NUCLEIC ACIDS FOR INHIBITING EXPRESSION OF LPA IN A CELL

20220002722 · 2022-01-06

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to products and compositions and their uses. In particular the invention relates to nucleic acid products that interfere with the LPA gene expression or inhibit its expression, preferably for use as treatment, prevention or reduction of risk of suffering cardiovascular disease such as coronary heart disease or aortic stenosis or stroke or any other disorder, pathology or syndrome linked to elevated levels of Lp(a) particles.

    Claims

    1. A nucleic acid for inhibiting expression of LPA in a cell, comprising at least one duplex region that comprises at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to at least a portion of RNA transcribed from the LPA gene, wherein said first strand comprises, or preferably consists of, a nucleotide sequence selected from the following sequences: SEQ ID NO: 9, 5, 1, 3, 7, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43, wherein the nucleotides at positions 2 and 14 from the 5′ end of the first strand are modified with a 2′ fluoro modification, and the nucleotides on the second strand which correspond to positions 11-13 of the first strand are modified with a 2′ fluoro modification.

    2. The nucleic acid of claim 1, wherein all nucleotides of the nucleic acid are modified at the 2′ position of the sugar.

    3. The nucleic acid of any preceding claim, wherein the nucleic acid is modified on the first strand with alternating 2′ O-methyl modifications and 2′ fluoro modifications.

    4. The nucleic acid of any preceding claim, wherein the remaining modifications of the second strand are naturally occurring modifications, preferably 2′ O-methyl.

    5. The nucleic acid of any preceding claim, wherein the nucleic acid comprises a phosphorothioate linkage between the terminal two or three 3′ nucleotides and/or 5′ nucleotides of one or both ends of the first and/or the second strand.

    6. The nucleic acid of any preceding claim, wherein the first strand comprises, or preferably consists of SEQ ID NO: 165 and optionally wherein the second strand comprises, or preferably consists of SEQ ID NO: 163.

    7. The nucleic acid of any of the preceding claims, wherein the nucleic acid is conjugated to a ligand.

    8. The nucleic acid of claim 7, wherein the ligand comprises (i) one or more N-acetyl galactosamine (GalNAc) moieties or derivatives thereof, and (ii) a linker, wherein the linker conjugates the at least one GalNAc moiety or derivative thereof to the nucleic acid.

    9. The nucleic acid of any preceding claim, wherein the nucleic acid is conjugated to a ligand comprising a compound of formula (I):
    [S—X.sup.1—P—X.sup.2].sub.3-A-X.sup.3—  (I) wherein: S represents a saccharide, preferably wherein the saccharide is N-acetyl galactosamine; X.sup.1 represents C.sub.3-C.sub.6 alkylene or (—CH.sub.2—CH.sub.2—O).sub.m(—CH.sub.2).sub.2— wherein m is 1, 2, or 3; P is a phosphate or modified phosphate, preferably a thiophosphate; X.sup.2 is alkylene or an alkylene ether of the formula (—CH.sub.2).sub.n—O—CH.sub.2— where n=1-6; A is a branching unit; X.sup.3 represents a bridging unit; wherein a nucleic acid as defined in any of claims 1 to 8 is conjugated to X.sup.3 via a phosphate or modified phosphate, preferably a thiophosphate, and the nucleic acid is preferably conjugated to X.sup.3 via the 5′ end of the second strand.

    10. The nucleic acid of any preceding claim, wherein the nucleic acid is conjugated to a ligand and has the following structure ##STR00066## wherein Z is a nucleic acid according any preceding claim and the ligand is preferably conjugated to the 5′ end of the second strand.

    11. The nucleic acid of any of claims 7-10, wherein the nucleic acid comprises two phosphorothioate linkages between each of the three terminal 3′ and between each of the three terminal 5′ nucleotides on the first strand, and two phosphorothioate linkages between the three terminal nucleotides of the 3′ end of the second strand and wherein the ligand is conjugated to the 5′ end of the second strand.

    12. A composition comprising a nucleic acid of any of claims 1-11 and optionally a delivery vehicle and/or a physiologically acceptable excipient and/or a carrier and/or a diluent and/or a buffer and/or a preservative, for use as a medicament, preferably for the prevention or treatment or risk reduction of a disease or pathology, wherein the disease or pathology preferably is a cardiovascular disease, wherein the cardiovascular disease preferably is a stroke, atherosclerosis, thrombosis, a coronary heart disease or aortic stenosis and/or any other disease or pathology associated to elevated levels of Lp(a) particles.

    13. A pharmaceutical composition comprising a nucleic acid of any of claims 1-11 and further comprising a delivery vehicle and/or a physiologically acceptable excipient and/or a carrier and/or a diluent.

    14. Use of a nucleic acid of any of claims 1-11 or a pharmaceutical composition of claim 13 for the prevention or treatment or risk reduction of a disease or pathology, wherein the disease or pathology preferably is a cardiovascular disease, wherein the cardiovascular disease preferably is a stroke, atherosclerosis, thrombosis, a coronary heart disease or aortic stenosis and any other disease or pathology associated to elevated levels of Lp(a) particles.

    15. A method of preventing or treating a disease, disorder or syndrome comprising administering a composition comprising a nucleic acid of any of claims 1-11 or a composition of any of claims 12-13 to an individual in need of treatment, preferably wherein the nucleic acid or composition is administered to the subject subcutaneously, intravenously or using any other application routes such as oral, rectal or intraperitoneal.

    Description

    FIGURES

    [0428] FIG. 1 shows the results of a non-conjugated siRNA molecule screen for inhibition of LPA mRNA expression in human RT-4 cells.

    [0429] FIGS. 2A and 2B show the dose response of non-conjugated LPA-targeting siRNA molecules on LPA mRNA expression in human RT-4 cells.

    [0430] FIG. 3 shows the inhibition of LPA mRNA expression in human and cynomolgus primary hepatocytes by different doses of GalNAc-L1 LPA-1038 conjugated siRNA molecules delivered by receptor-mediated uptake.

    [0431] FIG. 4 shows representative examples of the knockdown of LPA-mRNA by L6-conjugated GalNAc siRNAs indicated in primary human hepatocytes delivered by receptor-mediated uptake.

    [0432] FIG. 5 shows the synthesis of A0268, which is a 3′ mono-GalNAc conjugated single stranded oligonucleotide and is the starting material in the synthesis of Conjugate 1 and Conjugate 3. (ps) denotes phosphorothioate linkage.

    [0433] FIG. 6 shows the synthesis of A0006 which is a 5′ tri-antennary GalNAc conjugated single stranded oligonucleotide used for the synthesis of Reference Conjugate 4. (ps) denotes phosphorothioate linkage.

    [0434] FIG. 7 illustrates the in vitro determination of TTR knockdown. In particular, FIG. 7A shows the in vitro determination of TTR knockdown by Reference Conjugates (RC) 1 and 3 as well as the untreated control “UT”; FIG. 7B shows the in vitro determination of TTR knockdown by Reference Conjugates (RC) 2 and 3, as well as the untreated control “UT”; and FIG. 7C shows the in vitro determination of TTR knockdown by Conjugates 1, 2 and 3, as well as by RC3 and untreated control “UT”. Reference Conjugates 1 and 2 represent comparator conjugates. Reference Conjugate 3 represents a non-targeting GalNAc siRNA and “untreated” (“UT”) represents untreated cells. Both RC3 and UT are negative controls. mRNA levels were normalised against PtenII.

    [0435] FIG. 8 shows a time course of serum TTR in c57BL/6 mice cohorts of n=4 at 7, 14, and 27 days post s.c. treatment with 1 mg/kg—Conjugates 1-3, Reference Conjugates (RC) 1, 2 and 4 and mock treated (PBS) individuals.

    [0436] FIG. 9 shows oligonucleotide synthesis of 3′ and 5′ GalNAc conjugated oligonucleotides precursors (such as compound X0385B-prec).

    [0437] FIG. 10 shows equal dose response of knock down for LPA targeting siRNA with two single GalNAc units conjugated to the second strand as compared to a triantennary GalNAc unit at the 5′ second strand in primary cynomolgus hepatocytes.

    [0438] FIG. 11 illustrates the in vitro determination of TTR knockdown. In particular, FIG. 11A shows the in vitro determination of TTR knockdown by Conjugates 4, 5, 6 and 2 compared to “Luc” (Reference Conjugate 3) as well as the untreated control “UT”; FIG. 11B shows the in vitro determination of TTR knockdown by Conjugates 7 and 2, compared to “Luc” (Reference Conjugate 3) as well as the untreated control “UT”. Luc or Reference Conjugate 3 (RC3) represents a non-targeting GalNAc siRNA and “untreated” (“UT”) represents untreated cells. Both RC3 and UT are negative controls. mRNA level were normalised against PtenII.

    [0439] FIG. 12 illustrates the in vitro determination of TTR knockdown. In particular, FIG. 12A shows the in vitro determination of TTR knockdown by Conjugates 8, 9, 10, 11 and 2 compared to “Luc” (Reference Conjugate 3) as well as the untreated control “UT”; FIG. 12B shows the in vitro determination of TTR knockdown by Conjugates 12 and 2, compared to “Luc” (Reference Conjugate 3) as well as the untreated control “UT”. Luc or Reference Conjugate 3 represents a non-targeting GalNAc siRNA and “untreated” (“UT”) represents untreated cells. Both RC3 and UT are negative controls. mRNA level were normalised against PtenII.

    [0440] FIG. 13 illustrates the in vitro determination of LPA mRNA knockdown by Conjugate 19 compared to controls. Ctr represents a non-targeting GalNAc siRNA and “untreated” (“UT”) represents untreated cells. Both Ctr and UT are negative controls. mRNA level were normalised against ACTB.

    [0441] FIG. 14 shows a time course of Aldh2 liver mRNA levels in c57BL/6 mice cohorts of n=6 at 14, 28 and 42 days post s.c. treatment with 1 mg/kg—Conjugate 15, Reference Conjugate (RC) 6 and mock treated (PBS) individuals. mRNA level were normalised against Pten.

    [0442] FIG. 15 shows a time course of Aldh2 liver mRNA levels in c57BL/6 mice cohorts of n=6 at 14, 28 and 42 days post s.c. treatment with 1 mg/kg—Conjugate 16, Reference Conjugate (RC) 7 and mock treated (PBS) individuals. mRNA level were normalised against Pten.

    [0443] FIG. 16 shows a time course of Tmprss6 liver mRNA levels in c57BL/6 mice cohorts of n=6 at 14, 28 and 42 days post s.c. treatment with 1 mg/kg—Conjugate 18, Reference Conjugate (RC) 8 and mock treated (PBS) individuals. mRNA level were normalised against Pten.

    [0444] FIG. 17 shows serum stability of Conjugates 4, 5, 6, 7 and 2, and untreated control (UT) at 37° C. over 3 days.

    [0445] FIG. 18 shows serum stability of Conjugates 8, 9, 10, 11, 12 and 2, and untreated control (UT) at 37° C. over 3 days.

    [0446] FIG. 19 shows the reduction in LPA mRNA in primary human hepatocytes by Conjugate 21.

    [0447] FIG. 20 shows the reduction in LPA mRNA in primary cynonolgus hepatocytes by Conjugate 21.

    [0448] FIG. 21 shows that Conjugate 21 does not affect the level of APOB gene expression.

    [0449] FIG. 22 shows that Conjugate 21 does not affect the level of PLG gene expression.

    [0450] FIG. 23 shows a time course of serum Lp(a) inhibition over 29 days in cynomolgus with different dosages of conjugate 21.

    [0451] FIG. 24 shows a dose response curve of conjugate 21 showing reduction of serum Lp(a) at day 29 in cynomolgus.

    EXAMPLES

    [0452] The numbering referred to in each example is specific for said example.

    Example 1

    [0453] A number of modified conjugated siRNA molecules s or functional examples are shown re.

    [0454] LPA-1038 Derivatives:

    TABLE-US-00001 GalNAc-LPA-1038-L1 First strand (SEQ ID NO: 119, based on SEQ ID NO 5) OMeA-(ps)-FU-(ps)-OMeA-FA-OMeC-FU-OMeC-FU-OMeG-FU- OMeC-FC-OMeA-FU-OMeU-FA-OMeC-(ps)-FC-(ps)-OMeA 3′ Second strand (SEQ ID NO: 120, based on SEQ ID NO SEQ ID NO 6) 5′[ST23 (ps)]3 long trebler (ps)FU-OMeG-FG-OMeU- FA-OMeA-FU-OMeG-FG-OMeA-FC-OMeA-FG-OMeA-FG-OMeU- FU-(ps)-OMeA-(ps)-FU 3′ GalNAc-LPA-1038-L6 First strand (SEQ ID NO: 121, based on SEQ ID NO 5) OMeA-(ps)-FU-(ps)-OMeA-FA-OMeC-FU-OMeC-FU-OMeG-FU- OMeC-FC-OMeA-FU-OMeU-FA-OMeC-(ps)-FC-(ps)-OMeA 3′ Second strand (SEQ ID NO: 122, based on SEQ ID NO 6) 5′[ST23 (ps)]3 ST43 (ps)FU-OMeG-FG-OMeU-FA-OMeA- FU-OMeG-FG-OMeA-FC-OMeA-FG-OMeA-FG-OMeU-FU-(ps)- OMeA-(ps)-FU 3′ FN (N = A, C, G, U) denotes 2′Fluoro, 2′DeoxyNucleosides OMeN (N = A, C, G, U) denotes 2′O Methyl Nucleosides (ps) indicates a phosphorothioate linkage

    [0455] ST23 and T43 are as below.

