IN VITRO PRODUCTION OF HIGH AFFINITY MONOCLONAL ANTIBODIES

20220002670 · 2022-01-06

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to a method for the in vitro generation of antigen-specific antibodies or cells producing thereof, said method comprising culturing B cells with an antigen-coated carrier for at least 3 days, wherein said antigen-coated carrier has a size between 0.5 μm and 20 μm, and co-culturing the B cells obtained from step a) with CD4+ T cells for at least 3 days. Thus, high-affinity class-switched immunoglobulins of clinical and diagnostic interest are produced in vitro.

    Claims

    1. A method for the in vitro generation of antigen-specific antibodies or cells producing thereof, said method comprising: a) culturing B cells with an antigen-coated carrier for at least 3 days, wherein said antigen-coated carrier has a size between 0.5 μm and 20 μm, and b) co-culturing the B cells obtained from step a) with CD4+ T cells for at least 3 days.

    2. The method according to claim 1, wherein the B-cells from step a) are naïve B cells expressing non-class-switched immunoglobulins or memory B cells expressing class-switched immunoglobulins.

    3. The method according to claim 1 or 2, wherein the CD4.sup.+ T cells of step b) are naïve CD62L.sup.+, CD4.sup.+ T cells or memory CD44.sup.+, CD4.sup.+ T cells.

    4. The method according to any one of claims 1 to 3, wherein step a) and b) are simultaneously executed.

    5. The method according to any one of claims 1 to 4, wherein said method is further characterized by the absence in the culture of step a) of cells with antigen presenting capacity other than the B cells.

    6. The method according to any one of claims 1 to 5, wherein the size of the antigen-coated carrier is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 μm.

    7. The method according to any one of claims 1 to 6, where the antigen-coated carrier from step a) is an aggregate of small particles or a magnetic particle, preferably, a paramagnetic particle.

    8. The method according to any one of claims 1 to 7, wherein said B cells are follicular B cells comprising low expression levels of CD21, high expression levels of CD23, and CD43 negative.

    9. The method according to any one of claims 1 to 8, wherein the ratio of B cells to CD4+ T cells in step b) is 1:1.

    10. The method according to any one of claims 1 to 9, wherein the cells of step a) are human cells.

    11. The method according to any one of claims 1 to 10, wherein said antigen is selected from the group consisting of an hapten, peptide and protein, or a fragment of any thereof, preferably, the protein is a glycoprotein or a lipoprotein.

    12. The method according to any one of claims 1 to 11, wherein said antigen is derived from a pathogen, preferably selected from the group consisting of virus, bacteria, yeast and protozoa.

    13. The method according to any one of claims 1 to 12, wherein said method results in the production of high affinity class switched antibodies, wherein high affinity antibodies are characterized by binding to their antigen with a dissociation constant (KD) of 10.sup.−5 to 10.sup.−12 moles/liter or less.

    14. The method according to any of claims 1 to 13, wherein said method further comprises: c) selecting cells producing high affinity antigen-specific antibodies; and d) optionally, before or after the selection step in c) isolating and/or immortalizing said cells.

    15. The method according to claim 14, wherein the cells selected in step c) are producing high affinity class switched antibodies, preferably selected from the group consisting of IgG and IgA isotypes, more preferably selected from the group consisting of IgG1, IgG2a, IgG3 and IgA isotypes.

    16. A high affinity class switched antibody obtained by a method according to any one of claims 1 to 15, preferably, the high affinity antibody is characterized by binding to their antigen with a dissociation constant (KD) of 10-5 to 10-12 moles/L or less.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0096] FIG. 1. B cells can take up antigen and present it to T cells by a phagocytotic mechanism. (A) Flow cytometry plots of WT and RhoG-deficient B cells incubated for 1 h with Crimson fluorescent 1 μm beads coated with goat anti-mouse anti-IgM. Cells were later stained with an anti-goat Alexa 488 antibody to distinguish cells with beads attached to the cell surface (out) from cells having beads exclusively inside (in). Number of phagocytosed beads is calculated by the stepwise increase in Crimson fluorescence intensity. (B) A phagocytic index was calculated according to the number of phagocytic events for B cells incubated for 1 hour or 2 hours with either 1 μm or 3 μm beads coated with anti-IgM. B cells were of wild type (circles), Rras2−/− (triangles) or Rhog−/− (squares) mice. Data represent the mean±S.D. (n=3). * p<0.05; ** p<0.005; *** p<0.0005 (unpaired Students t test). (C) Phagocytic Index for WT B cells incubated for 1 hour with 1 μm, 3 μm and 10 μm beads coated with anti-IgM. Data represent the mean±S.D. (n=3). (D) Optical midplane section of follicular B cells in the process of phagocytosing 1 μm and 3 μm beads coated with anti-IgM. Completely phagocytosed beads, negative for anti-goat IgG, are indicated with an arrow, and non-phagocytosed or partly phagocytosed beads are indicated with an asterisk. (E) Proliferation of naïve OT-2 CD4+ T cells in response to antigen presentation by B cells preincubated with the indicated bead/cell ratios of 1 μm beads coated with anti-IgM, OVA or anti-IgM plus OVA. A proliferation index was calculated according to the number of cell divisions identified by Cell Trace Violet (CTV) dilution as illustrated in the left panel for T cells incubated with wild type B cells (WT or RhoG-deficient (Rhog−/−). Bar plot to the right represents mean±S.D. (n=3). * p<0.05 (unpaired Student's t test). (F) Induction of CD25 expression by OT-2 T cells incubated with phagocytic B cells as in (E) for 3 days. Histogram to the left shows an overlay of CD25 expression in OT-2 cells incubated with: wild type B cells preincubated with beads coated with anti-IgM plus OVA (WT line), with RhoG-deficient B cells preincubated with IgM plus OVA (Rho−/− line) B cells preincubated with beads coated with IgM plus OVA, or with wild type B cells preincubated with beads coated with IgM alone (grey shaded). Bar plot to the right represents mean±S.D. (n=3). * p<0.05; ** p<0.005; **** p<0.00005 (unpaired Student's t test). (G) Induction of TFH marker (PD1 and CXCR5) expression in OT-2 T cells after 3 days of culture with WT or RhoG-deficient B as in (E). Bar plots represent the percentage of double positive OT-2 T cells. Data represent the mean±S.D. (n=3). ** p<0.005 (unpaired Student's t test).

    [0097] FIG. 2. Phagocytosis of bead-bound antigen by B cells induces the expression of Tfh markers and release of cytokines by OT2 CD4+ T cells. (A) Proliferation of naïve OT2 CD4+ T cells in response to antigen presentation by B cells preincubated with the indicated doses of 1 μm and 3 μm beads coated with NIP-OVA. The dose of beads is normalized according to their exposed surface considering them as spheres. The bead/B cell ratios for 1 μm beads used were 0.1:1 to 3:1; for 3 μm beads were: 0.033:1 to 3.3:1. T cell proliferation was calculated by CTV dilution at day 4 after stimulation. Data represents mean±S.D. (n=3). (B) Induction of Tfh marker (PD1 and CXCR5; PD1 and ICOS) expression in OT2 CD4+ T cells after 4 days of culture with WT B cells as in (A). Data represents mean±S.D. (n=3).). (C) Cytokine release by OT2 CD4+ T cells incubated with B cells preincubated with the indicated doses of 1 μm and 3 μm beads coated with NIP-OVA as in (A). Cell supernatants were collected at day 4 and cytokine content determined using the multiplexed CBA Array. Data represents mean±S.D. (n=3). (D) Cytokine release by OT2 CD4+ T cells incubated with either WT or RhoG-deficient B cells preincubated with a 3:1 1 μm bead/B cell ratio of beads coated with NIP-OVA, or without beads. Cell supernatants were collected at day 7 and cytokine content determined by ELISA. Data represents mean±S.D. (n=3).

