MODULATION OF CANNABINOID PROFILE IN CANNABIS

20220002742 · 2022-01-06

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a Cannabis plant with reduced delta-9-tetrahydrocannabinol (THC) content, or reduced cannabidiol (CBD) content, or reduced THC and CBD content. According to a core aspect of the invention, the Cannabis plant comprises at least one targeted genome modification effective in decreasing expression of. at least one Cannabis gene encoding a cannabinoid biosynthesis enzyme selected from the group consisting of Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) and any combination thereof. Further disclose are methods for production of the Cannabis plants and use thereof.

Claims

1. A Cannabis plant with reduced delta-9-tetrahydrocannabinol (THC) content, or reduced cannabidiol (CBD) content, or reduced THC and CBD content, wherein said plant comprises at least one mutated gene encoding a cannabinoid biosynthesis enzyme selected from the group consisting of Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) and any combination thereof, further wherein said mutation is introduced by targeted genome modification using at least one RNA-guided (gRNA) endonuclease selected from the group consisting of: a. gRNA targeted to CsTHCAS genomic sequence, said gRNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 16-167 and any combination thereof; b. gRNA targeted to CsCBDAS genomic sequence, said gRNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 168-304, 824-825 and any combination thereof; c. gRNA targeted to CsPT genomic sequence, said gRNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 305-458 and any combination thereof; d. gRNA targeted to CsOLS genomic sequence, said gRNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 459-509 and any combination thereof; and e. gRNA targeted to CsAAE1 genomic sequence, said gRNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 510-823, 826 and any combination thereof.

2. (canceled)

3. (canceled)

4. (canceled)

5. (canceled)

6. (canceled)

7. The Cannabis plant according to claim 1, wherein the genomic sequence encoding said at least one cannabinoid biosynthesis enzyme is selected from the group consisting of: CsTHCAS having a genomic nucleotide sequence as set forth in SEQ ID NO:1 or a functional variant thereof, CsCBDAS having a genomic nucleotide sequence as set forth in SEQ ID NO:4 or a functional variant thereof, CsPT having a genomic nucleotide sequence as set forth in SEQ ID NO:7 or a functional variant thereof, CsOLS having a genomic nucleotide sequence as set forth in SEQ ID NO:10 or a functional variant thereof and CsAAE1 having a genomic nucleotide sequence as set forth in SEQ ID NO:13 or a functional variant thereof.

8. The Cannabis plant according to claim 7, wherein said functional variant has at least 75% sequence identity to the nucleotide sequence of said cannabinoid biosynthesis enzyme or a codon degenerate nucleotide sequence thereof.

9. The Cannabis plant according to claim 1, wherein said plant has decreased expression levels of at least one of CsTHCAS protein having an amino acid sequence with at least 75% identity to the amino acid sequence as set forth in SEQ ID NO:3 or a conservatively substituted amino acid sequence thereof, CsCBDAS protein having an amino acid sequence with at least 75% identity to the amino acid sequence as set forth in SEQ ID NO:6 or a conservatively substituted amino acid sequence thereof, CsPT protein having an amino acid sequence with at least 75% identity to the amino acid sequence as set forth in SEQ ID NO:9 or a conservatively substituted amino acid sequence thereof, CsOLS protein having an amino acid sequence with at least 75% identity to the amino acid sequence as set forth in SEQ ID NO:12 or a conservatively substituted amino acid sequence thereof, and CsAAE1 protein having an amino acid sequence with at least 75% identity to the amino acid sequence as set forth in SEQ ID NO:15 or a conservatively substituted amino acid sequence thereof.

10. The Cannabis plant according to claim 1, wherein said Cannabis plant has modulated expression of one or more of the cannabinoids, optionally cannabigerolic acid, cannabigerol, DELTA.9-tetrahydrocannabinolic acid, cannabidiolic acid, cannabichromenic acid, DELTA.9-tetrahydrocannabinol, cannabidiol, cannabichromene, THC, D9-THC, D8-THC, THCA, THCV, D8-THCV, D9-THCV, THCVA, CBD, CBDA, CBDV, CBDVA, CBC, CBCA, CBCV, CBCVA, CBG, CBGA, CBGV, CBGVA, CBN, CBNA, CBNV, CBNVA, CBND, CBNDA, CBNDV, CBNDVA, CBE, CBEA, CBEV, CBEVA, CBL, CBLA, CBLV, or CBLVA and cannabidiol.

11. (canceled)

12. (canceled)

13. (canceled)

14. (canceled)

15. (canceled)

16. (canceled)

17. (canceled)

18. The Cannabis plant of claim 1, wherein at least one of the following holds true: (a) said plant is homozygous for said at least one mutated gene; (b) said plant genotype is obtainable by deposit under accession number with NCIMB Aberdeen AB21 9YA, Scotland, UK; or (c) said Cannabis plant comprises a DNA encoding an antisense RNA or a siRNA effective to suppress expression of CsTHCAS, CsSP, CsCBDAS, CsPT, CsOLS, CsAAE1 and any combination thereof, the DNA operably linked to a heterologous promoter, wherein the Cannabis plant comprises reduced THC content, reduced CBD content, or decreased THC and CBD content relative to a Cannabis plant of a similar genotype that does not comprise the DNA.

19. (canceled)

20. (canceled)

21. (canceled)

22. (canceled)

23. (canceled)

24. (canceled)

25. (canceled)

26. (canceled)

27. A plant part, plant cell or plant seed, tissue culture of regenerable cells, protoplasts or callus of a plant according to claim 1.

28. (canceled)

29. (canceled)

30. (canceled)

31. The Cannabis plant according to claim 1, wherein said Cannabis plant has at least one of the following characteristics: (a) a THC content of up to 30% by weight, particularly between about 0.1% to about 30% by weight, more particularly between about 0.3% to about 30%, even more particularly between about 0.3% to about 10% by weight; (b) a CBD content of up to 30% by weight, particularly between about 0.1% to about 30% by weight, more particularly between about 0.3% to about 30%, even more particularly between about 0.3% to about 10% by weight; (c) a THC and/or CBD content of not more than about 0.5% by weight; or (d) said plant is THC free.

32. (canceled)

33. (canceled)

34. (canceled)

35. (canceled)

36. The Cannabis plant according to claim 1, wherein said plant has at least one targeted genome modification in at least one Cannabis gene encoding cannabinoid precursor synthesis enzyme selected from the group consisting of CsAAE, CsPT and CsOLS and said plant exhibits at least one of the following characteristics: (a) reduced expression of THC, CBD or both relative to a Cannabis plant of a similar genotype or genetic background lacking said targeted genome modification; (b) a THC and/or CBD content of up to 30% by weight, particularly between about 0.1% to about 30% by weight, more particularly between about 0.3% to about 30%, even more particularly between about 0.3% to about 10% by weight; or (c) a THC and/or CBD content of not more than about 0.5% by weight.

37. (canceled)

38. (canceled)

39. (canceled)

40. (canceled)

41. The Cannabis plant according to claim 1, wherein said plant has at least one targeted genome modification in CsTHCAS and said plant exhibits reduced expression of THCA or THC, and elevated expression of CBD or CBDA relative to a Cannabis plant of a similar genotype or genetic background lacking said targeted genome modification, and wherein said plant has at least one of the following characteristics: (a) a THC and/or THCA content of up to 30% by weight, particularly between about 0.1% to about 30% by weight, more particularly between about 0.3% to about 30%, even more particularly between about 0.3% to about 10% by weight; or (b) a THC and/or THCA content of not more than about 0.5% by weight.

42. (canceled)

43. (canceled)

44. The Cannabis plant according to claim 1, wherein said plant has at least one targeted genome modification in CsCBDAS and said plant exhibits reduced expression of CBDA or CBD, and elevated expression of THC or THCA relative to a Cannabis plant of a similar genotype or genetic background lacking said targeted genome modification, and wherein said plant has at least one of the following characteristics: (a) a CBD and/or CBDA content of up to 30% by weight, particularly between about 0.1% to about 30% by weight, more particularly between about 0.3% to about 30%, even more particularly between about 0.3% to about 10% by weight; or (b) a CBD and/or CBDA content of not more than about 0.5% by weight.

45. (canceled)

46. A Cannabis plant derived product or a derived medical composition from the plant of claim 1.

47. The Cannabis plant derived product of claim 46, comprising at least one of the following characteristics: (a) a combined cannabidiolic acid and cannabidiol concentration of about 0.3% to about 30% by weight; (b) a combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0.3% to about 30% by weight; (c) Cannabis oil, Cannabis tincture, dried Cannabis flowers, and/or dried Cannabis leaves; (d) utilized as a medicament; or (e) formulated for inhalation, oral consumption, sublingual consumption, or topical consumption.

48. (canceled)

49. (canceled)

50. (canceled)

51. (canceled)

52. (canceled)

53. A method for producing a Cannabis plant according to claim 1, wherein said method comprises steps of introducing into the genome of a Cannabis plant or a cell thereof at least one targeted genome modification effective in decreasing expression of a at least one Cannabis gene encoding a cannabinoid biosynthesis enzyme selected from the group consisting of tetrahydrocannabinolic acid synthase (THCAS), cannabidiolic acid synthase (CBDAS), aromatic prenyltransferase (PT), olivetol synthase (OLS), acyl-activating enzyme 1 (AAE1) and any combination thereof, said introducing of at least one targeted genome modification comprises steps of introducing into said Cannabis plant or a cell thereof at least one RNA-guided (gRNA) endonuclease selected from the group consisting of: a. gRNA targeted to CsTHCAS genomic sequence, said gRNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 16-167 and any combination thereof; b. gRNA targeted to CsCBDAS genomic sequence, said gRNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 168-304, 824-825 and any combination thereof; c. gRNA targeted to CsPT genomic sequence, said gRNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 305-458 and any combination thereof; d. gRNA targeted to CsOLS genomic sequence, said gRNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 459-509 and any combination thereof; and e. gRNA targeted to CsAAE1 genomic sequence, said gRNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 510-823, 826 and any combination thereof.

54. (canceled)

55. (canceled)

56. (canceled)

57. (canceled)

58. (canceled)

59. (canceled)

60. (canceled)

61. (canceled)

62. (canceled)

63. (canceled)

64. The method according to claim 53, wherein at least one of the following holds true: (a) the nucleotide sequence encoding said at least one cannabinoid biosynthesis enzyme is selected from the group consisting of: CsTHCAS having a genomic nucleotide sequence as set forth in SEQ ID NO:1 or a functional variant thereof, CsCBDAS having a genomic nucleotide sequence as set forth in SEQ ID NO:4 or a functional variant thereof, CsPT having a genomic nucleotide sequence as set forth in SEQ ID NO:7 or a functional variant thereof, CsOLS having a genomic nucleotide sequence as set forth in SEQ ID NO:10 or a functional variant thereof and CsAAE1 having a genomic nucleotide sequence as set forth in SEQ ID NO:13 or a functional variant thereof; or (b) said plant has decreased expression levels of at least one of CsTHCAS protein having an amino acid sequence with at least 75% identity to the amino acid sequence as set forth in SEQ ID NO:3 or a conservatively substituted amino acid sequence thereof, CsCBDAS protein having an amino acid sequence with at least 75% identity to the amino acid sequence as set forth in SEQ ID NO:6 or a conservatively substituted amino acid sequence thereof, CsPT protein having an amino acid sequence with at least 75% identity to the amino acid sequence as set forth in SEQ ID NO:9 or a conservatively substituted amino acid sequence thereof, CsOLS protein having an amino acid sequence with at least 75% identity to the amino acid sequence as set forth in SEQ ID NO:12 or a conservatively substituted amino acid sequence thereof, and CsAAE1 protein having an amino acid sequence with at least 75% identity to the amino acid sequence as set forth in SEQ ID NO:15 or a conservatively substituted amino acid sequence thereof.

65. (canceled)

66. (canceled)

67. (canceled)

68. (canceled)

69. (canceled)

70. (canceled)

71. (canceled)

72. (canceled)

73. (canceled)

74. (canceled)

75. (canceled)

76. A plant part, plant cell or plant seed produced by the method according to claim 53.

77. (canceled)

78. A method for producing a medical Cannabis composition, the method comprising: a. obtaining the Cannabis plant of claim 1; and b. formulating a medical Cannabis composition from said plant.

79. A method for manipulating a content of one or more cannabinoids in a Cannabis plant, the method comprising down-regulating activity of at least one Cannabis gene encoding a cannabinoid biosynthesis enzyme selected from the group consisting of tetrahydrocannabinolic acid synthase (THCAS) having a genomic nucleotide sequence with at least 75% sequence identity to a sequence as set forth in SEQ ID NO:1, cannabidiolic acid synthase (CBDAS) having a genomic nucleotide sequence with at least 75% sequence identity to a sequence as set forth in SEQ ID NO:4, aromatic prenyltransferase (PT) having a genomic nucleotide sequence with at least 75% sequence identity to a sequence as set forth in SEQ ID NO:7, olivetol synthase (OLS) having a genomic nucleotide sequence with at least 75% sequence identity to a sequence as set forth in SEQ ID NO:10, acyl-activating enzyme 1 (AAE1) having a genomic nucleotide sequence with at least 75% sequence identity to a sequence as set forth in SEQ ID NO:13 and any combination thereof, said down regulating comprising introducing a loss of function mutation into said nucleic acid sequence encoding said at least one cannabinoid biosynthesis enzyme using targeted genome modification.

80. (canceled)

81. (canceled)

82. (canceled)

83. An isolated nucleotide sequence having at least 75% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2 SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:14 and SEQ ID NO:16-826; and/or an isolated amino acid sequence having at least 75% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:12 and SEQ ID NO:15; and/or a vector, construct or expression system or cassette comprising nucleic acid sequence having at least 75% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:14 and SEQ ID NO:16-826.

84. (canceled)

85. (canceled)

86. (canceled)

87. (canceled)

88. A method for down regulation of at least one Cannabis cannabinoid biosynthesis enzyme gene selected from the group consisting of Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) and any combination thereof, which comprises utilizing the nucleotide sequence as set forth in at least one of SEQ ID NO:16-826 and any combination thereof said utilizing comprising introducing a loss of function mutation into said at least one gene encoding said at least one cannabinoid biosynthesis enzyme using targeted genome modification.

89. (canceled)

90. (canceled)

91. (canceled)

92. (canceled)

93.-100. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0112] Non-limiting examples of embodiments of the disclosure are described below with reference to figures attached hereto that are listed following this paragraph. Identical features that appear in more than one figure are generally labeled with a same label in all the figures in which they appear. A label labeling an icon representing a given feature of an embodiment of the disclosure in a figure may be used to reference the same given feature in other embodiments. Dimensions of features shown in the figures are chosen for convenience and clarity of presentation and are not necessarily shown to scale.

[0113] The invention, features and advantages thereof, may best be understood by reference to the following detailed description when read with the accompanied drawings. Embodiments of the invention are illustrated by way of example and not limitation in the figures of the accompanying drawings, in which like reference numerals indicate corresponding, analogous or similar elements, and in which:

[0114] FIG. 1 is schematically presenting CRISPR/Cas9 mode of action as depicted by Xie, Kabin, and Yinong Yang. “RNA-guided genome editing in plants using a CRISPRtCas system.” Molecular plant 6.6 (2013): 1975-1983;

[0115] FIG. 2 is schematically illustrating the cannabinoid biosynthesis pathway as depicted by the C. sativa (Cannabis) Genome Browser internet site;

[0116] FIG. 3 is photographically presenting staining of Cannabis plants after transient GUS transformation of (A) axillary buds (B) leaf (C) calli, and (D) cotyledons;

[0117] FIG. 4 is presenting regenerated transformed Cannabis tissue;

[0118] FIG. 5 is photographically presenting PCR detection of Cas9 DNA in shoots of Cannabis plants transformed using biolistics; and

[0119] FIG. 6 is illustrating in vitro cleavage activity of CRISPR/Cas9; (A) a scheme of genomic area targeted for editing, and (B) a gel showing digestion of PCR amplicon containing RNP complex of Cas9 and gene specific gRNA.

[0120] It will be appreciated that, for simplicity and clarity of illustration, elements shown in the figures have not necessarily been drawn accurately or to scale. For example, the dimensions of some of the elements may be exaggerated relative to other elements for clarity, or several physical components may be included in one functional block or element. Further, where considered appropriate, reference numerals may be repeated among the figures to indicate corresponding or analogous elements.

DETAILED DESCRIPTION OF THE INVENTION

[0121] In the following detailed description, numerous specific details are set forth in order to provide a thorough understanding of the invention. However, it will be understood by those skilled in the art that the present invention may be practiced without these specific details. In other instances, well-known methods, procedures, and components, modules, units and/or circuits have not been described in detail so as not to obscure the invention. Some features or elements described with respect to one embodiment may be combined with features or elements described with respect to other embodiments. For the sake of clarity, discussion of same or similar features or elements may not be repeated.

[0122] In the following detailed description of the preferred embodiments, reference is made to the accompanying drawings that form a part hereof, and in which are shown by way of illustration specific embodiments in which the invention may be practiced. It is understood that other embodiments may be utilized and structural changes may be made without departing from the scope of the present invention. The present invention may be practiced according to the claims without some or all of these specific details. For the purpose of clarity, technical material that is known in the technical fields related to the invention has not been described in detail so that the present invention is not unnecessarily obscured.

[0123] The present invention discloses manipulation of the biosynthesis pathways of a Cannabis plant of genus Cannabis. Accordingly, Cannabis plants of the present invention having a modified therapeutic component(s) profile may be useful in the production of medical Cannabis and/or may also be useful in the production of specific components or therapeutic formulations derived therefrom.

[0124] According to other main aspects of the present invention, THC free (e,g, hemp) plants for seeds, fiber and/or medical use are produced.

[0125] According to a main embodiment, the present invention provides a Cannabis plant with reduced delta-9-tetrahydrocannabinol (THC) content, or reduced cannabidiol (CBD) content, or reduced THC and CBD content, wherein said plant comprises at least one targeted genome modification effective in decreasing expression of a at least one Cannabis gene encoding a cannabinoid biosynthesis enzyme selected from the group consisting of Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) and any combination thereof.

[0126] According to one embodiment of the present invention, genes encoding cannabinoid precursor synthesis enzymes, namely AAE, PT and OLS are down regulated using targeted genome modification (e.g. gene editing techniques as inter alia presented). These enzymes are responsible for the production of a main cannabinoid precursor cannabigerolic acid (CBGA).

[0127] The final steps catalysing the synthesis of major active cannabinoids, namely, cannabichromenic acid (CBCA), cannabidiolic acid (CBDA) and Δ9-tetrahydrocannabinolic acid (THCA), are performed by oxidocyclases, namely, CBCA synthase (CBCAS), CBDA synthase (CBDAS) and THCA synthase (THCAS).