    [0456] A Further Example are LPA 1041 Derivatives:

    TABLE-US-00002 GalNAc-LPA-1041-L1 First strand (SEQ ID NO: 123, based on SEQ ID NO 9) 5′ OMeA-(ps)-FU-(ps)-OMeA-FA-OMeC-FU-OMeC-FU-OMeG- FU-OMeC-FC-OMeA-FU-OMeU-FA-OMeC-(ps)-FC-(ps)-OMeG 3′ Second strand (SEQ ID NO: 124, based on SEQ ID NO 10) 5′[ST23 (ps)]3 long trebler (ps) FC-OMeG-FG-OMeU- FA-OMeA-FU-OMeG-FG-OMeA-FC-OMeA-FG-OMeA-FG-OMeU- FU-(ps)-OMeA-(ps)-FU 3′ GalNAc-LPA-1041-L6 First strand (SEQ ID NO: 125, based on SEQ ID NO 9) 5′OMeA-(ps)-FU-(ps)-OMeA-FA-OMeC-FU-OMeC-FU-OMeG- FU-OMeC-FC-OMeA-FU-OMeU-FA-OMeC-(ps)-FC-(ps)-OMeG 3′ Second strand (SEQ ID NO: 126, based on SEQ ID NO 10) 5′[ST23 (ps)]3 ST43 (ps) FC-OMeG-FG-OMeU-FA-OMeA- FU-OMeG-FG-OMeA-FC-OMeA-FG-OMeA-FG-OMeU-FU-(ps)- OMeA-(ps)-FU 3′ FN (N = A, C, G, U) denotes 2′Fluoro, 2′DeoxyNucleosides OMeN (N = A, C, G, U) denotes 2′O Methyl Nucleosides (ps) indicates a phosphorothioate linkage

    [0457] All oligonucleotides were either obtained from commercial oligonucleotide manufacturers (Biospring, Frankfurt, Germany, or RiboBio, Guangzhou, Guangdong, PRO) or synthesized on an AKTA oligopilot synthesizer (in house) using standard phosphoramidite chemistry. Commercially available solid support and 2′O-Methyl RNA phosphoramidites, 2′Fluoro DNA phosphoramidites (all standard protection) and commercially available long trebler phosphoramidite (Glen research) were used. Synthesis was performed using 0.1 M solutions of the phosphoramidite in dry acetonitrile and benzylthiotetrazole (BTT) was used as activator (0.3M in acetonitrile). All other reagents were commercially available standard reagents.

    [0458] Conjugation of the respective GalNac synthon (e.g., ST23, ST41 or ST43) was achieved by coupling of the respective phosphoramidite to the 5′end of the oligochain under standard phosphoramidite coupling conditions. Phosphorothioates were introduced using standard commercially available thiolation reagents (EDITH, Link technologies).

    [0459] The single strands were cleaved off the CPG by using methylamine (40% aqueous) and the resulting crude oligonucleotide was purified by Ion exchange chromatography (Resource Q, 6 mL, GE Healthcare) on a AKTA Pure HPLC System using a Sodium chloride gradient.

    [0460] Product containing fractions were pooled, desalted on a size exclusion column (Zetadex, EMP Biotech) and lyophilised.

    [0461] For annealing, equimolar amounts of the respective single strands were dissolved in water and heated to 80° C. for 5 min. After gradual cooling to RT the resulting duplex was lyophilised.

    [0462] The sequences of the resulting nucleic acids (siRNAs) are set out in Table 1 below.

    TABLE-US-00003 TABLE 1 Table 1: Non-conjugated nucleic acid sequences tested for inhibition of LPA mRNA expression. Sequences and applied  modification pattern are indicated SEQ ID NO: siRNA ID strand Sequence Modifications 1 LPA-1014 first  5′ucguauaacaauaaggggc3′ 5381616272616284847 strand 2 second 5′gccccuuauuguuauacga3′ 4737351615451616382 strand 3 LPA-1024 first  5′gauaacucuguccauuacc3′ 8252635354537251637 strand 4 second 5′gguaauggacagaguuauc3′ 4816254827282815253 strand 5 LPA-1038 first  5′auaacucuguccauuacca3′ 6162717181736152736 strand 6 second 5′ugguaauggacagaguuau3′ 1845261846364645161 strand 7 LPA-1040 first  5′uaacucuguccauuaccgu3′ 5263535453725163745 strand 8 second 5′acgguaauggacagaguua3′ 2748162548272828152 strand 9 LPA-1041 first 5′auaacucuguccauuaccg3′ 6162717181736152738 strand 10 second 5′cgguaauggacagaguuau3′ 3845261846364645161 strand 11 LPA-1055 first  5′agaaugugccucgauaacu3′ 6462545473538252635 strand 12 second 5′aguuaucgaggcacauucu3′ 2815253828472725171 strand 13 LPA-1057 first  5′auaacucuguccaucacca3′ 6162717181736172736 strand 14 second 5′uggugauggacagaguuau3′ 1845461846364645161 strand 15 LPA-1058 first  5′auaacucuguccaucaccu3′ 6162717181736172735 strand 16 second 5′aggugauggacagaguuau3′ 2845461846364645161 strand 17 LPA 1061 first  5′uaacucuguccauuaccau3′ 5263535453725163725 strand 18 second 5′augguaauggacagaguua3′ 2548162548272828152 strand 19 LPA-1086 first 5′augugccuugauaacucug3′ 6181837154616271718 strand 20 second 5′cagaguuaucaaggcacau3′ 3646451617264836361 strand 21 LPA-1099 first  5′aguuggugcugcuucagaa3′ 6451845471835172826 strand 22 second 5′uucugaagcagcaccaacu3′ 1535462836472736271 strand 23 LPA-1102 first  5′aauaaggggcugccacagg3′ 6252648483547363648 strand 24 second 5′ccuguggcagccccuuauu3′ 3718184728373715251 strand 25 LPA-1116 first  5′uaacucuguccaucaccau3′ 5263535453725363725 strand 26 second 5′auggugauggacagaguua3′ 2548182548272828152 strand 27 LPA-1127 first  5′augagccucgauaacucug3′ 6182837174616271718 strand 28 second 5′cagaguuaucgaggcucau3′ 3646451617464835361 strand 29 LPA-1128 first  5′aaugagccucgauaacucu3′ 6254647353825263535 strand 30 second 5′agaguuaucgaggcucauu3′ 2828152538284717251 strand 31 LPA-1141 first  5′aaugcuuccaggacauuuc3′ 6254715372846361517 strand 32 second 5′gaaauguccuggaagcauu3′ 4626181735482647251 strand 33 LPA-1151 first  5′acagugguggagaaugugc3′ 6364548184646254547 strand 34 second 5′gcacauucuccaccacugu3′ 4727251717363727181 strand 35 LPA-1171 first  5′guaugugccucgauaacuc3′ 8161818371746162717 strand 36 second 5′gaguuaucgaggcacauac3′ 4645161746483636163 strand 37 LPA-1177 first  5′ucgauaacucuguccauca3′ 5382526353545372536 strand 38 second Yugauggacagaguuaucga3′ 1825482728281525382 strand 39 LPA-1189 first  5′ugucacuggacauuguguc3′ 5453635482725181817 strand 40 second 5′gacacaauguccagugaca3′ 4636362545372818272 strand 41 LPA-1244 first  5′cugggauccaugguguaac3′ 7184825372548181627 strand 42 second 5′guuacaccauggaucccag3′ 4516363725482537364 strand 43 LPA-1248 first  5′agaugaccaagcuuggcag3′ 6461827362835184728 strand 44 second 5′cugccaagcuuggucaucu3′ 3547362835184536171 strand

    [0463] Table 1: Nucleotides modifications are depicted by the following numbers (column 4), 1=2′F-dU, 2=2′F-dA, 3=2′F-dC, 4=2′F-dG, 5=2′-OMe-rU; 6=2′-OMe-rA; 7=2′-OMe-rC; 8=2′-OMe-rG.

    TABLE-US-00004 TABLE 2 Sequences of LPA, APOB,beta-Actin and PTEN qPCR amplicon sets that were used to measure mRNA levels are shown below. SEQ ID Gene Species Sequences NO: LPA: human 5′ AAGTG 45 (upper) TCCTTGC GACGTCC 3′ LPA: 5′ CCTGG 46 (lower) ACTGTGG GGCTTT 3′ LPA: 5′ CTGTT 47 (probe) TCTGAAC AAGCACC AACGGAG C 3′ LPA cynomolgus 5′ GTGTC 48 (upper) CTCGCAA CGTCCA 3′ LPA 5′ GACCC 49 (lower) CGGGGCT TTG 3′ LPA 5′ TGGCT 50 (probe) GTTTCTG AACAAGC ACCAATG G 3′ APOB human 5′ TCATT 51 (upper) CCTTCCC CAAAGAG ACC 3′ APOB 5′ CACCT 52 (lower) CCGTTTT GGTGGTA GAG 3′ APOB 5′ CAAGC 53 (probe) TGCTCAG TGGAGGC AACACAT TA 3′ beta- human 5′ GCATG 54 Actin GGTCAGA (upper) AGGATTC CTAT 3′ beta- 5′ TGTAG 55 Actin AAGGTGT (lower) GGTGCCA GATT 3′ beta- 5′ TCGAG 56 Actin CACGGCA (probe) TCGTCAC CAA 3′ beta- cynomolgus 5′ AAGG 57 Actin CCAACCG (upper) CGAGAAG 3′ beta- 5′ AGAGG 58 Actin CGTACAG (lower) GGACAGC A 3′ beta- 5′ TGAGA 59 Actin CCTTCAA (probe) CACCCCA GCCATGT AC 3′ PPIB human 5′ AGATG 60 (upper) TAGGCCG GGTGATC TTT 3′ PPIB 5′ GTAGC 61 (lower) CAAATCC TTTCTCT CCTGT 3′ PPIB 5′ TGTTC 62 (probe) CAAAAAC AGTGGAT AATTTTG TGGCC 3′

    Example 2

    [0464] Screening of non-conjugated siRNA molecules (Table 1) for inhibition of LPA mRNA expression in human RT-4 cells.

    [0465] Liposomal transfection complexes were prepared in triplicate at a ratio of 1.5 μl RNAiMax (ThermoFisher)/80 pmol of the indicated siRNA molecules. The complex was diluted to the indicated concentrations of 2.5 nM and 25 nM, respectively (values represented pairwise as light and darker grey bars). RT4 human urinary bladder transitional cell papilloma cells expressing endogenously LPA were seeded at a density of 125.000 cells per well in 24-well format on top of previously plated transfection complexes (reverse transfection) at the indicated concentration. 24 hours after transfection total RNA was isolated using the Spin Cell Mini Kit 250 (Stratec). LPA mRNA levels were determined by qRT-PCR relative to PP/B mRNA expression in the respective samples as housekeeping transcript. Values were normalized to the amount of LPA mRNA detected in untreated cells (intraplate). A non-silencing siRNA compound was transfected as an additional control. Means and SD of normalized triplicate values are shown. Results are shown in FIG. 1.

    Example 3

    [0466] Dose response of non-conjugated LPA-targeting siRNA compounds on LPA mRNA expression in human RT-4 cells.

    [0467] RT4 human urinary bladder transitional cell papilloma cells were reversely transfected as described above (Example 2) and treated at the indicated concentration (range 100 nM to 0.2 nM) with the different non-conjugated siRNA compounds (Table 1) as labeled. 24 h post transfection, total RNA was isolated using the Spin Cell Mini Kit 250 (Stratec). LPA mRNA levels were determined by qRT-PCR relative to PP/B mRNA expression in the respective samples as housekeeping transcript. Values were normalized to the amount of LPA mRNA detected in untreated cells. The bars represent the remaining LPA mRNA expression for each data point. Results are shown in FIG. 2.

    Example 4

    [0468] Inhibition of LPA mRNA expression in human and cynomolgus primary hepatocytes by different doses of GalNAc-L1 LPA-1038 conjugated siRNA molecule delivered by receptor-mediated uptake.

    [0469] Primary hepatocytes (ThermoFisher) were plated on collagen-coated 96-well plates at densities of 45,000 cells per well (cynomolgus) and 30,000 cells per well (human). GalNAc-L1-conjugated LPA-1038 was added immediately after plating at the indicated concentrations (nM). 24 hours after siRNA treatment total RNA was isolated using the InviTrap RNA cell HTS 96 well kit (Stratec). LPA mRNA levels were determined by qRT-PCR relative to Actin (cynomolgus) or APOB (human) mRNA levels in the respective samples as housekeeping transcript. Values were normalized to LPA expression in untreated cells. Means and SD of normalized triplicate values of remaining LPA mRNA levels are shown as black bars. Results shown in FIG. 3.

    Example 5

    [0470] Knockdown of LPA-mRNA in human primary hepatocytes by the different indicated L6-GalNAc conjugated siRNAs in primary human hepatocytes upon receptor-mediated delivery.

    [0471] Primary human hepatocytes (ThermoFisher) were plated on collagen-coated 96-well plates at 30,000 cells per well (96 well format). GalNAc-L6-conjugated siRNAs including a non-silencing control were added immediately after cell plating at the two indicated concentrations. 24 hours after siRNA treatment total RNA was isolated using the InviTrap RNA cell HTS 96 well kit (Stratec). LPA mRNA expression levels were determined by qRT-PCR relative to APOB mRNA as housekeeping transcript. Values were normalized to LPA mRNA expression in untreated cells and remaining LPA mRNA levels represented pairwise as bars (100 nM black bars, 20 nM grey bars). Means and SD of normalized triplicate values are shown in FIG. 4.

    Example 6—In Vitro Determination of TTR Knockdown of Various TTR siRNA GalNAc Conjugates

    [0472] Murine primary hepatocytes were seeded into collagen pre-coated 96 well plates (Thermo Fisher Scientific, #A1142803) at a cell density of 30,000 cells per well and treated with siRNA-conjugates at concentrations ranging from 10 nM to 0.0001 nM. 24 h post treatment cells were lysed and RNA extracted with InviTrap® RNA Cell HTS 96 Kit/C24×96 preps (Stratec #7061300400) according to the manufactures protocol. Transcripts levels of TTR and housekeeping mRNA (PtenII) were quantified by TaqMan analysis.

    [0473] Target gene expression in primary murine hepatocytes 24 h following treatment with the conjugates of the invention, Conjugates 1-3, showed that target gene expression decreases as the dose of the conjugate increased compared to the negative controls (see “UT” column and Reference Conjugate 3), as shown in FIG. 7. This indicates that the first strand is binding to the target gene, thus lowering gene expression. FIG. 7 also shows the target gene expression levels of Reference Conjugates 1 and 2 which act as comparator conjugates. As can be seen from a comparison between the data presented in FIGS. 7A and 7C, and 7B and 7C, the conjugates of the invention (Conjugates 1-3) decrease the target gene expression compared to Reference Conjugates 1 and 2. The most effective conjugate at 0.01 nM appears to be Conjugate 2. The most effective conjugate at 0.1 nM, 0.5 nM, 1 nM and 10 nM appears to be Conjugate 3.