    [0098] FIG. 3. B cells differentiate in vitro into GC B cells upon their activation with phagocytic antigen and T-cell help. (A) Naïve B cells from WT and Rhog−/− mice were preincubated with 1 μm beads coated with IgM plus OVA or IgM alone, at a 10:1 bead/cell ratio, and co-cultured for 3 days with OT-2 T cells (1:1 B/T cell ratio). FACS contour-plots to the left show the appearance of a double positive (CD95+GL7+) population in gated B220+ B cells. Bar plot to the right represents mean±S.D. (n=3). * p<0.05; ** p<0.005 (unpaired Student's t test). (B) Proliferation of B cells after 3 days of culture was calculated by CTV dilution as in FIG. 1E. Data represent the mean±S.D. (n=3). ** p<0.05; ** p<0.005 (unpaired Student's t test). (C) Naïve B cells from B1-8hi transgenic WT and Rhog−/− mice were preincubated with 1 μm beads coated with NIP-OVA or NP-CGG, at a 3:1 bead/cell ratio, and co-cultured for 4 days with OT-2 T cells (1:1 B/T cell ratio). FACS contour-plots to the left show the appearance of a double positive (CD95+GL7+) population in gated B220+ B cells. Bar plot to the right represents mean±S.D. (n=3). ** p<0.005; *** p<0.0005 (unpaired Student's t test). (D) Proliferation of B cells from B1-8hi transgenic WT and Rhog−/− mice was calculated after 4 days of culture by CTV dilution as in FIG. 1E. Data represent the mean±S.D. (n=3). * p<0.05 (unpaired Student's t test). (E) Differentiation of naïve B cells from B1-8hi transgenic WT mice to GC B cells was followed along 7 days of culture in vitro with beads coated with either NIP-OVA or NP-CGG and OT-2 T CD4+ T cells. The percentage of GC B cells was calculated according to GL7 expression and intracellular Bcl-6 expression. Line plot to the right represents mean±S.D. (n=3). (F) Expression of master gene regulators of GC (Bcl-6) and plasmacytic cell differentiation (Blimp-1) in function of the number of cell divisions by naïve B cells from B1-8hi transgenic WT mice stimulated 3-4 days in vitro with 1 μm beads coated with either NIP-OVA or NP-CGG and OT-2 T CD4+ T cells. Number of cell divisions was assessed by CTV dilution. (G) Expression of Bcl-6 and Blimp-1 measured simultaneously in function of the number of cell divisions by naïve B cells f rom B1-8hi transgenic WT mice stimulated 34 days in vitro with 1 μm beads coated with NIP-OVA and OT-2 T CD4+ T cells. Number of cell divisions was assessed by CTV dilution. Data represent mean±S.D. (n=3).

    [0099] FIG. 4. Phagocytosis of bead-bound antigen by B cells induces the expression of GC B cell markers. (A) Non-transgenic B cells from WT and Rhog−/− mice were preincubated with 1 μm beads coated with IgM+OVA or IgM alone, at a 20:1 bead/cell ratio, and co-cultured for 3 days with OT2 T cells (1:1 B/T cell ratio). Overlay histogram to the left show the upregulation of CD40 expression in gated WT B220+ B cells compared to their RhoG-deficient counterparts. Bar plot to the right represents mean±S.D. (n=3): * p<0.05; ** p<0.005 (unpaired Student's t test). (B) Differentiation of naïve B cells from B1-8hi transgenic WT mice to GC B cells was followed along 7 days of culture in vitro with beads coated with either NP-OVA or NP-CGG and OT2 T CD4+ T cells. The percentage of GC B cells was calculated according to GL7 and CD38 expression. Line plot to the right represents mean±S.D. (n=3).

    [0100] FIG. 5. Phagocytic antigen induces the formation of large clusters of intermingled B and T cells. (A) Confocal microscopy image of a large cell cluster generated after 4 days of co-culture of OT-2 T cells and non-transgenic B cells stimulated with 1 μm beads coated with anti-IgM and OVA. B cells are stained with B220; OT-2 T cells with CD4. A quantification of the number of cells per cluster is shown in the plot to the right. (B) Confocal microscopy image of cell clusters generated after 7 days of incubation of naïve B cells from B1-8hi transgenic WT mice with OT-2 T cells and either 1 μm beads coated with NIP-OVA or with soluble NIP-OVA. Cell number quantification per cluster for both antigen conditions is represented in the graph to the right. Data represent the mean±S.D. * p<0.05 (unpaired Student's t test). (C) Confocal microscopy image of a cluster of B1-8hi transgenic WT B cells labeled with CTV and cultured for 4 days with CFSE-labeled OT-2 T cells and 1 μm beads coated with NIP-OVA. The intensity of CFSE and CTV staining was measured for all cells placed within the drawn concentric areas and represented in the plot to the right in function of the distance to the center of the cluster. Data represent the mean±S.D. for n=5 clusters of similar size. (D) Confocal microscopy of a cluster generated by stimulation of B1-8hi WT B cells with 1 μm beads coated with NIP-OVA for 7 days and stained with the B220 B cell marker and the GL7 GC marker. GL7 intensity in function of the distance to the center of the cluster was measured as in FIG. 3C. Line plot to the right represents the mean±S.D. for n=5 clusters of similar size.

    [0101] FIG. 6. A phagocytic antigen is more efficient than a soluble one at inducing GC B cells in vitro. (A) Proliferation of OT-2 T cells after 4 days of culture with WT B1-8hi B cells stimulated at different doses of bead-bound or soluble NIP-OVA antigen. Arrows indicate the bead/B cell ratio (3:1) and soluble antigen concentration (100 ng/mL) that induce comparable OT-2T cell proliferation. (B) Graph plots of TFH markers (CXCR5 and PD1) and proliferation of OT-2 T cells after 4 days of culture with the antigen conditions selected in (A). (C) Contour plots of germinal center marker (CD95 and GL7) expression in B1-8hi B cells after 4 days of culture as in (A). Bar plots below show the percentage of CD95+GL7+ B cells and B cell proliferation. B1-8hi B cells stimulated with bead-bound NIP-OVA but without OT-2 T cells were used as control. Data represent the mean±S.D. (n=3). * p<0.05; ** p<0.005 (unpaired Student's t test). (D) RT-qPCR analysis of expression of the indicated genes performed on sorted WT or Rhog−/− B1-8hi B cells after 7 days of culture with OT-2 and specific stimulus as in (A) and (C). Bar plots show the fold induction expression of genes relative to the bead-bound WT condition. HPRT and 18S were used as normalizers. Data represent the mean±S.D. (n=3). (E) Contour plots showing the appearance of Ig class-switched IgG1+IgD− B1-8hi B cells after 4 days in culture as in (A). Line plot to the right shows the appearance of IgG1+ B cells along 4 and 7 days in culture. Data represent the mean±S.D. (n=3). ** p<0.005 (unpaired Student's t test). (F) Contour plots showing the appearance of plasma cells (B220+CD138+IgD−) after 4 days in culture as in (A). Bar plots below show the percentage of plasma cells (B220int CD138+IgD−) and non-germinal center (B220hi CD138− IgD+) B cells in those cultures. Data represent the mean±S.D. (n=3). ** p<0.005 (unpaired Student's t test). (G) Contour plots illustrates the generation of IgG1+ plasmablasts (B220int IgG1+CD138+) after 4 days in culture as in (A). Bar plots to the right represent the mean±S.D. (n=3). * p<0.05 (unpaired Student's t test).

    [0102] FIG. 7. Generation of somatic mutations in IgH V genes in conditions of GC formation in vitro. (A) Number of IgH nucleotide mutations and frequency of non-silent mutations in the IgH V sequence of sorted B cells from B1-8hi transgenic WT or RhoG-deficient mice stimulated with a 3:1 bead/cell ratio of 1 μm beads coated with NP-OVA or with 100 ng/mL of soluble NP-OVA and co-cultured for 7 days with OT2 T cells. (B) Sequences (SEQ ID NO: 15) of the B1-8Vh genes with amino acid replacement mutations detected in the NIP-OVA bead stimulated cultures and their distribution according the 3 CDR regions.

    [0103] FIG. 8. A phagocytic antigen induces the production of high-affinity class-switched and neutralizing antibodies in vitro. (A) Detection of high-affinity and low-affinity anti-NP Igs in supernatants from WT or Rhog−/− B1-8hi B cells cultured for 7 days with OT-2 T cells and bead-bound NIP-OVA (3:1 1 μm bead/B cell ratio). Data represent the mean±S.D. (n=3). (B) Detection of high- and low-affinity anti-NP Igs in supernatants of B1-8hi B cells stimulated with soluble or bead-bound NIP-OVA together with OT-2 T cells for 7 days. Data represent the mean±S.D. (n=3). (C) Detection of high affinity anti-NP Igs and anti-HIV Env protein Igs in culture supernatants of non-transgenic B cells stimulated with 1 μm beads (3:1 ratio) coated with NIP-OVA and HIV Env recombinant protein together with OT-2 T cells for 7 days or 10 days. 10-day cell cultures were supplemented at day 5 with 1 ng/ml IL-4 and 10 ng/mL IL-21. Data represent the mean±S.D. (n=3). (D) Presence of HIV neutralizing antibodies in the culture supernatants of (C) manifested as the inhibition of entry of GFP-expressing HIV virions coated with either the HIV Env protein or pseudotyped with the VSV G protein in MOLT-4 T cells. Data represent the mean±S.D. (n=3). p values were assessed using an unpaired Student's t test.