[0128] According to a further embodiment of the present invention, cannabinoid biosynthesis enzymes namely cannabidiolic acid (CBDA) synthase (CBDAS) and/or 49-tetrahydrocannabinolic acid (THCA) synthase (THCAS) are down regulated using targeted genome modification (e.g. gene editing techniques as inter alia presented). As a result, the production of the major cannabinoids CBDA (converted into CBD by decarboxylation) and/or THCA (converted into THC by decarboxylation) is significantly reduced and/or totally abolished.

[0129] Thus, according to one embodiment, targeted genome modification of one or more of the herein identified Cannabis genes encoding cannabinoid precursor synthesis enzymes, namely, CsAAE, CsPT and CsOLS, negatively affects the production of the cannabinoid precursor CBGA. As a result Cannabis plants with reduced content, or free of, THCA (and/or THC) and reduced content or free of CBDA (and/or CBD) are provided by the present invention.

[0130] According to a further embodiment of the present invention, targeted genome modification of the herein identified Cannabis gene encoding cannabinoid synthesis enzyme CsTHCAS results in reduced or no production of THCA and thus Cannabis plants with reduced content, or free of, THCA and/or THC are provided by the present invention.

[0131] According to a further embodiment of the present invention, targeted genome modification of the herein identified Cannabis gene encoding cannabinoid synthesis enzyme CsCBDAS results in reduced or no production of CBDA and thus Cannabis plants with reduced content, or free of, CBDA and/or CBD are provided by the present invention.

[0132] Breeding Cannabis plants is currently mostly done by small Cannabis growers. There is very limited if any molecular tools supporting or leading the breeding process. Traditional Cannabis breeding is done by mixing breeding material with hope to find the desired traits and phenotypes in random crosses. These methods have allowed the construction of the leading Cannabis varieties on the market today. During the last few decades, most of the breeding was focused on the psychoactive phytochemicals of the Cannabis plant. These phytochemicals, known as cannabinoids, are the compounds responsible for the medical attributes of the Cannabis plant.

[0133] As the medical Cannabis pharmaceutical industry is focusing on developing new cannabinoid based drugs, and these are mostly extracted from the Cannabis plant, there is a growing need for Cannabis plants bred for producing high levels of specific cannabinoids. In addition, there is a need for advanced breeding programs for food and fiber (Hemp) as well.

[0134] The present invention is aimed at enhancing cannabinoid breeding capabilities by using advanced molecular genome editing technologies in order to maximize the plants' phyto-chemical molecules production potential.

[0135] According to a further aspect of the present invention, a method or a tool is provided that enables the regulation in planta or the production of specific cannabinoid molecules.

[0136] It is further within the scope of the present invention to provide means and methods for in planta modification of specific genes that relate to and/or control the cannabinoid biosynthesis pathways (as indicated in FIG. 2). More specifically, but not limited to, the present invention achieves the use of the CRISPR/Cas technology (see FIG. 1), such as, but not limited to Cas9 or Cpf1, in order to generate knockout alleles of the genes depicted in FIG. 2, rendering the enzymes inactive thereby controlling in planta the production of the resulting cannabinoid products depicted in FIG. 2.

[0137] According to some embodiments of the present invention, the above in planta modification can be based on alternative gene silencing technologies such as Zinc Finger Nucleases (ZFN's), Transcription activator-like effector nucleases (TALEN's), RNA silencing, amiRNA or any other gene silencing technique known in the art.

[0138] According to some other embodiments of the present invention, DNA introduction into the plant cells can be done by Agrobacterium infiltration, viral based plasmids for virus induced gene silencing (VIGS) and by mechanical insertion of DNA (PEG, gene gun etc).

[0139] According to further aspects of the present invention, it is possible to directly insert the Cas9 protein together with a gRNA in order to bypass the need for in vivo transcription and translation of the Cas9+gRNA plasmid in planta in order to achieve the same desired outcome.

[0140] It is a core aspect of the present invention that the above CRISPR/Cas system allows the modification of specific DNA sequences. This is achieved by combining the Cas nuclease (Cas9, Cpf1 or the like) with a guide RNA molecule (gRNA). The gRNA is designed such that it should be complementary to a specific DNA sequence targeted for editing in the plant genome and which guides the Cas nuclease to a specific nucleotide sequence (see FIG. 1). Gene specific gRNA's are cloned into the same plasmid as the Cas gene and this plasmid is inserted into plant cells. Insertion of this plasmid DNA can be done, but not limited to, by different delivery systems biological and or mechanical.

[0141] Without wishing to be bound by theory, according to further specific aspects of the present invention, upon reaching the specific DNA sequence, the Cas9 nuclease cleaves both DNA strands to create double stranded breaks leaving blunt ends. This cleavage site is then repaired by the cellular non homologous end joining DNA repair mechanism resulting in insertions or deletions which eventually creates a mutation around the cleavage site. The deletion form of the mutation consists of at least 1 base pair deletion. As a result of this base pair deletion the gene coding sequence is disrupted and the translation of the encoded protein is compromised either by a premature stop codon or disruption of a functional or structural property of the protein.

[0142] It is further within the scope that by introducing a gRNA with homology to a specific site of a gene described in FIG. 2, and sub cloning this gRNA into a plasmid containing the Cas9 gene, and upon insertion of the described plasmid into the plant cells, site specific mutations are generated in the genes herein described (delta-9-tetrahydrocannabinol (THC) content, or reduced cannabidiol (CBD) content, or reduced THC and CBD content, wherein said plant comprises a targeted genome modification effective in decreasing expression of a at least one Cannabis gene encoding a cannabinoid biosynthesis enzyme selected from the group consisting of Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) and any combination thereof). Thus effectively creating non-active proteins in the cannabinoid biosynthesis pathway, resulting in inactivation of their enzymatic activity. As a result, the present disclosure enables altering cannabinoid content in the genome edited plant. This alteration of cannabinoid content can result in a plant with significantly reduced synthesis of the molecules depicted in FIG. 2 and/or of one or more cannabinoids produced by these enzymes.

[0143] It is herein acknowledged that as the pharma industry is interested in extracting the cannabinoids from the Cannabis plant, individual Cannabis plants or strains or varieties containing modulated levels of such cannabinoids can be developed, tailored to the specific needs of the pharma industry thereby increasing the cost effectiveness and attractiveness of this crop.

[0144] The solution proposed by the current invention is using genome editing such as the CRISPR/Cas system in order to create cultivated Cannabis plants with modulated levels or ratios of cannabinoids. More specifically alternation of specific cannabinoids, i.e. THC and CBD is achieved by using genome editing techniques to reduce the expression of enzymes in the cannabinoid biosynthesis pathway.

[0145] Breeding using genome editing allows a precise and significantly shorter breeding process in order to achieve these goals with a much higher success rate. Thus genome editing, has the potential to generate improved varieties faster and at a lower cost.

[0146] In order to generate a reproducible product, Cannabis growers are currently using vegetative propagation (cloning or tissue culture). However, in conventional agricultural, genetic stability of field crops and vegetables is maintained by using F1 hybrid seeds. These hybrids are generated by crossing homozygous parental lines.

[0147] The next step for the Cannabis industry is the adoption and use of hybrid seeds for propagation, which is common practice in the conventional seed industry (from field crops to vegetables). This will allow growing and supplying high quality and reproducible raw material for the pharmaceutical industry.

[0148] The current invention discloses the generation of non GMO Cannabis plants with manipulated and controlled cannabinoid content, using the genome editing technology, e.g., the CRISPR/Cas9 highly precise tool. The generated mutations can be introduced into elite or locally adapted Cannabis lines rapidly, with relatively minimal effort and investment.

[0149] Genome editing is an efficient and useful tool for increasing crop productivity traits, and there is particular interest in advancing manipulation of genes controlling cannabinoids biosynthesis in Cannabis species, to produce strains which are adapted to specific therapeutic or regulatory needs.

[0150] Genome-editing technologies, such as the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein-9 nuclease (Cas9) (CRISPR-Cas9) provide opportunities to address these deficiencies, with the aims of increasing quality and yield.

[0151] A major obstacle for CRISPR-Cas9 plant genome editing is lack of efficient tissue culture and transformation methodologies. The present invention achieves these aims and surprisingly provides transformed and regenerated Cannabis plants with modified desirable cannabinoids content.

[0152] To that end, guide RNAs (gRNAs) were designed for each of the target genes herein identified in Cannabis to induce mutations in at least one cannabinoid biosynthesis enzyme including Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) and any combination thereof.

[0153] The present invention shows that Cannabis plants which contain genome editing events with at least one of the CsAAE1, CsOLS, CsPT genes or any combination thereof, express not more than 0.5% THC (or THCA) and CBD (or THCA) by weight. In specific embodiments, such plants express less than 0.5%, preferably less than 0.4%, less than 0.3%, less than 0.2%, less than 0.1% or 0% THC and CBD by weight (e.g. by dry weight).

[0154] It is further within the scope that Cannabis plants which contain genome editing events with at least one of the CsAAE1, CsOLS, CsPT genes or any combination thereof, express not more than 0.5% THC (or THCA) and/or CBD (or THCA) by weight. In specific embodiments, such plants express less than 0.5%, preferably less than 0.4%, less than 0.3%, less than 0.2%, less than 0.1% or 0% THC and/or CBD by weight (e.g. by dry weight).

[0155] The present invention further shows that Cannabis plants containing genome editing events within the CsTHCAS gene express higher levels of CBD (or CBDA) compared to non-edited plants. In a further embodiment, the CsTHCAS edited plants contain very low levels of THCA (or THC), preferably not more than 0.5% by weight.

[0156] The present invention further shows that plants containing genome editing events within the CsCBDAS gene express higher levels of THC (or THCA) as compared to non-edited plants. In a further embodiment, the CsCBDAS edited plants contain very low levels of CBDA (or CBD), preferably not more than 0.5% by weight.

[0157] It is a further aspect of the present invention to provide the Cannabis plant as defined in any of the above, wherein said plant has a THC and/or CBD content of up to 30% by weight, particularly between about %0.1 to about 30% by weight, more particularly between about %0.3 to about 30%, even more particularly between about %0.3 to about 10% by weight.

[0158] As used herein the term “about” denotes ±25% of the defined amount or measure or value.

[0159] As used herein the term “similar” denotes a correspondence or resemblance range of about ±20%, particularly ±15%, more particularly about ±10% and even more particularly about ±5%.

[0160] As used herein the term “corresponding” generally means similar, analogous, like, alike, akin, parallel, identical, resembling or comparable. In further aspects it means having or participating in the same relationship (such as type or species, kind, degree, position, correspondence, or function). It further means related or accompanying. In some embodiments of the present invention it refers to plants of the same Cannabis species or strain or variety or to sibling plant, or one or more individuals having one or both parents in common.

[0161] A “plant” as used herein refers to any plant at any stage of development, particularly a seed plant. The term “plant” includes the whole plant or any parts or derivatives thereof, such as plant cells, seeds, plant protoplasts, plant cell tissue culture from which tomato plants can be regenerated, plant callus or calli, meristematic cells, microspores, embryos, immature embryos, pollen, ovules, anthers, fruit, flowers, leaves, cotyledons, pistil, seeds, seed coat, roots, root tips and the like.

[0162] The term “plant cell” used herein refers to a structural and physiological unit of a plant, comprising a protoplast and a cell wall. The plant cell may be in a form of an isolated single cell or a cultured cell, or as a part of higher organized unit such as, for example, plant tissue, a plant organ, or a whole plant.

[0163] The term “plant cell culture” as used herein means cultures of plant units such as, for example, protoplasts, regenerable cells, cell culture, cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes and embryos at various stages of development, leaves, roots, root tips, anthers, meristematic cells, microspores, flowers, cotyledons, pistil, fruit, seeds, seed coat or any combination thereof.

[0164] The term “plant material” or “plant part” used herein refers to leaves, stems, roots, root tips, flowers or flower parts, fruits, pollen, egg cells, zygotes, seeds, seed coat, cuttings, cell or tissue cultures, or any other part or product of a plant or a combination thereof.

[0165] A “plant organ” as used herein means a distinct and visibly structured and differentiated part of a plant such as a root, stem, leaf, flower, flower bud, or embryo.

[0166] The term “Plant tissue” as used herein means a group of plant cells organized into a structural and functional unit. Any tissue of a plant in planta or in culture is included. This term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue culture, protoplasts, meristematic cells, calli and any group of plant cells organized into structural and/or functional units. The use of this term in conjunction with, or in the absence of, any specific type of plant tissue as listed above or otherwise embraced by this definition is not intended to be exclusive of any other type of plant tissue.

[0167] As used herein, the term “progeny” or “progenies” refers in a non limiting manner to offspring or descendant plants. According to certain embodiments, the term “progeny” or “progenies” refers to plants developed or grown or produced from the disclosed or deposited seeds as detailed inter alia. The grown plants preferably have the desired traits of the disclosed or deposited seeds, i.e. loss of function mutation in at least one CsSP gene or at least one CsSP5G gene.

[0168] The term “Cannabis” refers hereinafter to a genus of flowering plants in the family Cannabaceae. Cannabis is an annual, dioecious, flowering herb that includes, but is not limited to three different species, Cannabis sativa, Cannabis indica and Cannabis ruderalis. The term also refers to hemp. Cannabis plants produce a group of chemicals called cannabinoids. Cannabinoids, terpenoids, and other compounds are secreted by glandular trichomes that occur most abundantly on the floral calyxes and bracts of female Cannabis plants.

[0169] The term “nonpsychoactive” refers hereinafter to products or compositions or elements or components of Cannabis not significantly affecting the mind or mental processes.

[0170] The term “cannabinoid” refers hereinafter to a class of diverse chemical compounds that act on cannabinoid receptors on cells that repress neurotransmitter release in the brain. These receptor proteins include the endocannabinoids (produced naturally in the body by humans and animals), the phytocannabinoids (found in Cannabis and some other plants), and synthetic cannabinoids.

[0171] The main cannabinoids are concentrated in a viscous resin produced in structures known as glandular trichomes. Up until now, at least 113 different cannabinoids have been isolated from the Cannabis plant. The main classes of cannabinoids from Cannabis are THC (tetrahydrocannabinol), THCA (tetrahydrocannabinolic acid), CBD (cannabidiol), CBDA (cannabidiolic acid), CBN (cannabinol), CBG (cannabigerol), CBC (cannabichromene), CBL (cannabicyclol), CBV (cannabivarin), THCV (tetrahydrocannabivarin), CBDV (cannabidivarin), CBCV (cannabichromevarin), CBGV (cannabigerovarin), CBGM (cannabigerol monomethyl ether), CBE (cannabielsoin), CBT (cannabicitran) and any combination thereof.

[0172] The best studied cannabinoids include tetrahydrocannabinol (THC), cannabidiol (CBD) and cannabinol (CBN).

[0173] Reference is now made to Tetrahydrocannabinol (THC), the primary psychoactive component of the Cannabis plant. Delta-9-tetrahydrocannabinol (Δ9-THC, THC) and delta-8-tetrahydrocannabinol (Δ8-THC), through intracellular CB1 activation, induce anandamide and 2-arachidonoylglycerol synthesis produced naturally in the body and brain. These cannabinoids produce the effects associated with Cannabis by binding to the CB1 cannabinoid receptors in the brain.

[0174] Tetrahydrocannabinolic acid (THCA, 2-COOH-THC; conjugate base tetrahydrocannabinolate) is a precursor of tetrahydrocannabinol (THC), the active component of cannabis. THCA is found in variable quantities in fresh, undried cannabis, but is progressively decarboxylated to THC with drying, and especially under intense heating such as when cannabis is smoked or cooked into cannabis edibles. In the context of the present invention, the term THC also refers to THCA and vice versa.

[0175] Reference is now made to Cannabidiol (CBD) which is considered as non-psychotropic. Cannabidiol has little affinity for CB1 and CB2 receptors but acts as an indirect antagonist of cannabinoid agonists. It is further acknowledged herein that it is an antagonist at the putative cannabinoid receptor, GPR55, a GPCR expressed in the caudate nucleus and putamen. Cannabidiol has also been shown to act as a 5-HT1A receptor agonist. Cannabis produces CBD-carboxylic acid through the same metabolic pathway as THC, until the next to last step, where CBDA synthase performs catalysis instead of THCA synthase. CBDA is converted into CBD by decarboxylation. In the context of the present invention, the term CBD also refers to CBDA and vice versa.

[0176] CBD shares a precursor with THC and is the main cannabinoid in CBD-dominant Cannabis strains.

[0177] In the context of the current invention, enzymes within the biosynthetic pathway of THC and CBD, especially AAE, OLS, PT, CBDAS and THCAS (depicted in FIG. 2), are down regulated to control and the content of CBD and/or THC in the Cannabis plant.

[0178] Reference is now made to FIG. 2 schematically illustrating the proposed pathway leading to the major cannabinoids Δ 9-tetrahydrocannabinolic acid (THCA) and cannabidiolic acid (CBDA), which decarboxylate to yield Δ 9-tetrahydrocannabinol (THC) and cannabidiol (CBD), respectively. The biosynthesis of THC and CBD in Cannabis follows a similar pathway.

[0179] Cannabigerolic acid (CBGA), the precursor to all natural cannabinoids, is cyclized into tetrahydrocannabinolic acid (THCA) and cannabidiolic acid (CBDA) by THCA and CBDA synthase (THCAS and CBDAS in FIG. 2), respectively. The final products of THC and CBD are formed via decarboxylation of these acidic forms. Structurally, there is an important difference between these major cannabinoids. Where THC contains a cyclic ring, CBD contains a hydroxyl group. This seemingly small difference in molecular structure may give the two compounds their different pharmacological properties.

[0180] A more specific and detailed description of the biosynthetic pathway of cannabinoids in the Cannabis plant follows below:

[0181] The isoprenoid and prenyl precursors for cannabigerolic acid (CBGA), are provided by the hexanoate and 2-C-methyl-D-erythritol 4-phosphate (MEP) pathways, respectively. Geranyl diphosphate (GPP), is a key intermediate metabolite and building block for both cannabinoid and terpenoid biosynthesis. The seven-step mevalonate (MVA) pathway converts pyruvate and glyceraldehyde-3-phosphate (G-3-P) into isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). Key catalytic enzymes controlling flux through this pathway include the first two steps, 1-deoxy-D-xylulose 5-phosphate synthase (DXS) and 1-deoxy-D-xylulose 5-phosphate reductase (DXR). In the six-step MEP pathway, three units of acetyl coenzyme A (CoA) are converted to IPP, which is isomerized with DMAPP by IPP isomerase. The enzyme catalysing the synthesis of MEV, 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR), is considered to control flux through this pathway. The number of consecutive condensations of the five-carbon monomer isopentenyl diphosphate (IPP) to its isomer, dimethylallyl diphosphate (DMAPP) is indicated by 1x, 2x, 3x. Longer-chain isoprenoids, GPP, farnesyl diphosphate (FPP) and geranyl geranyl diphosphate (GGPP), are the products of IPP and DMAPP condensation catalysed by GPP synthase, FPP synthase and GGPP synthase, respectively. GPP, FPP and geranyl-geranyl diphosphate (GGPP) are the precursors for mono-, sequi-, and di-terpines, respectively. The final steps catalysing the synthesis of major active cannabinoids, cannabichromenic acid (CBCA), cannabidiolic acid (CBDA) and Δ9-tetrahydrocannabinolic acid (THCA), are oxidocyclases, CBCA synthase (CBCAS), CBDA synthase (CBDAS) and THCA synthase (THCAS).