    Example 7—In Vivo Time Course of Serum TTR in Mice

    [0474] C57BL/6 mice were treated s.c. with 1 mg/kg siRNA-conjugates at day 0. Serum samples were taken at day 7, 14, and 27 by orbital sinus bleeding and stored at −20° C. until analysis. Serum TTR quantification was performed with a Mouse Prealbumin ELISA (ALPCO, 41-PALMS/lot 22, 2008003B) according to the manufacturers protocol (sample dilution 1:8000 or 1:800).

    [0475] The results of the time course of serum TTR in c57BL/6 mice cohorts of n=4 at 7, 14, and 27 days post s.c. treatment with 1 mg/kg Conjugates 1-3, Reference Conjugates 1, 2 and 4, and mock treated (PBS) individuals is shown in FIG. 8. As indicated by the data in FIG. 8, the conjugates of the invention are particularly effective at reducing target gene expression compared to the negative control (PBS) and Reference Conjugates 1, 2, and in particular to Reference Conjugate 4. Conjugates 2 and 3 are also more effective than Reference Conjugates 1, 2 and 4. The most effective conjugate is Conjugate 2. Thus, it may be expected that the dosing level of Conjugate 3 would be about three times lower to achieve the same initial knock down and would also result in longer duration of knock down as compared to Reference Conjugate 4.

    [0476] More specifically, Conjugate 2 resulted in 3-fold lower target protein level in serum at day seven and 4-fold lower target protein level in serum at day 27 compared to Reference Conjugate 4 at equimolar dose in wild type mice. Furthermore, Conjugate 2 resulted in 85% reduction of target serum protein level at day 27 after single injection, compared to 36% reduction by equimolar amount of Reference Conjugate 4.

    Example 8

    [0477] Equal dose response of knock down for LPA targeting siRNA with two single GalNAc units conjugated to the second strand as compared to a triantennary GalNAc unit at the 5′ second strand in primary cynomolgus hepatocytes.

    [0478] The siRNAs are modified with alternating 2′-OMe/2′-F and contain each two phosphorothioate (PS) internucleotide linkages at their 5′ and 3′ terminal two internucleotide linkages. In conjugate 19 one serinol-GalNAc unit each is attached via a PS-bond to the 5′ and 3′ of the second strand. In conjugate 20 the two terminal 5′ internucleotides of the second strand are phosphodiesters and a triantennary GalNAc linker is attached via a PS bond to this end.

    [0479] Dose response of LPA knockdown in primary cynomolgus hepatocytes was assessed 24 h post treatment with 100, 20, 4, 0.8, 0.16, 0.032, and 0.006 nM siRNA. The reference control is construct 2, the non-targeting control is named Cte. The transcript ct-value for each treatment group was normalized to the transcript ct value for the house keeping gen ACTB (Δct) and to untreated hepatocytes, named ut (ΔΔct).

    [0480] Data are shown in FIG. 10

    [0481] Material & Methods:

    TABLE-US-00005 siRNAs SEQ ID NO: name batch strand sequence 135 Conjugate X0373 X0373A mA (ps) fU 19 (ps) mA fA mC fU mC fU mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG 136 X0373B Ser(GN) (ps) fC (ps) mG (ps) fG mU fA mA fU mG fG mA fC mA fG mA fG mU fU (ps) mA (ps) fU (ps) Ser(GN) 135 Ref. STS200 STS2041 mA (ps) fU Conjugate 41L6 A (ps) mA fA 9 mC fU mC fU mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG 137 STS2041 ST23 (ps) B ST23 (ps) ST23 (ps) C6XLT (ps) fC mG fG mU fA mA fU mG fG mA fC mA fG mA fG mU fU (ps) mA (ps) fU 138 Reference X0125 X0125A mC (ps) fU Conjugate (ps) mU fA 5 (CTR) mC fU mC fU mC fG mC fC mC fA mA fG mC (ps) fG (ps) mA 139 X0125B [(ST23) (ps)]3 (C6XLT) (ps) fU mC fG mC fU mU fG mG fG mC fG mA fG mA fG mU fA (ps) mA (ps) fG Legend mA, mU, mC, mG 2′-O-Methyl RNA fA, fU, fC, fG 2′-deoxy-2′-fluoro RNA (ps) phosphorothioate (po) phosphodiester

    [0482] Primer:

    TABLE-US-00006 SEQ ID NO: LPA fw GTGTCCTCGCAACGTCCA 48 rev GACCCCGGGGCTTTG 49 probe BHQ1-TGGCTGTTTCTGAAC 140 AAGCACCAATGG-FAM ACTB fw GCATGGGTCAGAAGGATTCCTAT 54 rev TGTAGAAGGTGTGGTGCCAGATT 55 probe BHQ1-TCGAGCACGGCATCGTCA 141 CCAA-VIC

    [0483] General Methods

    [0484] In Vitro Experiments

    [0485] Primary murine hepatocytes (Thermo Scientific: GIBCO Lot: #MC798) were thawed and cryo-preservation medium exchanged for Williams E medium supplemented with 5% FBS, 1 μM dexamethasone, 2 mM GlutaMax, 1% PenStrep, 4 mg/ml human recombinant insulin, 15 mM Hepes. Cell density was adjusted to 250000 cells per 1 ml. 100 μl per well of this cell suspension were seeded into collagen pre-coated 96 well plates. The test article was prediluted in the same medium (5 times concentrated) for each concentration and 25 μl of this prediluted siRNA or medium only were added to the cells. Cells were cultured in at 37° C. and 5% CO.sub.2. 24 h post treatment the supernatant was discarded, and cells were washed in cold PBS and 250 μl RNA-Lysis Buffer S (Stratec) was added. Following 15 mi incubation at room temperature plates were storage at −80° C. until RNA isolation according to the manufacturers protocol.

    [0486] TaqMan Analysis

    [0487] For mTTR & PTEN MultiPlex TaqMan analysis 10 μl isolated RNA for each treatment group were mixed with 10 μl PCR mastermix (TAKYON low Rox) containing 600 nM mTTR-primer, 400 nM ApoB-primer and 200 nM of each probe as well as 0.5 units Euroscript II RT polymerase with 0.2 units RNAse inhibitor. TaqMan analysis was performed in 384-well plate with a 10 min RT step at 48° C., 3 mi initial denaturation at 95° C. and 40 cycles of 95° C. for 10 sec and 60° C. for 1 mi. The primers contain two of BHQ1, FAM and YY, one at each end of the sequence.

    [0488] For TMPRSS6 & ApoB MultiPlex TaqMan analysis 10 μl isolated RNA for each treatment group were mixed with 10 μl PCR mastermix (TAKYON low Rox) containing 800 nM TMPRSS6 primer, 100 nM ApoB primer and 200 nM of either probe as well as 0.5 units Euroscript II RT polymerase with 0.2 units RNAse inhibitor. TaqMan analysis was performed in 384-well plate with a 10 min RT step at 48° C., 3 min initial denaturation at 95° C. and 40 cycles of 95° C. for 10 sec and 60° C. for 1 mi.

    [0489] In Vivo Experiments

    [0490] To compare in vivo potency of different siRNA conjugates 1 mg/kg siRNA dissolved in PBS was administered sub cutaneous in the scapular region of c57BL/6 mice. Cohorts of of n=6 for were treated with siRNA targeting Aldh2 or Tmprss6 at day 1 and sacrificed at selected times points post treatment. Liver samples were snap frozen in liquid nitrogen and stored at −80° C. until extraction RNA with InviTrap Spin Tissue RNA Mini Kit (stratec) according to the manufacturers manual. Following, transcript level of Aldh2, Tmprss6 and Pten were quantified as described above.

    [0491] Tritosome Stability Assay

    [0492] To probe for RNAase stability in the endosomal/lysosomal compartment of hepatic cells in vitro siRNA was incubated for 0 h, 4 h, 24 h or 72 h in Sprague Dawley Rat Liver Tritosomes (Tebu-Bio, CatN.: R0610.LT, lot: 1610405, pH: 7.4, 2.827 Units/ml). To mimic the acidified environment the Tritosomes were mixed 1:10 with low pH buffer (1.5M acetic acid, 1.5M sodium acetate pH 4.75). 30 μl of this acidified Tritosomes. Following 10 μl siRNA (20 μM) were mixed with and incubated for the indicated times at 37° C. Following incubation RNA was isolated with the Clarity OTX Starter Kit-Cartriges (Phenomenex CatNo: KSO-8494) according to the manufactures protocol for biological fluids. Lyophilized RNA was reconstituted in 30 μl H.sub.2O, mixed with 4× loading buffer and 5 μl were loaded to a 20% TBE-polyacrylamide gel electrophoresis (PAGE) for separation qualitative semi-quantitative analysis. PAGE was run at 120 V for 2 h and RNA visualized by Ethidum-bromide staining with subsequent digital imaging with a Biorad Imaging system.

    Example 9—Synthesis of Conjugates

    [0493] Example compounds were synthesised according to methods described below and methods known to the person skilled in the art. Assembly of the oligonucleotide chain and linker building blocks was performed by solid phase synthesis applying phosphoramidite methodology. GalNAc conjugation was achieved by peptide bond formation of a GalNAc-carboxylic acid building block to the prior assembled and purified oligonucleotide having the necessary number of amino modified linker building blocks attached.

    [0494] Oligonucleotide synthesis, deprotection and purification followed standard procedures that are known in the art.

    [0495] All Oligonucleotides were synthesized on an AKTA oligopilot synthesizer using standard phosphoramidite chemistry. Commercially available solid support and 2′O-Methyl RNA phosphoramidites, 2′Fluoro, 2′Deoxy RNA phosphoramidites (all standard protection, ChemGenes, LinkTech) and commercially available 3′-Amino Modifier TFA Amino C-6 Icaa CPG 500 Å (Chemgenes), Fmoc-Amino-DMT C-7 CE phosphoramidite (GlyC3Am), 3′-Amino Modifier C-3 Icaa CPG 500 Å (C3Am), Fmoc-Amino-DMT C-3 CED phosphoramidite (C3Am) and TEA-Amino C-6 CED phosphoramidite (C6Am) (Chemgenes), 3′-Amino-Modifier C7 CPG (C7Am) (Glen Research), Non-nucleosidic TFA amino Phosphoramidite (Pip), Non-nucleosidic TFA amino Solid Support (PipAm) (AM Chemicals) were used. Per-acetylated galactose amine 8 is commercially available.

    [0496] Ancillary reagents were purchased from EMP Biotech. Synthesis was performed using a 0.1 M solution of the phosphoramidite in dry acetonitrile and benzyithiotetrazole (BTT) was used as activator (0.3M in acetonitrile). Coupling time was 15 min. A Cap/OX/Cap or Cap/Thio/Cap cycle was applied (Cap: Ac.sub.2O/NMI/Lutidine/Acetonitrile, Oxidizer: 0.1M I.sub.2 in pyridine/H.sub.2O). Phosphorothioates were introduced using standard commercially available thiolation reagent (EDITH, Link technologies). DMT cleavage was achieved by treatment with 3% dichloroacetic acid in toluene. Upon completion of the programmed synthesis cycles a diethylamine (DEA) wash was performed. All oligonucleotides were synthesized in DMT-off mode.

    [0497] Attachment of the serinol-derived linker moiety was achieved by use of either base-loaded (S)-DMT-Serinol(TFA)-succinate-Icaa-CPG 10 or a (S)-DMT-Serinol(TFA) phosphoramidite 7 (synthesis was performed as described in literature Hoevelmann et al. Chem. Sci., 2016, 7, 128-135). Tri-antennary GalNAc clusters (ST23/C4XLT or ST23/C6XLT) were introduced by successive coupling of the respective trebler amidite derivatives (C4XLT-phos or C6XLT-phos) followed by the GalNAc amidite (ST23-phos).

    [0498] Attachment of amino modified moieties (non-serinol-derived linkers) was achieved by use of either the respective commercially available amino modified building block CPG or amidite.

    [0499] The single strands were cleaved off the CPG by 40% aq. methylamine treatment. The resulting crude oligonucleotide was purified by ion exchange chromatography (Resource Q, 6 mL, GE Healthcare) on a AKTA Pure HPLC System using a sodium chloride gradient. Product containing fractions were pooled, desalted on a size exclusion column (Zetadex, EMP Biotech) and lyophilised.

    [0500] Individual single strands were dissolved in a concentration of 60 OD/mL in H.sub.2O. Both individual oligonucleotide solutions were added together in a reaction vessel. For easier reaction monitoring a titration was performed. The first strand was added in 25% excess over the second strand as determined by UV-absorption at 260 nm. The reaction mixture was heated to 80° C. for 5 min and then slowly cooled to RT. Double strand formation was monitored by ion pairing reverse phase HPLC. From the UV-area of the residual single strand the needed amount of the second strand was calculated and added to the reaction mixture. The reaction was heated to 80° C. again and slowly cooled to RT. This procedure was repeated until less than 10% of residual single strand was detected.

    [0501] Synthesis of Compounds 2-10

    [0502] Compounds 2 to 5 and (S)-DMT-Serinol(TFA)-phosphoramidite 7 were synthesised according to literature published methods (Hoevelmann et al. Chem. Sci., 2016, 7, 128-135).

    (S)-4-(3-(bis(4-methoxyphenyl)(phenyl)methoxy)-2-(2,2,2-trifluoroacetamido)propoxy)-4-oxobutanoic Acid (6)

    [0503] To a solution of 5 in pyridine was added succinic anhydride, followed by DMAP. The resulting mixture was stirred at room temperature overnight. All starting material was consumed, as judged by TLC. The reaction was concentrated. The crude material was chromatographed in silica gel using a gradient 0% to 5% methanol in DCM (+1% triethylamine) to afford 1.33 g of 6 (yield=38%). m/z (ESI−): 588.2 (100%), (calcd. for C30H29F3NO8.sup.− [M-H].sup.− 588.6). 1H-NMR: (400 MHz, CDCl3) δ [ppm]=7.94 (d, 1H, NH), 7.39-7.36 (m, 2H, CHaryl), 7.29-7.25 (m, 7H, CHaryl), 6.82-6.79 (m, 4H, CHaryl), 4.51-4.47 (m, 1H), 4.31-4.24 (m, 2H), 3.77 (s, 6H, 2xDMTr-OMe), 3.66-3.60 (m, 16H, HNEt.sub.3.sup.+), 3.26-3.25 (m, 2H), 2.97-2.81 (m, 20H, NEt.sub.3), 2.50-2.41 (4H, m), 1.48-1.45 (m, 26H, HNEt.sub.3.sup.+), 1.24-1.18 (m, 29H, NEt.sub.3).