    [0104] FIG. 9. Generation of a GC reaction by phagocytic B cells and helper T cells does not require a third cell type. (A) Sorting of naïve follicular B cells from B1-8hi transgenic WT mice and of naïve CD4+ T cells from OT2 transgenic WT mice. The Dump channel contain the CD11b+ and CD43+ cells (for follicular B cell sorting) and the B220+, CD11 b+, CD8+, NK1.1+, F480+ cells (for CD4+ T cells). (B) Sorted B and T cells as in (A) were incubated with either 1 μm beads coated with NIP-OVA or NP-CGG (3:1 bead:B cell ratio), or with 100 ng/mL soluble NP-OVA for 4 days at a 1:1 B/T cell ratio. FACS contour-plots to the left show the appearance of a double positive (CD95+GL7+) population in gated B220+ B cells. Bar plot to the right represents mean±S.D. (n=3): * p<0.05; ** p<0.005 (unpaired Student's t test). (C) Detection of high-affinity anti-NP Igs in supernatants from B and T cell cultures prepared as in (A) and (B) incubated for 7 days (3:1 1 μm bead/B cell ratio) and soluble antigen concentration. Data represent the mean±S.D. (n=3).

    [0105] FIG. 10. A phagocytic antigen induces a stronger and more sustained BCR signal than a soluble one. (A) Surface BCR saturation plot of purified B1-8hi B cells incubated with bead-bound or soluble NIP-OVA antigen at different doses for 1 hour at 0° C. Free unbound BCR was estimated by staining with NP-PE. Data represent the mean±S. D. (n=3). Arrows indicate the bead-dose and soluble concentration determined previously with comparable effects on OT-2 T cell proliferation (FIG. 4A). (B) BCR downmodulation was estimated according to anti-IgM staining of B1-8hi B cells after stimulation with bead-bound (square, 3:1 ratio) or soluble (circle, 100 ng/ml) NIP-OVA antigen for different time-points at 37° C. Data represent the mean±S.D. (n=3). (C) F-actin content was measured by phalloidin staining of B11-8hi B cells after stimulation with bead-bound (square, 3:1 ratio) or soluble (circle, 100 ng/ml) NIP-OVA antigen for different time-points at 37° C. Data represent the mean±S.D. (n=3). * p<0.05; ** p<0.005 (unpaired Student's t test). (D) Immunoblot analysis of phosphorylation events downstream of the BCR after stimulation of WT B11-8hi B cells with either a 3:1 ratio of bead-bound NIP-OVA or with 100 ng/ml of soluble NIP-OVA for different time-points. Plots to the right show protein phosphorylation levels relative to the amount of actin quantified by densitometry. (E) Immunoblot analysis of phosphorylation events downstream of the BCR after stimulation of WT or RhoG-deficient (RhoG−/−) B1-8hi B cells with a 3:1 ratio of bead-bound NIP-OVA for different time-points. Plots to the right show protein phosphorylation levels relative to the amount of actin quantified by densitometry. (F) Midplane confocal microscopy images of B11-8hi B cells in the process of phagocytosing (5 min. of incubation) or having completely phagocytosed (30 min.) 1 μm beads coated with NIP-OVA. Details of the phagocytic cups (5 min) and the phagosomes (30 min.) are shown in the enlarged pictures. Histogram overlays show the signal intensity of the B220 B cell marker, beads and p-Syk along the lines drawn in the main images.

    [0106] FIG. 11. Phagocytosis of antigen by B cells mediates the adjuvant effect of alum in vivo. (A) Phagocytosis of 1 μm fluorescent (Crimson) beads covalently bound to NIP-OVA by spleen B cells of WT or Rhog−/− B11-8hi mice was assessed 5 hours after bead administration i.p. Splenic B cells were identified by double labeling with CD19 and B220 and within B cells, the BCR transgene bearing population by staining with NP-PE. The percentage of B cells that had phagocytosed beads was calculated according to the acquisition of Crimson dye fluorescence and negative staining with extracellular anti-OVA. Plot to the right represents the mean±S.D. (n=3). * p<0.05 (unpaired Student's t test). (B) Expression of GC GL7 and CD95 B cell markers in WT and Rhog−/− mice 7 days after i.p immunization with NIP-OVA covalently bound to 1 μm beads. Plot represents the mean±S.D. (n=3) of selected populations. ** p<0.005 (unpaired Student's t test). (C) Adoptive transfer of purified CD45.2+ B cells from WT or Rhog−/− mice to WT CD45.1+ recipient mice was followed by i.p immunization with NIP-OVA covalently bound to 1 μm beads. Seven days later spleen cells were analyzed for CD95 and GL7 GC marker expression within the transferred CD45.2+ B220+ and the endogenous CD45.1+ B220+ populations. Plots represent the mean±S.D. (n=3) of selected populations. ** p<0.005; n.s., not significant (unpaired Student's t test). (D) Detection of high-affinity anti-NP Igs in sera from WT or Rhog−/− non-transgenic mice 20 days after the first immunization either with soluble NIP-OVA or a NIP-OVA plus alum complex Data represent the mean±S.D. (n=3). ** p<0.005 (unpaired Student's t test). (E) Detection of high- and low-affinity anti-NP Igs in sera from Rag1−/− mice adoptively transferred with purified OT-2 CD4+ T cells and either WT or Rhog−/− B cells and immunized with NIP-OVA plus alum complex Sera were taken 16 days after the first immunization. Data represent the mean±S.D. (n=2). **** p<0.00005; ***** p<0.000005 (unpaired Student's t test).

    [0107] FIG. 12. Splenic follicular and MZ B cells phagocytose antigen-coated beads by a RhoG-dependent process. (A) WT spleen B11-8hi B cells were incubated in vitro with fluorescent 1 μm beads coated with NIP-OVA at 0° C. for 1 hour and subsequently were stained or not with an anti-OVA antibody. B cells that had bound beads but did not internalize them were Crimson+ and positive for anti-OVA staining. (B) Phagocytosis of 1 μm fluorescent (Crimson) beads covalently bound to NIP-OVA by spleen B cells of WT or Rhog−/− B1-8hi mice was assessed 5 hours after bead administration i.p. Follicular (FO) and marginal zone (MZ) splenic B cells were identified within the CD19+ population by CD21 and CD23 staining. Non-transgenic WT mice was inoculated in parallel as a control group. The percentage of follicular and MZ B cells that had phagocytosed beads was calculated according to their positivity to Crimson dye and negative staining with extracellular anti-OVA. Plot to the right represents the mean±S.D. (n=3). * p<0.05 (unpaired Student's t test). (C) Phagocytosis of beads inoculated i.p. by spleen macrophages was assessed in the samples studied in B after staining with CD11 b and F4/80 markers. Plot to the right represents the mean±S.D. (n=3). * p<0.05 (unpaired Student's t test).

    [0108] FIG. 13. Rhog−/− mice are not deficient in the GC response to immunization with SRBC. (A) Percentage of T and B cells and of Tfh and GC B cells in the spleen of WT and Rhog−/− mice 7 days after immunization with SRBC. (B) Percentage of T and B cells and of GC B cells in Peyer's Patches of non-immunized WT and Rhog−/− mice. Bar plots represents mean±S.D. (n=3 mice per group).

    [0109] FIG. 14. Phagocytosis of antigen by B cells mediates the adjuvant effect of alum in vivo. (A) Adoptive transfer of purified CD45.2+ B cells from WT or Rhog−/− mice to WT CD45.1+ recipient mice was followed by i.p immunization with NIP-OVA plus alum complex Seven days later spleen cells were analyzed for CD95 and GL7 GC marker expression, NP-binding capability and IgG1 expression within the transferred CD45.2+ B220+ population. Plots represent the mean±S.D. (n=3) of selected populations. ** p<0.005 **** p<0.00005; ***** p<0.000005 (unpaired Student's t test). (B) Detection of low-affinity anti-NP Igs in sera from Rag1−/− mice adoptively transferred with purified OT-2 CD4+ T cells and either WT or Rhog−/− B cells and immunized with NIP-OVA plus alum complex Sera were taken 14 days after immunization. Data represent the mean±S.D.

    EXAMPLE

    [0110] I. Materials and Methods

    [0111] Mice

    [0112] Rras2−/− and Rhog−/− mice were generated as previously described (Delgado, et al. (2009). Nat Immunol. 10, 880-888; Vigorito, E. et al. (2004). Mol Cell Biol. 24, 719-729). Those mice were crossed with NP-specific B1-8hi knocking mice bearing a pre-rearranged V region (Shih, T. A., et al. (2002). Nat Immunol. 3, 399-406). Mice transgenic for the OT-2 TCR specific for a peptide 323-339 of chicken ovoalbumin presented by I-Ab (Barnden, M. J., et al. (1998). Immunol Cell Biol. 76, 34-40) and C57BL/6 bearing the pan-leukocyte markerallele CD45.1 were kindly provided by Dr. Carlos Ardavin (CNB, Madrid). Mice carrying the Rag1tm1Mom mutation in homozygosis lack both T and B cells (Mombaerts, P., et al. (1992). Cell. 68, 869-877) and were kindly provided by Dr. Cesar Cobaleda (CBMSO, Madrid). All animals were backcrossed to the C57BL/6 background for at least 10 generations. For all in vivo experiments age (6-10 weeks) and sex were matched between the Rhog+/+(WT) and Rhog−/− mice. Mice were maintained under SPF conditions in the animal facility of the Centro de Biologia Molecular Severo Ochoa in accordance with applicable national and European guidelines. All animal procedures were approved by the ethical committee of the Centro de Biologia Molecular Severo Ochoa.