[0182] In the current invention, AAE, refers to acyl-activating enzyme; CBD: cannabidiol; CYP76F39, α/β-santalene monooxygenase; GPP synthase small subunit; OLS, olivetol synthase; P450: haemoprotein cytochrome P450; PT, prenyltransferase; STS, santalene synthase; TS, gamma-terpinene synthase; and TXS, taxadiene synthase.

[0183] As used herein the term “genetic modification” or “genome modification” refers hereinafter to genetic manipulation or modulation, which is the direct manipulation of an organism's genes using biotechnology. It also refers to a set of technologies used to change the genetic makeup of cells, including the transfer of genes within and across species, targeted mutagenesis and genome editing technologies to produce improved organisms. According to main embodiments of the present invention, modified Cannabis plants with altered cannabinoid content traits are generated using genome editing mechanism. This technique enables to achieve in planta modification of specific genes that control the biosynthesis of main cannabinoids, namely, THC and/or CBD in the Cannabis plant.

[0184] The term “genome editing”, or “genome/genetic modification” or “genome engineering” generally refers hereinafter to a type of genetic engineering in which DNA is inserted, deleted, modified or replaced in the genome of a living organism. Unlike previous genetic engineering techniques that randomly insert genetic material into a host genome, genome editing targets the insertions to site specific locations.

[0185] It is within the scope of the present invention that the common methods for such editing use engineered nucleases, or “molecular scissors”. These nucleases create site-specific double-strand breaks (DSBs) at desired locations in the genome. The induced double-strand breaks are repaired through nonhomologous end-joining (NHEJ) or homologous recombination (HR), resulting in targeted mutations (‘edits’). Families of engineered nucleases used by the current invention include, but are not limited to: meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALEN), and the clustered regularly interspaced short palindromic repeats (CRISPR/Cas9) system.

[0186] Reference is now made to exemplary genome editing terms used by the current disclosure:

Genome Editing Glossary

[0187] Cas=CRISPR-associated genes

[0188] Cas9, Csn1=a CRISPR-associated protein containing two nuclcease domains, that is programmed by small RNAs to cleave DNA

[0189] crRNA=CRISPR RNA

[0190] dCAS9=nuclease-deficient Cas9

[0191] DSB=Double-Stranded Break

[0192] gRNA=guide RNA

[0193] HDR=Homology-Directed Repair

[0194] HNH=an endonuclease domain named for characteristic histidine and asparagine residues

[0195] Indel=insertion and/or deletion

[0196] NHEJ=Non-Homologous End Joining

[0197] PAM=Protospacer-Adjacent Motif

[0198] RuvC=an endonuclease domain named for an E. coli protein involved to DNA repair

[0199] sgRNA=single guide RNA

[0200] tracrRNA, trRNA=trans-activating crRNA

[0201] TALEN=Transcription-Activator Like Effector Nuclease

[0202] ZFN=Zinc-Finger Nuclease

[0203] According to specific aspects of the present invention, the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and CRISPR-associated (Cas) genes are used for the first time for generating genome modification in targeted genes in the Cannabis plant. It is herein acknowledged that the functions of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and CRISPR-associated (Cas) genes are essential in adaptive immunity in select bacteria and archaea, enabling the organisms to respond to and eliminate invading genetic material. These repeats were initially discovered in the 1980s in E. coli. Without wishing to be bound by theory, reference is now made to a type of CRISPR mechanism, in which invading DNA from viruses or plasmids is cut into small fragments and incorporated into a CRISPR locus comprising a series of short repeats (around 20 bps). The loci are transcribed, and transcripts are then processed to generate small RNAs (crRNA, namely CRISPR RNA), which are used to guide effector endonucleases that target invading DNA based on sequence complementarity.

[0204] According to further aspects of the invention, Cas protein, such as Cas9 (also known as Csn1) is required for gene silencing. Cas9 participates in the processing of crRNAs, and is responsible for the destruction of the target DNA. Cas9's function in both of these steps relies on the presence of two nuclease domains, a RuvC-like nuclease domain located at the amino terminus and a HNH-like nuclease domain that resides in the mid-region of the protein. To achieve site-specific DNA recognition and cleavage, Cas9 is complexed with both a crRNA and a separate trans-activating crRNA (tracrRNA or trRNA), that is partially complementary to the crRNA. The tracrRNA is required for crRNA maturation from a primary transcript encoding multiple pre-crRNAs. This occurs in the presence of RNase III and Cas9.

[0205] Without wishing to be bound by theory, it is herein acknowledged that during the destruction of target DNA, the HNH and RuvC-like nuclease domains cut both DNA strands, generating double-stranded breaks (DSBs) at sites defined by a 20-nucleotide target sequence within an associated crRNA transcript. The HNH domain cleaves the complementary strand, while the RuvC domain cleaves the noncomplementary strand.

[0206] It is further noted that the double-stranded endonuclease activity of Cas9 also requires that a short conserved sequence, (2-5 nts) known as protospacer-associated motif (PAM), follows immediately 3′- of the crRNA complementary sequence.

[0207] According to further aspects of the invention, a two-component system may be used by the current invention, combining trRNA and crRNA into a single synthetic single guide RNA (sgRNA) for guiding targeted gene alterations.

[0208] It is further within the scope that Cas9 nuclease variants include wild-type Cas9, Cas9D10A and nuclease-deficient Cas9 (dCas9).

[0209] Reference is now made to FIG. 1 schematically presenting an example of CRISPR/Cas9 mechanism of action as depicted by Xie, Kabin, and Yinong Yang. “RNA guided genome editing in plants using a CRISPR-Cas system.” Molecular plant 6.6 (2013): 1975-1983. As shown in this figure, the Cas9 endonuclease forms a complex with a chimeric RNA (called guide RNA or gRNA), replacing the crRNA-transcrRNA heteroduplex, and the gRNA could be programmed to target specific sites. The gRNA-Cas9 should comprise at least 15-base-pairing (gRNA seed region) without mismatch between the 5′-end of engineered gRNA and targeted genomic site, and an NGG motif (called protospacer-adjacent motif or PAM) that follows the base-pairing region in the complementary strand of the targeted DNA.

[0210] The term “meganucleases” as used herein refers hereinafter to endodeoxyribonucleases characterized by a large recognition site (double-stranded DNA sequences of 12 to 40 base pairs); as a result this site generally occurs only once in any given genome. Meganucleases are therefore considered to be the most specific naturally occurring restriction enzymes.

[0211] The term “protospacer adjacent motif” or “PAM” as used herein refers hereinafter to a 2-6 base pair DNA sequence immediately following the DNA sequence targeted by the Cas9 nuclease in the CRISPR bacterial adaptive immune system. PAM is a component of the invading virus or plasmid, but is not a component of the bacterial CRISPR locus. PAM is an essential targeting component which distinguishes bacterial self from non-self DNA, thereby preventing the CRISPR locus from being targeted and destroyed by nuclease.

[0212] The term “Next-generation sequencing” or “NGS” as used herein refers hereinafter to massively, parallel, high-throughput or deep sequencing technology platforms that perform sequencing of millions of small fragments of DNA in parallel. Bioinformatics analyses are used to piece together these fragments by mapping the individual reads to the reference genome.

[0213] The term “gene knockdown” as used herein refers hereinafter to an experimental technique by which the expression of one or more of an organism's genes is reduced. The reduction can occur through genetic modification, i.e. targeted genome editing or by treatment with a reagent such as a short DNA or RNA oligonucleotide that has a sequence complementary to either gene or an mRNA transcript. The reduced expression can be at the level of RNA or at the level of protein. It is within the scope of the present invention that the term gene knockdown also refers to a loss of function mutation and/or gene knockout mutation in which an organism's genes is made inoperative or nonfunctional.

[0214] The term “gene silencing” as used herein refers hereinafter to the regulation of gene expression in a cell to prevent the expression of a certain gene. Gene silencing can occur during either transcription or translation. In certain aspects of the invention, gene silencing is considered to have a similar meaning as gene knockdown. When genes are silenced, their expression is reduced. In contrast, when genes are knocked out, they are completely not expressed. Gene silencing may be considered a gene knockdown mechanism since the methods used to silence genes, such as RNAi, CRISPR, or siRNA, generally reduce the expression of a gene by at least 70% but do not completely eliminate it.

[0215] The term “loss of function mutation” as used herein refers to a type of mutation in which the altered gene product lacks the function of the wild-type gene. A synonyms of the term included within the scope of the present invention is null mutation.

[0216] The term “microRNAs” or “miRNAs” refers hereinafter to small non-coding RNAs that have been found in most of the eukaryotic organisms. They are involved in the regulation of gene expression at the post-transcriptional level in a sequence specific manner. MiRNAs are produced from their precursors by Dicer-dependent small RNA biogenesis pathway. MiRNAs are candidates for studying gene function using different RNA-based gene silencing techniques. For example, artificial miRNAs (amiRNAs) targeting one or several genes of interest is a potential tool in functional genomics.

[0217] The term “in planta” means in the context of the present invention within the plant or plant cells. More specifically, it means introducing CRISPR/Cas complex into plant material comprising a tissue culture of several cells, a whole plant, or into a single plant cell, without introducing a foreign gene or a mutated gene. It also used to describe conditions present in a non-laboratory environment (e.g. in vivo).

[0218] The term “genotype” or “genetic background” refers hereinafter to the genetic constitution of a cell or organism. An individual's genotype includes the specific alleles, for one or more genetic marker loci, present in the individual's haplotype. As is known in the art, a genotype can relate to a single locus or to multiple loci, whether the loci are related or unrelated and/or are linked or unlinked. In some embodiments, an individual's genotype relates to one or more genes that are related in that the one or more of the genes are involved in the expression of a phenotype of interest. Thus, in some embodiments a genotype comprises a summary of one or more alleles present within an individual at one or more genetic loci. In some embodiments, a genotype is expressed in terms of a haplotype. It further refers to any inbreeding group, including taxonomic subgroups such as subspecies, taxonomically subordinate to species and superordinate to a race or subrace and marked by a pre-determined profile of latent factors of hereditary traits.

[0219] The term “orthologue” as used herein refers hereinafter to one of two or more homologous gene sequences found in different species.

[0220] The term “functional variant” or “functional variant of a nucleic acid or amino acid sequence” as used herein, for example with reference to SEQ ID NOs: 1, 4 or 7 refers to a variant of a sequence or part of a sequence which retains the biological function of the full non-variant allele and hence has the activity of the expressed gene or protein. A functional variant also comprises a variant of the gene of interest encoding a polypeptide which has sequence alterations that do not affect function of the resulting protein, for example, in non-conserved residues. Also encompassed is a variant that is substantially identical, i.e. has only some sequence variations, for example, in non-conserved residues, to the wild type nucleic acid or amino acid sequences of the alleles as shown herein, and is biologically active.

[0221] The term “variety” or “cultivar” used herein means a group of similar plants that by structural features and performance can be identified from other varieties within the same species.

[0222] The term “allele” used herein means any of one or more alternative or variant forms of a gene or a genetic unit at a particular locus, all of which alleles relate to one trait or characteristic at a specific locus. In a diploid cell of an organism, alleles of a given gene are located at a specific location, or locus (loci plural) on a chromosome. Alternative or variant forms of alleles may be the result of single nucleotide polymorphisms, insertions, inversions, translocations or deletions, or the consequence of gene regulation caused by, for example, by chemical or structural modification, transcription regulation or post-translational modification/regulation. An allele associated with a qualitative trait may comprise alternative or variant forms of various genetic units including those mat are identical or associated with a single gene or multiple genes or their products or even a gene disrupting or controlled by a genetic factor contributing to the phenotype represented by the locus. According to further embodiments, the term “allele” designates any of one or more alternative forms of a gene at a particular locus. Heterozygous alleles are two different alleles at the same locus. Homozygous alleles are two identical alleles at a particular locus. A wild type allele is a naturally occurring allele.

[0223] As used herein, the term “locus” (loci plural) means a specific place or places or region or a site on a chromosome where for example a gene or genetic marker element or factor is found. In specific embodiments, such a genetic element is contributing to a trait.

[0224] As used herein, the term “homozygous” refers to a genetic condition or configuration existing when two identical or like alleles reside at a specific locus, but are positioned individually on corresponding pairs of homologous chromosomes in the cell of a diploid organism.

[0225] Conversely, as used herein, the term “heterozygous” means a genetic condition or configuration existing when two different or unlike alleles reside at a specific locus, but are positioned individually on corresponding pairs of homologous chromosomes in the cell of a diploid organism.

[0226] As used herein, the phrase “genetic marker” or “molecular marker” or “biomarker” refers to a feature in an individual's genome e.g., a nucleotide or a polynucleotide sequence that is associated with one or more loci or trait of interest In some embodiments, a genetic marker is polymorphic in a population of interest, or the locus occupied by the polymorphism, depending on context. Genetic markers or molecular markers include, for example, single nucleotide polymorphisms (SNPs), indels (i.e. insertions deletions), simple sequence repeats (SSRs), restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNAs (RAFDs), cleaved amplified polymorphic sequence (CAPS) markers, Diversity Arrays Technology (DArT) markers, and amplified fragment length polymorphisms (AFLPs) or combinations thereof, among many other examples such as the DNA sequence per se. Genetic markers can, for example, be used to locate genetic loci containing alleles on a chromosome that contribute to variability of phenotypic traits. The phrase “genetic marker” or “molecular marker” or “biomarker” can also refer to a polynucleotide sequence complementary or corresponding to a genomic sequence, such as a sequence of a nucleic acid used as a probe or primer.

[0227] As used herein, the term “germplasm” refers to the totality of the genotypes of a population or other group of individuals (e.g., a species). The term “germplasm” can also refer to plant material; e.g., a group of plants that act as a repository for various alleles. Such germplasm genotypes or populations include plant materials of proven genetic superiority; e.g., for a given environment or geographical area, and plant materials of unknown or unproven genetic value; that are not part of an established breeding population and that do not have a known relationship to a member of the established breeding population.

[0228] The terms “hybrid”, “hybrid plant” and “hybrid progeny” used herein refers to an individual produced from genetically different parents (e.g., a genetically heterozygous or mostly heterozygous individual).

[0229] As used herein, “sequence identity” or “identity” in the context of two nucleic acid or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins, it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. The term further refers hereinafter to the amount of characters which match exactly between two different sequences. Hereby, gaps are not counted and the measurement is relational to the shorter of the two sequences.

[0230] It is further within the scope that the terms “similarity” and “identity” additionally refer to local homology, identifying domains that are homologous or similar (in nucleotide and/or amino acid sequence). It is acknowledged that bioinformatics tools such as BLAST, SSEARCH, FASTA, and HMMER calculate local sequence alignments which identify the most similar region between two sequences. For domains that are found in different sequence contexts in different proteins, the alignment should be limited to the homologous domain, since the domain homology is providing the sequence similarity captured in the score. According to some aspects the term similarity or identity further includes a sequence motif, which is a nucleotide or amino-acid sequence pattern that is widespread and has, or is conjectured to have, a biological significance.

[0231] Proteins may have a sequence motif and/or a structural motif, a motif formed by the three-dimensional arrangement of amino acids which may not be adjacent.

[0232] As used herein, the terms “nucleic acid”, “nucleic acid sequence”, “nucleotide”, “nucleic acid molecule” or “polynucleotide” are intended to include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), natural occurring, mutated, synthetic DNA or RNA molecules, and analogs of the DNA or RNA generated using nucleotide analogs. It can be single-stranded or double-stranded. Such nucleic acids or polynucleotides include, but are not limited to, coding sequences of structural genes, anti-sense sequences, and non-coding regulatory sequences that do not encode mRNAs or protein products. These terms also encompass a gene. The term “gene”, “allele” or “gene sequence” is used broadly to refer to a DNA nucleic acid associated with a biological function. Thus, genes may include introns and exons as in the genomic sequence, or may comprise only a coding sequence as in cDNAs, and/or may include cDNAs in combination with regulatory sequences. Thus, according to the various aspects of the invention, genomic DNA, cDNA or coding DNA may be used. In one embodiment, the nucleic acid is cDNA or coding DNA.

[0233] The terms “peptide”, “polypeptide” and “protein” are used interchangeably herein and refer to amino acids in a polymeric form of any length, linked together by peptide bonds.

[0234] According to other aspects of the invention, a “modified” or a “mutant” plant is a plant that has been altered compared to the naturally occurring wild type (WT) plant. Specifically, the endogenous nucleic acid sequences of one or more of the Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1), and any combination thereof, homologs in Cannabis have been altered compared to wild type sequences using mutagenesis and/or genome editing methods as described herein. This causes inactivation of at least one of these endogenous genes and thus disables their function in production of THC and/or CBD, depending on the gene or combination of genes down regulated.

[0235] Such plants have an altered cannabinoid profile which may be suitable for treatment of different medical conditions or diseases. Therefore, the cannabinoid profile is affected by the presence of at least one mutated endogenous cannabinoid biosynthesis enzyme gene in the Cannabis plant genome which has been specifically targeted using genome editing technique.

[0236] As used herein, the term “cannabinoid biosynthesis enzyme” refers to a protein acting as a catalyst for producing one or more cannabinoids in a plant of genus Cannabis.

[0237] Examples of cannabinoid biosynthesis enzymes within the context of this disclosure include, but are not limited to: tetrahydrocannabinolic acid synthase (THCAS), cannabidiolic acid synthase (CBDAS), aromatic prenyltransferase (PT), olivetol synthase (OLS), acyl-activating enzyme 1 (AAE1), polyketide synthase (PKS), olivetolic acid cyclase (OAC), tetraketide synthase (TKS), type III PKS, chalcone synthase (CHS), prenyltransferase, CBCA synthase, GPP synthase, FPP synthase, Limonene synthase, aromatic prenyltransferase, and geranylphosphate: olivetolate geranyltrasferase.

[0238] Disclosed herein, is a method of controlling cannabinoid synthesis in a plant of genus Cannabis. In some embodiments, the method comprising: Manipulating expression of a gene coding for a cannabinoid biosynthesis enzyme selected from the group consisting of Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) and any combination thereof.

[0239] As used herein, the term “controlling” refers to directing, governing, steering, and/or manipulating, specifically reducing, decreasing or down regulating or silencing the amount of a cannabinoid or cannabinoids produced in a plant of genus Cannabis. In one embodiment, controlling comprises modifying a plant of genus Cannabis to produce an unnaturally occurring concentration of a first cannabinoid. In one embodiment, controlling comprises modifying a plant of genus Cannabis to produce an unnaturally occurring ratio of a first cannabinoid. In one embodiment, controlling comprises modifying a plant of genus Cannabis to produce an unnaturally occurring concentration of a second cannabinoid. In one embodiment, controlling comprises modifying a plant of genus Cannabis to produce an unnaturally occurring ratio of a second cannabinoid.