    (S)-DMT-Serinol(TFA)-succinate-Icaa-CPG (10)

    [0504] The (S)-DMT-Serinol(TFA)-succinate (159 mg, 270 umol) and HBTU (113 mg, 299 umol) were dissolved in CH.sub.3CN (10 mL). Diisopropylethylamine (DIPEA, 94 μL, 540 umol) was added to the solution, and the mixture was swirled for 2 mi followed by addition native amino-Icaa-CPG (500 A, 3 g, amine content: 136 umol/g). The suspension was gently shaken at room temperature on a wrist-action shaker for 16 h then filtered, and washed with DCM and EtOH. The solid support was dried under vacuum for 2 h. The unreacted amines on the support were capped by stirring with acetic anhydride/lutidine/N-methylimidazole at room temperature. The washing of the support was repeated as above. The solid was dried under vacuum to yield solid support 10 (3 g, 26 umol/g loading).

    [0505] GalNAc Synthon (9)

    [0506] Synthesis of the GalNAc synthon 9 was performed as described in Nair et al. J. Am, Chem. Soc., 2014, 136 (49), pp 16958-16961, in 46% yield over two steps.

    [0507] The characterising data matched the published data.

    [0508] Synthesis of Oligonucleotides

    [0509] All single stranded oligonucleotides were synthesised according to the reaction conditions described above and in FIGS. 5 and 6, and are outlined in Tables 3 and 4.

    [0510] All final single stranded products were analysed by AEX-HPLC to prove their purity. Purity is given in % FLP (% full length product) which is the percentage of the UV-area under the assigned product signal in the UV-trace of the AEX-HPLC analysis of the final product.

    [0511] Identity of the respective single stranded products (non-modified, amino-modified precursors or GalNAc conjugated oligonucleotides) was proved by LC-MS analysis.

    TABLE-US-00007 TABLE 3 Single stranded un-conjugated oligonucleotides MW % FLP Product MW (ESI−) (AEX- (11) Name calc. found HPLC) A0002 STS16001A 6943.3 Da 6943.0 Da 86.6% A0006 STS16001BL4 8387.5 Da 8387.5 Da 94.1% A0114 STS22006A 6143.8 Da 6143.7 Da 94.3% A0115 STS22006BL1 7855.1 Da 7855.1 Da 92.8% A0122 STS22009A 6260.9 Da 6260.6 Da 92.8% A0123 STS22009BL1 7783.0 Da 7782.9 Da 87.1% A0130 STS18001A 6259.9 Da 6259.8 Da 76.5% A0131 STS18001BL4 7813.2 Da 7813.1 Da 74.3% A0220 STS16001B-5′1xNH2 6982.2 Da 6982.1 Da 95.7% A0237 STS16001A 6943.3 Da 6943.3 Da 95.6% A0244 STS16001BV1 6845.2 Da 6844.9 Da 98.2% A0264 STS16001AV4-3′1xNH2 7112.4 Da 7112.2 Da 95.4% A0329 STS16001BV6-3′5′1xNH2 7183.3 Da 7183.2 Da 88.8% A0560 STS16001A 6943.3 Da 6943.3 Da 96.7% A0541 STS16001BV1-3′5′NH2 7151.3 Da 7151.0 Da 85.6% A0547 STS16001BV16-3′5′NH2 7119.3 Da 7119.1 Da 89.9% A0617 STS16001BV20-3′5′NH2 7087.3 Da 7086.7 Da 90.1% A0619 STS16001BV1-3′5′2xNH2 7521.3 Da 7521.3 Da 93.4% A0680 STS16001A 6943.3 Da 6942.9 Da 91.2% A0514 STS22006A 6143.8 Da 6143.7 Da 94.6% A0516 STS22009BV11-3′5′NH2 6665.0 Da 6664.8 Da 87.0% A0517 STS22009BV11-3′5′NH2 6593.0 Da 6593.0 Da 86.0% A0521 STS12009BV1-3′5′NH2 6437.7 Da 6437.8 Da 91.1% A0303 STS12209BL4 7665.0 Da 7664.9 Da 90.4% A0304 STS12209A 6393.1 Da 6392.9 Da 77.6% A0319 STS22009A 6260.9 Da 6260.5 Da 86.9% A0353 STS12009A 6416.1 Da 6416.1 Da 94.1% A0216 STS17001A 6178.8 Da 6178.7 Da 87.2% A0217 STS17001BL6 7937.2 Da 7937.2 Da 78.3%

    [0512] 5′1×NH2 means refers to the position (5′ end) and number (1×NH2) of free serinol derived amino groups which are available for conjugation. For example, 1×3′NH2 on A0264 means there is free amino group which can be reacted with GalNAc synthon 9 at the 3′ end of the strand A0264. 3′5′1×NH2 means there is one serinol-derived free amino group which can be reacted with GalNAc linker 9 at the 3′ end and the 5′ end of the strand.

    TABLE-US-00008 TABLE 4 Single stranded oligonucleotides with 5′ and 3′ modifications MW % FLP MW (ESI−) (AEX- Product Name 5′mod 3′mod calc. found HPLC) A0561 STS16001BV1-3′5′1xNH2 C6Am GlyC3Am 7267.5 Da 7267.5 Da 66.7% A0563 STS16001BV1-3′5′1xNH2 C3Am C3Am 7183.4 Da 7183.1 Da 75.1% A0651 STS16001BV1-3′5′1xNH2 C6Am C7Am 7265.6 Da 7265.2 Da 99.6% A0653 STS16001BV1-3′5′1xNH2 GlyC3Am GlyC3Am 7299.5 Da 7299.3 Da 88.1% A0655 STS16001BV1-3′5′1xNH2 PipAm PipAm 7517.7 Da 7517.5 Da 89.8%

    [0513] Similarly, 3′5′1×NH2 refers to the position (3′ and 5′ end) and number (1×NH2 each) of free amino groups which are available for conjugation. For example, 3′5′1×NH2 on A0561 means there are 2 free amino group (1 at the 3′ AND 1 at the 5′ end) which can be reacted with GalNAc synthon 9 at the 3′ end of the strand A0561.

    [0514] Synthesis of Certain Conjugates and Reference Conjugates 1-2

    [0515] Conjugation of the GalNac synthon (9) was achieved by coupling to the serinol-amino function of the respective oligonucleotide strand 11 using a peptide coupling reagent. Therefore, the respective amino-modified precursor molecule 11 was dissolved in H.sub.2O (500 OD/mL) and DMSO (DMSO/H.sub.2O, 2/1, v/v) was added, followed by DIPEA (2.5% of total volume). In a separate reaction vessel pre-activation of the GalN(Ac4)-C4-acid (9) was performed by reacting 2 eq. (per amino function in the amino-modified precursor oligonucleotide 11) of the carboxylic acid component with 2 eq. of HBTU in presence of 8 eq. DIPEA in DMSO. After 2 mi the pre-activated compound 9 was added to the solution of the respective amino-modified precursor molecule. After 30 mi the reaction progress was monitored by LCMS or AEX-HPLC. Upon completion of the conjugation reaction the crude product was precipitated by addition of 10×iPrOH and 0.1×2M NaCl and harvested by centrifugation and decantation. To set free the acetylated hydroxyl groups in the GalNAc moieties the resulting pellet was dissolved in 40% MeNH2 (1 mL per 500 OD) and after 15 min at RT diluted in H.sub.2O (1:10) and finally purified again by anion exchange and size exclusion chromatography and lyophilised to yield the final product 12 (Table 5).

    TABLE-US-00009 TABLE 5 Single stranded GalNAc-conjugated oligonucleotides MW % FLP Product Starting MW (ESI−) (AEX- (12) Material Name calc. found HPLC) A0241 A0220 STS16001BL20 7285.5 Da 7285.3 Da 91.8% A0268 A0264 STS16001AV4L33 7415.7 Da 7415.4 Da 96.9% A0330 A0329 STS16001BV6L42 7789.8 Da 7789.8 Da 95.5% A0544 A0541 STS16001BV1L75 7757.9 Da 7757.7 Da 93.3% A0550 A0547 STS16001BV16L42 7725.9 Da 7725.7 Da 88.5% A0620 A0617 STS16001BV20L75 7693.91 Da  7693.2 Da 90.9% A0622 A0619 STS16001BV1L94 8734.3 Da 8734.6 Da 82.9% A0519 A0516 STS22006BV11L42 7271.7 Da 7271.7 Da 90.0% A0520 A0517 STS22009BV11L42 7199.6 Da 7199.7 Da 92.9% A0522 A0521 STS12009BV1L42 7044.4 Da 7044.4 Da 96.0% A0603 A0602 STS20041BV1L42 7280.7 Da 7280.4 Da 93.4%

    [0516] Synthesis of Certain Conjugates of the Invention

    [0517] Conjugation of the GalNac synthon (9) was achieved by coupling to the amino function of the respective oligonucleotide strand 14 using a peptide coupling reagent. Therefore, the respective amino-modified precursor molecule 14 was dissolved in H.sub.2O (500 OD/mL) and DMSO (DMSO/H.sub.2O, 2/1, v/v) was added, followed by DIPEA (2.5% of total volume). In a separate reaction vessel pre-activation of the GalN(Ac4)-C4-acid (9) was performed by reacting 2 eq. (per amino function in the amino-modified precursor oligonucleotide 14) of the carboxylic acid component with 2 eq. of HBTU in presence of 8 eq. DIPEA in DMSO. After 2 min the pre-activated compound 9 was added to the solution of the respective amino-modified precursor molecule. After 30 min the reaction progress was monitored by LCMS or AEX-HPLC. Upon completion of the conjugation reaction the crude product was precipitated by addition of 10×iPrOH and 0.1×2M NaCl and harvested by centrifugation and decantation. To set free the acetylated hydroxyl groups in the GalNAc moieties the resulting pellet was dissolved in 40% MeNH2 (1 mL per 500 OD) and after 15 mi at RT diluted in H.sub.2O (1:10) and finally purified again by anion exchange and size exclusion chromatography and lyophilised to yield the final product 15 (Table 6).

    TABLE-US-00010 TABLE 6 Single stranded GalNAc-conjugated oligonucleotides MW % FLP Product Starting MW (ESI−) (AEX- (15) Material Name calc. found HPLC) A0562 A0561 STS16001BV1L87 7874.2 Da 7874.0 Da 82.7% A0564 A0563 STS16001BV1L88 7790.0 Da 7789.4 Da 90.4% A0652 A0651 STS16001BV1L96 7872.2 Da 7871.8 Da 94.6% A0654 A0653 STS16001BV1L97 7906.2 Da 7905.6 Da 89.9% A0656 A0655 STS16001BV1L98 8124.3 Da 8124.0 Da 93.6%

    [0518] Double Strand Formation

    [0519] Double strand formation was performed according to the methods described above.

    [0520] The double strand purity is given in % double strand which is the percentage of the UV-area under the assigned product signal in the UV-trace of the IP-RP-HPLC analysis (Table 7).

    TABLE-US-00011 TABLE 7 Nucleic acid conjugates Starting Materials First Second % double Product Strand Strand Name strand Ref. Conj. 1 A0237 A0241 STS16001L20 97.7% Ref. Conj. 2 A0268 A0244 STS16001L33 97.8% Ref. Conj. 3 A0130 A0131 STS18001L4 96.8% Ref. Conj. 4 A0002 A0006 STS16001L4 90.1% Ref. Conj. 5 A0216 A0217 STS17001L6 88.4% Conjugate 1 A0268 A0241 STS16001L24 96.0% Conjugate 2 A0237 A0330 STS16001V1L42 98.5% Conjugate 3 A0268 A0330 STS16001V1L43 98.2% Conjugate 4 A0560 A0544 STS16001V1L75 92.5% Conjugate 5 A0560 A0550 STS16001V16L42 95.3% Conjugate 6 A0237 A0620 STS16001V20L75 97.8% Conjugate 7 A0237 A0622 STS16001V1L94 93.7% Conjugate 8 A0680 A0652 STS16001V1L96 98.4% Conjugate 9 A0680 A0654 STS16001V1L97 95.8% Conjugate 10 A0680 A0656 STS16001V1L98 97.6% Conjugate 11 A0560 A0564 STS16001V1L88 95.0% Conjugate 12 A0237 A0562 STS16001V1L87 96.8% Conjugate 13 A0114 A0115 STS22006L1 85.6% Conjugate 14 A0122 A0123 STS22009L1 96.4% Conjugate 15 A0514 A0519 STS22006V11L42 98.6% Conjugate 16 A0319 A0520 STS22009V11L42 97.0% Conjugate 17 A0304 A0303 STS12209L4 93.0% Conjugate 18 A0353 A0522 STS12009V1L42 98.0% Conjugate 19 A0601 A0603 STS20041BL42 97.6%

    [0521] Sequences

    [0522] Modifications key for the following sequences:

    [0523] f denotes 2′Fluoro 2′deoxyribonucleotide or 2′-fluoro ribonucleotide (the terms are interchangeable)

    [0524] m denotes 2′O Methyl ribonucleotide

    [0525] (ps) denotes phosphorothioate linkage

    [0526] FAM=6-Carboxyfluorescein

    [0527] BHQ=Black Hole Quencher 1

    [0528] YY=Yakima Yellow

    Definitions

    [0529] Ser(GN) is a GalNAc-C4 building block attached to serinol derived linker moiety:

    ##STR00038##

    [0530] wherein the O— is the linkage between the oxygen atom and e.g. H, phosphordiester linkage or phosphorothioate linkage.

    [0531] GN is:

    ##STR00039##

    [0532] C4XLT is:

    ##STR00040##

    [0533] C6XLT is:

    ##STR00041##

    [0534] ST23 is:

    ##STR00042##

    [0535] Synthesis of the phosphoraridite derivatives of C4XLT (C4XLT-phos), C6XLT (C6XLT-phos) as well as ST23 (ST23-phos) can be performed as described in WO2017/174657.