    [0113] Antigen-Coated Bead Preparation

    [0114] To prepare beads with adsorbed antigen, carboxylated latex beads of 1 μm diameter, a total of 130×10.sup.6 beads were incubated overnight with a concentration of 40 μg/ml of protein in 1 mL of PBS at 4° C. For preparation of antigen-coated beads of 3 and 10 m diameter the concentration of beads was reduced in staggered way, 3-fold and 30-fold, respectively. Beads were subsequently washed twice with PBS plus 1% BSA and resuspended in RPMI medium. To prepare beads with covalently bound antigen, the PolyLink Protein Coupling Kit (Polysciences) was used as indicated by the manufacturer. An equivalent to 12.5 mg of beads were washed in Coupling Buffer (50 mM MES, pH 5.2, 0.05% Proclin 300), centrifuged 10 minutes at 1000 g and resuspended in 170 μL Coupling Buffer. A 20 μL volume of Carbodiimide solution (freshly prepared at 200 mg/mL) was added to the bead suspension and incubated for 15 minutes. After that, a total of 400 μg of NIP-OVA were added at a concentration of 5 mg/ml final concentration. To prepare beads coupled to two different proteins we followed a sequential procedure: the first protein was added at sub-saturating conditions (100 μg p17/p24/gp120 HIV-1 protein) for one hour and after that the second one was added to reach saturation (400 μg NIP-OVA) and incubated one additional hour. Incubations were carried out at room temperature with gentle mixing. Beads were centrifuged and washed twice in Wash/Storage buffer (10 mM Tris, pH 8.0, 0.05% BSA, 0.05% Proclin 300). To remove non-covalent bound protein, beads were washed once with 0.1% SDS followed by two washes with PBS+1% BSA to remove the SDS.

    [0115] Phagocytosis Assays

    [0116] Naïve B2 cells were resuspended in RPMI containing 20 mM Hepes plus 0.2% BSA and plated in 96 well V-bottom plates at a concentration of 1×10.sup.6 cells in 50 μl. Antibody-coated beads were added to reach a bead:cell ratio of 10. The cell and bead suspension was briefly centrifuged at 1,500 rpm and was incubated at 37° C. for different time points. Subsequently, cells were washed and stained on ice with a fluorescent isotype-specific Ig antibody to track the presence of beads bound to the cells that had not been phagocytosed. At this stage, the cells were either analysed by flow cytometry (FACS Canto II) or incubated for 15 minutes on coverslips coated with poly-L-lysine and then processed for immunofluorescence.

    [0117] Proliferation and Stimulation Assays

    [0118] Proliferation of OT-II and B cells was assessed using CFSE or Cell Tracer Violet (CTV) labelling as specified by the manufacturer (Thermofisher). A total of 2×10.sup.5 purified naïve B cells were CTV-stained and co-cultured with purified CFSE-stained OT-II T cells at a 1:1 ratio together with antigen coated-beads or soluble antigen in a round-bottom 96 well plate. For the bead-bound stimulus, B cells were incubated with 1 μm beads coated with NIP-OVA, NP-CGG or anti-IgM plus ovalbumin at different bead:B cell ratios. For stimulation with soluble antigen, NIP-OVA was used at a concentration of 100 ng/mL. After 3-4 days of culture, cells were washed in PBS plus 1% BSA and stained for T cell activation (CD25, CD44), Tfh (CXCR5, PD1, ICOS) or germinal center B cell (CD95, GL7, CD38) markers. To study differentiation of these cultured B cells to plasma cells, the cells were left on culture for 4 and 7 days and stained for CD138, IgD, and IgG1. The intracellular staining for Bcl-6 and Blimp1 were performed using the Foxp3/Transcription Factor Staining Buffer Set. Samples were analysed by FACS (FACS Canto II) and FlowJo software.

    [0119] Measurement of Antigen-Specific Antibodies

    [0120] To measure the release of NP-specific Ig in vitro B cell: OT-2 T cell culture supernatants were incubated on NP(7)-BSA-coated or NP(41)-BSA coated Costar p96 flat-bottom plates to measure the release of high- and low-affinity Igs, respectively. The SBA Clonotyping System-HRP (Southern Biotech) was used to detect the presence of antigen-specific Ig isotypes. When B1-8hi transgenic B cells were used, B cells and OT-2 T cells were cultured at 1:1 ratio for 4 or 7 days in the presence of NIP-OVA-coated 1 μm beads (3:1 bead/B cell ratio) or 100 ng/mL soluble NIP-OVA. For culture s of non-transgenic B cells, purified naïve C57BL/6 B2 cells were preincubated with a mixture of NIP-OVA and HIV-1 p17/p24/gp120 fusion protein (Jena Biosciences) covalently bound to 1 μm beads (1 bead:Bcell ratio) and cultured with OT-2 T cells (1:1 B cell/OT-2 T cell ratio). After 5 days of culture, some cultures were supplemented with 1 ng/mL IL-4 and 10 ng/mL IL-21 (Prepotech). Supernatants were recovered at day 10 and used to measure Igs by ELISA.

    [0121] In immunized mice, sera were obtained after 7 days of first immunization with 200 μg of NIP-OVA embedded with Alum or PBS, or 10×106 1 μm beads covalently bound to NIP-OVA. After 14 days from first immunization, mice were reimmunized and sera were obtained one week later. NP(7)-BSA and NP(41)-BSA plate bound were also used to measure high and low-affinity immunoglobulins. SBA Clonotyping System-HRP (Southern Biotech) was used to perform the ELISA.

    [0122] HIV Neutralization Assay

    [0123] Lentiviral supernatants were produced from transfected HEK-293T cells as described previously (Martinez-Martin, N., et al. (2009). Sci Signal. 2, ra43.). Briefly, lentivirus were obtained by co-transfecting plasmids psPAX2 (gag/pol), pHRSIN-GFP (Provided by J. A. Pintor) and either HIV-1 envelope (pCMV-NL4.3) or VSV envelope (pMD2.G) using the JetPEI transfection reagent (Polyplus Transfection). Viral supernatant were obtained after 24 and 48 hours of transfection. Polybrene (8 μg/mL) was added to the viral supernatants previous transduction of MOLT-4 cells (ATCC® CRL-1582™). A total of 3×10.sup.5 MOLT-4 cells were plated in a p-24 flat-bottom well and 700 μL of viral supernatant were added to them. Cells were centrifuged for 90 minutes at 2, 200 rpm and left in culture for 24 hours.

    [0124] The culture supernatants of purified naïve C57BL6 B2 cells stimulated with a mixture of NIP-OVA and HIV-1 p17/p24/gp120 fusion protein covalently bound to 1 μm beads (1 bead:Bcell ratio) together with OT-2 T cells (1:1 B cell/OT-2 T cell ratio) were incubated at different dilutions (1:8 and 1:4) with the viral supernatant for 1 hour at 37° C. and subsequently the mixture was used to infect MOLT-4 cells. As a control of infectivity, MOLT-4 cells were infected with viral supernatant without antibody supernatants. MOLT-4 cell infection was assessed according to GFP expression by Flow Cytometry (FACS Canto II).

    [0125] In Vivo Phagocytosis Assay

    [0126] B1-8hi mice were immunized intraperitoneally with 2×10.sup.7 Crimson fluorescent beads of 1 μm covalently bound to NIP-OVA. Spleens were harvested after 5 hours and were disintegrated in PBS+2% FBS on ice. Cell suspensions were stained with antibodies to identify macrophagues, (CD11 band F4/80), B cells (CD19 and B220), marginal zone and follicular B cells (CD23 and CD21). To identify those beads phagocytosed from those just attached to the membrane, cells were stained with anti-Ovalbumin-FITC 1:100 dilution for 30 minutes. Samples were analysed by Flow Cytometry (FACS Canto II). All ex-vivo procedures were performed at 0° C.

    [0127] Adoptive Transfer and Immunizations

    [0128] To assess the formation of GC B cells in vivo, 6- to 12-week-old mice were immunized intraperitoneally (i.p.) with 2×10.sup.9 SRBC as described previously (Aiba, Y., et al. (2010). Proc Natl Acad Sci USA. 107, 12192-12197). Spleens were harvested 7 days post-injection (p.i.). To assess the formation of GC B cells in vivo and the generation of anti-NP antibodies, mice were immunized i.p. with 200 μg of soluble NIP-OVA in 200 μl of PBS. Alternatively, mice were immunized with 200 μg of NIP-OVA complexes with 100 μl of Alum diluted 1:1 with PBS. For immunization with NIP-OVA bound to beads, a total of 20×106 1 μm beads covalently bound to NIP-OVA were administered i.p. in 200 μL PBS.