[0240] As used herein, the term “expression of a gene” refers to a plant's ability to utilize information from genetic material for producing functional gene products. Within the context of this disclosure, expression is meant to encompass the plant's ability to produce proteins, such as enzymes, and various other molecules from the plant's genetic material. In one embodiment, the plant expresses mutated or modified cannabinoid biosynthesis enzymes for cannabinoid biosynthesis. In one embodiment it refers to transcription (RNA) or translation (protein) levels of gene expression.

[0241] As used herein, the term “manipulating expression of a gene” refers to intentionally changing the genome of a plant of genus Cannabis to control the expression of certain features.

[0242] In one embodiment, the plant's genome is manipulated to express less CBDA synthase.

[0243] In one embodiment, the plant's genome is manipulated to express less THCA synthase.

[0244] In one embodiment, the plant's genome is manipulated to express less aromatic prenyltransferase (PT).

[0245] In one embodiment, the plant's genome is manipulated to express less olivetol synthase (OLS).

[0246] In one embodiment, the plant's genome is manipulated to express less acyl-activating enzyme 1 (AAE1).

[0247] According to a further embodiment, the plant's genome is manipulated to express less of any combination of the above mentioned cannabinoid biosynthesis enzymes.

[0248] As used herein, the term “coding” refers to storing genetic information and accessing the genetic information for producing functional gene products.

[0249] According to further aspects of the present invention, the altered THC and/or CBD content trait is not conferred by the presence of transgenes expressed in Cannabis.

[0250] Cannabis plants of the invention are modified plants compared to wild type plants which comprise and express at least one mutant Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) and any combination thereof allele.

[0251] Main aspects of the invention involve targeted mutagenesis methods, specifically genome editing, and exclude embodiments that are solely based on generating plants by traditional breeding methods.

[0252] Described are polynucleotides as well as methods for modifying metabolite biosynthesis pathways in Cannabis plants and/or Cannabis plant cells, Cannabis plants and/or plant cells exhibiting modified metabolite biosynthesis pathways. In particular, described are methods for modifying production of THC and/or CBD in Cannabis plants by modulating the expression and/or activity of at least one of Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) and any combination thereof and Cannabis plants having modified expression and/or activity of at least one of these genes/proteins.

[0253] Accordingly, in certain embodiments, the present invention provides methods of downregulating production of THC and/or CBD. In particular embodiments, there is provided methods of downregulating expression and/or activity THCA synthase and/or CBDA synthase.

[0254] Also provided are plants and/or plant cells having modified production of THC and/or CBD. In certain embodiments, there are provided Cannabis plants and/or cells having down-regulated expression of and/or activity of at least one of Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) and any combination thereof.

[0255] Down regulation of key steps in metabolic pathway re-directs intermediates and energy to alternative metabolic pathways and results in increased production and accumulation or reduced production and elimination of other end products. THC and other Cannabis metabolites share a biosynthetic pathway; that cannabigerolic acid is a precursor of THC, CBD and Cannabichromene. In particular, THCA synthase catalyzes the production of delta-9-tetrahydrocannabinolic acid from cannabigerolic acid; delta-9-tetrahydrocannabinolic undergoes thermal conversion to form THC. CBDA synthase catalyzes the production of cannabidiolic acid from cannabigerolic acid; cannabidiolic acid undergoes thermal conversion to CBD. CBCA synthase catalyzes the production of cannabichromenic acid from cannabigerolic acid; cannabichromenic acid undergoes thermal conversion to cannabichromene.

[0256] A reduction in the production of THC, CBD, or Cannabichromene will enhance production of the remaining metabolites in this shared pathway. For example, production of CBD and/or Cannabichromene is enhanced by inhibiting production of THC. THC production may be inhibited by inhibiting expression and/or activity of tetrahydrocannabinolic acid (THCA) synthase enzyme.

[0257] Described are certain embodiments of enhancing production of one or more secondary metabolites by downregulation of the production of one or more metabolites having a shared biosynthetic pathway. Certain embodiments provide methods of enhancing production of one or more secondary metabolites that share steps and intermediates in the THC and/or CBD biosynthetic pathway by downregulation of THC and/or CBD production. In specific embodiments, there are provided methods of enhancing production of CBD and/or Cannabichromene by inhibiting production of THC. In other specific embodiments, there are provided methods of enhancing production of THC by inhibiting production of CBD.

[0258] In other specific embodiments, both the production of CBD and THC is inhibited by targeting at least one of the herein identified genes CsAAE1 (SEQ ID NO:13), or CsOLS (SEQ ID NO:10), or CsPT (SEQ ID NO:7) or any combination thereof.

[0259] In other specific embodiments, the production of CBD is inhibited (and THC is induced or not affected) by targeting the herein identified gene CsCBDAS (SEQ ID NO:4).

[0260] In other specific embodiments, the production of THC is inhibited (and CBD is induced or not affected) by targeting the herein identified gene CsTHCAS (SEQ ID NO:1).

[0261] Certain embodiments provide methods of enhancing production of one or more secondary metabolites which share steps and intermediates in the THC biosynthetic pathway by downregulation of expression and/or activity of CsTHCA synthase (SEQ ID NO:1).

[0262] In specific embodiments, there are provided methods of enhancing production of CBD and/or Cannabichromene by downregulation of expression and/or activity of THCA synthase.

[0263] Also provided are plants and plant cells having modified production of one or more metabolites having a shared biosynthetic pathway. In certain embodiments, there are provided Cannabis plants and cells enhanced production of one or more secondary metabolites and downregulation of one or more other metabolites having a shared biosynthetic pathway. In certain embodiments, there are provided Cannabis plants and cells having enhanced production of one or more secondary metabolites and downregulation of one or more other metabolites in the THC and or CBD biosynthetic pathway. In certain embodiments, there are provided Cannabis plants and cells having enhanced production of one or more secondary metabolites in the THC biosynthetic pathway and downregulated THC production. In specific embodiments, there are provided Cannabis plants and cells having enhanced production of CBD and/or Cannabichromene and downregulated THC production.

[0264] In specific embodiments, there are provided Cannabis plants and/or cells having enhanced production of CBD and/or Cannabichromene and downregulated expression and/or activity of THCA synthase.

[0265] The loss of function mutation may be a deletion or insertion (“indels”) with reference the wild type allele sequence. The deletion may comprise 1-20 or more nucleotides, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1, 12, 13, 14, 15, 16, 17, 18 or 20 nucleotides or more in one or more strand. The insertion may comprise 1-20 or more nucleotides, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1, 12, 13, 14, 15, 16, 17, 18 or 20 or more nucleotides in one or more strand.

[0266] The plant of the invention includes plants wherein the plant is heterozygous for the each of the mutations. In other embodiment however, the plant is homozygous for the mutations. Progeny that is also homozygous can be generated from these plants according to methods known in the art.

[0267] It is further within the scope that variants of a particular nucleotide or amino acid sequence according to the various aspects of the invention will have at least about 50%-99%, for example at least 75%, for example at least 85%, 86%, 87%, 88%, 89%, 90%, 92%, 94%, 95%, 96%, 97%, 98% or 99% or more sequence identity to that particular non-variant nucleotide sequence of the Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) allele as shown in SEQ ID NO 1, 4, 7, 10 or 13; and/or SEQ ID NO 2, 5, 8, 11 or 14, respectively. Sequence alignment programs to determine sequence identity are well known in the art.

[0268] Also, the various aspects of the invention encompass not only a Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) nucleic acid sequence or amino acid sequence, but also fragments thereof. By “fragment” is intended a portion of the nucleotide sequence or a portion of the amino acid sequence and hence of the protein encoded thereby. Fragments of a nucleotide sequence may encode protein fragments that retain the biological activity of the native protein, in this case cannabinoid biosynthesis enzymes.

[0269] According to further embodiments of the present invention, DNA introduction into the plant cells can be done by Agrobacterium infiltration, virus based plasmids for delivery of the genome editing molecules and mechanical insertion of DNA (PEG mediated DNA transformation, biolistics, etc.).

[0270] In addition, it is within the scope of the present invention that the Cas9 protein is directly inserted together with a gRNA (ribonucleoprotein-RNP's) in order to bypass the need for in vivo transcription and translation of the Cas9+gRNA plasmid in planta to achieve gene editing.

[0271] It is within the scope of the present invention that the usage of CRISPR/Cas system for the generation of Cannabis plants with at least one improved domestication trait, allows the modification of predetermined specific DNA sequences without introducing foreign DNA into the genome by GMO techniques. According to one embodiment of the present invention, this is achieved by combining the Cas nuclease (e.g. Cas9, Cpf1 and the like) with a predefined guide RNA molecule (gRNA). The gRNA is complementary to a specific DNA sequence targeted for editing in the plant genome and which guides the Cas nuclease to a specific nucleotide sequence (for example see FIG. 1). The predefined gene specific gRNA's are cloned into the same plasmid as the Cas gene and this plasmid is inserted into plant cells. Insertion of the aforementioned plasmid DNA can be done, but not limited to, using different delivery systems, biological and/or mechanical, e.g. Agrobacterium infiltration, virus based plasmids for delivery of the genome editing molecules and mechanical insertion of DNA (PEG mediated DNA transformation, biolistics, etc.).

[0272] It is further within the scope of the present invention that upon reaching the specific predetermined DNA sequence, the Cas9 nuclease cleaves both DNA strands to create double stranded breaks leaving blunt ends. This cleavage site is then repaired by the cellular non homologous end joining DNA repair mechanism resulting in insertions or deletions which eventually create a mutation at the cleavage site. For example, it is acknowledged that a deletion form of the mutation consists of at least 1 base pair deletion. As a result of this base pair deletion the gene coding sequence is disrupted and the translation of the encoded protein is compromised either by a premature stop codon or disruption of a functional or structural property of the protein. Thus DNA is cut by the Cas9 protein and re-assembled by the cell's DNA repair mechanism.

[0273] It is further within the scope that manipulation of cannabinoid biosynthesis enzymes in Cannabis plants is herein achieved by generating gRNA with homology to a specific site of predetermined genes in the Cannabis genome i.e. Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) genes, sub cloning this gRNA into a plasmid containing the Cas9 gene, and insertion of the plasmid into the Cannabis plant cells. In this way site specific mutations in the aforementioned genes are generated thus effectively creating non-active molecules, resulting in loss of function of at least one of the enzymes, reduced content of THC, CBD or both of the cannabinoids in the genome edited plant.

[0274] In order to understand the invention and to see how it may be implemented in practice, a plurality of preferred embodiments will now be described, by way of non-limiting example only, with reference to the following examples.

Example 1

Production of Cannabis Plants with Modulated Cannabinoid Expression

[0275] Production of Cannabis lines with mutated Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS) or Cannabis cannabidiolic acid synthase (CsCBDAS) or Cannabis aromatic prenyltransferase (CsPT) or Cannabis olivetol synthase (CsOLS) or Cannabis acyl-activating enzyme 1 (CsAAE1) gene or any combination thereof may be achieved by at least one of the following breeding/cultivation schemes:

[0276] Scheme 1: [0277] line stabilization by self pollination [0278] Generation of F6 parental lines [0279] Genome editing of parental lines [0280] Crossing edited parental lines to generate an F1 hybrid plant

[0281] Scheme 2: [0282] Identifying genes/alleles of interest [0283] Designing gRNA [0284] Transformation of plants with Cas9+gRNA constructs [0285] Screening and identifying editing events [0286] Genome editing of parental lines

[0287] It is noted that line stabilization may be performed by the following: [0288] Induction of male flowering on female (XX) plants [0289] Self pollination

[0290] According to some embodiments of the present invention, line stabilization requires about 6 self-crossing (6 generations) and done through a single seed descent (SSD) approach.

[0291] F1 hybrid seed production: Novel hybrids are produced by crosses between different Cannabis strains.

[0292] According to a further aspect of the current invention, shortening line stabilization is performed by Doubled Haploids (DH). More specifically, the CRISPR-Cas9 system is transformed into microspores to achieve DH homozygous parental lines. A doubled haploid (DH) is a genotype formed when haploid cells undergo chromosome doubling. Artificial production of doubled haploids is important in plant breeding. It is herein acknowledged that conventional inbreeding procedures take about six generations to achieve approximately complete homozygosity, whereas doubled haploidy achieves it in one generation.

[0293] It is within the scope of the current invention that genetic markers specific for Cannabis are developed and provided by the current invention: [0294] Sex markers—molecular markers are used for identification and selection of female vs male plants in the herein disclosed breeding program [0295] Genotyping markers—germplasm used in the current invention is genotyped using molecular markers, in order to allow a more efficient breeding process and identification of the Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS) or Cannabis acyl-activating enzyme 1 (CsAAE1) editing event.

[0296] It is further within the scope of the current invention that allele and genetic variation is analysed for the Cannabis strains used.

[0297] Reference is now made to optional stages that have been used for the production of mutated Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) Cannabis plants by genome editing:

[0298] Stage 1: Identifying Cannabis sativa (C. sativa), C. indica and C. ruderalis tetrahydrocannabinolic acid synthase (THCAS), cannabidiolic acid synthase (CBDAS), aromatic prenyltransferase (PT), olivetol synthase (OLS), acyl-activating enzyme 1 (AAE1) orthologues/homologs.

[0299] The following homologs have herein been identified in Cannabis sativa (C. sativa), C. indica and C. ruderalis, namely Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS) and Cannabis acyl-activating enzyme 1 (CsAAE1). These homologous genes have been sequenced and mapped.

[0300] CsTHCAS has been mapped to CM011610.1:22243181-22246809 and has a genomic sequence as set forth in SEQ ID NO:1. The CsTHCAS gene has a coding sequence as set forth in SEQ ID NO:2 and it encodes an amino acid sequence as set forth in SEQ ID NO:3.

[0301] CsCBDAS has been mapped to CM011610.1:21836038-21839672 and has a genomic sequence as set forth in SEQ ID NO:4. The CsCBDAS gene has a coding sequence as set forth in SEQ ID NO:5 and it encodes an amino acid sequence as set forth in SEQ ID NO:6.

[0302] CsPT has been mapped to CM011614.1:1184501-1186728 and has a genomic sequence as set forth in SEQ ID NO:7. The CsPT gene has a coding sequence as set forth in SEQ ID NO:8 and it encodes an amino acid sequence as set forth in SEQ ID NO:9.

[0303] CsOLS has been mapped to CM011613.1:2335391-2338392 and has a genomic sequence as set forth in SEQ ID NO:10. The CsOLS gene has a coding sequence as set forth in SEQ ID NO:11 and it encodes an amino acid sequence as set forth in SEQ ID NO:12.

[0304] CsAAE1 has been mapped to CM011611.1:1210973-1228229 and has a genomic sequence as set forth in SEQ ID NO:13. The CsAAElgene has a coding sequence as set forth in SEQ ID NO:14 and it encodes an amino acid sequence as set forth in SEQ ID NO:15.

[0305] Stage 2: Designing and synthesizing gRNA molecules corresponding to the sequence targeted for editing, i.e. sequences of each of the genes Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1). It is noted that the editing event is preferably targeted to a unique restriction site sequence to allow easier screening for plants carrying an editing event within their genome.

[0306] According to some aspects of the invention, the nucleotide sequence of the gRNAs should be completely compatible with the genomic sequence of the target gene. Therefore, for example, suitable gRNA molecules should be constructed for different Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) homologues of different Cannabis strains.

[0307] Reference is now made to Tables 1-5 presenting gRNA molecules targeted for silencing Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1), respectively. The term ‘PAM’ refers hereinafter to Protospacer Adjacent Motif, which is a 2-6 base pair DNA sequence immediately following the DNA sequence targeted by the Cas9 nuclease in the CRISPR bacterial adaptive immune system.