    [0536] C4XLT-phos:

    ##STR00043##

    [0537] C6XLT-phos:

    ##STR00044##

    [0538] ST23-phos:

    ##STR00045##

    ##STR00046##

    [0539] wherein G=H (pre conjugation) or G=GN (post conjugation).

    [0540] Conjugate 1

    TABLE-US-00012 Antisense strand-STS16001AL33 (SEQ ID NO: 127) 5′ mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU (ps) Ser(GN) 3′ Sense strand-STS16001BL20 (SEQ ID NO: 128) 5′ Ser(GN) (ps) fA mA fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA 3′

    [0541] Conjugate 2

    TABLE-US-00013 Antisense strand-STS16001A (SEQ ID NO: 129) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU Sense strand-STS16001BV1L42 (SEQ ID NO: 130) Ser(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) Ser(GN)

    [0542] Conjugate 3

    TABLE-US-00014 Antisense strand-STS16001AL33 (SEQ ID NO: 127) 5′ mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU (ps) Ser(GN) 3′ Sense strand-STS16001BV1L42 (SEQ ID NO: 130) 5′ Ser(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) Ser(GN) 3′

    [0543] Conjugate 4

    TABLE-US-00015 Antisense strand-STS16001A (SEQ ID NO: 129) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU Sense strand-STS16001BV1L75 (SEQ ID NO: 142) 5′ Ser(GN) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA Ser(GN) 3′

    [0544] Conjugate 5

    TABLE-US-00016 Antisense strand-STS16001A (SEQ ID NO: 129) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU Sense strand-STS16001BV16L42 (SEQ ID NO: 143) 5′ Ser(GN) (ps) fA mA fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU mA fA (ps) Ser(GN) 3′

    [0545] Conjugate 6

    TABLE-US-00017 Antisense strand-STS16001A (SEQ ID NO: 129) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU Sense strand-5T516001BV20L75 (SEQ ID NO: 144) 5′ Ser(GN)fA mA fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU mA fA Ser(GN) 3′

    [0546] Conjugate 7

    TABLE-US-00018 Antisense strand- (SEQ ID NO: 129) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU Sense strand-STS16001BV1L94 (SEQ ID NO: 145) 5′ Ser(GN) (ps) Ser(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) Ser(GN) (ps) Ser(GN) 3′

    [0547] Conjugate 8

    TABLE-US-00019 Antisense strand-STS16001A (SEQ ID NO: 129) 5′ mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU 3′ Sense strand-STS16001V1BL96 (SEQ ID NO: 146) 5′ C6Am(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) C7Am(GN) 3′

    [0548] Conjugate 9

    TABLE-US-00020 Antisense strand-STS16001A (SEQ ID NO: 129) 5′ mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU 3′ Sense strand-STS16001V1BL97 (SEQ ID NO: 147) 5′ GlyC3Am(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) GlyC3Am(GN) 3′

    [0549] Conjugate 10

    TABLE-US-00021 Antisense strand-STS16001A (SEQ ID NO: 129) 5′ mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU 3′ Sense strand (SEQ ID NO: 148) 5′ PipAm(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) PipAm(GN) 3′

    [0550] Conjugate 11

    TABLE-US-00022 Antisense strand-STS16001A (SEQ ID NO: 129) 5′ mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU 3′ Sense strand-STS16001V1BL88 (SEQ ID NO: 149) 5′ C3Am(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) C3Am(GN) 3′

    [0551] Conjugate 12

    TABLE-US-00023 Antisense strand-STS16001A (SEQ ID NO: 129) 5′ mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU 3′ Sense strand-STS16001V1BL87 (SEQ ID NO: 150) 5′ C6Am(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) GlyC3Am(GN) 3′

    [0552] Conjugate 15

    TABLE-US-00024 Antisense strand (SEQ ID NO: 151) mU (ps) fC (ps) mU fU mC fU mU fA mA fA mC fU mG fA mG fU mU (ps) fU (ps) mC Sense strand (SEQ ID NO: 152) Ser(GN) (ps) fG (ps) mA (ps) fA mA fC mU fC mA fG mU fU mU fA mA fG mA fA (ps) mG (ps) fA (ps) Ser(GN)

    [0553] Conjugate 16

    TABLE-US-00025 Antisense strand (SEQ ID NO: 153) mA (ps) fU (ps) mG fU mA fG mC fC mG fA mG fG mA fU mC fU mU (ps) fC (ps) mU Sense strand (SEQ ID NO: 154) Ser(GN) (ps) fA (ps) mG (ps) fA mA fG mA fU mC fC mU fC mG fG mC fU mA fC (ps) mA (ps) fU (ps) Ser(GN)

    [0554] Conjugate 18

    TABLE-US-00026 Antisense strand (SEQ ID NO: 155) mA (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA Sense strand (SEQ ID NO: 156) Ser(GN) (ps) fU (ps) mC (ps) fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fU (ps) Ser(GN)

    [0555] Conjugate 19

    TABLE-US-00027 Antisense strand (SEQ ID NO: 135) mA (ps) fU (ps) mA fA mC fU mC fU mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG Sense strand (SEQ ID NO: 136) Ser(GN) (ps) fC (ps) mG (ps) fG mU fA mA fU mG fG mA fC mA fG mA fG mU fU (ps) mA (ps) fU (ps) Ser(GN)

    [0556] Reference Conjugate 1

    TABLE-US-00028 Antisense strand - STS16001A (SEQ ID NO: 129) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU Sense strand - STS16001BL20 (SEQ ID NO: 128) Ser(GN) (ps) fA mA fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA

    [0557] Reference Conjugate 2

    TABLE-US-00029 Antisense strand-STS16001AL33 (SEQ ID NO: 127) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU (ps) Ser(GN) Sense strand-STS16001BV1 (SEQ ID NO: 157) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA

    [0558] Reference Conjugate 3—“Luc”

    TABLE-US-00030 Antisense strand-STS18001A (A0130, SEQ ID NO: 132) mU (ps) fC (ps) mG fA mA fG mU fA mU fU mC fC mG fC mG fU mA(ps)fC(ps)mG Sense strand-STS18001BL4 (A0131, SEQ ID NO: 133) [(ST23) (ps)].sub.3 C4XLT (ps) fC mG fU mA fC mG fC mG fG mA fA mU fA mC fU mU fC (ps) mG (ps) fA

    [0559] Reference Conjugate 4

    TABLE-US-00031 Antisense strand-STS16001AL33 (SEQ ID NO: 127) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU Sense strand-STS16001BL4 (SEQ ID NO: 134) 5′[(ST23) (ps).sub.3 C4XLT(ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA

    [0560] Reference Conjugate 5—“Ctr”

    TABLE-US-00032 Antisense strand (SEQ ID NO: 138) mC (ps) fU (ps) mU fA mC fU mC fU mC fG mC fC mC fA mA fG mC (ps) fG (ps) mA Sense strand (SEQ ID NO: 139) [(ST23) (ps)]3 (C6XLT) (ps) fU mC fG mC fU mU fG mG fG mC fG mA fG mA fG mU fA (ps) mA (ps) fG

    [0561] Reference Conjugate 6

    TABLE-US-00033 Antisense strand (SEQ ID NO: 151) mU (ps) fC (ps) mU fU mC fU mU fA mA fA mC fU mG fA mG fU mU (ps) fU (ps) mC Sense strand (SEQ ID NO: 158) [ST23 (ps)]3 Itrb (ps) fG mA fA mA fC mU fC mA fG mU fU mU fA mA fG mA fA (ps) mG (ps) fA

    TABLE-US-00034 Reference Coniudate 7 Antisense strand (SEQ ID NO: 153) mA (ps) fU (ps) mG fU mA fG mC fC mG fA mG fG mA fU mC fU mU (ps) fC (ps) mU Sense strand (SEQ ID NO: 159) [ST23 (ps)]3 Itrb (ps) fA mG fA mA fG mA fU mC fC mU fC mG fG mC fU mA fC (ps) mA (ps) fU

    [0562] Reference Conjugate 8

    TABLE-US-00035 Antisense strand (SEQ ID NO: 160) mU (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA Sense strand (SEQ ID NO: 161) [ST23 (ps)]3 ST41 (ps)fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fA

    [0563] Reference Conjugate 9

    TABLE-US-00036 Antisense strand (SEQ ID NO: 135) mA (ps) fU (ps) mA fA mC fU mC fU mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG Sense strand (SEQ ID NO: 162) [ST23 (ps)]3 C6XLT (ps) fC mG fG mU fA mA fU mG fG mA fC mA fG mA fG mU fU (ps) mA (ps) fU

    Example 10—In Vitro Determination of TTR Knockdown of Various TTR siRNA GalNAc Conjugates

    [0564] Conjugates 4 to 7

    [0565] The method described above under “In vitro experiments” in the General Method section was followed.

    [0566] Target gene expression in primary murine hepatocytes 24 h following treatment at 0.01 nM, 0.1 nM, 0.5 nM, 1 nM and 10 nM with the conjugates of the invention, Conjugates 4-7, showed that target gene expression decreases as the dose of the conjugate increased compared to the negative controls (see “UT” column and Luc [Reference Conjugate 3]), as shown in FIG. 11. This indicates that the first strand is binding to the target gene, thus lowering gene expression.

    [0567] The in vitro data show that in the context of one or two serinol-derived linker moieties being provided at 5′ and 3′ ends of the sense strand in Conjugates 4-7, the number of phosphorothioate (PS) bonds between the terminal nucleotide and the linker, and/or between the terminal three nucleotides in the sense strand, can be varied whilst maintaining efficacy for decreasing target gene expression.

    [0568] Conjugates 8 to 12 and 19

    [0569] The method described above under “In vitro experiments” in the General Method section was followed.

    [0570] Target gene expression in primary murine hepatocytes 24 h following treatment at 0.01 nM, 0.1 nM, 0.5 nM, 1 nM and 10 nM with the conjugates of the invention, Conjugates 8-12, showed that target gene expression decreases as the dose of the conjugate increased compared to the negative controls (see “UT” column and Luc [Reference Conjugate 3]), as shown in FIG. 12. This indicates that the first strand is binding to the target gene, thus lowering gene expression. In particular, Conjugates 8, 9, 10 and 11 appear to be comparable to or better than Conjugate 2 which was previously shown to be the most effective conjugate at 0.01 nM.

    [0571] Conjugate 19 was also shown to decrease target gene expression compared to the negative controls (see “UT” column and Ctr which is a non-targeting siRNA and also referred to as Reference Conjugate 5), as shown in FIG. 13. This indicates that the first strand is binding to the target gene, thus lowering gene expression.

    [0572] The in vitro data for Conjugates 8-12 and 19 show that a number of linkers which are structurally diverse and which are conjugated at both termini of the sense strand are effective at decreasing target gene expression. Conjugates 8-12 and 19 decrease target gene expression more effectively than “Luc” which is Reference Conjugate 3 (for Conjugates 8-12), “Ctr” which is Reference Conjugate 5 (for Conjugate 19) and untreated control.

    Example 11—In Vivo Time Course of Serum Ttr, Aldh2 and Tmprss6 in Mice

    [0573] Conjugates 15 to 18

    [0574] The method described above under “In vivo experiments” in the General Method section was followed.

    [0575] The results of the time course of serum Aldh2 in c57BL/6 mice cohorts of n=6 at 14, 28 and 42 days post s.c. treatment with 1 mg/kg Conjugates 15 and 16, Reference Conjugates 6 and 7, and mock treated (PBS) individuals is shown in FIGS. 14 and 15. As indicated by the data in FIGS. 14 and 15, the conjugates of the invention are particularly effective at reducing target gene expression compared to the negative control (PBS) and Reference Conjugates 6 and 7 respectively.

    [0576] The results of the time course of serum Tmprss6 in c57BL/6 mice cohorts of n=6 at 14, 28 and 42 days post s.c. treatment with 1 mg/kg Conjugate 18, Reference Conjugate 8, and mock treated (PBS) individuals is shown in FIG. 16. As indicated by the data in FIG. 16, the conjugates of the invention are particularly effective at reducing target gene expression compared to the negative control (PBS) and Reference Conjugate 8.

    [0577] Overall, the in vivo data show that a variety of example linkers which are conjugated at both termini of the second strand are effective at decreasing target gene expression in vivo. The positioning of the linker improves in vivo potency conjugates, as compared to a triantennary GalNAc-linker control at the 5′ terminus of the second strand (Reference Conjugates 6, 7 and 8).

    Example 12—Serum Stability Studies

    [0578] The method described above under “Tritosome stability assay” in the General Method section was followed.

    [0579] FIG. 17 shows the results from the serum stability studies in respect of Conjugates 2, 4, 5, 6 and 7. FIG. 18 shows the serum stability of Conjugates 2, 8, 9, 10, 11 and 12.

    [0580] All conjugates of the invention that were tested are more stable in serum compared to control.

    [0581] All tested conjugates contain each one GalNAc linker unit at the 5′ end and another at the 3′ end of the second strand. The siRNAs are modified with alternating 2′-OMe/2′-F and contain each two phosphorothioate (PS) internucleotide linkages at their 5′ and 3′ terminal two internucleotide linkages, unless stated differently.

    [0582] In Conjugate 4 the serinol-GalNAc units are attached via a phosphodiester bond. In Conjugate 5 the serinol-GalNAc units are conjugated via PS, whereas all internucleotide linkage in the second strand are phosphodiesters. In Conjugate 6 the second strand contains no PS. In Conjugate 7 two serinol-GalNAc units are attached to each second strand terminus and to each other via a PS-bonds at the respective ends. In Conjugate 8 a C6-amino-modifier at 5′ and a C7-amino-modifier at the 3′ end of the second strand were applied for ligand attachment. In Conjugate 9 Gly-C3-amino-modifiers, in Conjugate 10 piperidyl-amino-modifiers, in Conjugate 11 C3-amino-modifiers and in Conjugate 2 serinol-GalNAc units were used as linkers for conjugation to both ends of the second strand. In Conjugate 2 both terminal internucleotides as well as the nucleotide-serinol bonds are PS. In Conjugate 12 a C6-amino-modifier at the 5′ and a GlyC3-amino-modifier at the 3′ end of second strand were applied for ligand attachment. “ut” indicates an untreated sample which the other samples were normalised to. “Luc” indicates an siRNA targeting Luciferase (Reference Conjugate 3), which was used as non-targeting control and does not reduce target mRNA levels.