    [0129] For adoptive transfer into CD45.1 mice, 1×10.sup.7 purified B cells from spleens of B1-8 WT and RhoG−/− were injected intravenously. Acceptor mice were immunized with 200 μgr NIP-OVA embedded with Alum intraperitoneally or with 2×10.sup.7 of 1 μm beads bound covalently to NIP-OVA.

    [0130] For adoptive transfer into Rag1−/− mice, 1×10.sup.5 purified CD4 T cells from lymph nodes and spleen of OT-2 mice and 1×10.sup.6 purified B cells from spleen of B1-8hi WT or Rhog−/− mice were injected intravenously. Acceptor mice were immunized intraperitoneally with 200 μg NIP-OVA either mixed with Alum or in PBS. After 14 days from first immunization, acceptor mice were reimmunized in the same conditions.

    [0131] Soluble immunoglobulins were quantified by ELISA for isotype determination (Southern Biotech) with a 1:100 dilution of the sera from the immunized mice.

    [0132] Cell Preparation and Purification

    [0133] The lymph nodes and spleen from 6-8 weeks mice were homogenized with 40 μm strainers and washed in phosphate-buffered saline (PBS) containing 2% (vol/vol) fetal bovine serum (FBS). Spleen cells were resuspended for 3 minutes in AcK buffer (0.15 M NH4Cl, 10 mM KHCO3, 0.1 mM EDTA, pH 7.2-7.4) lo lyse the erythrocytes and washed in PBS 2% FBS. B cells from spleen were negatively selected using a combination of biotinylated anti-CD43 and anti-CD11b antibodies and incubation with streptavidin beads (Dynabeads Invitrogen) for 30 minutes and separated using Dynal Invitrogen Beads Separator. B11-8hi B cells were purified using biotinylated anti-CD43, anti-CD11 b and anti-kappa antibodies. OT-2 T cells from lymph nodes and spleen were purified using a mix of biotinylated antibodies: anti-B220, anti-CD8, anti-NK1.1, anti-CD11 b, anti-GR1, and anti-F4/80. Splenic and lymph node B and T cells were maintained in RPMI 10% FBS supplemented with 2 mM L-glutamine, 100 U/mL penicillin, 100 U/mL streptomycin, 20 μm β-mercaptoethanol and 10 mM sodium pyruvate.

    [0134] Real-Time PCR

    [0135] A total of 5×10.sup.6 purified B1-8hi WT or Rhog−/− B2 cells were cultured with purified OT2 (ratio 1:1) and different BCR stimuli (NIP-OVA bound to 1 μm beads, 100 ng/mL soluble NIP-OVA or NP-CGG bound to 1 μm beads) in a 6 well flat-bottom plate. After 7 days, B cells were sorted (FACSAria Fusion (BSC II)) and their RNA was isolated using the RNAeasy Plus Mini Kit (QIAGEN). cDNA was synthetized with SuperScript III (Invitrogen) using Oligo-dT primers. Quantitative real-time PCR was performed in triplicate using the reverse transcription reaction with SYBR Green PCR Master Mix, gene-specific primers and ABI 7300 Real Time PCR System. Obtained cycle threshold (Ct) values were used to calculate mRNA levels relative to the HPRT and GAPDH expression using the 2-ΔΔCt method.

    [0136] BCR Downmodulation

    [0137] Purified B1-8hi B cells were resuspended in RPMI plus 10% FBS at a density of 2.5×10.sup.5 cells/well in a p96 V-bottom plate in a total volume of 50 μL. Stimulus (NIP-OVA bound to beads in a 3:1 ratio or soluble NIP-OVA at 100 ng/mL concentration) were added to the wells and incubated at 37° C. for different time points. After appropriate incubation time, cells were stained for IgM, CD19 and B220 at 0° C. and analysed by FACS.

    [0138] Confocal Microscopy

    [0139] For immunofluorescence analysis of B:T cell clusters, purified B cells were cultured with purified OT2 T cells for 4 or 7 days in 6 well flat-bottom plates with either 1 μm beads coated with anti-IgM plus ovalbumin or NIP-OVA or 100 ng/mL soluble NIP-OVA. Afterwards, cells were fixed in 4% paraformaldehyde for 20 minutes and transferred to poly-L-lysine treated coverslips. Cells were stained for 1 hour at 0° C. with antibodies specific for B220, CD4 and GL7. For analysis of intracellular phosphorylation, purified B1-8hi B cells were starved for one hour in RPMI plus 20 mM HEPES-HCl pH=7.4, and subsequently stimulated with NIP-OVA-coated fluorescent-beads (3 bead:B cell ratio) or soluble NIP-OVA (100 ng/mL). Cells were fixed in 4% paraformaldehyde at 0° C. for 20 minutes to stop the stimulus, washed with Tris-buffered saline (TBS), and adhered to poly-L-lysine treated coverslips. Extracellular staining for B220 was performed in TBS for 1 hour at 0° C. After that, cells were stained for anti-phospho-Syk and anti-phospho-Iga as suggested by the manufacter (Cell Signaling). Confocal images were acquired with a Zeiss LSM710 system and a Zeiss AxioObserver LSM710 Confocal microscopes.

    [0140] Measurement of Actin Polymerization

    [0141] Purified B1-8hi B cells were starved as above and stimulated with either NIP-OVA bound to beads or soluble NIP-OVA for different times at 37° C. After that, cells were washed once in PBS plus 1% BSA at 37° C. and fixed with 4% paraformaldehyde for 10 minutes at room temperature. Extracellular staining for B220 was performed in PBS plus 1% BSA. After washing, cells were permeabilized in 4% paraformaldehyde plus 0.1% Triton X-100 for two minutes at room temperature. Phalloidin-Alexa488 was diluted 1:200 in PBS plus 1% BSA and incubated with cells for 1 hour. After washing, cells were analysed by Flow Cytometry (FACS Canto II).

    [0142] NP Saturation Assay

    [0143] A total of 1×10.sup.5 purified B1-8hi B cells/well were plated in a V bottom 96 well plates and incubated with different doses of stimuli for one hour at 0° C. Cells were washed once with cold PBS plus 1% BSA and stained with NP(36)-PE at 2.5 μg/ml in 50 μL per well at 0° C. for 30 minutes. Cells were washed once with cold PBS plus 1% BSA and analyzed by Flow Cytometry (FACS Canto II).

    [0144] Immunoblot Analysis of B Cell Activation

    [0145] Purified B1-8 B cells were resuspended in RPMI plus 20 mM Hepes and left in starving conditions for 1 hour. Cells were stimulated at different time-points with NIP-OVA bound-beads (ratio 3:1 beads/B cell) or 100 ng/mL soluble NIP-OVA. After stimulation, cells were lysed in Brij96 lysis buffer containing protease and phosphatase inhibitors (1% Brij96, 140 mM NaCl, 10 mM Tris-HCl [pH 7.8], 10 mM iodoacetamide, 1 mM PMSF, 1 μg/mL leupeptin, 1 μg/mL aprotinin, 1 mM sodium orthovanadate, 20 mM sodium fluoride and 5 mM of MgCl2). Immunoblotting was performed as described previously (Martinez-Martin et al., 2009, cited ad supra)

    [0146] Somatic Hypermutation

    [0147] Purified WT or RhoG−/− B1-8 B cells were cultured with purified OT-II T cells (ratio 1:1) and soluble NIP-OVA (100 ng/mL) or bead-bound NIP-OVA (ratio 3:1 beads/Bcell). After 7 days of culture, B1-8 cells were sorted and their genomic DNA was extracted using QIAamp DNA kit (QIAGEN). B1-8Vh genes were amplified by PCR with the Expand High Fidelity (Roche) and the primers forward 5′-CCATGGGATGGAGCTGTATCATCC-3′ (SEQ ID NO: 1) and reverse 5′-GAGGAGACTGTGAGAGTGGTGCC-3 (SEQ ID NO: 2) as described previously (Shih, T. A., et al. (2002). Nat Immunol. 3, 399-406). PCR products were subcloned into PCR2.1 vector (Invitrogen). DH5α bacteria were transformed with the subcloned products. Individual DH5α clones grown in LB+Ampicillin were selected for sequencing using the SUPREMERUN 96 system of GATC.

    [0148] Interleukin Measurement

    [0149] Purified WT B1-8hi B cells were cultured together with OT2 T cells and two different bead sizes (1 μm and 3 μm) bound to NIP-OVA at different doses. After 4 days, the supernatant was used to measure cytokines with a BD Cytometric Bead Array (CBA) Kit as indicated by the manufacturer. In cultures of WT or RhoG-deficient B1-8hi B cells with purified OT2 T cells and NIP-OVA 1 μm bead-bound, the supernatant was obtained after 7 days.