TABLE-US-00001 TABLE 1 gRNA sequences targeted for CsTHCAS Position on SEQ. Specificity Efficiency SEQ. ID. NO.: 1 Strand Sequence PAM Score Score ID NO  919 -1 TATAACTTTATATTGGAGCG GGG 91.68505 59.10928  16  920 -1 CTATAACTTTATATTGGAGC GGG 81.97792 39.46084  17  921 -1 TCTATAACTTTATATTGGAG CGG 59.73169 58.95429  18  926 -1 TCCTTTCTATAACTTTATAT TGG 56.2663 28.95317  19  936  1 TCCAATATAAAGTTATAGAA AGG 52.27911 43.64749  20 1013  1 ACTACTCAACATTCTCCTTT AGG 78.87146 29.78268  21 1017 -1 AATTTTGTAAACAAACCTAA AGG 47.82242 50.8107  22 1085 -1 CAATTTAGGAAATTTTCTTG AGG 53.52986 57.27972  23 1099 -1 TATATTGGGAGAAGCAATTT AGG 72.42583 23.48898  24 1113 -1 TGGATTGTTATGAATATATT GGG 39.7547 29.09505  25 1114 -1 CTGGATTGTTATGAATATAT TGG 62.7209 37.8461  26 1133 -1 TATACGAGTTTTAGATTTGC TGG 72.07547 31.53966  27 1168 -1 TCAGGACAGACATATACAAT TGG 85.35755 47.27478  28 1186 -1 GATTTTGTATTGTCAAATTC AGG 60.33738 31.33693  29 1218 -1 TGGTTTTGGGGTTGTATCAG AGG 87.42544 54.0448  30 1230 -1 GACAATAACGAGTGGTTTTG GGG 52.23624 53.9614  31 1231 -1 TGACAATAACGAGTGGTTTT GGG 75.404 22.91377  32 1232 -1 GTGACAATAACGAGTGGTTT TGG 84.75157 30.78067  33 1238 -1 GAAGGAGTGACAATAACGAG TGG 81.66494 66.45396  34 1256 -1 TGGATATGGGAGACATTTGA AGG 79.3898 47.59851  35 1269 -1 TAGAATAGTGGCTTGGATAT GGG 90.41741 42.20222  36 1270 -1 ATAGAATAGTGGCTTGGATA TGG 86.00061 40.03718  37 1276 -1 TGGAGCATAGAATAGTGGCT TGG 91.91503 51.2944  38 1281 -1 TTTCTTGGAGCATAGAATAG TGG 71.98696 51.24085  39 1296 -1 AATCTGCAAGCCAACTTTCT TGG 83.889 23.52241  40 1297  1 ATTCTATGCTCCAAGAAAGT TGG 76.79961 44.57193  41 1321  1 TTGCAGATTCGAACTCGAAG CGG 91.27714 68.55563  42 1324  1 CAGATTCGAACTCGAAGCGG TGG 95.1427 59.66476  43 1336 -1 AGGACAAACCCTCAGCATCA TGG 91.96485 64.63997  44 1338  1 AAGCGGTGGCCATGATGCTG AGG 89.20633 53.30037  45 1339  1 AGCGGTGGCCATGATGCTGA GGG 92.84794 63.02093  46 1356 -1 AAATGGGACTTGAGATGTGT AGG 82.02117 58.19267  47 1372 -1 TCAAGTCTACTATAACAAAT GGG 66.95566 44.7251  48 1373 -1 CTCAAGTCTACTATAACAAA TGG 79.05133 34.85902  49 1398  1 AGACTTGAGAAACATGCATT CGG 78.16459 54.20818  50 1429 -1 CGGCTTCAACCCACGCAGTT TGG 99.57277 40.06864  51 1430  1 ATATTCGTAGCCAAACTGCG TGG 92.73046 65.82128  52 1431  1 TATTCGTAGCCAAACTGCGT GGG 97.53917 62.7453  53 1441  1 CAAACTGCGTGGGTTGAAGC CGG 95.87721 52.5429  54 1449 -1 AACTTCTCCAAGGGTAGCTC CGG 72.36938 46.01821  55 1453  1 GTTGAAGCCGGAGCTACCCT TGG 97.29983 54.79341  56 1458 -1 CCAATAATAAACTTCTCCAA GGG 74.16963 63.94759  57 1459 -1 TCCAATAATAAACTTCTCCA AGG 73.52665 52.58996  58 1469  1 CCCTTGGAGAAGTTTATTAT TGG 83.24938 16.35292  59 1504  1 AATGAGAATCTTAGTTTTCC TGG 66.81185 30.01853  60 1507  1 GAGAATCTTAGTTTTCCTGG TGG 85.44233 66.58972  61 1508  1 AGAATCTTAGTTTTCCTGGT GGG 81.70394 50.34528  62 1511 -1 ACAGTAGGGCAATACCCACC AGG 96.88637 64.82422  63 1525  1 GGTGGGTATTGCCCTACTGT TGG 78.50407 53.56142  64 1525 -1 GTCCACCTACGCCAACAGTA GGG 89.72665 55.22571  65 1526 -1 TGTCCACCTACGCCAACAGT AGG 89.39852 57.68998  66 1531  1 TATTGCCCTACTGTTGGCGT AGG 94.7426 55.96514  67 1534  1 TGCCCTACTGTTGGCGTAGG TGG 95.81918 46.27569  68 1546  1 GGCGTAGGTGGACACTTTAG TGG 66.85409 46.38521  69 1549  1 GTAGGTGGACACTTTAGTGG AGG 13.8355 69.31429  70 1552  1 GGTGGACACTTTAGTGGAGG AGG 16.66937 53.37905  71 1558  1 CACTTTAGTGGAGGAGGCTA TGG 45.06996 40.83788  72 1579  1 GGAGCATTAATGCGAAATTA TGG 83.83888 31.63254  73 1591 -1 CAATGATATTATCAGCTGCG AGG 87.7846 69.05545  74 1627  1 GCACACTTAGTCAATGTTGA TGG 81.81927 49.79998  75 1653  1 AGTTCTAGATCGAAAATCCA TGG 82.25517 53.08044  76 1654  1 GTTCTAGATCGAAAATCCAT GGG 87.53577 49.36309  77 1655  1 TTCTAGATCGAAAATCCATG GGG 80.87126 69.96673  78 1656  1 TCTAGATCGAAAATCCATGG GGG 87.02608 75.88737  79 1659 -1 CCAAAATAGATCTTCCCCCA TGG 52.2372 64.79896  80 1670  1 CCATGGGGGAAGATCTATTT TGG 40.87315 10.50835  81 1671  1 CATGGGGGAAGATCTATTTT GGG 45.38645 26.29582  82 1681  1 GATCTATTTTGGGCTATACG TGG 92.9509 65.38681  83 1684  1 CTATTTTGGGCTATACGTGG TGG 93.89012 56.74158  84 1687  1 TTTTGGGCTATACGTGGTGG TGG 89.67677 47.46932  85 1690  1 TGGGCTATACGTGGTGGTGG AGG 89.86004 51.37554  86 1702  1 GGTGGTGGAGGTGAAAACTT TGG 82.68444 59.30357  87 1718  1 ACTTTGGAATCATTGCAGCG TGG 94.22981 66.30813  88 1731  1 TGCAGCGTGGAAAATTAGAC TGG 88.9567 50.21323  89 1748  1 GACTGGTTGCTGTCCCATCA AGG 98.25535 54.41897  90 1749  1 ACTGGTTGCTGTCCCATCAA GGG 90.45162 53.09475  91 1750 -1 TGAATATAGTAGCCCTTGAT GGG 89.11324 51.54889  92 1751 -1 CTGAATATAGTAGCCCTTGA TGG 94.41378 50.50505  93 1772  1 CTACTATATTCAGTGTTAAA AGG 79.2234 36.92709  94 1779  1 ATTCAGTGTTAAAAGGAATA TGG 65.11384 40.20542  95 1789  1 AAAAGGAATATGGAGATACA TGG 63.91743 56.49626  96 1790  1 AAAGGAATATGGAGATACAT GGG 68.15381 55.96289  97 1814  1 TTGTCAAGTTATTTAACAAA TGG 47.11745 34.12702  98 1874  1 TCATGACTCACTTCATAACC AGG 35.67077 53.19672  99 1881 -1 TTGATTATCTATAATATTCC TGG 75.11494 33.49257 100 1894  1 AGGAATATTATAGATAATCA AGG 61.99209 56.41876 101 1918  1 AAGAATAAGACTACAGTACA CGG 22.03371 69.66059 102 1942  1 TACTTCTCTTGCATTTTCCA TGG 70.76593 46.22116 103 1945  1 TTCTCTTGCATTTTCCATGG TGG 64.23993 47.59533 104 1948 -1 CTAGACTATCCACTCCACCA TGG 94.11237 66.93721 105 1950  1 TTGCATTTTCCATGGTGGAG TGG 86.29578 54.03153 106 1992  1 GAACAAGAGCTTTCCTGAGT TGG 94.74542 48.70955 107 1993  1 AACAAGAGCTTTCCTGAGTT GGG 91.66248 41.21334 108 1994 -1 GTTTTTTTAATACCCAACTC AGG 81.54763 48.23303 109 2027  1 CTGATTGCAAAGAATTGAGC TGG 91.63062 45.41598 110 2049 -1 TACAACACCACTGTAGAAGA TGG 87.1194 55.28908 111 2053  1 GATACTACCATCTTCTACAG TGG 85.64352 61.29416 112 2088  1 TAACACTACTAATTTTCAAA AGG 52.892 37.63415 113 2113  1 ATTTTGCTTGATAGATCAGC TGG 89.54269 45.49052 114 2114  1 TTTTGCTTGATAGATCAGCT GGG 83.06148 69.66798 115 2168 -1 ACAATTGCAGTTTCTGGAAT TGG 83.65549 27.85148 116 2174 -1 ATTTTGACAATTGCAGTTTC TGG 71.89285 13.8671 117 2190  1 AACTGCAATTGTCAAAATTT TGG 51.26105 21.65345 118 2215  1 AAATTGTATGAAGAAGATGT AGG 50.42741 60.89104 119 2221  1 TATGAAGAAGATGTAGGAGT TGG 74.0566 40.67797 120 2245  1 GTGTATGTATTGTACCCTTA CGG 87.47868 52.95626 121 2248  1 TATGTATTGTACCCTTACGG TGG 88.53147 70.67558 122 2248 -1 TGTCCATTATACCACCGTAA GGG 98.58031 65.38253 123 2249 -1 TTGTCCATTATACCACCGTA AGG 96.99197 52.80478 124 2256  1 GTACCCTTACGGTGGTATAA TGG 86.96972 36.4762 125 2291 -1 ATTCCAGCTCGATGAGGGAA AGG 85.04932 58.09939 126 2296 -1 ACATGATTCCAGCTCGATGA GGG 95.76248 60.07786 127 2297 -1 TACATGATTCCAGCTCGATG AGG 96.20958 66.08229 128 2299  1 ATTCCTTTCCCTCATCGAGC TGG 72.65637 45.46834 129 2318  1 CTGGAATCATGTACGAAGTT TGG 91.44916 38.23198 130 2333  1 AAGTTTGGTACGCAGCTACC TGG 97.19351 52.48753 131 2334  1 AGTTTGGTACGCAGCTACCT GGG 99.34096 54.73117 132 2340 -1 ATTATCTTCTTGCTTCTCCC AGG 65.57768 47.7251 133 2369  1 ATAATGAAAAGCATATAAAC TGG 54.90991 38.48962 134 2370  1 TAATGAAAAGCATATAAACT GGG 52.19307 58.36084 135 2408 -1 CTTGGATTTTGGGACACATA AGG 86.23392 45.11168 136 2418 -1 ATACGCCATTCTTGGATTTT GGG 83.33913 19.22763 137 2419 -1 GATACGCCATTCTTGGATTT TGG 84.63939 21.34065 138 2424  1 TGTGTCCCAAAATCCAAGAA TGG 72.13536 54.39396 139 2426 -1 TAATTGAGATACGCCATTCT TGG 94.47859 25.9349 140 2441  1 GAATGGCGTATCTCAATTAT AGG 87.03451 33.66134 141 2442  1 AATGGCGTATCTCAATTATA GGG 83.63841 42.44805 142 2455  1 AATTATAGGGACCTTGATTT AGG 51.02913 28.76282 143 2455 -1 GATCAGTTTTTCCTAAATCA AGG 81.50991 49.62644 144 2477 -1 GTGTAATTATTAGGACTCTT GGG 63.03567 37.12308 145 2478 -1 GGTGTAATTATTAGGACTCT TGG 87.51322 36.60593 146 2486 -1 CGTGCTTGGGTGTAATTATT AGG 89.37979 20.5205 147 2499 -1 TTCACCCCAGATACGTGCTT GGG 96.64962 52.4944 148 2500 -1 TTTCACCCCAGATACGTGCT TGG 98.66657 52.02383 149 2504  1 ATTACACCCAAGCACGTATC TGG 74.79545 34.14523 150 2505  1 TTACACCCAAGCACGTATCT GGG 95.37111 41.9996 151 2506  1 TACACCCAAGCACGTATCTG GGG 98.75694 62.87462 152 2521  1 ATCTGGGGTGAAAAGTACTT TGG 87.2143 49.68151 153 2547  1 AAACTTTGACAAGTTAGTTA AGG 62.31057 39.88018 154 2565 -1 AAAATTATTGGGATCAACTT TGG 58.80076 33.4693 155 2576 -1 TCGTTTCTAAAAAAATTATT GGG 48.06619 22.76069 156 2577 -1 CTCGTTTCTAAAAAAATTAT TGG 55.23725 14.78939 157 2608 -1 GACGTCGTGGCGGAAGAGGT GGG 98.09602 65.65899 158 2609 -1 TGACGTCGTGGCGGAAGAGG TGG 91.81254 50.45154 159 2612 -1 TAATGACGTCGTGGCGGAAG AGG 98.07448 47.29841 160 2618 -1 AATAATTAATGACGTCGTGG CGG 89.39021 64.62174 161 2621 -1 AAAAATAATTAATGACGTCG TGG 78.57945 59.53964 162 2684 -1 ATATATAACAGATACATGTA TGG 62.7441 56.45533 163 2719 -1 CTTAGGAGCATACATAGTAC AGG 83.60953 55.16134 164 2736 -1 TACTGTAGATGTTCATACTT AGG 72.89098 47.9896 165 2776  1 TGTAGACATCATAAGATATA TGG 61.18482 42.96127 166 2807  1 AAATTATCTTTCTTATTTAA TGG 40.09022 10.00087 167

TABLE-US-00002 TABLE 2 gRNA sequences targeted for CsCBDAS Position on SEQ. Efficiency SEQ. ID. NO.: 4 Strand Sequence PAM Score ID NO. 927 -1 AGCTTTATATATTGGAGCAG GGG 54.68597 168 928 -1 TAGCTTTATATATTGGAGCA GGG 56.13836 169 929 -1 ATAGCTTTATATATTGGAGC AGG 39.33975 170 935 -1 CTATTTATAGCTTTATATAT TGG 24.05235 171 947  1 CAATATATAAAGCTATAAAT AGG 27.93541 172 971 -1 TAATGAATTTTGAATTACTA TGG 34.40115 173 1022  1 AGTACTCAACATTCTCCTTT TGG 25.84144 174 1026 -1 TATCTTGCAAACAAACCAAA AGG 54.35998 175 1075 -1 GAGGATTAGCAATGGAAGTT TGG 35.85374 176 1083 -1 GTTTTCTCGAGGATTAGCAA TGG 61.84745 177 1094 -1 CATTTAAGGAAGTTTTCTCG AGG 62.59449 178 1108 -1 TATATTGCGAGAAGCATTTA AGG 22.98833 179 1133 -1 TTTAGATTTGTTGCATTATT GGG 18.30136 180 1134 -1 TTTTAGATTTGTTGCATTAT TGG 22.12177 181 1177 -1 TTAGGACAGACATATACAAT GGG 50.41844 182 1178 -1 TTTAGGACAGACATATACAA TGG 52.3325 183 1195 -1 GATTGTGTATTGTCGAATTT AGG 29.00652 184 1239 -1 GACGATAACAAGTGGTTTTG GGG 53.7312 185 1240 -1 TGACGATAACAAGTGGTTTT GGG 22.17034 186 1241 -1 GTGACGATAACAAGTGGTTT TGG 32.43789 187 1247 -1 GAAGGAGTGACGATAACAAG TGG 66.33896 188 1265 -1 TGGATATGAGAGACATGTGA AGG 69.66263 189 1279  1 TCACATGTCTCTCATATCCA AGG 60.60093 190 1285 -1 TGGAGCATAGAATAGTGCCT TGG 51.2944 191 1305 -1 AATCTGCAAGCCAACTTTCT TGG 23.52241 192 1306  1 ATTCTATGCTCCAAGAAAGT TGG 44.57193 193 1330  1 TTGCAGATTCGAACTCGAAG TGG 63.85956 194 1333  1 CAGATTCGAACTCGAAGTGG TGG 60.21029 195 1347  1 AAGTGGTGGTCATGATTCTG AGG 61.14171 196 1348  1 AGTGGTGGTCATGATTCTGA GGG 66.1321 197 1365 -1 AAATGGGACTTGAGATATGT AGG 48.94352 198 1381 -1 TCAAGTCTACTATAACAAAT GGG 44.7251 199 1382 -1 CTCAAGTCTACTATAACAAA TGG 34.85902 200 1438 -1 CGGCTTCAACCCATGCAGTT TGG 41.98925 201 1439  1 ATGTTCATAGCCAAACTGCA TGG 53.04758 202 1440  1 TGTTCATAGCCAAACTGCAT GGG 62.17149 203 1450  1 CAAACTGCATGGGTTGAAGC CGG 57.17967 204 1458 -1 AACTTCTCCAAGGGTAGCTC CGG 46.01821 205 1462  1 GTTGAAGCCGGAGCTACCCT TGG 56.02393 206 1467 -1 CCAATAATAAACTTCTCCAA GGG 65.85225 207 1468 -1 CCCAATAATAAACTTCTCCA AGG 53.53392 208 1478  1 CCCTTGGAGAAGTTTATTAT TGG 20.92657 209 1479  1 CCTTGGAGAAGTTTATTATT GGG 22.0283 210 1509  1 GAAAAATGAGAGTCTTAGTT TGG 32.53304 211 1516  1 GAGAGTCTTAGTTTGGCTGC TGG 40.11193 212 1517  1 AGAGTCTTAGTTTGGCTGCT GGG 53.68777 213 1534 -1 GTCCACCTGCGCAAACAGTA GGG 51.52452 214 1540  1 TATTGCCCTACTGTTTGCGC AGG 51.06289 215 1543  1 TGCCCTACTGTTTGCGCAGG TGG 42.48452 216 1552  1 GTTTGCGCAGGTGGACACTT TGG 56.37796 217 1558  1 GCAGGTGGACACTTTGGTGG AGG 55.26903 218 1561  1 GGTGGACACTTTGGTGGAGG AGG 53.00302 219 1567  1 CACTTTGGTGGAGGAGGCTA TGG 43.62549 220 1580 -1 AGGCCATAGCTTCTCATCAA TGG 51.67311 221 1588  1 GGACCATTGATGAGAAGCTA TGG 51.46816 222 1596  1 GATGAGAAGCTATGGCCTCG CGG 72.19046 223 1600 -1 CAATGATATTATCAGCCGCG AGG 70.84796 224 1636  1 GCACACTTAGTCAACGTTCA TGG 51.20136 225 1662  1 AGTGCTAGATCGAAAATCTA TGG 38.12486 226 1663  1 GTGCTAGATCGAAAATCTAT GGG 38.40821 227 1664  1 TGCTAGATCGAAAATCTATG GGG 57.41791 228 1665  1 GCTAGATCGAAAATCTATGG GGG 68.96928 229 1679  1 CTATGGGGGAAGATCTCTTT TGG 21.51399 230 1680  1 TATGGGGGAAGATCTCTTTT GGG 27.66662 231 1690  1 GATCTCTTTTGGGCTTTACG TGG 59.22284 232 1693  1 CTCTTTTGGGCTTTACGTGG TGG 46.97883 233 1696  1 TTTTGGGCTTTACGTGGTGG TGG 42.65142 234 1711  1 GGTGGTGGAGCAGAAAGCTT CGG 56.63543 235 1727  1 GCTTCGGAATCATTGTAGCA TGG 58.92273 236 1740  1 TGTAGCATGGAAAATTAGAC TGG 47.49685 237 1759 -1 CACTAAACATAGTAGACTTT GGG 33.44838 238 1760 -1 ACACTAAACATAGTAGACTT TGG 43.66107 239 1785  1 GTTTAGTGTTAAAAAGATCA TGG 50.38465 240 1820  1 TTGTCAAGTTAGTTAACAAA TGG 43.40152 241 1880  1 TCATGACTCACTTCATAACT AGG 50.92123 242 1900  1 AGGAACATTACAGATAATCA AGG 55.24406 243 1901  1 GGAACATTACAGATAATCAA GGG 59.25054 244 1948  1 TACTTCTCTTCAGTTTTCCT TGG 33.58233 245 1951  1 TTCTCTTCAGTTTTCCTTGG TGG 33.88507 246 1954 -1 CTAGACTATCCACTCCACCA AGG 70.9998 247 1956  1 TTCAGTTTTCCTTGGTGGAG TGG 49.36462 248 1998  1 GAACAAGAGTTTTCCTGAGT TGG 44.24263 249 1999  1 AACAAGAGTTTTCCTGAGTT GGG 38.37804 250 2000 -1 GTTTTTTTAATACCCAACTC AGG 47.70664 251 2013  1 TGAGTTGGGTATTAAAAAAA CGG 35.28865 252 2033  1 CGGATTGCAGACAATTGAGC TGG 51.29451 253 2059  1 GATACTATCATCTTCTATAG TGG 50.42687 254 2094  1 CGACACTGATAATTTTAACA AGG 47.46003 255 2119  1 ATTTTGCTTGATAGATCCGC TGG 45.52498 256 2120  1 TTTTGCTTGATAGATCCGCT GGG 66.15602 257 2124 -1 GAAAGCACCGTTCTGCCCAG CGG 74.32675 258 2128  1 GATAGATCCGCTGGGCAGAA CGG 60.09095 259 2174 -1 ACAAATACAGATTCTGGAAT TGG 29.64316 260 2180 -1 ATTTGGACAAATACAGATTC TGG 32.93366 261 2196  1 ATCTGTATTTGTCCAAATTT TGG 19.19094 262 2197 -1 CATATAATTTTTCCAAAATT TGG 22.7704 263 2221  1 AAATTATATGAAGAAGATAT AGG 48.31475 264 2227  1 TATGAAGAAGATATAGGAGC TGG 37.66845 265 2228  1 ATGAAGAAGATATAGGAGCT GGG 55.50564 266 2251  1 ATGTATGCGTTGTACCCTTA CGG 51.83563 267 2254  1 TATGCGTTGTACCCTTACGG TGG 70.89895 268 2254 -1 CATCCATTATACCACCGTAA GGG 65.50071 269 2255 -1 TCATCCATTATACCACCGTA AGG 52.60015 270 2262  1 GTACCCTTACGGTGGTATAA TGG 37.81553 271 2297 -1 ATTCCAGCTCGATGAGGGAA TGG 52.19017 272 2302 -1 ACAAGATTCCAGCTCGATGA GGG 58.64874 273 2303 -1 TACAAGATTCCAGCTCGATG AGG 64.02127 274 2305  1 ATTCCATTCCCTCATCGAGC TGG 52.09796 275 2324  1 CTGGAATCTTGTATGAGTTA TGG 42.0067 276 2339  1 AGTTATGGTACATATGTAGC TGG 42.23778 277 2340  1 GTTATGGTACATATGTAGCT GGG 57.33278 278 2375  1 ATAACGAAAAGCATCTAAAC TGG 36.44159 279 2414 -1 CTTGGATTTTGGGACACATA AGG 45.61377 280 2424 -1 ATATGCCAATCTTGGATTTT GGG 20.28758 281 2425 -1 GATATGCCAATCTTGGATTT TGG 27.04467 282 2430  1 TGTGTCCCAAAATCCAAGAT TGG 48.79389 283 2432 -1 TAATTGAGATATGCCAATCT TGG 37.73585 284 2461  1 AATTATAGAGACCTTGATAT AGG 48.98627 285 2461 -1 GATCATTTATTCCTATATCA AGG 43.92608 286 2483 -1 GTGTAATTATTTGGATTCTT GGG 35.25388 287 2484 -1 TGTGTAATTATTTGGATTCT TGG 32.83863 288 2492 -1 CGTGCTTGTGTGTAATTATT TGG 14.08447 289 2510  1 ATTACACACAAGCACGTATT TGG 23.81028 290 2511  1 TTACACACAAGCACGTATTT GGG 22.17912 291 2512  1 TACACACAAGCACGTATTTG GGG 52.47749 292 2527  1 ATTTGGGGTGAGAAGTATTT TGG 23.04503 293 2543  1 ATTTTGGTAAAAATTTTGAC AGG 51.19317 294 2565  1 GCTAGTAAAAGTGAAAACCC TGG 70.67066 295 2571 -1 AAAATTATTGGGATCAACCA GGG 60.21659 296 2572 -1 AAAAATTATTGGGATCAACC AGG 51.83397 297 2582 -1 TCGTTTCTAAAAAAATTATT GGG 23.03526 298 2583 -1 TTCGTTTCTAAAAAAATTAT TGG 16.97799 299 2614 -1 GATGATGCCGTGGAAGAGGT GGG 70.41151 300 2615 -1 TGATGATGCCGTGGAAGAGG TGG 55.81165 301 2618  1 AAAGCATCCCACCTCTTCCA CGG 62.29392 302 2618 -1 TAATGATGATGCCGTGGAAG AGG 53.28713 303 2624 -1 GATCATTAATGATGATGCCG TGG 59.64588 304 1535 -1 TGTCCACCTGCGCAAACAGT AGG 50.51317 824 1555 -1 TGCGCAGGTGGACACTTTGG TGG 53.04254 825