    [0583] The data show that in context of a serinol-derived linker moiety being provided at 5′ and 3′ ends of the sense strand, the number of phosphorothioate (PS) bonds between the terminal nucleotide and the linker, and/or between the terminal three nucleotides in the sense strand, can be varied whilst maintaining stability in serum.

    Example 13

    [0584] Primary human (Lot Hu1823) and cynomolgus (Lot CY367) hepatocytes and media were sourced from Life Technologies. As described by the manufacturer, primary hepatocytes were thawed and plated in plating media consisting of Williams' E medium (Life Technologies), supplemented with 5% fetal bovine serum, 1 μM Dexamethasone in DMSO (final concentration of DMSO=0.01%) and 3.6% v/v of Thawing/Plating Cocktail-A (Thermo Fisher Scientific, CM3000).

    [0585] Human primary hepatocytes were seeded into collagen 1-coated 96-well plates (Life Technologies) at a density of 30,000 cells per well. Cynomolgus hepatocytes were seeded at a density of 45,000 cells per well. Conjugate 21 and a control GalNAc-conjugated siRNA were serially diluted 5-fold at a concentration range of 0.006-100 nM and added immediately after plating in plating media. Plates were then incubated at 37° C. in a 5% CO.sub.2 atmosphere for 24 hours. Subsequently, cells were lysed and RNA was isolated using the method described below.

    [0586] Conjugate 21 Sequences

    TABLE-US-00037 Antisense strand-Conjugate 21 (SEQ ID NO: 165) 5′ mA (ps) fU (ps) mA fA mC fU mC fU mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG 3′ Sense strand-STS16001BL20 (SEQ ID NO: 164) 5′ [ST23 (ps)]3 C6XLT (ps) mC mG mG mU mA mA fU fG fG mA mC mA mG mA mG mU mU (ps) mA (ps) mU 3′

    [0587] Total RNA was extracted using the InviTrap HTS 96-well kit (Stratec Molecular GmbH, Berlin, Germany) according to the manufacturer's instructions with the following changes to the protocol: After the last washing step, plates were centrifuged at 6,000 rpm for twenty minutes. Subsequently, the RNA binding plate was positioned on top of an elution plate, and RNA was eluted by two rounds of adding 30 μl of elution buffer and incubating for two minutes at room temperature, followed by one minute of centrifugation at 1,000 rpm. A final elution step was performed by centrifuging at 1700 g (4000 rpm) for 3 minutes RNA was stored at −80° C.

    [0588] Ten μl of RNA-solution was used for gene expression analysis by reverse transcription quantitative polymerase chain reaction (RT-qPCR) performed with amplicon sets/sequences for LPA, ACTB (Eurogentec Deutschland GmbH, Cologne, Germany), APOB and PLG (BioTez GmbH, Berlin, Germany).

    [0589] The RT-qPCR reactions were carried out with an ABI StepOne Plus (Applied Biosystems, part of Thermo Fisher Scientific, Massachusetts, USA) using standard protocols for RT-PCR (48° C. 30 min, 95° C. 10 mi, 40 cycles at 95° C. 15 s followed by 60° C. 1 min).

    [0590] In primary hepatocytes, LPA and PLG analyses were performed in singleplex assays (primers: 300 nM, probe: 100 nM). APOB (200 nM) and ACTB (300 nM) were run in a multiplex assay adding 100 nM of each probe to the standard mixture.

    [0591] The data were calculated by using the comparative CT method also known as the 2.sup.−ΔΔCt method (Livak and Schmittgen, 2001 and Schmittgen and Livak, 2008). Here the amount of APOB, LPA or PLG mRNA normalised to the endogenous reference ACTB relative to a calibrator (untreated control) is given by the formula


    Fold-change=2.sup.−ΔΔCt.

    [0592] Unless stated otherwise, all values presented in the example refer to mean±SD. IC.sub.50 values were calculated using a sigmoidal 4 parameter dose response curve in GraphPad Prism 7.

    [0593] FIG. 19 shows the knockdown of LPA mRNA by Conjugate 21 through receptor-mediated uptake into primary human hepatocytes 24 hours post siRNA treatment (IC.sub.50=3.6 nM). LPA mRNA expression levels were normalised to ACTB and relative to cells treated with a non-targeting siRNA control measured by RT-qPCR. Data is presented as the mean±SD of a single experiment. FIG. 20 shows the knockdown of LPA mRNA by Conjugate 21 through receptor-mediated uptake into primary cynomolgus hepatocytes 24 hours post siRNA treatment (IC.sub.50=0.7 nM). LPA mRNA expression levels were normalised to ACTB and relative to cells treated with a non-targeting siRNA control measured by RT-qPCR. Data is presented as the mean±SD of a single experiment.

    [0594] FIG. 21 shows Knockdown of APOB mRNA by Conjugate 21 through receptor-mediated uptake into primary human hepatocytes 24 hours post siRNA treatment. APOB mRNA expression levels were normalised to ACTB and relative to cells treated with a non-targeting siRNA control measured by RT-qPCR. Data is presented as the mean±SD of a single experiment.

    [0595] FIG. 22 shows Knockdown of PLG mRNA by Conjugate 21 through receptor-mediated uptake into primary human hepatocytes 24 hours post siRNA treatment. PLG mRNA expression levels were normalised to ACTB and relative to cells treated with a non-targeting siRNA control measured by RT-qPCR. Data is presented as the mean±SD of a single experiment.

    [0596] Conjugate 21 achieves high levels of LPA mRNA inhibition without affecting the levels of APOB and PLG mRNAs.

    Example 14

    [0597] To test the efficacy of conjugate 21 in vivo, male cynomolgus monkeys were used to perform a pharmacodynamic study. Animals were grouped into 4 groups, 3 animals per group. Before dosing, serum was prepared to establish the baseline Lp(a) level for each animal. On day 1, conjugate 21 was formulated in 0.9% saline and each animal received a single dose of conjugate 21 at doses of 0.1, 0.3, 1.0 and 3.0 mg/kg.

    [0598] Serial samples were taken over 29 days and Lp(a) levels were measured by ELISA (Mercodia, Catalogue No. 10-1106-01Lot: 27736; Uppsala, Sweden). All values were normalised to the baseline values for each individual animal taken before dosing and presented as a percentage of the starting level (FIG. 23). Doses of 1.0 and 3.0 mg/kg showed marked reduction of the serum Lp(a) levels (69.4 and 77.3% after 29 days respectively). The dose dependent effect results in an ED.sub.50 dose of 0.56 mg/kg (FIG. 24). These data indicate that a significant and sustained reduction in serum Lp(a) is achievable through a single dose of conjugate 21. Based on this data, dosing would be expected to be infrequent, not more often than once every two months.

    STATEMENTS OF INVENTION

    [0599] The following are statements of the invention: [0600] 1. A nucleic acid for inhibiting expression of LPA in a cell, comprising at least one duplex region that comprises at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to at least a portion of RNA transcribed from the LPA gene, wherein said first strand comprises a nucleotide sequence selected from the following sequences: SEQ ID NO: 9, 5, 1, 3, 7, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41 or 43. [0601] 2. The nucleic acid of statement 1, wherein said first strand comprises a nucleotide sequence of SEQ ID NO: 9, and optionally wherein said second strand comprises a nucleotide sequence of SEQ ID NO: 10; or wherein said first strand comprises a nucleotide sequence of SEQ ID NO: 5, and optionally wherein said second strand comprises a nucleotide sequence of SEQ ID NO: 6. [0602] 3. A nucleic acid for inhibiting expression of LPA in a cell, comprising at least one duplex region that comprises at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to at least a portion of RNA transcribed from the LPA gene, wherein said first strand comprises a nucleotide sequence selected from the following sequences: SEQ ID NO: 9 or 5. [0603] 4. The nucleic acid of any of the preceding statements, wherein said first strand and/or said second strand are each from 17-35 nucleotides in length. [0604] 5. The nucleic acid of any of the preceding statements, wherein the at least one duplex region consists of 17-25, preferably 19-25, consecutive nucleotide base pairs. [0605] 6. The nucleic acid of any of the preceding statements, wherein the nucleic acid: [0606] a) is blunt ended at both ends; or [0607] b) has an overhang at one end and a blunt end at the other; or [0608] c) has an overhang at both ends. [0609] 7. The nucleic acid of any of the preceding statements, wherein one or more nucleotides on the first and/or second strand are modified, to form modified nucleotides. [0610] 8. The nucleic acid of any of the preceding statements, wherein the nucleic acid comprises a phosphorothioate linkage between the terminal one, two or three 3′ nucleotides and/or 5′ nucleotides of one or both ends of the first and/or the second strand. [0611] 9. The nucleic acid of any of the preceding statements, wherein the nucleic acid is conjugated to a ligand. [0612] 10. The nucleic acid of statement 9, wherein the ligand comprises (i) one or more N-acetyl galactosamine (GalNAc) moieties or derivatives thereof, and (ii) a linker, wherein the linker conjugates the at least one GalNAc moiety or derivative thereof to the nucleic acid. [0613] 11. The nucleic acid of any of statements 9-10, wherein the nucleic acid is conjugated to a ligand comprising a compound of formula (I):


    [S—X.sup.1—P—X.sup.2].sub.3-A-X.sup.3—  (I) [0614] wherein: [0615] S represents a saccharide, preferably wherein the saccharide is N-acetyl galactosamine; [0616] X.sup.1 represents C.sub.3-C.sub.6 alkylene or (—CH.sub.2—CH.sub.2—O).sub.m(—CH.sub.2).sub.2— wherein m is 1, 2, or 3; [0617] P is a phosphate or modified phosphate, preferably a thiophosphate; [0618] X.sup.2 is alkylene or an alkylene ether of the formula (—CH.sub.2).sub.n—O—CH.sub.2— where n=1-6; [0619] A is a branching unit; [0620] X.sup.3 represents a bridging unit; [0621] wherein a nucleic acid as defined in any of statements 1 to 8 is conjugated to [0622] X.sup.3 via a phosphate or modified phosphate, preferably a thiophosphate. [0623] 12. The nucleic acid of any of statements 9-10, wherein the first RNA strand is a compound of formula (X):

    ##STR00047## [0624] wherein b is 0 or 1; and [0625] the second RNA strand is a compound of formula (XI):

    ##STR00048## [0626] wherein: [0627] c and d are independently 0 or 1; [0628] Z.sub.1 and Z.sub.2 are the RNA portions of the first and second RNA strands respectively; [0629] Y is O or S; [0630] n is, 1, 2 or 3; and [0631] L.sub.1 is a linker to which a ligand is attached; and [0632] wherein b+c+d is 2 or 3. [0633] 13. A nucleic acid for inhibiting expression of LPA in a cell, comprising at least one duplex region that comprises at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to at least a portion of RNA transcribed from the LPA gene, wherein said first strand comprises, and preferably consists of, the nucleotide sequence of SEQ ID NO: 9 and optionally, wherein said second strand comprises, and preferably consists of, the nucleotide sequence of SEQ ID NO. 10. [0634] 14. The nucleic acid of statement 13, wherein the nucleic acid is conjugated to a ligand and has the following structure

    ##STR00049## [0635] wherein Z is a nucleic acid according ot statement 13 and is preferably conjugated to the 5′ end of the second strand. [0636] 15. The nucleic acid of statement 14, wherein the nucleic acid comprises two phosphorothioate linkages between each of the three terminal 3′ and between each of the three terminal 5′ nucleotides on the first strand, and two phosphorothioate linkages between the three terminal nucleotides of the 3′ end of the second strand and wherein the ligand is conjugated to the 5′ end of the second strand. [0637] 16. The nucleic acid of statement 13, wherein the nucleic acid is conjugated to a ligand, wherein the first RNA strand is a compound of formula (XV):

    ##STR00050## [0638] wherein b is 0 or 1; and [0639] the second RNA strand is a compound of formula (XVI):

    ##STR00051## [0640] wherein c and d are independently 0 or 1; [0641] wherein: [0642] Z.sub.1 and Z.sub.2 are the RNA portions of the first and second RNA strands respectively; [0643] Y is O or S; [0644] R.sub.1 is H or methyl; [0645] n is 0, 1, 2 or 3; and [0646] L is the same or different in formulae (XV) and (XVI) and is selected from the group consisting of: [0647] —(CH.sub.2).sub.q, wherein q=2-12; [0648] —(H.sub.2).sub.rC(O)—, wherein r=2-12; [0649] —(CH.sub.2—CH.sub.2—O).sub.sCH.sub.2—C(O)—, wherein s=1-5; [0650] —(CH.sub.2).sub.t—CO—NH—(CH.sub.2).sub.t—NH—C(O)—, wherein t is independently is 1-5; [0651] —(CH.sub.2).sub.u—CO—NH—(CH.sub.2).sub.u—C(O)—, wherein u is independently is 1-5; and [0652] —(CH.sub.2).sub.v—NH—C(O)—, wherein v is 2-12; and [0653] wherein the terminal C(O), if present, is attached to the NH group; [0654] and wherein b+c+d is 2 or 3. [0655] 17. The nucleic acid of any of statements 13-16, comprising a sequence and modifications as shown below:

    TABLE-US-00038 SEQ ID NO: sequence modifications 9 5′ AUAACUCUGUC 6162717181736152738 CAUUACCG 3 10 5′ CGGUAAUGGAC 3845261846364645161 AGAGUUAU 3′ [0656] wherein, the specific modifications are depicted by numbers [0657] 1=2′F-dU, [0658] 2=2′F-dA, [0659] 3=2′F-dC, [0660] 4=2′F-dG, [0661] 52′-OMe-rU; [0662] 6=2′-OMe-rA; [0663] 7=2′-OMe-rC; [0664] 8=2′-OMe-rG. [0665] 18. The nucleic acid of any of statements 13-16, wherein the nucleotides at positions 2 and 14 from the 5′ end of the first strand are modified with a 2′ fluoro modification, and the nucleotides on the second strand which correspond to position 11, or 13, or 11 and 13, or 11-13 of the first strand are modified with a 2′ fluoro modification. [0666] 19. A composition comprising a nucleic acid of any of statements 1-18 and optionally a delivery vehicle and/or a physiologically acceptable excipient and/or a carrier and/or a diluent and/or a buffer and/or a preservative, for use as a medicament, preferably for the prevention or treatment or risk reduction of a disease or pathology, wherein the disease or pathology preferably is a cardiovascular disease, wherein the cardiovascular disease preferably is a stroke, atherosclerosis, thrombosis, a coronary heart disease or aortic stenosis and/or any other disease or pathology associated to elevated levels of Lp(a)-containing particles. [0667] 20. A pharmaceutical composition comprising a nucleic acid of any of statements 1-18 and further comprising a delivery vehicle, preferably liposomes and/or a physiologically acceptable excipient and/or a carrier and/or a diluent. [0668] 21. Use of a nucleic acid of any of statements 1-18 or a pharmaceutical composition of statement 20 for the prevention or treatment or risk reduction of a disease or pathology, wherein the disease or pathology preferably is a cardiovascular disease, wherein the cardiovascular disease preferably is a stroke, atherosclerosis, thrombosis, a coronary heart disease or aortic stenosis and any other disease or pathology associated to elevated levels of Lp(a)-containing particles. [0669] 22. A method of preventing or treating a disease, disorder or syndrome comprising administering a composition comprising a nucleic acid of any of statements 1-18 or a composition according to statements 19-20 to an individual in need of treatment, preferably wherein the nucleic acid or composition is administered to the subject subcutaneously, intravenously or using any other application routes such as oral, rectal or intraperitoneal.

