552-562. [0302] 21. Flotte, T R, et al. (1993). The Journal of biological chemistry 268: 3781-3790. [0303] 22. Ghosh, A, Yue, Y, and Duan, D (2011). Human gene therapy 22: 77-83. [0304] 23. Chiorini, J A, et al., (1999). Journal of virology 73: 1309-1319. [0305] 24. Yan, Z, Zak, R, Zhang, Y. and Engelhardt, J F (2005). Journal of virology 79: 364-379. [0306] 25. Yan, Z, et al. (2007). Human gene therapy 18: 81-87. [0307] 26. Karali, et al. (2010). BMC genomics 11: 715. [0308] 27. Kutty, R K, et al. (2010). Molecular vision 16: 1475-1486. [0309] 28. Ragusa, M, et al. (2013). Molecular vision 19: 430-440. [0310] 29. Sundermeier, T R, and Palczewski, K (2012). Cellular and molecular life sciences: CMLS 69: 2739-2750. [0311] 30. Karali, M, et al. (2011). PloS one 6: e22166. [0312] 31. Gilon, T, Chomsky, O, and Kulka, R G (1998). The EMBO journal 17: 2759-2766. [0313] 32. Bence, N F, Sampat, R M, and Kopito, R R (2001). Science 292: 1552-1555. [0314] 33. Bachmair, A, Finley. D, and Varshavsky, A (1986). Science 234: 179-186. [0315] 34. Johnson, E S, et al., (1992). The EMBO journal 11: 497-505. [0316] 35. Sadis, S, et al., (1995). Molecular and cellular biology 15: 4086-4094. [0317] 36. Chiorini, J A, Afione, S, and Kotin, R M (1999). Journal of virology 73: 4293-4298. [0318] 37. Tian, W, et al. (2012). PloS one 7: e29551. [0319] 38. Wang, Z (2011). Methods in molecular biology 676: 211-223. [0320] 39. Mussolino, C, et al. (2011). Gene Ther 18: 637-645. [0321] 40. Hendrickson, A, and Hicks, D (2002). Experimental eye research 74: 435-444. [0322] 41. Reich, S J, et al. (2003). Human gene therapy 14: 37-44. [0323] 42. Koo, T, et al., (2014). Human gene therapy 25: 98-108. [0324] 43. Walters, R W, Bradrick, S S, and Gromeier, M (2010). Rna 16: 239-250. [0325] 44. Ricci, E P, et al. (2011). Nucleic acids research 39: 5215-5231. [0326] 45. Auricchio, et al. (2001). Human molecular genetics 10: 3075-3081. [0327] 46. Gao, G, et al. (2000). Human gene therapy 11: 2079-2091. [0328] 47. Young, J E, et al., (2003). Investigative ophthalmology & visual science 44: 4076-4085. [0329] 48. Doria, M, et al., (2013). Human gene therapy methods 24: 392-398. [0330] 49. Zhang, Y, et al., (2000). Journal of virology 74: 8003-8010. [0331] 50. Drittanti, L, et al., (2000). Gene Ther 7: 924-929. [0332] 51 Gargiulo, S, et al. (2012). ILAR journal/National Research Council, Institute of Laboratory Animal Resources 53: E70-81. [0333] 52. Liang, F Q, et al., (2001). Methods in molecular medicine 47: 125-139. [0334] 53. Beltran, et al. (2012) Proc. Natl. Acad. Sci. U.S.A. 109, 2132-2137. [0335] 54. Boye, S. E., et al. (2012) Hum. Gene Ther., 23, 1101-1115. [0336] 55. Khani, S. C., et al., (2007) Invest. Ophthalmol. Vis. Sci., 48, 3954-3961. [0337] 56. Chandler, M. J., et al., (1999) Vet. Ophthalmol., 2, 179-184. [0338] 57. Li, A., Zhu, X. and Craft, C. M. (2002) Invest. Ophthalmol. Vis. Sci., 43, 1375-1383. [0339] 58. Allocca, M., et al. (2008) J. Clin. Invest., 118, 1955-1964. [0340] 59. Parish, C. A., et al., (1998) Proc. Natl. Acad. Sci. U.S.A. 95, 14609-14613. [0341] 60. Ben-Shabat, S., et al., (2002) J. Biol. Chem., 277, 7183-7190. [0342] 61. Gargiulo, S., et al., (2012) ILAR J, 53. E70-81. [0343] 62. Liang, F. Q., et al., (2001) Methods Mol. Med., 47, 125-139. [0344] 63. Gargiulo, A., et al. (2009) Mol. Ther., 17, 1347-1354. [0345] 64. Manfredi, A., et al. (2013) Hum. Gene Ther., 24, 982-992. [0346] 65. Venables V N and Ripley B D. (2002) Modern Applied Statistics with S. Springer Science+Business Media, New York, USA. [0347] 66. Li, A., Zhu. X., Brown, B. and Craft, C. M. (2003) Adv. Exp. Med. Biol., 533, 361-368. [0348] 67. Li, A., et al. (2003) Invest. Ophthalmol. Vis. Sci., 44, 996-1007. [0349] 68. Allocca, M., et al. (2011) Invest. Ophthalmol. Vis. Sci., 52.5713-5719. [0350] 69. Testa, F., et al. (2011) Invest. Ophthalmol. Vis. Sci., 52, 5618-5624. [0351] 70. Molday, L. L., Rabin, A. R. and Molday, R. S. (2000) Nat. Genet., 25, 257-258. [0352] 71. Sparrow, J. R., Wu, Y., Nagasaki, T., Yoon, K. D., Yamamoto, K. and Zhou, J. (2010) Photochem Photobiol Sci, 9, 1480-1489. [0353] 72. Sparrow, J. R. and Duncker, T. (2014) J Clin Med, 3, 1302-1321. [0354] 73. Finnemann, S. C., Leung, L. W. and Rodriguez-Boulan, E. (2002) Proc. Nat. Acad. Sci. U.S.A, 99, 3842-3847. [0355] 74. Secondi, R., Kong, J., Blonska. A. M., Staurenghi, G. and Sparrow, J. R. (2012) Invest. Ophthalmol. Vis. Sci., 53, 5190-5197. [0356] 75. Delori, F. C., Dorey, C. K., Staurenghi, G., Arend, O., Goger, D. G. and Weiter, J. J. (1995) Invest. Ophthalmol. Vis. Sci., 36, 718-729.