TABLE-US-00003 TABLE 3 gRNA sequences targeted for CsPT Position on SEQ. Specificity Efficiency SEQ. ID. NO.: 7 Strand Sequence PAM Score Score ID NO. 2533  1 CTATAAATAATATAATGTGT TGG 50.15504 52.66784 305 2548 -1 TCATATAATTAAGACACATT AGG 58.08987 39.51504 306 2605 -1 GAAGATTTTACGAGTTCATG TGG 78.97558 61.36868 307 2630 -1 GGTTGTACAATGCAGGAAGC AGG 94.76609 53.10248 308 2637 -1 TATATTGGGTTGTACAATGC AGG 89.85941 51.19467 309 2651 -1 ATCTGATTATATTTTATATT GGG 39.36258 19.27719 310 2652 -1 CATCTGATTATATTTTATAT TGG 30.46803 22.76394 311 2717  1 TTTTGTATGTACCAATAAAG AGG 62.64158 47.70007 312 2717 -1 TGTGTTATTATCCTCTTTAT TGG 59.87869 13.1344 313 2736  1 GAGGATAATAACACAATTAA TGG 53.00849 32.95598 314 2758  1 GTAGTCATTTTGAGTATTAC CGG 65.22014 38.84988 315 2759  1 TAGTCATTTTGAGTATTACC GGG 71.968 55.98069 316 2766 -1 TGCGTTAACAAATTACGACC CGG 95.86365 58.36396 317 2886  1 ATAGATAATTTAATTCAAAA TGG 40.48669 36.67217 318 2895  1 TTAATTCAAAATGGCAAACC TGG 77.80096 45.1845 319 2898  1 ATTCAAAATGGCAAACCTGG AGG 80.97824 62.29508 320 2902 -1 AGCATTTTGGTTAATCCTCC AGG 91.75956 45.33793 321 2915 -1 TTCATGCAATCTTAGCATTT TGG 58.15822 22.94305 322 2962 -1 ATCATTTCTTATTTAATTAC AGG 45.18918 19.61169 323 2988  1 GAAATGATGAGAAGAAATGA TGG 34.5444 57.85824 324 2997  1 AGAAGAAATGATGGCAAACC TGG 78.33764 53.71781 325 3004 -1 TAAGAATTTATTAAAAAACC AGG 51.75369 55.62077 326 3817  1 TATAGATGAGATGAGATACC TGG 85.29248 42.90625 327 3818  1 ATAGATGAGATGAGATACCT GGG 81.64461 53.0755 328 3819  1 TAGATGAGATGAGATACCTG GGG 90.29784 74.15808 329 3824 -1 TGCTGGGATTATCTGGCCCC AGG 99.76501 49.69658 330 3831 -1 CTATACTTGCTGGGATTATC TGG 91.47874 32.32128 331 3840 -1 ATGTGGCTGCTATACTTGCT GGG 78.11018 54.0404 332 3841 -1 TATGTGGCTGCTATACTTGC TGG 89.74351 29.36968 333 3854  1 AGCAAGTATAGCAGCCACAT AGG 88.70643 65.60028 334 3857 -1 AATTGTTCTCCTATCCTATG TGG 83.08341 61.11113 335 3859  1 GTATAGCAGCCACATAGGAT AGG 88.86311 52.55338 336 3880 -1 AACTTGACATTATTTTGTTC TGG 60.92679 30.32567 337 3896  1 ACAAAATAATGTCAAGTTTC TGG 60.06363 20.93761 338 3910 -1 TCAACGTTGGCAAGTAAATA TGG 58.30165 30.24285 339 3923 -1 AAGATTTGGCATATCAACGT TGG 83.63482 54.17247 340 3937 -1 TATATATTTCTTTCAAGATT TGG 43.05887 26.00648 341 3994  1 AATTATTTAAACTAATTATA AGG 27.59395 24.43668 342 4038 -1 AAAGATGCTTCAGACGTTGA AGG 87.29059 53.27521 343 4069 -1 TAAATCAATGGGTGCAGCTT TGG 87.80614 30.65775 344 4080 -1 CTAGCATTTATTAAATCAAT GGG 56.10289 36.01011 345 4081 -1 GCTAGCATTTATTAAATCAA TGG 77.76418 42.71614 346 4095  1 TTGATTTAATAAATGCTAGC AGG 80.47522 49.30411 347 4109  1 GCTAGCAGGAAAGTAAAAGA AGG 82.20668 59.95433 348 4121 -1 ATTTCAATTTGATTATTTTC AGG 42.72452 19.67918 349 4166  1 ATACAATCAAATTAAAATAC AGG 41.34514 46.2972 350 4167  1 TACAATCAAATTAAAATACA GGG 38.73103 56.21882 351 4186  1 AGGGAAATCGTTTATGTTAT TGG 77.90025 22.30105 352 4224 -1 GAAACACGTATTTTAGAGAT TGG 86.63062 41.49631 353 4473 -1 ACCACTTAAGAATTTTCTTT TGG 55.0929 24.80139 354 4483  1 GCCAAAAGAAAATTCTTAAG TGG 64.12831 50.01367 355 4515 -1 CAAGATATACTATATAATAT AGG 44.93458 38.54408 356 4527  1 CTATATTATATAGTATATCT TGG 56.9374 31.81188 357 4528  1 TATATTATATAGTATATCTT GGG 49.01302 47.17769 358 4573 -1 CCTACCATTTGAGTTGAGGT GGG 84.17055 57.97852 359 4574 -1 TCCTACCATTTGAGTTGAGG TGG 72.81109 48.59222 360 4577 -1 TTGTCCTACCATTTGAGTTG AGG 79.45986 49.37752 361 4580  1 ATTACCCACCTCAACTCAAA TGG 78.76399 43.71813 362 4584  1 CCCACCTCAACTCAAATGGT AGG 88.70205 65.11965 363 4603  1 TAGGACAAGAGCTGCTCTGC TGG 96.15743 52.64779 364 4635  1 ATGTGAAATTTGTAATAATA TGG 46.50782 21.55043 365 4636  1 TGTGAAATTTGTAATAATAT GGG 44.42897 39.03579 366 4648 -1 TTTTTTTAATCTGCTTGCAC AGG 81.28024 42.68662 367 4763  1 TACTCTTATAGTAACCAGAG AGG 91.51612 71.60058 368 4766 -1 ATAGTAATTAGTTACCTCTC TGG 88.7712 40.73368 369 4898 -1 TTATATAAAAATATATTCGT TGG 52.69209 44.66746 370 4915  1 AATATATTTTTATATAAATA TGG 25.28327 23.82603 371 4916  1 ATATATTTTTATATAAATAT GGG 20.87203 33.8773 372 4989  1 AATTATCTCATCTAACTAAA TGG 61.01435 39.06579 373 5099  1 TGTTAGTAAAGTAAAATACC AGG 75.01818 60.50068 374 5106 -1 TGCATTTCTTCTCAATTTCC TGG 55.3698 27.57883 375 5121  1 GAAATTGAGAAGAAATGCAG TGG 66.10407 61.792 376 5125  1 TTGAGAAGAAATGCAGTGGA AGG 82.89142 54.57658 377 5146  1 GGATTTTGCTTCCATCTAAA TGG 80.36516 33.72734 378 5146 -1 ATTCTGTTCCACCATTTAGA TGG 81.59639 41.29933 379 5149  1 TTTTGCTTCCATCTAAATGG TGG 73.22228 58.83392 380 5177 -1 TACTGTTTTGGTATTTTTGG TGG 52.22343 46.50211 381 5180 -1 GGCTACTGTTTTGGTATTTT TGG 57.1959 14.32438 382 5189 -1 TATATATTTGGCTACTGTTT TGG 70.57808 21.40652 383 5201 -1 GGTGGACCACTCTATATATT TGG 88.25064 28.7384 384 5206  1 CAGTAGCCAAATATATAGAG TGG 80.8101 56.01321 385 5219 -1 ATAACTATAAAAATGAAGGG TGG 58.67371 66.9197 386 5222 -1 ATAATAACTATAAAAATGAA GGG 32.04873 55.75115 387 5223 -1 GATAATAACTATAAAAATGA AGG 44.11535 43.57819 388 5249 -1 AGCATAATTGTGGCACTGTT TGG 91.98088 35.4872 389 5259 -1 TTGGATTATGAGCATAATTG TGG 56.2773 59.04583 390 5278 -1 AAATATCAGTAAACACAGCT TGG 83.11907 51.55396 391 5301 -1 TGATCTACCACTAGCTTCAG GGG 89.84025 61.37871 392 5302 -1 CTGATCTACCACTAGCTTCA GGG 92.57816 49.17639 393 5303 -1 CCTGATCTACCACTAGCTTC AGG 91.25108 35.18826 394 5305  1 GATATTTCCCCTGAAGCTAG TGG 85.99172 60.18662 395 5314  1 CCTGAAGCTAGTGGTAGATC AGG 92.20769 47.61895 396 5403  1 TACAAAAAATTGTTGTAGCT AGG 60.78952 43.73403 397 5404  1 ACAAAAAATTGTTGTAGCTA GGG 62.02877 48.6504 398 5484 -1 TGTGGGTCATAAATAAAGTT GGG 63.20534 39.71502 399 5485 -1 TTGTGGGTCATAAATAAAGT TGG 76.86574 49.65417 400 5501 -1 ATAACAATTATAATTTTTGT GGG 35.20761 38.75031 401 5502 -1 GATAACAATTATAATTTTTG TGG 40.09979 38.6558 402 5524 -1 TATGCTATTGAACTTCTAGT AGG 73.91656 50.40142 403 5565 -1 TAATTTGAGTTAATAATTTT AGG 35.14236 12.79093 404 5737 -1 TTTACGATCTTCACATTGAC AGG 86.84326 43.60669 405 5760  1 AAGATCGTAAATCTGATTGA TGG 79.39694 53.97011 406 5802 -1 CAAGGCATTCTTTTTTTTGG TGG 78.28594 36.74021 407 5805 -1 GTTCAAGGCATTCTTTTTTT TGG 77.61678 15.8281 408 5820 -1 AAGTTGGTCTCTGATGTTCA AGG 78.39446 48.10956 409 5836 -1 ATAACACAAATTTAATAAGT TGG 49.51096 36.82689 410 5872 -1 GGGAGAGCAGTGGATTGTTT GGG 90.26781 39.34907 411 5873 -1 TGGGAGAGCAGTGGATTGTT TGG 88.36253 32.36556 412 5882 -1 ATTTTGGTATGGGAGAGCAG TGG 94.63991 58.35153 413 5892 -1 ATTTGTTTTAATTTTGGTAT GGG 41.95799 36.82488 414 5893 -1 TATTTGTTTTAATTTTGGTA TGG 44.60475 38.88369 415 5898 -1 ATATATATTTGTTTTAATTT TGG 27.84114 26.40511 416 5979 -1 TTAGATTTGAGAGTTAAATG TGG 55.46527 69.10913 417 5998  1 AACTCTCAAATCTAAATTTT TGG 45.16858 7.464133 418 5999  1 ACTCTCAAATCTAAATTTTT GGG 45.01203 12.96086 419 6000  1 CTCTCAAATCTAAATTTTTG GGG 47.56245 39.64619 420 6033  1 TTAATCTTTTTTGTTATTTA AGG 39.86712 15.52071 421 6036  1 ATCTTTTTTGTTATTTAAGG TGG 61.57787 43.97947 422 9091 -1 ATACTTTCTGTGCAAAAATA TGG 63.71265 24.27214 423 9190 -1 TAGCATTTACTTCATGCGCT TGG 88.85683 40.57145 424 9214  1 GTAAATGCTATGATTGTATA TGG 67.17232 42.70364 425 9238 -1 TAAACTTTGGGAAGGCATGT TGG 82.83401 50.01002 426 9246 -1 TAAAATTTTAAACTTTGGGA AGG 42.81657 55.00889 427 9250 -1 CAACTAAAATTTTAAACTTT GGG 34.37113 28.08549 428 9251 -1 GCAACTAAAATTTTAAACTT TGG 48.74808 29.25676 429 9286  1 ACTGAATGATTATCAGATTC TGG 81.6358 34.3321 430 9289  1 GAATGATTATCAGATTCTGG AGG 77.96775 65.74172 431 9324 -1 AATAATAATAATGTGTTAAC AGG 53.34883 37.14458 432 9379  1 GTTGTGTATTTTTTTCTTTT AGG 44.5762 18.62322 433 9420 -1 TAATATTATATTTAATTAGA GGG 39.10845 36.29759 434 9421 -1 TTAATATTATATTTAATTAG AGG 31.68565 39.80062 435 9510  1 GAGACACACACATACCCTAA TGG 86.59004 50.40612 436 9513 -1 AATCGCAAAAAATTCCATTA GGG 57.75175 49.45903 437 9514 -1 CAATCGCAAAAAATTCCATT AGG 59.61224 37.96305 438 9567  1 GTTTTGTAGATGAAAACTCT TGG 57.02108 52.35675 439 9570  1 TTGTAGATGAAAACTCTTGG TGG 76.57239 57.2048 440 9585  1 CTTGGTGGAGCAATGTTTAG AGG 81.85424 43.12889 441 9586  1 TTGGTGGAGCAATGTTTAGA GGG 81.38342 49.63563 442 9613  1 TTATTGTAAGAGTATTTAAT TGG 42.08458 25.1192 443 9621  1 AGAGTATTTAATTGGTGTTT TGG 28.15366 29.48476 444 9622  1 GAGTATTTAATTGGTGTTTT GGG 59.62235 18.36114 445 9623  1 AGTATTTAATTGGTGTTTTG GGG 51.98403 49.93003 446 9642  1 GGGGTGTCGATATAATAATG AGG 74.06144 54.09539 447 9648  1 TCGATATAATAATGAGGTTT TGG 66.02342 29.35407 448 9649  1 CGATATAATAATGAGGTTTT GGG 54.71808 18.42158 449 9664  1 GTTTTGGGATTATTATTGTG AGG 54.73719 60.27909 450 9680  1 TGTGAGGATTTAATAAAGTA TGG 62.9832 45.48923 451 9702  1 GTAATTAGTTTGAAATGAAA AGG 42.78812 38.59876 452 9731 -1 CAATCAATAATAATCTTCAT GGG 51.22321 46.33554 453 9732 -1 TCAATCAATAATAATCTTCA TGG 52.54212 42.7126 454 9765  1 AATATTAAAAAGAAAAAATG AGG 32.91192 50.40054 455 9766  1 ATATTAAAAAGAAAAAATGA GGG 31.58425 59.29349 456 9775  1 AGAAAAAATGAGGGAAAGAA AGG 37.46114 45.55358 457 9776  1 GAAAAAATGAGGGAAAGAAA GGG 19.94773 54.89242 458