    TABLE-US-00039 TABLE Summary sequence Unmodified SEQ Sequence ID Sequence counterpart NO Name (5′-3′) (5′-3′) 1 LPA-1014 UCGUAUAACA UCGUAUAACA first AUAAGGGGC AUAAGGGGC strand 2 LPA-1014 GCCCCUUAUU GCCCCUUAUU second GUUAUACGA GUUAUACGA strand 3 LPA-1024 GAUAACUCUG GAUAACUCUG first UCCAUUACC UCCAUUACC strand 4 LPA-1024 GGUAAUGGAC GGUAAUGGAC second AGAGUUAUC AGAGUUAUC strand 5 LPA-1038 AUAACUCUGU AUAACUCUGU first CCAUUACCA CCAUUACCA strand 6 LPA-1038 UGGUAAUGGA UGGUAAUGGA second CAGAGUUAU CAGAGUUAU strand 7 LPA-1040 UAACUCUGUC UAACUCUGUC first CAUUACCGU CAUUACCGU strand 8 LPA-1040 ACGGUAAUGG ACGGUAAUGG second ACAGAGUUA ACAGAGUUA strand 9 LPA-1041 AUAACUCUGU AUAACUCUGU first CCAUUACCG CCAUUACCG strand 10 LPA-1041 CGGUAAUGGA CGGUAAUGGA second CAGAGUUAU CAGAGUUAU strand 11 LPA-1055 AGAAUGUGCC AGAAUGUGCC first UCGAUAACU UCGAUAACU strand 12 LPA-1055 AGUUAUCGAG AGUUAUCGAG second GCACAUUCU GCACAUUCU strand 13 LPA-1057 AUAACUCUGU AUAACUCUGU first CCAUCACCA CCAUCACCA strand 14 LPA-1057 UGGUGAUGGA UGGUGAUGGA second CAGAGUUAU CAGAGUUAU strand 15 LPA-1058 AUAACUCUGU AUAACUCUGU first CCAUCACCU CCAUCACCU strand 16 LPA-1058 AGGUGAUGGA AGGUGAUGGA second CAGAGUUAU CAGAGUUAU strand 17 LPA-1061 UAACUCUGUC UAACUCUGUC first CAUUACCAU CAUUACCAU strand 18 LPA-1061 AUGGUAAUGG AUGGUAAUGG second ACAGAGUUA ACAGAGUUA strand 19 LPA-1086 AUGUGCCUUG AUGUGCCUUG first AUAACUCUG AUAACUCUG strand 20 LPA-1086 CAGAGUUAUC CAGAGUUAUC second AAGGCACAU AAGGCACAU strand 21 LPA-1099 AGUUGGUGCU AGUUGGUGCU first GCUUCAGAA GCUUCAGAA strand 22 LPA-1099 UUCUGAAGCA UUCUGAAGCA second GCACCAACU GCACCAACU strand 23 LPA-1102 AAUAAGGGGC AAUAAGGGGC first UGCCACAGG UGCCACAGG strand 24 LPA-1102 CCUGUGGCAG CCUGUGGCAG second CCCCUUAUU CCCCUUAUU strand 25 LPA-1116 UAACUCUGUC UAACUCUGUC first CAUCACCAU CAUCACCAU strand 26 LPA-1116 AUGGUGAUGG AUGGUGAUGG second ACAGAGUUA ACAGAGUUA strand 27 LPA-1127 AUGAGCCUCG AUGAGCCUCG first AUAACUCUG AUAACUCUG strand 28 LPA-1127 CAGAGUUAUC CAGAGUUAUC second GAGGCUCAU GAGGCUCAU strand 29 LPA-1128 AAUGAGCCUC AAUGAGCCUC first GAUAACUCU GAUAACUCU strand 30 LPA-1128 AGAGUUAUCG AGAGUUAUCG second AGGCUCAUU AGGCUCAUU strand 31 LPA-1141 AAUGCUUCCA AAUGCUUCCA first GGACAUUUC GGACAUUUC strand 32 LPA-1141 GAAAUGUCCU GAAAUGUCCU second GGAAGCAUU GGAAGCAUU strand 33 LPA-1151 ACAGUGGUGG ACAGUGGUGG first AGAAUGUGC AGAAUGUGC strand 34 LPA-1151 GCACAUUCUC GCACAUUCUC second CACCACUGU CACCACUGU strand 35 LPA-1171 GUAUGUGCCU GUAUGUGCCU first CGAUAACUC CGAUAACUC strand 36 LPA-1171 GAGUUAUCGA GAGUUAUCGA second GGCACAUAC GGCACAUAC strand 37 LPA-1177 UCGAUAACUC UCGAUAACUC first UGUCCAUCA UGUCCAUCA strand 38 LPA-1177 UGAUGGACAG UGAUGGACAG second AGUUAUCGA AGUUAUCGA strand 39 LPA-1189 UGUCACUGGA UGUCACUGGA first CAUUGUGUC CAUUGUGUC strand 40 LPA-1189 GACACAAUGU GACACAAUGU second CCAGUGACA CCAGUGACA strand 41 LPA-1244 CUGGGAUCCA CUGGGAUCCA first UGGUGUAAC UGGUGUAAC strand 42 LPA-1244 GUUACACCAU GUUACACCAU second GGAUCCCAG GGAUCCCAG strand 43 LPA-1248 AGAUGACCAA AGAUGACCAA first GCUUGGCAG GCUUGGCAG strand 44 LPA-1248 CUGCCAAGCU CUGCCAAGCU second UGGUCAUCU UGGUCAUCU strand 45 LPA: AAGTGTCCTT AAGTGTCCTT (upper) GCGACGTCC GCGACGTCC human 46 LPA: CCTGGACTGT CCTGGACTGT (lower) GGGGCTTT GGGGCTTT human 47 LPA: CTGTTTCTGA CTGTTTCTGA (probe) ACAAGCACCA ACAAGCACCA human ACGGAGC ACGGAGC 48 LPA GTGTCCTCGC GTGTCCTCGC (upper) AACGTCCA AACGTCCA cynomolgus 49 LPA GACCCCGGGG GACCCCGGGG (lower) CTTTG CTTTG cynomolgus 50 LPA TGGCTGTTTC TGGCTGTTTC (probe) TGAACAAGCA TGAACAAGCA cynomolgus CCAATGG CCAATGG 51 APOB TCATTCCTTC TCATTCCTTC (upper) CCCAAAGAGA CCCAAAGAGA human CC CC 52 APOB CACCTCCGTT CACCTCCGTT (lower) TTGGTGGTAG TTGGTGGTAG human AG AG 53 APOB CAAGCTGCTC CAAGCTGCTC (probe) AGTGGAGGCA AGTGGAGGCA human ACACATTA ACACATTA 54 beta-Actin GCATGGGTCA GCATGGGTCA (upper) GAAGGATTCC GAAGGATTCC human TAT TAT 55 beta-Actin TGTAGAAGGT TGTAGAAGGT (lower) GTGGTGCCAG GTGGTGCCAG human ATT ATT 56 beta-Actin TCGAGCACGG TCGAGCACGG (probe) CATCGTCACC CATCGTCACC human AA AA 57 beta-Actin AAGGCCAACC AAGGCCAACC (upper) GCGAGAAG GCGAGAAG cynomolgus 58 beta-Actin AGAGGCGTAC AGAGGCGTAC (lower) AGGGACAGCA AGGGACAGCA cynomolgus 59 beta-Actin TGAGACCTTC TGAGACCTTC (probe) AACACCCCAG AACACCCCAG cynomolgus CCATGTAC CCATGTAC 60 PPIB AGATGTAGGC AGATGTAGGC (upper) CGGGTGATCT CGGGTGATCT human TT TT 61 PPIB GTAGCCAAAT GTAGCCAAAT (lower) CCTTTCTCTC CCTTTCTCTC human CTGT CTGT 62 PPIB TGTTCCAAAA TGTTCCAAAA (probe) ACAGTGGATA ACAGTGGATA human ATTTTGTGGC ATTTTGTGGC C C 63 LPA: AAGTGTCCTT AAGTGTCCTT (upper) GCGACGTCC GCGACGTCC human 64 LPA: CCTGGACTGT CCTGGACTGT (lower) GGGGCTTT GGGGCTTT human 65 LPA: CTGTTTCTGA CTGTTTCTGA (probe) ACAAGCACCA ACAAGCACCA human ACGGAGC ACGGAGC 66 LPA GTGTCCTCGC GTGTCCTCGC (upper) AACGTCCA AACGTCCA cynomolgus 67 LPA GACCCCGGGG GACCCCGGGG (lower) CTTTG CTTTG cynomolgus 68 LPA TGGCTGTTTC TGGCTGTTTC (probe) TGAACAAGCA TGAACAAGCA cynomolgus CCAATGG CCAATGG 69 APOB TCATTCCTTC TCATTCCTTC (upper) CCCAAAGAGA CCCAAAGAGA human CC CC 70 APOB CACCTCCGTT CACCTCCGTT (lower) TTGGTGGTAG TTGGTGGTAG human AG AG 71 APOB CAAGCTGCTC CAAGCTGCTC (probe) AGTGGAGGCA AGTGGAGGCA human ACACATTA ACACATTA 72 beta-Actin GCATGGGTCA GCATGGGTCA (upper) GAAGGATTCC GAAGGATTCC human TAT TAT 73 beta-Actin TGTAGAAGGT TGTAGAAGGT (lower) GTGGTGCCAG GTGGTGCCAG human ATT ATT 74 beta-Actin TCGAGCACGG TCGAGCACGG (probe) CATCGTCACC CATCGTCACC human AA AA 75 Modified 5381616272 UCGUAUAACA SEQ 616284847 AUAAGGGGC ID NO: 1 76 Modified 4737351615 GCCCCUUAUU SEQ 451616382 GUUAUACGA ID NO: 2 77 Modified 8252635354 GAUAACUCUG SEQ 537251637 UCCAUUACC ID NO: 3 78 Modified 4816254827 GGUAAUGGAC SEQ 282815253 AGAGUUAUC ID NO: 4 79 Modified 6162717181 AUAACUCUGU SEQ 736152736 CCAUUACCA ID NO: 5 80 Modified 1845261846 UGGUAAUGGA SEQ 364645161 CAGAGUUAU ID NO: 6 81 Modified 5263535453 UAACUCUGUC SEQ 725163745 CAUUACCGU ID NO: 7 82 Modified 2748162548 ACGGUAAUGG SEQ 272828152 ACAGAGUUA ID NO: 8 83 Modified 6162717181 AUAACUCUGU SEQ 736152738 CCAUUACCG ID NO: 9 84 Modified 3845261846 CGGUAAUGGA SEQ 364645161 CAGAGUUAU ID NO: 10 85 Modified 6462545473 AGAAUGUGCC SEQ 538252635 UCGAUAACU ID NO: 11 86 Modified 2815253828 AGUUAUCGAG SEQ 472725171 GCACAUUCU ID NO: 12 87 Modified 6162717181 AUAACUCUGU SEQ 736172736 CCAUCACCA ID NO: 13 88 Modified 1845461846 UGGUGAUGGA SEQ 364645161 CAGAGUUAU ID NO: 14 89 Modified 6162717181 AUAACUCUGU SEQ 736172735 CCAUCACCU ID NO: 15 90 Modified 2845461846 AGGUGAUGGA SEQ 364645161 CAGAGUUAU ID NO: 16 91 Modified 5263535453 UAACUCUGUC SEQ 725163725 CAUUACCAU ID NO: 17 92 Modified 2548162548 AUGGUAAUGG SEQ 272828152 ACAGAGUUA ID NO: 18 93 Modified 6181837154 AUGUGCCUUG SEQ 616271718 AUAACUCUG ID NO: 19 94 Modified 3646451617 CAGAGUUAUC SEQ 264836361 AAGGCACAU ID NO: 20 95 Modified 6451845471 AGUUGGUGCU SEQ 835172826 GCUUCAGAA ID NO: 21 96 Modified 1535462836 UUCUGAAGCA SEQ 472736271 GCACCAACU ID NO: 22 97 Modified 6252648483 AAUAAGGGGC SEQ 547363648 UGCCACAGG ID NO: 23 98 Modified 3718184728 CCUGUGGCAG SEQ 373715251 CCCCUUAUU ID NO: 24 99 Modified 5263535453 UAACUCUGUC SEQ 725363725 CAUCACCAU ID NO: 25 100 Modified 2548182548 AUGGUGAUGG SEQ 272828152 ACAGAGUUA ID NO: 26 101 Modified 6182837174 AUGAGCCUCG SEQ 616271718 AUAACUCUG ID NO: 27 102 Modified 3646451617 CAGAGUUAUC SEQ 464835361 GAGGCUCAU ID NO: 28 103 Modified 6254647353 AAUGAGCCUC SEQ 825263535 GAUAACUCU ID NO: 29 104 Modified 2828152538 AGAGUUAUCG SEQ 284717251 AGGCUCAUU ID NO: 30 105 Modified 6254715372 AAUGCUUCCA SEQ 846361517 GGACAUUUC ID NO: 31 106 Modified 4626181735 GAAAUGUCCU SEQ 482647251 GGAAGCAUU ID NO: 32 107 Modified 6364548184 ACAGUGGUGG SEQ 646254547 AGAAUGUGC ID NO: 33 108 Modified 4727251717 GCACAUUCUC SEQ 363727181 CACCACUGU ID NO: 34 109 Modified 8161818371 GUAUGUGCCU SEQ 746162717 CGAUAACUC ID NO: 35 110 Modified 4645161746 GAGUUAUCGA SEQ 483636163 GGCACAUAC ID NO: 36 111 Modified 5382526353 UCGAUAACUC SEQ 545372536 UGUCCAUCA ID NO: 37 112 Modified 1825482728 UGAUGGACAG SEQ 281525382 AGUUAUCGA ID NO: 38 113 Modified 5453635482 UGUCACUGGA SEQ 725181817 CAUUGUGUC ID NO: 39 114 Modified 4636362545 GACACAAUGU SEQ 372818272 CCAGUGACA ID NO: 40 115 Modified 7184825372 CUGGGAUCCA SEQ 548181627 UGGUGUAAC ID NO: 41 116 Modified 4516363725 GUUACACCAU SEQ 482537364 GGAUCCCAG ID NO: 42 117 Modified 6461827362 AGAUGACCAA SEQ 835184728 GCUUGGCAG ID NO: 43 118 Modified 3547362835 CUGCCAAGCU SEQ 184536171 UGGUCAUCU ID NO: 44 119 GalNAc-LPA- OMeA-(ps)- AUAACUCUGU 1038-L1 FU-(ps)-OM CCAUUACCA first eA-FA-OMeC strand -FU-OMeC- FU-OMeG-FU -OMeC-FC-O MeA-FU-OMe U-FA-OMeC- (ps)-FC- (ps)-OMeA 120 GalNAc-LPA- [ST23 UGGUAAUGGA 1038-L1 (ps)]3 CAGAGUUAU second long strand trebler (ps)FU- OMeG-FG- OMeU-FA- OMeA-FU-OM eG-FG-OMeA- FC-OMeA-F G-OMeA-FG- OMeU-FU- (ps)-OMeA- (ps)-FU 121 GalNAc-LPA- OMeA-(ps)- AUAACUCUGU 1038-L6 FU-(ps)-OMeA- CCAUUACCA First FA-OMeC-FU- strand OMeC-FU-OMeG- FU-OMeC-FC- OMeA-FU-OMeU- FA-OMeC-(ps)- FC-(ps)-OMeA 122 GalNAc-LPA- [ST23 (ps)]3 UGGUAAUGGA 1038-L6 ST43(ps)FU- CAGAGUUAU Second OMeG-FG-OMeU- strand FA-OMeA-FU- OMeG-FG-OMeA- FC-OMeA-FG- OMeA-FG-OMeU- FU-(ps)-OMeA- (ps)-FU 123 GalNAc-LPA- OMeA-(ps)-FU- AUAACUCUGU 1041-L1 (ps)-OMeA-FA- CCAUUACCG First OMeC-FU-OMeC- strand FU-OMeG-FU- OMeC-FC-OMeA- FU-OMeU-FA- OMeC-(ps)- FC-(ps)-OMeG 124 GalNAc-LPA- [ST23(ps)]3 CGGUAAUGGA 1041-L1 long trebler CAGAGUUAU Second (ps)FC-OMeG- strand FG-OMeU-FA- OMeA-FU-OMeG- FG-OMeA-FC- OMeA-FG- OMeA-FG-OMeU- FU-(ps)-OMeA- (ps)-FU 125 GalNAc- OMeA-(ps)- AUAACUCUGU LPA-1041- FU-(ps)-OMeA- CCAUUACCG L6 first FA-OMeC-FU- strand OMeC-FU-OMeG- FU-OMeC-FC- OMeA-FU-OMeU- FA-OMeC-(ps)- FC-(ps)-OMeG 126 GalNAc-LPA- (ST23 (ps)]3 CGGUAAUGGA 1041-L6 ST43(ps)FC- CAGAGUUAU second OMeG-FG-OMeU- strand FA-OMeA-FU- OMeG-FG-OMeA- FC-OMeA-FG- OMeA-FG-OMeU- FU-(ps)OMeA- (ps)FU 127 STS1600 mU (ps) fU UUAUAGAGCA 1AL33 (ps) mA fU AGAACACUGU mA fG mA Fg U mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU (ps) Ser(GN) 128 STS1600 Ser(GN) (ps) AACAGUGUUC 1BL20 fA mA fC mA UUGCUCUAUA fG mU fG mU A fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA 129 STS16001A mU (ps) fU UUAUAGAGCA (ps) mA fU AGAACACUGU mA fG mA fG U mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU 130 STS16001 Ser(GN) (ps) AACAGUGUUC BV1L42 fA (ps) mA UUGCUCUAUA (ps) fC mA A fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) Ser(GN) 131 STS1600 fA (ps) mA AACAGUGUUC 1V1B (ps) fC mA UUGCUCUAUA fG mU fG mU A fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA 132 STS1800 mU (ps) fC UCGAAGUAUU 1A (ps) mG fA CCGCGUACG mA fG mU fA mU fU mC fC mG fC mG fU mA (ps) fC (ps) mG 133 STS1800 [(ST23) (ps)].sub.3 CGUACGCGGA 1BL4 C4XLT (ps) AUACUUCGA fC mG fU mA fC mG fC mG fG mA fA mU fA mC fU mU fC (ps) mG (ps) fA 134 STS1600 [(ST23) (ps)]3 AACAGUGUUC 1BL4 C4XLT(ps) fA UUGCUCUAUA (ps) mA (ps) A fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA 135 X0373A mA (ps) fU AUAACUCUGU (ps) mA fA CCAUUACCG mC fU mC fU mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG 136 X0373B Ser(GN) (ps) CGGUAAUGGA fC (ps) mG CAGAGUUAU (ps) fG mU fA mA fU mG fG mA fC mA fG mA fG mU fU (ps) mA (ps) fU (ps) Ser(GN) 137 STS2041B ST23 (ps) CGGUAAUGGA ST23 (ps) CAGAGUUAU ST23 (ps) C6XLT (ps) fC mG fG mU fA mA fU mG fG mA fC mA fG mA fG mU fU (ps) mA (ps) fU 138 X0125A mC (ps) fU CUUACUCUCG (ps) mU fA CCCAAGCGA mC fU mC fU mC fG mC fC mC fA mA fG mC (ps) fG (ps) mA 139 X0125B [(ST23) (ps)].sub.3 UCGCUUGGGC (C6XLT) (ps) GAGAGUAAG fU mC fG mC fU mU fG mG fG mC fG mA fG mA fG mU fA (ps) mA (ps) fG 140 Probe based BHQ1-TGGCTGT TGGCTGTTTC on SEQ ID TTCTGAACAAGC TGAACAAGCA NO: 50 ACCAATGG-FAM CCAATGG 141 Probe based BHQ1-TCGAGCA TCGAGCACGG on SEQ ID CGGCATCGTCAC CATCGTCACC NO: 56 CAA-VIC AA 142 STS1600 Ser(GN) fA AACAGUGUUC 1BV1L75 (ps) mA (ps) UUGCUCUAUA fC mA fG mU A fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA Ser(GN) 143 STS1600 Ser(GN) (ps) AACAGUGUUC 1BV16L42 fA mA fC mA UUGCUCUAUA fG mU fG mU A fU mC fU mU fG mC fU mC fU mA fU mA fA (ps) Ser(GN) 144 STS1600 Ser(GN) fA mA AACAGUGUUC 1BV20L75 fC mA fG mU UUGCUCUAUA fG mU fU mC A fU mU fG mC fU mC fU mA fU mA fA Ser(GN) 145 STS1600 Ser(GN) (ps) AACAGUGUUC 1BV1L94 Ser(GN) (ps UUGCUCUAUA fA (ps) mA) A (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) Ser(GN) (ps) Ser(GN) 146 STS1600 C6Am(GN) (ps) AACAGUGUUC 1V1BL96 fA (ps) mA UUGCUCUAUA (ps) fC mA fG A mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) C7Am(GN) 147 STS1600 GlyC3Am(GN) AACAGUGUUC 1V1BL97 (ps) fA (ps) UUGCUCUAUA mA (ps) fC A mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) GlyC3Am(GN) 148 Conjugate PipAm(GN) (ps) AACAGUGUUC 10 fA (ps) mA UUGCUCUAUA second (ps) fC mA A strand fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) PipAm(GN) 149 STS1600 C3Am(GN) (ps) AACAGUGUUC 1V1BL88 fA (ps) mA UUGCUCUAUA (ps) fC mA fG A mU fG mU fU mC fU mU fG Mc fU mC fU mA fU (ps) mA (ps) fA (ps) C3Am(GN) 150 STS1600 C6Am(GN) (ps) AACAGUGUUC 1V1BL87 fA (ps) mA UUGCUCUAUA (ps) fC mA fG A mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) GlyC3Am(GN) 151 Conjugate mU (ps) fC UCUUCUUAAA 15 (ps) mU fU CUGAGUUUC antisense mC fU mU fA strand mA fA mC fU mG fA mG fU mU (ps) fU (ps) mC 152 Conjugate Ser(GN) (ps) GAAACUCAGU 15 fG (ps) mA UUAAGAAGA sense (ps) fA mA strand fC mU fC mA fG mU fU mU fA mA fG mA fA (ps) mG (ps) fA (ps) Ser(GN) 153 Conjugate mA (ps) fU AUGUAGCCGA 16 (ps) mG fU GGAUCUUCU antisense mA fG mC strand fC mG fA mG fG mA fU mC fU mU (ps) fC (ps) mU 154 Conjugate Ser(GN) (ps) AGAAGAUCCU 16 fA (ps) mG CGGCUACAU antisense (ps) fA mA strand fG mA fU mC fC mU fC mG fG mC fU mA fC (ps) mA (ps) fU (ps) Ser(GN) 155 Conjugate mA (ps) fA AACCAGAAGA 18 (ps) mC fC AGCAGGUGA antisense mA fG mA fA strand mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA 156 Conjugate Ser(GN) (ps) UCACCUGCUU 18 fU (ps) mC CUUCUGGUU sense (ps) fA mC strand fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fU (ps) Ser(GN) 157 STS16001BV1 fA (ps) mA AACAGUGUUC (ps) fC mA UUGCUCUAUA fG mU fG mU A fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA 158 Reference [ST23 (ps)]3 GAAACUCAGU Conjugate ltrb (ps) fG UUAAGAAGA 6 mA fA mA fC sense mU fC mA fG strand mU fU mU fA mA fG mA fA (ps) mG (ps) fA 159 Reference [ST23 (ps)]3 AGAAGAUCCU Conjugate ltrb (ps) fA CGGCUACAU 7 mG fA mA fG sense mA fU mC fC strand mU fC mG fG mC fU mA fC (ps) mA (ps) fU 160 Reference mU (ps) fA UACCAGAAGA Conjugate (ps) mC fC AGCAGGUGA 8 mA fG mA antisense fA mG fA mA strand fG mC fA mG fG mU (ps) fG (ps) mA 161 Reference [ST23 (ps)]3 UCACCUGCUU Conjugate ST41 (ps)fU CUUCUGGUA 8 mC fA mC fC sense mU fG mC fU strand mU fC mU fU mC fU mG fG (ps) mU (ps) fA 162 Reference [ST23 (ps)]3 CGGUAAUGGA Conjugate C6XLT (ps) CAGAGUUAU 9 fC mG fG mU sense fA mA fU mG strand fG mA fC mA fG mA fG mU fU (ps) mA (ps) fU 163 Conjugate mC mG mG mU CGGUAAUGGA 21 mA mA fU fG CAGAGUUAU sense fG mA mC mA strand mG mA mG mU without mU (ps) mA ligand (ps) mU 164 Conjugate [ST23 (ps)]3 CGGUAAUGGA 21 C6XLT (ps) CAGAGUUAU sense mC mG mG strand mU mA mA fU fG fG mA mC mA mG mA mG mU mU (ps) mA (ps) mU 165 Conjugate mA (ps) fU AUAACUCUGU 21 (ps) mA fA CCAUUACCG antisense mC fU mC fU strand mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG

    [0670] A single sequence may have more than one name. In those cases, one of those names is given in the summary sequence table.

    [0671] Where specific linkers and or modified linkages are taught within an RNA sequence, such as (ps) and [ST23 (ps)]3 ST41 (ps) etc, these are optional parts of the sequence, but are a preferred embodiment of that sequence.

    [0672] The following abbreviations may be used, particularly in listed sequences:

    TABLE-US-00040 Abbreviation Meaning 1 2′F-dU 2 2′F-dA 3 2′F-dC 4 2′F-dG 5 2′OMe-rU 6 2′OMe-rA 7 2′OMe-rC 8 2′OMe-rG mA, mU, mG, OMeA, 2′deoxy-2′-F RNA OMeU, OMeC, OMeG 2′-OMe 2′-O-Methyl modification fA, fU, fC, fG 2′ deoxy-2′-F RNA nucleotides 2′-F, 2′-fluoro, 2′ fluoro 2′-fluoro modification (ps) phosphorothioate (vp) Vinyl-(E)-phosphonate ivA, ivC, ivU, ivG inverted RNA (3′-3′) FAM 6-Carboxyfluorescein BHQ Black Hole Quencher 1 ST23 [00052]embedded image ST41/C4XLT [00053]embedded image ST43 (or C6XLT) [00054]embedded image ST43-phos/C6XLT-phos [00055]embedded image Long trebler/Itrb/STKS (phosphoramidite) [00056]embedded image Ser(GN) [00057]embedded image Ser(GN) (phosphoramidite) [00058]embedded image C3Am(GN) [00059]embedded image GlyC3Am(GN) [00060]embedded image C6Am(GN) [00061]embedded image C7Am(GN) [00062]embedded image PipAm(GN) [00063]embedded image [ST23 (ps)]3 C4XLT (ps) = [ST23 (ps)]3 ST41 (ps) = L4 [00064]embedded image [ST23 (ps)]3 C6XLT (ps) = [ST23 (ps)]3 ST43 (ps) = L6 [00065]embedded image