    [0150] Statistical Analysis

    [0151] Statistical parameters including the exact value of n, the means+/−s.d. are reported in the Figure and Figure legends. A non-parametric 2-tailed unpaired t-test was used to assess the confidence intervals.

    [0152] Origin of the Reagents Used in the Illustrative Example of the Invention

    TABLE-US-00001 TABLE 1 Sequence-Based Reagents Gene Primers Bcl6 FW GGAAGTTCATCAAGGCCAGT (SEQ ID NO: 3) RV GACCTCGGTAGGCCATGA (SEQ ID NO: 4) Bcl2 FW GTACCTGAACCGGCATCTG (SEQ ID NO: 5) RV GGGGCCATATAGTTCCACAA (SEQ ID NO: 6) Blimp1 FW GGCTCCACTACCCTTATCCTG (SEQ ID NO: 7) RV TTTGGGTTGCTTTCCGTTT (SEQ ID NO: 8) Irf4 FW GGAGTTTCCAGACCCTCAGA (SEQ ID NO: 9) RV CTGGCTAGCAGAGGTTCCAC (SEQ ID NO: 10) HPRT FW TCCTCCTCAGCAAGCTTTT (SEQ ID NO: 11) RV CCTGGTTCATCATCGCTAATC (SEQ ID NO: 12) GAPDH FW CTCCCACTCTTCCACCTTCG (SEQ ID NO: 13) RV CATACCAGGAAATGAGCTTGACAA (SEQ ID NO: 14)

    [0153] II. Results

    [0154] B2 Cells Phagocytose and Present Antigen by a RhoG-Dependent Mechanism.

    [0155] To study the RRas2 and RhoG dependence of BCR-triggered B cell phagocytosis, we incubated primary spleen B cells from wild type, Rras2−/− or Rhog−/− mice for 1-2 hours with 1 μm diameter fluorescent latex beads coated with an anti-IgM antibody and determined their internalization (phagocytosis) by flow cytometry. To restrict the assay to B2 B cells, B220+CD43−CD11b− lymphocytes were gated on. In order to distinguish totally phagocytosed beads from beads just adhered to the B cell surface, the cell cultures were incubated with a fluorescent anti-goat IgG antibody able to recognize the anti-IgM antibody used to coat the beads. Cells with beads adhered to their cell membrane could be identified by their positivity to the secondary anti-goat IgG antibody and the number of bound beads was calculated by the stepwise increase in bead fluorescence intensity (FIG. 1A). Cells positive for bead fluorescence and negative for the anti-goat IgG antibody were considered as cells that had totally phagocytosed the beads, which would make them inaccessible to the antibody. The stepwise increase in fluorescence intensity allowed calculation of a parameter-phagocytic index—that reflected the number of phagocytic events. B cells deficient in either RRas2 or RhoG were also deficient in the phagocytosis of 1 μm beads (FIG. 1B, left). The effect of RRas2 and RhoG deficiencies was even more prominent when the bead diameter was increased to 3 μm, suggesting that the requirement for these GTPases is more stringent for bigger particles (FIG. 1B, right). Indeed, phagocytosis of 10 μm beads was almost negligible (FIG. 1C). Confocal microscopy studies of B cells incubated with anti-IgM-coated 1 μm and 3 μm beads revealed that some beads were totally phagocytosed (FIG. 1D, arrows), becoming inaccessible to the anti-goatIgG antibody, whereas others could still be detected outside (FIG. 1D, asterisks).

    [0156] It was investigated whether phagocytosis of antigen by B2 B cells allows antigen presentation to T cells. As described above, the effect of RhoG-deficiency on B cell phagocytosis was stronger than that of RRas2 deficiency. Therefore RhoG-deficient B cells were used for all subsequent functional studies. To evaluate if phagocytic B cells present antigen to T cells, purified naïve B2 B cells from WT and Rhog−/− mice were preincubated with different ratios of beads coated with a mixture of anti-IgM and ovalbumin (OVA). Subsequently, these cells were incubated with purified Cell Trace Violet (CTV)-labeled T cells from OT-2 TCR transgenic mice for 3 days. OT-2 T cells respond to an OVA-derived peptide presented by I-Ab. Preincubation with beads coated with anti-IgM and OVA induced OT-2 T cell proliferation whereas preincubation with beads coated with either anti-IgM or OVA alone did not (FIG. 1E). These data suggest that B cell activation alone is not sufficient to activate CD4 T cells, but rather that OVA antigen uptake by B cells requires a BCR-dependent process. Furthermore, compared to WT B cells, proliferation of OT-2 T cells was reduced if B cells lacked RhoG (FIG. 1E FIG. 1E). Likewise, upregulation of IL-2Rα (CD25) expression by OT-2 T cells was antigen- and BCR triggering-dependent and mediated in part by RhoG (FIG. 1E). These data suggest that B cells take up antigen and present it in a dose-dependent manner to T cells by a phagocytic mechanism.

    [0157] The GC reaction is regulated by a subset of CD4+ T cells (Tfh cells) that express the master regulator Bcl-6, as well as the surface markers CXCR5 and PD1. It was found that OT-2 T cells expressed CXCR5 and PD1 when stimulated with B cells that had been pre-incubated with 1 μm beads coated with anti-IgM and OVA in a RhoG-dependent process (FIG. 1G). To determine if OT-2 T cell differentiation to Tfh cells was also induced upon phagocytosis in an antigen-specific manner, B cells isolated from B1-8hi BCR knock-in mice were co-culture with OT-2 T cells. B1-8hi knock-in mice bear an already rearranged VDJ region in the IgH locus that in combination with a rearranging lambda light chain confers specificity for recognition of the hapten 4-hydroxy-3-nitrophenylacetyl (NP) and its iodinated derivative 4-hydroxy-3-iodo-5-nitrophenylacetic acid (NIP). It was found that OT-2 T cells proliferated and expressed CXCR5, PD1 and ICOS markers of Tfh cells in response to B1-8hi B cells that had phagocytosed 1 or 3 μm beads coated with NIP covalently bound to OVA carrier protein (NIP-OVA, Suppl. FIGS. 1A and 1B). Interestingly, proliferation of OT-2 T cells increased with the dose of beads whereas expression of surface markers was optimum at intermediate doses of beads that depended on their diameter. This optimum was also observed for the generation of key Tfh cell cytokines involved in the GC response: IL-4, IL-6, and IL-21 (FIG. 2C). Interestingly, RhoG deficiency in B11-8hi B cells impaired cytokine release by OT-2 T cells (FIG. 2D), strongly suggesting that B cell phagocytosis of antigen is required. Altogether, the above data suggest that B cells can phagocytose antigen and present it to cognate T cells that become activated and adopt markers and properties of Tfh cells.

    [0158] Generation of GC B Cells In Vitro by a Phagocytic-Dependent Mechanism.

    [0159] In addition to promoting CD4+ T cell differentiation to Tfh cells, follicular B cells incubated with beads coated with anti-IgM and ovalbumin proliferated and expressed the GC B cell markers CD95 and GL7 (FIG. 3). They also upregulated CD40 and their proliferation depended on T cell help and RhoG expression (FIG. 3A, 3B and FIG. 4). These data suggested that antibody-mediated BCR triggering can promote the phagocytosis and presentation of antigen to T cells, inducing T cell and B cell proliferation as well as the acquisition of B cell and T cell markers typical of a GC response. To determine if GC B cell differentiation was induced upon phagocytosis in an antigen-specific manner, purified B11-8hi B cells were incubated with 1 μm beads coated with NIP-OVA in the presence of OT-2 T cells for 4 days. This led to the emergence of GC B cells characterized by the expression of the GL7 and CD95 markers and to B cell proliferation (FIGS. 3C and 3D). Beads coated with NP linked to a different carrier protein (chicken gammaglobulin, CGG) did not elicit GC B cell differentiation or proliferation, indicating that T cell help is required. Likewise, emergence of a GC B cell phenotype was inhibited if B cells lacked RhoG, suggesting that beads, and the NIP-OVA antigen, were taken up by phagocytosis. A key feature of GC B cell differentiation is the expression of the master regulator Bcl-6. The emergence of a Bcl-6+ B cell population that also expresses the GL7 GC marker for 7 days of WT B cell culture were followed with NIP-OVA-coated 1 μm beads and OT-2 T cells. It was found a distinct double positive population that reached a maximum of 40% of all B cells at day 3 of co-culture (FIG. 3E). The maximum of Bcl-6+GL7+ B cells at day 3 was also coincident with the maximum for GL7+ B cells that had downregulated CD38, another feature of GC B cells (FIG. 4B). The analysis of Bcl-6 expression according to the number of cell divisions at day 3 showed that Bcl-6 upregulation peaked in B cells that had undergone 2 cell divisions and gradually decayed in cells that had undergone 3 divisions or more (FIG. 3F). B cells stimulated with NP-CGG-coated beads in the presence of OT-2 underwent a maximum of 3 cell divisions and did not upregulate Bcl-6 (FIG. 3F), indicating that T cell help was required. The bead-bound NB-CGG stimulus was also unable to upregulate the plasmacytic B cell master regulator Blimp-1 that occurred after the 3rd cell division (FIG. 3F). Bcl-6 and Blimp-1 are involved in a mutually regulatory loop in a way that Bcl-6 represses Blimp-1 expression and the latter represses Bcl-6, favoring the exit of cells from the GC differentiation program and terminal differentiation. Since Blimp-1 expression steadily increases with cell division the bell-shaped behavior of Bcl-6 expression with cell division could very well be originated by the growing repression exerted by Blimp-1 expression (FIG. 3G) and responsible for the decline in Bcl-6 expression after 3 days of culture (FIG. 3E). These results indicate that B cell stimulation with bead-bound antigen results in their differentiation to GC B cells in vitro that are regulated by Bcl-6 and Blimp-1 expression as it has been previously established in vivo.