TABLE-US-00004 TABLE 4 gRNA sequences targeted for CsOLS Position on SEQ. ID. Specificity Efficiency SEQ. NO.: 10 Strand Sequence PAM Score Score ID NO.  606  1 CATACATAATATATATATAT AGG 38.80015 37.5899 459  694  1 TATGAATCATCTTCGTGCTG AGG 92.51688 55.65201 460  695  1 ATGAATCATCTTCGTGCTGA GGG 92.26269 55.16668 461  700  1 TCATCTTCGTGCTGAGGGTC CGG 97.38454 45.93456 462  708 -1 CCGATGGCGAGAACGGAGGC CGG 99.23283 53.34917 463  712 -1 GGTGCCGATGGCGAGAACGG AGG 99.09248 64.53414 464  715 -1 GGCGGTGCCGATGGCGAGAA CGG 98.67263 50.70203 465  719  1 CCGGCCTCCGTTCTCGCCAT CGG 99.67834 47.54908 466  724 -1 CTCCGGATTGGCGGTGCCGA TGG 99.54478 39.05761 467  733  1 CGCCATCGGCACCGCCAATC CGG 99.93027 36.80185 468  733 -1 TAAAATGTTCTCCGGATTGG CGG 90.17454 51.19588 469  736 -1 TATTAAAATGTTCTCCGGAT TGG 88.80068 45.44233 470  741 -1 TCTTGTATTAAAATGTTCTC CGG 73.04651 45.0436 471  771 -1 GTGACCCGAAAGTAGTAGTC AGG 96.00665 45.73853 472  777  1 AGTTTCCTGACTACTACTTT CGG 89.23006 34.52546 473  778  1 GTTTCCTGACTACTACTTTC GGG 92.15777 29.58151 474  793 -1 TTGAGTCATGTGTTCACTTT TGG 73.05001 32.95869 475  876 -1 CATGGAAAAGTATTATTAGT TGG 56.37872 42.87624 476  894 -1 AAATAGATAATGCTTATACA TGG 65.92159 54.09676 477  917  1 ATTATCTATTTATATAATAA AGG 38.73228 37.78037 478 1000  1 CTTACTTTATATGTATATGT AGG 48.96629 45.21245 479 1019  1 TAGGTGACAAAAGTATGATA AGG 63.42832 45.85195 480 1071  1 TCTAAAGCAAAACCCAAGAT TGG 65.43717 53.59795 481 1072 -1 TCTCGTGCTCCGCCAATCTT GGG 95.9415 42.77202 482 1073 -1 ATCTCGTGCTCCGCCAATCT TGG 97.96263 28.38723 483 1074  1 AAAGCAAAACCCAAGATTGG CGG 51.53179 58.86478 484 1095  1 GGAGCACGAGATGCAAACTC TGG 94.77341 54.21811 485 1116  1 GGATGCACGTCAAGACATGT TGG 94.27103 64.06157 486 1125  1 TCAAGACATGTTGGTAGTTG AGG 77.53627 54.5857 487 1138  1 GTAGTTGAGGTTCCAAAACT TGG 70.93462 44.35067 488 1139  1 TAGTTGAGGTTCCAAAACTT GGG 68.9903 55.5133 489 1139 -1 CAAGCATCCTTCCCAAGTTT TGG 89.31912 22.9458 490 1143  1 TGAGGTTCCAAAACTTGGGA AGG 81.7532 56.98226 491 1158  1 TGGGAAGGATGCTTGTGCAA AGG 86.76519 63.49574 492 1170 -1 GGGTTGACCCCATTCTTTGA TGG 82.91197 29.12733 493 1172  1 GTGCAAAGGCCATCAAAGAA TGG 72.44945 46.30634 494 1173  1 TGCAAAGGCCATCAAAGAAT GGG 70.64931 38.21922 495 1174  1 GCAAAGGCCATCAAAGAATG GGG 78.23762 71.1964 496 1190 -1 AAATGAGTGATTTTAGACTT GGG 54.17939 50.10922 497 1191 -1 TAAATGAGTGATTTTAGACT TGG 64.67096 46.53421 498 1233 -1 GTCTGCACCGGGCATGTCAG TGG 97.80392 53.96746 499 1237  1 GCATCAACCACTGACATGCC CGG 92.69975 59.55302 500 1244 -1 GCGCAATGGTAGTCTGCACC GGG 99.19901 57.07458 501 1245 -1 AGCGCAATGGTAGTCTGCAC CGG 98.52043 48.84276 502 1258 -1 GTCCGAGAAGCTTAGCGCAA TGG 94.35214 55.9059 503 1267  1 TACCATTGCGCTAAGCTTCT CGG 91.29961 37.63117 504 1286 -1 ATCATCACACGCTTCACTGA GGG 89.91737 65.13509 505 1287 -1 CATCATCACACGCTTCACTG AGG 96.68067 65.997 506 1309  1 CGTGTGATGATGTATCAACT AGG 84.90515 64.72637 507 1318  1 ATGTATCAACTAGGCTGTTA TGG 89.65638 40.36473 508 1321  1 TATCAACTAGGCTGTTATGG TGG 89.40848 68.01826 509