    [0160] In germinal centers, antigen-specific B cells form clusters of highly proliferating cells that segregate from non-responding B cells in follicles. In the culture plates in vitro, it was found the formation of large clusters containing as many as 4,000 cells when B cells were stimulated with 1 μm beads coated with anti-IgM plus ovalbumin (FIG. 5A). The clusters consisted of a mixture of tightly intermingled B cells and CD4+ T cells. Similar clusters were found when mixtures of NP-specific B1-8hi B cells and OT-2 T cells were incubated with 1 μm beads coated with NIP-OVA (FIG. 5B). Interestingly, stimulation of B cells with a similar dose (see below) of soluble NIP-OVA, resulted in the formation of much smaller clusters, suggesting that the large B cell and T cell aggregates were related to the phagocytic stimulus. Using mixtures of CTV-labeled B1-8hi B cells and CFSE-labeled OT-2 T cells, after 7 days of stimulation with NIP-OVA antigen-coated beads we found that the periphery of the cluster contained the cells with most diluted CTV and CFSE, suggesting that B and T cells proliferate and expand towards the edges of the clusters (FIG. 5C). The periphery of the clusters also contained the highest percentage of B cells positive for the GC marker GL7 (FIG. 5D), suggesting that B cells proliferate and express GC markers towards the periphery. These data show that follicular B cells stimulated with antigen-coated beads form large clusters, together with T cells, that are reminiscent of germinal centers.

    [0161] A Bead-Bound but not a Soluble Antigen Induces the Generation of Class-Switched Immunoglobulins of High Affinity.

    [0162] During the GC response, B cells recognize antigen through their BCR and this recognition has a dual effect: the activation of intracellular signaling pathways and antigen internalization for processing and presentation to CD4+ T cells. Thus, it was analyzed if the way in which the antigen is given to B cells (soluble versus phagocytic) influences B cell activation independently of antigen presentation to T cells. To normalize both stimuli for equal antigen presentation, a titration experiment in which proliferation of OVA-specific OT-2 CD4+ T cells was measured in response to B cells preincubated with different doses of soluble and bead-bound NIP-OVA were carried out. It was found that a concentration of 100 ng/ml soluble NIP-OVA was as effective as a dose of 3 NIP-OVA-coated beads per B cell for inducing OT-2 cell proliferation (FIG. 6A). Furthermore, those doses of stimuli were equally effective at inducing the expression of TFH cell markers in OT-2 T cells and T cell proliferation (FIG. 6B). In such conditions, B1-8hi B cells expressed GC B cell markers GL7 and CD95 independently of the soluble or bead-bound nature of the stimulus (FIG. 6C). By contrast, the form of antigen delivery to B cells (soluble vs. bead-bound) influenced B cell proliferation. Indeed, the soluble antigen was significantly less mitogenic than the bead-bound one (FIG. 6C). In addition to the different proliferation rate, bead-bound antigen was more effective at promoting expression of Bcl-6 and Blimp-1 than soluble antigen (FIG. 6D). On the contrary, soluble antigen was more effective at inducing the expression of the cytidine deaminase gene (Aicda) than bead-bound antigen. Nevertheless, bead-bound and soluble antigens were equally efficient at inducing somatic mutations in the nucleotide sequence, although the bead-bound stimulus was 3-fold more efficient th an the soluble one at inducing changes in the amino acid sequence (FIG. 7A). These results suggest that B cells with V region mutations are being selected for certain amino acid mutations in our in vitro system. Indeed, most of the mutations mapped at, or in the proximity of, the antigen-binding CDR sequences (FIG. 7B). The effect of bead-bound antigen on upregulation of Aicda, Bcl-6 and Blimp1, and somatic mutation were related to a phagocytic process, for RhoG-deficient B cells were less competent in these processes than WT cells (FIG. 6D and FIG. 7D). These data indicate that a bead-bound, phagocytic-dependent antigen stimulus is more effective than soluble antigen at inducing B cell proliferation, as well as their differentiation into bona fide GC B cells. Indeed, bead-bound antigen was more effective than soluble antigen at inducing Ig class switch, which is a GC-dependent event, as evidenced by the expression of IgG1 at the B cell membrane (FIG. 6E). Furthermore, B cell stimulation with bead-bound antigen was a better inducer of the plasma cell differentiation marker CD138 than soluble antigen (FIG. 6F). In addition, we identified the CD138+ IgG1+ B cell plasma blast population only in samples stimulated with bead-bound antigen (FIG. 6G). These data suggest that stimulation of B cells with bead-bound antigen induces their differentiation into plasmablasts and antibody-secreting plasma cells.

    [0163] The capacity of bead-bound antigen to induce plasma cell differentiation was paralleled by the detection of high affinity anti-NP Igs in 7-day culture supernatants. The anti-NP Igs were comprised of non-switched IgM but also of high amounts of class-switched IgG1, IgG2a, IgG3, IgA and lesser, but detectable, amounts of IgG2b (FIG. 8A). The production of high and low affinity class-switched anti-NP Igs by bead-bound antigen-stimulated cells was strongly inhibited if B cells lacked RhoG, suggesting that generation of high-affinity mature Igs required the beads to be phagocytosed. Likewise, the supernatant of WT B11-8hi B cell cultures stimulated with bead-bound antigen, but not with soluble antigen, contained high-affinity class-switched Igs (FIG. 8B). The presence of mature Igs was more evident at day 7 than at day 4 after stimulation with bead-bound antigen and included high concentrations of IgG1 but also IgG2a, IgG3 and IgA. The above experiments were carried out with B11-8hi B cells and OT-2 T cells purified by negative selection. To exclude the participation of a third cell type that could be contaminating the B and T cell populations, the experiments with bead-bound versus soluble NIP-OVA antigen were repeated with FACS-sorted follicular B (B220+CD23+CD43−CD11 b−) and CD4+OT-2 T cells (FIG. 9A). In these conditions, B cells acquired GC markers (FIG. 9B) and differentiated into antibody-producing cells able to secrete mature Igs (FIG. 9C), thus indicating that T and B cells are sufficient to generate the GC-like reaction. Overall, these data showed that incubation of naïve B cells with a haptenated antigen immobilized onto 1 μm beads in the presence of antigen-specific helper CD4+ T cells in vitro results in the generation of high affinity antigen-specific antibodies of mature, class-switched, isotypes.

    [0164] B Cell Stimulation with Bead-Bound Antigen Generates Functional Antibodies from Non-Transgenic B Cells In Vitro.

    [0165] To interrogate if the phagocytic-dependent antigen delivery to B cells can be used to generate antigen-specific antibodies in vitro out of a non-transgenic, BCR repertoire NP-OVA-coated 1 μm beads were incubated with purified B cells from non-transgenic C57BL/6 mice and with OT-2 T cells. After 7 days, the culture supernatant contained anti-NP IgMs but not detectable class-switched Igs (FIG. 8C). Since the concentrations of IL-4 and IL-21 in the culture supernatants of bead-bound antigen-stimulate d B cells was low (FIGS. 2C and 2D), to extend the life of the cultures by adding recombinant IL-4 and IL-21 at day 5 was attempted. It was found detectable anti-NP IgG1 and IgA in the cytokine-supplemented cultures after 10 days of incubation (FIG. 8C).

    [0166] To determine if the in vitro system can be used to generate antibodies of medical interest, we coated 1 μm beads with Env recombinant protein of HIV and NIP-OVA as carrier protein. Coated beads were incubated with B cells from non-transgenic C57BL/6 mice and OT-2 T cells. We detected the generation of Env-specific IgMs both at day 7 and day 10 but not class-switched Igs (FIG. 8C). Nonetheless, the supernatant of 7-day cultures was tested for its capacity to inhibit the entry of HIV viral particles coated with the HIV Env protein or pseudotyped with the envelope protein of VSV. The supernatant inhibited in a dose-dependent manner the entry of the HIV Env-mediated virus but not of the VSV G-dependent one, suggesting that the generated anti-HIV Env IgMs specifically neutralize HIV.

    [0167] A Bead-Bound Phagocytic Stimulus Provides a Strong and Sustained BCR Signal.

    [0168] To provide a mechanistic explanation to the above findings, it was interrogated if the bead-bound stimulus could result in a more intense or more sustained BCR signal than soluble antigen. The degree of occupancy of the BCR in both conditions using a fluorescent NP derivative were first determined. At the conditions used above for comparison (3 coated beads vs. 100 ng/ml of soluble protein), 35% of the B1-8 BCR was free to bind NP hapten in cells incubated with beads, whereas only 1% was free if cells had been incubated with soluble protein (FIG. 10A). BCR downregulation in function of time was also measured and found that the soluble stimulus was at least as effective as the bead-bound one at promoting BCR downregulation (FIG. 10B). These data indicate that the bead-bound antigen is not more effective than the soluble one in terms of BCR occupancy or BCR downregulation. Therefore, its superior capacity to produce class-switched high affinity antigen-specific Igs is not explained by simply higher BCR occupation. It was therefore investigated if signaling events downstream of the BCR were differentially activated. Phagocytosis requires the rearrangement of the actin cytoskeleton around the particle in the phagocytic cup. Thus, it was investigated if there were differences in terms of the intensity or duration of actin polymerization in B cells incubated with bead-bound vs. soluble antigen. Both stimuli equally increased polymerized F-actin levels in B cells after 1 minute of incubation (FIG. 10C). However, whereas the polymerization phase was rapidly followed by an intense depolymerization in B cells stimulated with soluble antigen, the high F-actin content was sustained in B cells stimulated with bead-bound antigen. The bead-bound stimulus elicited a more intense and sustained phosphorylation of Akt and ERK, which are two events linked to activation of the PI3K and Ras pathways, than the soluble stimulus (FIG. 10D). More importantly, phosphorylation of Syk, a direct BCR effector previously shown to mediate FcγR- and CR-dependent phagocytosis, was also more intense and sustained (FIG. 10D). This suggests that the bead-bound stimulus induces a stronger BCR signal that is more persistent in time than the soluble stimulus. To determine if the stronger sig n al promoted by the bead-bound stimulus was related to the phagocytic process, the phosphorylation of Akt and S6 (in the PI3K pathway) and of ERK in WT vs RhoG-deficient B cells was compared in response to bead-bound antigen. It was found that RhoG is required to induce and sustain those signals, as well as the phosphorylation of Syk and of the Igα subunit of the BCR, strongly suggesting that antigen phagocytosis elicits a longer and more intense BCR signal (FIG. 10E).

    [0169] Next the cellular location of phosphorylated BCRs during antigen phagocytosis was assessed. Using fluorescent 1 μm beads and confocal microscopy, it was found that in B cells stimulated with bead-bound antigen for a short time (5 minutes), both phospho-Igα and phospho-Syk were only found in the phagocytic cups (FIG. 10F). Interestingly, both proteins were still found phosphorylated all around the phagocytosed beads at a late (30 minutes) time point. These results show that BCR phosphorylation persists in the intracellular phagosome and suggest that this might be the cause for sustained BCR signaling when antigen is taken up by a phagocytic mechanism.

    [0170] Phagocytosis of Antigen by B Cells Induces a Potent Humoral Response In Vivo.

    [0171] Once established that phagocytosis of antigen by B cells can drive the generation of a GC response and formation of mature high-affinity Igs, it was next interrogated if the process may also occur in vivo. If B cells phagocytosed beads in vivo was studied first. To this end, B1-8hi transgenic WT and Rhog−/− mice was inoculated with fluorescent 1 μm beads covalently bound to NIP-OVA by the intraperitoneal route and measure the presence of beads inside B cells in the spleen. To distinguish B cells that had phagocytosed beads entirely from B cells that had adherent beads, spleen B cells with a fluorescent anti-OVA antibody were extracellularly stained. Using controls of B cells incubated in vitro with beads on ice plus or minus anti-OVA (FIG. 12A) the conditions for the in vivo experiment were set up. It was found that 5 hours after i.p. inoculation a measurable percentage of the NP+ spleen B cell population was detected with beads exclusively inside. The percentage of B cells with phagocytosed beads was 4-fold lower in RhoG-deficient mice than in their WT counterparts (FIG. 11). Phagocytosis by B cells unable to bind the NP hapten (NP−) was negligible, suggesting that the process was BCR-dependent. Both, MZ and follicular B1-8hi B cells phagocytosed NIP-OVA coated beads to a similar extend, and required the expression of RhoG and of the NP-specific BCR (FIG. 12B). Phagocytosis by NP+ B cells was higher than this of splenic CD11b+F4/80+ macrophages (0.14% vs. 0.05%), suggesting that the efficiency of phagocytosis by antigen-specific B cells was not lower than that of professional phagocytes (FIGS. 12B and 12C).

    [0172] Here it is showed that the number of B cells with a GC phenotype in Peyer's patches of non-immunized mice or in the spleen of mice immunized with sheep red blood cells was not affected by RhoG deficiency (FIG. 13). Therefore, antigen phagocytosis mediated by RhoG does not seem to be required for the humoral T-dependent response to a soluble antibody or to erythrocytes. However, RhoG-deficient mice immunized by the intraperitoneal route with NIP-OVA covalently bound to 1 μm beads were less efficient (3-fold) in the generation of GC B cells (FIG. 11B). To determine if the defective GC response to bead-bound antigen of Rhog−/− mice was B cell intrinsic, purified B cells from WT and Rhog−/− mice (both expressing the CD45.2 allele) were adoptively transferred into WT CD45.1+ recipient mice and then immunized with bead-bound NIP-OVA as above. By gating on B cells bearing the CD45.2 vs. the CD45.1 marker, the effect of RhoG deficiency on the GC B cell response to bead-bound antigen could be assessed. It was found equal proportion of CD45.2+WT and RhoG-deficient B cells in both sets of mice, indicating that RhoG deficiency did not affect migration to the spleen of B cells or their survival (FIG. 11C). However, the percentage of B cells with GC markers within the transferred population (CD45.2+) was drastically reduced suggesting that B cells required to phagocytose the bead-bound antigen to become GC B cells. The difference in the percentage of GC B cells within the endogenous WT B cell population (CD45.1+) in both groups of mice was not significant. The above results show that B cells can phagocytose antigen in vivo and that by doing so enter into the GC reaction.

    [0173] The use of beads that can be phagocytosed by B cells is not yet implemented as a mechanism to boost or modulate the humoral response. However, it is well known that in order to elicit a protective humoral response, vaccines need to incorporate an adjuvant that most frequently consists of aluminum compounds known as “alum”. Interestingly, antigen becomes trapped within large 1-10 μm aggregates formed by alum which are thought to favor phagocytosis by dendritic cells. Using a combination of NIP-OVA plus alum for vaccination, a stronger production of high affinity class-switched Igs in WT mice compared to the immunization with soluble NIP-OVA antigen was detected (FIG. 11D). Interestingly, although RhoG deficiency did not impair the response to soluble antigen, it blocked the boosting effect of the alum adjuvant detected in the generation of anti-NP antibodies of the IgG2b and IgG3 subclasses. These results suggest that the RhoG-dependent phagocytosis mechanism is involved in the response to antigen plus alum immunizations. We additionally performed adoptive transfer experiments to study whether RhoG was necessary for GC formation and Ig class switch in a B cell-intrinsic manner. Purified B cells from WT or Rhog−/− mice (CD45.2+) were inoculated into CD45.1+ wild type (WT) receptor mice and subsequently were immunized with NIP-OVA plus alum. The GC response in the Rhog−/− CD45.2+ population was strongly inhibited in terms of CD95 and GL7 GC marker expression, expansion of NP-binding B cells or expression of class-switched IgG1, compared to WT B cells (FIG. 14A). These results suggest that antigen phagocytosis by B cells is required for a GC response to immunization with antigen plus alum.

    [0174] To assess the effect of RhoG deficiency in B cells on antibody production, adoptive transfer experiments in Rag1−/− mice which lack endogenous T and B cells were carried out. These mice were reconstituted with purified WT OT-2 T cells and either with purified WT or with purified RhoG-deficient B cells. Subsequently, they were immunized with NIP-OVA either soluble or complexed with alum. The presence of low and high affinity anti-NP antibodies was evaluated to find that mice reconstituted with WT B cells produced low and high affinity IgM and class-switched Igs, whereas mice reconstituted with RhoG-deficient B cells were incompetent to produce class-switched anti-NP immunoglobulins of high affinity (FIG. 11E and FIG. 14). These results suggest that phagocytosis of antigen by B cells might be involved in the in vivo generation of high affinity mature immunoglobulins in response to antigen plus alum formulation.