TABLE-US-00005 TABLE 5 gRNA sequences targeted for CsAAE1 Position on SEQ. ID. Specificity Efficiency SEQ. NO.: 13 Strand Sequence PAM Score Score ID No.  1017  1 ATTCAAAGTGAGAAAATTGT TGG  46.82883 42.08966 510  1036 -1 AACCAACAAGATCATGAGAA GGG  65.50328 65.57937 511  1037 -1 CAACCAACAAGATCATGAGA AGG  69.62583 61.96231 512  1045  1 AACCCTTCTCATGATCTTGT TGG  26.15799 41.67638 513  1058  1 ATCTTGTTGGTTGCTGTTCT CGG  83.86054 29.09087 514  1073  1 GTTCTCGGAAGTGATGAAAG AGG  79.35978 74.00854 515  1099 -1 TGTTTGGTTAATTATTAAAT AGG  33.15963 19.05195 516  1115 -1 ACTAATTCTAATTTGGTGTT TGG  59.84418 32.05943 517  1122 -1 ATTGTATACTAATTCTAATT TGG  54.12193 21.41009 518  1157  1 ATAAGATCATCATCATAGTG TGG  66.94162 60.62696 519  1168  1 ATCATAGTGTGGAAGTGTAT AGG  73.55537 49.07951 520  1213 -1 TTTTTAGTCTTGACTCTCAA GGG  77.37359 51.59533 521  1214 -1 ATTTTTAGTCTTGACTCTCA AGG  74.23792 43.89766 522  1259  1 AAAGTTAATAATGATGAAAT TGG  35.52392 37.97787 523  1274  1 GAAATTGGTACCTTGAACAG AGG  81.08644 61.31573 524  1305 -1 TTGAGGTTATCTTTCAACTT GGG  64.77667 37.47441 525  1306 -1 ATTGAGGTTATCTTTCAACT TGG  77.67685 49.4408 526  1322 -1 CAATTGACTTAAATCAATTG AGG  58.54721 51.56257 527  1382  1 AAGAAAATTACTAATTGCTC AGG  70.79317 49.81138 528  1395 -1 GGGGTGCCACCTTTGGGCGG TGG  98.94197 45.7826 529  1397  1 TGCTCAGGTCCACCGCCCAA AGG  99.42523 59.45534 530  1398 -1 ATTGGGGTGCCACCTTTGGG CGG  95.01333 60.80505 531  1400  1 TCAGGTCCACCGCCCAAAGG TGG  97.56412 60.82488 532  1401 -1 GCTATTGGGGTGCCACCTTT GGG  95.35281 30.579 533  1402 -1 TGCTATTGGGGTGCCACCTT TGG  97.59112 22.5998 534  1414 -1 TTTCGAGACAACTGCTATTG GGG  95.02736 53.10779 535  1415 -1 TTTTCGAGACAACTGCTATT GGG  91.01659 36.67599 536  1416 -1 GTTTTCGAGACAACTGCTAT TGG  93.27798 46.45164 537  1555 -1 GTTACTTTTGATAATTTGAT AGG  45.16312 42.37079 538  7139 -1 AATGAATATTGGAGGCATCA AGG  69.38955 59.92139 539  7147 -1 GATGATACAATGAATATTGG AGG  65.15451 59.16492 540  7150 -1 GCAGATGATACAATGAATAT TGG  70.32188 47.43563 541  7177 -1 AATGGTTATTATCATGCACA TGG  69.87898 60.70248 542  7195 -1 ATTTTTGAGCTTACATCTAA TGG  68.8764 35.50075 543  7220 -1 AGAGGTTTTAAGGAGGCATG GGG  90.60318 66.45911 544  7221 -1 GAGAGGTTTTAAGGAGGCAT GGG  82.79088 50.05129 545  7222 -1 GGAGAGGTTTTAAGGAGGCA TGG  80.93082 48.72577 546  7227 -1 TGAATGGAGAGGTTTTAAGG AGG  74.09145 69.25707 547  7230 -1 CATTGAATGGAGAGGTTTTA AGG  69.65457 16.77595 548  7238 -1 AATGCCTACATTGAATGGAG AGG  85.66528 65.63677 549  7243 -1 AAGGGAATGCCTACATTGAA TGG  89.92094 39.76854 550  7245  1 AAAACCTCTCCATTCAATGT AGG  79.28148 56.68625 551  7261 -1 CACCATGATGTTTATTTTAA GGG  58.97317  9.801739 552  7262 -1 TCACCATGATGTTTATTTTA AGG  58.8467 15.41337 553  7270  1 TTCCCTTAAAATAAACATCA TGG  61.84936 57.29224 554  7288 -1 GCATCGAAGACTCTGTTGAA TGG  91.56656 52.95186 555  7312 -1 GCGCTCGGTCCAGTCATGTT TGG  94.43272 39.68016 556  7314  1 TTCGATGCTCCAAACATGAC TGG  86.8283 47.62248 557  7327 -1 GGAATTGGTGAATTAGCGCT CGG  96.74799 68.37405 558  7341  1 AGCGCTAATTCACCAATTCC TGG  93.7153 36.16436 559  7342 -1 CCTAAAAACAAACCAGGAAT TGG  86.34378 41.08083 560  7348 -1 ATGCAGCCTAAAAACAAACC AGG  90.91529 63.74234 561  7353  1 CCAATTCCTGGTTTGTTTTT AGG  66.41673  7.967407 562  7417  1 AAATGTAACATAATTTTATA TGG  30.24509 21.5658 563  7418  1 AATGTAACATAATTTTATAT GGG  36.43879 34.67268 564  7461 -1 ACTTTTCAAATAAGATTTGA TGG  49.31759 24.4411 565  7489 -1 AAAATATAATTTAAAAATAT TGG  23.50641 25.15222 566  7523  1 ATAAGTTTATTAATTACCAT TGG  43.96007 52.6669 567  7528 -1 TGACAACAATGGTTATCCAA TGG  81.46885 63.06849 568  7539 -1 TTATACATACTTGACAACAA TGG  72.70705 49.88993 569  7569 -1 TCATTTAGTTCACAATGTAT GGG  69.87154 43.07873 570  7570 -1 TTCATTTAGTTCACAATGTA TGG  64.11188 34.27846 571  7620 -1 ATTGGTGGTGCATTTTCTGC TGG  75.70066 41.54012 572  7635 -1 TGTGGTGGCACAGAAATTGG TGG  86.97385 62.37008 573  7638 -1 ATGTGTGGTGGCACAGAAAT TGG  91.18051 35.67967 574  7650 -1 CCTGTTATCGAAATGTGTGG TGG  86.4401 69.73002 575  7653 -1 AAGCCTGTTATCGAAATGTG TGG  86.07817 69.79364 576  7661  1 CCACCACACATTTCGATAAC AGG  91.98911 34.09153 577  7688 -1 ATGAATACCTATGGTTGATG GGG  79.66939 61.20548 578  7689 -1 GATGAATACCTATGGTTGAT GGG  77.02024 47.22441 579  7690 -1 AGATGAATACCTATGGTTGA TGG  76.43674 51.54312 580  7692  1 TTGCTCTCCCCATCAACCAT AGG  89.17718 57.68331 581  7697 -1 CTAATGTAGATGAATACCTA TGG  79.03258 52.66036 582  7726  1 ATTAGATGCTTCACCAGAAG AGG  76.7559 48.05163 583  7728 -1 TGTAGTTGCTTTTCCTCTTC TGG  70.77754 18.10598 584  7745  1 GAGGAAAAGCAACTACAAGA AGG  77.08372 61.08762 585  7746  1 AGGAAAAGCAACTACAAGAA GGG  59.40687 56.12144 586  7780 -1 ATTATATTAAACGTATTATA TGG  58.83333 26.89437 587  7828  1 TGTGCATAGATAAGAAATAT TGG  49.90268 36.74205 588  7853  1 AATATATTATAATTCTTTAC CGG  49.5763 28.18052 589  7857  1 TATTATAATTCTTTACCGGA TGG  78.22362 52.20352 590  7860  1 TATAATTCTTTACCGGATGG TGG  93.78137 54.29303 591  7861 -1 GCTATGATTGGTCCACCATC CGG  82.3879 55.49635 592  7873 -1 ATTGTGTTAGTGGCTATGAT TGG  85.22929 56.76141 593  7883 -1 AAAAGTAGCAATTGTGTTAG TGG  71.54968 45.76116 594  7906 -1 TCCCTAGCATTGTTCGATCA TGG  95.58084 52.55436 595  7915  1 TTCCATGATCGAACAATGCT AGG  89.83435 51.35939 596  7916  1 TCCATGATCGAACAATGCTA GGG  83.34292 59.40933 597  7929 -1 TAAAGTAACAATGCTAGGTG TGG  86.0951 63.10284 598  7934 -1 GATGCTAAAGTAACAATGCT AGG  68.92833 59.04437 599  7956 -1 ATGTTTTCTAATATGTGTGT AGG  35.74139 53.28168 600  8037 -1 AATAAAAAACATGATAAGTT CGG  49.74918 45.14228 601  8086  1 AATAAAAATGATGTGATTAT TGG  45.03911 43.8586 602  8114 -1 ATGTCTAATTCATTATAGAA GGG  64.65734 51.67938 603  8115 -1 AATGTCTAATTCATTATAGA AGG  55.7369 45.68541 604  8199  1 CTAAAAAGTTTATTAGTTAA TGG  50.73953 27.333 605  8223 -1 TAGCTTCGCCAAATTTGTGC AGG  88.30821 49.16688 606  8226  1 TTAGTTTACCTGCACAAATT TGG  74.90104 37.25004 607  8245  1 TTGGCGAAGCTAGAAACAAG TGG  82.9657 68.53364 608  8261 -1 GCTTCTCTTGCCTTGTATAA TGG  81.45785 36.91329 609  8262  1 AAGTGGTGATCCATTATACA AGG  80.45179 62.09832 610  8282  1 AGGCAAGAGAAGCCCCATTA AGG  93.10259 42.00278 611  8283 -1 CTATGCTTCACTCCTTAATG GGG  92.90881 51.33474 612  8284 -1 TCTATGCTTCACTCCTTAAT GGG  80.41893 33.5345 613  8285 -1 GTCTATGCTTCACTCCTTAA TGG  92.13485 27.46679 614  8305  1 AGTGAAGCATAGACCAGCCA AGG  93.2408 55.91368 615  8307 -1 TTGGATGATGGGTCCTTGGC TGG  89.87415 37.38458 616  8311 -1 TTGGTTGGATGATGGGTCCT TGG  90.64716 46.50603 617  8318 -1 ACTAATCTTGGTTGGATGAT GGG  55.88848 43.22222 618  8319 -1 CACTAATCTTGGTTGGATGA TGG  64.35474 40.68855 619  8326 -1 TTTGGCCCACTAATCTTGGT TGG  63.95374 49.8337 620  8330 -1 ATTGTTTGGCCCACTAATCT TGG  83.91578 42.92642 621  8331  1 CATCATCCAACCAAGATTAG TGG  45.46742 53.20986 622  8332  1 ATCATCCAACCAAGATTAGT GGG  44.6141 53.44581 623  8344 -1 GGAAAGGTGATGTCATTGTT TGG  78.65278 38.65702 624  8360 -1 AGCCATTTGGACATTAGGAA AGG  84.2141 58.69325 625  8365 -1 GGTGGAGCCATTTGGACATT AGG  86.64479 40.00615 626  8369  1 CACCTTTCCTAATGTCCAAA TGG  75.0476 45.46945 627  8373 -1 TGCAGATGGGTGGAGCCATT TGG  93.51908 44.95053 628  8383 -1 TAAAAGCAGCTGCAGATGGG TGG  93.4923 62.38047 629  8386 -1 CTTTAAAAGCAGCTGCAGAT GGG  88.26499 50.81653 630  8387 -1 CCTTTAAAAGCAGCTGCAGA TGG  86.2835 54.0118 631  8398  1 CCATCTGCAGCTGCTTTTAA AGG  87.21073 15.05639 632  8408  1 CTGCTTTTAAAGGAGTTGCT TGG  88.7393 43.96243 633  8409  1 TGCTTTTAAAGGAGTTGCTT GGG  70.87059 39.59579 634  8416  1 AAAGGAGTTGCTTGGGTCCA TGG  92.13848 46.59847 635  8422 -1 GGGAGCCAAAGGCAATTCCA TGG  82.72992 60.08041 636  8428  1 TGGGTCCATGGAATTGCCTT TGG  83.84223 36.75466 637  8433 -1 TTTTGGTATAGGGGAGCCAA AGG  62.72308 58.65204 638  8442 -1 ACAATATTGTTTTGGTATAG GGG  70.04203 44.96968 639  8443 -1 GACAATATTGTTTTGGTATA GGG  65.06063 24.34171 640  8444 -1 AGACAATATTGTTTTGGTAT AGG  60.62704 36.77509 641  8450 -1 GATGGAAGACAATATTGTTT TGG  49.88722 31.0149 642  8468 -1 ATCAATCTAAACACTTTTGA TGG  65.25066 22.9316 643  8497  1 TTGATGAACAAAACTAATTA AGG  60.26021 31.42456 644  8506  1 AAAACTAATTAAGGATATTA AGG  28.77328 23.99012 645  8507  1 AAACTAATTAAGGATATTAA GGG  47.82816 35.89387 646  8508  1 AACTAATTAAGGATATTAAG GGG  56.45894 52.91201 647  8509  1 ACTAATTAAGGATATTAAGG GGG  66.78309 63.26044 648  8529  1 GGGCTCATGAGATTTTTTAA CGG  72.44404 35.38053 649  8573 -1 ATTCAGTAAATAATGATGCT TGG  74.0009 56.25971 650  8598 -1 TTTTAAGAGCGCAAACTAAA AGG  69.75899 34.44909 651  8648  1 GTTTTGTTTAAAGATAATAG CGG  63.36248 63.28955 652  8649  1 TTTTGTTTAAAGATAATAGC GGG  66.03681 52.89056 653  8681  1 TCAAAATTTTATATTGTAAG CGG  40.99317 51.22546 654  8758 -1 AGACAATAAGAGAGTTTATA CGG  63.10426 33.70903 655  8777  1 ACTCTCTTATTGTCTTAAAC AGG  82.59379 27.0699 656  8778  1 CTCTCTTATTGTCTTAAACA GGG  76.21161 46.02143 657  8779  1 TCTCTTATTGTCTTAAACAG GGG  81.69869 60.34407 658  8801 -1 GATTTAATGATCAAGAATTT AGG  52.45697 36.47312 659  8853 -1 GAATTTATTAAAATAGCATT TGG  58.39351 33.17128 660  8873  1 ATTTTAATAAATTCAAAACA TGG  42.10593 49.13089 661  8876  1 TTAATAAATTCAAAACATGG CGG  51.71372 68.38405 662  8879  1 ATAAATTCAAAACATGGCGG TGG  87.21197 46.77449 663  8900 -1 CTCTTCTCATCTGGAACAAC AGG  83.95127 38.49164 664  8909 -1 ACAAACATCCTCTTCTCATC TGG  82.47663 39.35798 665  8912  1 CTGTTGTTCCAGATGAGAAG AGG  82.81433 53.17806 666  8925  1 TGAGAAGAGGATGTTTGTAT AGG  75.94583 50.65718 667  8934  1 GATGTTTGTATAGGCATCAA CGG  83.23553 48.99018 668  8935  1 ATGTTTGTATAGGCATCAAC GGG  71.89291 50.59686 669  8970  1 AGTAAATTCACAATTTCTGC AGG  72.90705 51.93162 670  8984 -1 GGGACTAATATCTTCTTGAG TGG  81.64895 66.64607 671  9004 -1 AAAATAATAAGCATATATGT GGG  46.06348 54.81391 672  9005 -1 CAAAATAATAAGCATATATG TGG  50.75457 48.01509 673  9017  1 CACATATATGCTTATTATTT TGG  49.76422  8.576781 674  9121 -1 TTTTTAATTAAAAGTAACAC AGG  60.1073 53.94147 675  9187 -1 TTAATTTAGGAGTTATTTTG GGG  44.33331 53.49833 676  9188 -1 ATTAATTTAGGAGTTATTTT GGG  41.75312 20.1865 677  9189 -1 TATTAATTTAGGAGTTATTT TGG  46.05579  9.863159 678  9200 -1 AAGTTGGGCATTATTAATTT AGG  64.26833 29.09929 679  9215 -1 ATCAGGGGTTTTATCAAGTT GGG  73.93607 33.45243 680  9216 -1 TATCAGGGGTTTTATCAAGT TGG  84.29187 44.06854 681  9230 -1 ATCACGTTTCTTATTATCAG GGG  80.66179 58.62752 682  9231 -1 TATCACGTTTCTTATTATCA GGG  82.42224 47.4101 683  9232 -1 GTATCACGTTTCTTATTATC AGG  58.04329 29.70134 684  9261 -1 AAAATACATGTGAATGTTAG TGG  69.1364 51.00635 685  9289  1 TATTTTAGTTCAAACTCCAA TGG  60.62746 52.04271 686  9294 -1 ATATGAACATTTGGATCCAT TGG  46.78738 41.8429 687  9303 -1 TATCTATATATATGAACATT TGG  54.10978 35.78905 688  9338 -1 GTGGAATATATAAACAGTAG AGG  80.1669 56.2241 689  9357 -1 AATTCGTATAGAGATTAATG TGG  73.95175 62.50764 690  9459 -1 GCGTGATGGCGATATTTCTT GGG  86.54713 37.70124 691  9460 -1 TGCGTGATGGCGATATTTCT TGG  91.24965 32.52202 692  9473 -1 ATTGGTGCAGAATTGCGTGA TGG  89.64882 66.39713 693  9491 -1 CCTTGTAGTGGCTCTAATAT TGG  83.67391 26.74643 694  9502  1 CCAATATTAGAGCCACTACA AGG  88.94997 62.54443 695  9503 -1 GCCATTGTTATTCCTTGTAG TGG  86.75924 41.11451 696  9513  1 GCCACTACAAGGAATAACAA TGG  78.65214 62.36806 697  9519  1 ACAAGGAATAACAATGGCCA TGG  84.70821 54.69464 698  9520  1 CAAGGAATAACAATGGCCAT GGG  88.76204 62.99032 699  9525 -1 TGTGGAAGCCAAGTCTCCCA TGG  96.83523 60.94207 700  9528  1 AACAATGGCCATGGGAGACT TGG  91.04348 37.2658 701  9543 -1 TAAATTGTGCAGTAGAGTTG TGG  74.79858 59.21973 702  9574  1 TTAACTCTTTTTTTGTGAGA TGG  67.00048 39.91071 703  9617  1 ATAATTTATTATTATTTGTC AGG  34.22417 35.90263 704 13019  1 TGCTAGTACATGTCTATATA AGG  51.98406 29.87248 705 13060 -1 AGCAAAAGCCATTTTTACAC AGG  81.1356 53.00551 706 13063  1 TATATATACCTGTGTAAAAA TGG  60.80392 35.0674 707 13103  1 CGAAGTCTTGTTGATATTTC AGG  57.63384 20.64668 708 13152 -1 TATCTAGCTATTGTTCTTGC GGG  77.9103 33.48401 709 13153 -1 CTATCTAGCTATTGTTCTTG CGG  74.55985 43.94593 710 13180 -1 GCCAATGCATGTGGATGCTG TGG  92.72347 60.88652 711 13189 -1 AATTGATATGCCAATGCATG TGG  77.53646 64.53936 712 13190  1 ACCACAGCATCCACATGCAT TGG  81.43998 59.13625 713 13224 -1 GAAGAAATGGGTTTGGAGAA GGG  49.22523 49.88879 714 13225 -1 TGAAGAAATGGGTTTGGAGA AGG  69.09616 48.87133 715 13231 -1 TGCACTTGAAGAAATGGGTT TGG  71.57783 32.7508 716 13236 -1 GGTTATGCACTTGAAGAAAT GGG  58.12192 38.87319 717 13237 -1 TGGTTATGCACTTGAAGAAA TGG  67.04056 33.35969 718 13257 -1 TAATTAATTTGATGGTTAGT TGG  56.6831 44.59873 719 13265 -1 ATGTATGGTAATTAATTTGA TGG  46.32665 36.88262 720 13280 -1 TTGGATATTGAAACTATGTA TGG  64.43349 55.56421 721 13299 -1 TTAATATGATATGGTTTATT TGG  51.05981 16.59851 722 13308 -1 TTCATAAAGTTAATATGATA TGG  45.86946 38.61687 723 13386 -1 ACCAATTGCGTAAACGTGTT GGG  92.64873 38.15694 724 13387 -1 GACCAATTGCGTAAACGTGT TGG  94.58325 51.95048 725 13396  1 ACCCAACACGTTTACGCAAT TGG  94.35879 35.38154 726 13419  1 TCAAGTGTCAATTTGTTTAG AGG  60.27782 38.1724 727 13444 -1 ATGATTGTATGGCGTGATGA AGG  93.06641 56.01275 728 13455 -1 TGAATGATACAATGATTGTA TGG  65.25489 43.79748 729 13524  1 GCTGAGTTAAGATAACCTCC TGG  95.01444 53.02965 730 13528 -1 GGTAGTGAATGGCTTCCAGG AGG  97.82923 69.29733 731 13531 -1 GGGGGTAGTGAATGGCTTCC AGG  97.10675 35.56817 732 13539 -1 ATAATCCAGGGGGTAGTGAA TGG  91.39645 59.2292 733 13545  1 GGAAGCCATTCACTACCCCC TGG  99.45732 52.97305 734 13549 -1 GATGATATTAATAATCCAGG GGG  87.72204 72.36028 735 13550 -1 TGATGATATTAATAATCCAG GGG  70.74045 64.58516 736 13551 -1 ATGATGATATTAATAATCCA GGG  56.34847 64.43657 737 13552 -1 GATGATGATATTAATAATCC AGG  64.68399 47.30268 738 13584  1 TCTCTACGCAATATACATTC TGG  85.48205 37.55777 739 13598 -1 GATGAAGATAAGTTTTTCAA AGG  34.9946 46.22336 740 13625 -1 GTATTGGAGAACATTACTAA TGG  81.61714 54.192 741 13641 -1 TTATATAATGTTAGGTGTAT TGG  50.0441 37.07111 742 13649 -1 GGTTAATATTATATAATGTT AGG  46.14634 41.29752 743 13670 -1 TGTTAATTATTTGTAATTAA TGG  30.06382 19.30784 744 13699 -1 TTTATTATTTTATTTGAGGG TGG  56.87973 54.11921 745 13702 -1 CTATTTATTATTTTATTTGA GGG  22.86306 26.95378 746 13703 -1 ACTATTTATTATTTTATTTG AGG  24.37755 35.02855 747 13732  1 ATAGTTATTATTATTACCTC AGG  69.1903 42.38884 748 13733  1 TAGTTATTATTATTACCTCA GGG  66.22878 58.43041 749 13737 -1 ATTTTCTGTAAGAAACCCTG AGG  86.29961 70.70242 750 13754  1 GGTTTCTTACAGAAAATTCT TGG  66.82242 29.73772 751 13776  1 GAAATGAGAAAAGCTTGAAA TGG  53.70676 37.62262 752 13777  1 AAATGAGAAAAGCTTGAAAT GGG  61.18077 43.36214 753 13791 -1 GTTTTTGGGAGTCAAGTATA AGG  79.38507 47.93209 754 13805 -1 AAGCGAGGAAAAGAGTTTTT GGG  66.05009 27.99152 755 13806 -1 GAAGCGAGGAAAAGAGTTTT TGG  65.56542 30.89956 756 13820 -1 GGCGCACTTTTGGAGAAGCG AGG  98.3174 63.90309 757 13830 -1 CACCAATATGGGCGCACTTT TGG  96.32144 22.47601 758 13839  1 CTCCAAAAGTGCGCCCATAT TGG  94.31583 41.35959 759 13841 -1 AAAGTAAAGTCCACCAATAT GGG  68.75283 36.52054 760 13842  1 CAAAAGTGCGCCCATATTGG TGG  97.30856 48.92306 761 13842 -1 GAAAGTAAAGTCCACCAATA TGG  84.33286 38.41171 762 13866 -1 TTTTCTTTTATTATGATTCA GGG  39.04863 43.80485 763 13867 -1 TTTTTCTTTTATTATGATTC AGG  29.8602 27.80478 764 15978  1 GAAAAAATATATATATAGTA AGG  36.13766 41.8761 765 15995  1 GTAAGGAAAGAGAGAGATTA CGG  54.88255 36.8303 766 15996  1 TAAGGAAAGAGAGAGATTAC GGG  57.53794 51.49059 767 16000  1 GAAAGAGAGAGATTACGGGT CGG  86.61929 64.70693 768 16001  1 AAAGAGAGAGATTACGGGTC GGG  93.1411 48.83463 769 16013  1 TACGGGTCGGGTATCCATGC AGG  98.86045 52.97598 770 16016  1 GGGTCGGGTATCCATGCAGG AGG  97.58735 53.65399 771 16016 -1 TTGGACCCGCCCCTCCTGCA TGG  96.38923 49.42741 772 16017  1 GGTCGGGTATCCATGCAGGA GGG  99.45455 58.97398 773 16018  1 GTCGGGTATCCATGCAGGAG GGG  98.23654 50.30444 774 16021  1 GGGTATCCATGCAGGAGGGG CGG  94.19216 43.31877 775 16022  1 GGTATCCATGCAGGAGGGGC GGG  98.70541 48.06551 776 16035 -1 TATGGTTGCTATAAAGACTT TGG  72.61024 46.52942 777 16053 -1 CTGCACCAGATGCTCTACTA TGG  93.10997 49.44754 778 16059  1 AGCAACCATAGTAGAGCATC TGG  93.28253 48.85983 779 16065  1 CATAGTAGAGCATCTGGTGC AGG  93.11563 41.82045 780 16066  1 ATAGTAGAGCATCTGGTGCA GGG  83.82199 65.30317 781 16072  1 GAGCATCTGGTGCAGGGAGA AGG  95.16992 42.4774 782 16073  1 AGCATCTGGTGCAGGGAGAA GGG  92.19717 45.18153 783 16074  1 GCATCTGGTGCAGGGAGAAG GGG  81.91369 46.14286 784 16077  1 TCTGGTGCAGGGAGAAGGGG AGG  92.48414 60.72469 785 16082  1 TGCAGGGAGAAGGGGAGGTC AGG  93.10184 46.08437 786 16095  1 GGAGGTCAGGCGAGAGAATA TGG  93.54221 39.68623 787 16099  1 GTCAGGCGAGAGAATATGGT TGG  92.48836 56.48815 788 16119  1 TGGCAATATTGATCCATGTT TGG  82.02049 32.56259 789 16120  1 GGCAATATTGATCCATGTTT GGG  77.55255 27.19259 790 16121  1 GCAATATTGATCCATGTTTG GGG  74.7566 63.12063 791 16121 -1 GCGCTGCCACTCCCCAAACA TGG  96.37777 52.90008 792 16126  1 ATTGATCCATGTTTGGGGAG TGG  87.10662 48.37676 793 16143 -1 GCCGAGATCGTGTGTAATTA TGG  97.83461 28.59523 794 16153  1 GCCATAATTACACACGATCT CGG  96.59886 55.77195 795 16165 -1 TGAGACACTCCATGGTAGAC TGG  91.79216 52.52207 796 16167  1 CGATCTCGGCCAGTCTACCA TGG 100 52.39825 797 16173 -1 GAAGTTGCTGAGACACTCCA TGG  95.9579 67.21232 798 16187  1 TGGAGTGTCTCAGCAACTTC AGG  90.0358 32.39625 799 16188  1 GGAGTGTCTCAGCAACTTCA GGG  93.36081 51.14577 800 16189  1 GAGTGTCTCAGCAACTTCAG GGG  89.51798 72.6193 801 16200  1 CAACTTCAGGGGTGATACCT AGG  97.10935 43.25481 802 16201  1 AACTTCAGGGGTGATACCTA GGG  90.00002 51.96256 803 16206 -1 GCCTCTGACTTCATAGCCCT AGG  93.23889 55.05182 804 16216  1 ACCTAGGGCTATGAAGTCAG AGG  96.23264 65.86427 805 16228 -1 CAAGTCCCTGGACTCTGTTG TGG  96.47011 52.94814 806 16233  1 CAGAGGCCACAACAGAGTCC AGG  98.55521 53.21894 807 16234  1 AGAGGCCACAACAGAGTCCA GGG  94.01286 58.98263 808 16240 -1 GGGTAAGAATTACAAGTCCC TGG  90.97415 50.38745 809 16260 -1 AGTTTAATAGAAGTAATAAT GGG  46.88021 37.37628 810 16261 -1 CAGTTTAATAGAAGTAATAA TGG  62.668 33.52716 811 16332  1 AATATTATATATATTTATAT TGG  27.51617 28.97861 812 16339  1 TATATATTTATATTGGATTT TGG  45.60089 18.21184 813 16340  1 ATATATTTATATTGGATTTT GGG  41.67556 15.57417 814 16344  1 ATTTATATTGGATTTTGGGA TGG  54.07712 37.86541 815 16345  1 TTTATATTGGATTTTGGGAT GGG  52.6776 44.14789 816 16398  1 ATCAAAGACTTGCTCAATAA TGG  65.21274 25.05297 817 16404  1 GACTTGCTCAATAATGGATT AGG  79.79469 45.48502 818 16408  1 TGCTCAATAATGGATTAGGC TGG  82.83171 48.09015 819 16415  1 TAATGGATTAGGCTGGAATT TGG  87.54181 34.74462 820 16420  1 GATTAGGCTGGAATTTGGTT TGG  73.47545 37.68495 821 16421  1 ATTAGGCTGGAATTTGGTTT GGG  61.27861 39.60131 822 16447 -1 TCAAAGGCAACACAAGTGAT AGG  89.10229 58.40638 823  1273 -1 GAAACTAAATCCTCTGTTCA AGG  90.64196 43.40519 826

[0308] Reference is made to Table 6 presenting a summary of the sequences within the scope of the current invention.

TABLE-US-00006 TABLE 6 Summary of sequences within the scope of the present invention Sequence type CsTHCAS CsCBDAS CsPT CsOLS CsAAE1 Genomic SEQ ID NO: 1 SEQ ID NO: 4 SEQ ID NO: 7 SEQ ID NO: 10 SEQ ID NO: 13 sequence Coding sequence SEQ ID NO: 2 SEQ ID NO: 5 SEQ ID NO: 8 SEQ ID NO: 11 SEQ ID NO: 14 (CDS) Amino acid SEQ ID NO: 3 SEQ ID NO: 6 SEQ ID NO: 9 SEQ ID NO: 12 SEQ ID NO: 15 sequence gRNA sequence SEQ ID NO: 16- SEQ ID NO: 168-304 & SEQ ID NO: 305- SEQ ID NO: 459- SEQ ID NO: 510-823 & SEQ ID NO: 167 SEQ ID NO: 824-825 SEQ ID NO: 458 SEQ ID NO: 509 SEQ ID NO: 826 (Table 1) (Table 2) (Table 3) (Table 4) (Table 5)

[0309] The above gRNA molecules have been cloned into suitable vectors and their sequence has been verified. In addition different Cas9 versions have been analyzed for optimal compatibility between the Cas9 protein activity and the gRNA molecule in the Cannabis plant.

[0310] The efficiency of the designed gRNA molecules have been validated by transiently transforming Cannabis tissue culture. A plasmid carrying a gRNA sequence together with the Cas9 gene has been transformed into Cannabis protoplasts. The protoplast cells have been grown for a short period of time and then were analyzed for existence of genome editing events. The positive constructs have been subjected to the herein established stable transformation protocol into Cannabis plant tissue for producing genome edited Cannabis plants in Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) genes.

[0311] Stage 3: Transforming Cannabis plants using Agrobacterium or biolistics (gene gun) methods. For Agrobacterium and bioloistics, a DNA plasmid carrying (Cas9+gene specific gRNA) can be used. A vector containing a selection marker, Cas9 gene and relevant gene specific gRNA's is constructed. For biolistics, Ribonucleoprotein (RNP) complexes carrying (Cas9 protein+gene specific gRNA) are used. RNP complexes are created by mixing the Cas9 protein with relevant gene specific gRNA's.

[0312] According to some embodiments of the present invention, transformation of various Cannabis tissues was performed using particle bombardment of: [0313] DNA vectors [0314] Ribonucleoprotein complex (RNP's)

[0315] According to further embodiments of the present invention, transformation of various Cannabis tissues was performed using Agrobacterium (Agrobacterium tumefaciens) by: [0316] Regeneration-based transformation [0317] Floral-dip transformation [0318] Seedling transformation

[0319] Transformation efficiency by A. tumefaciens has been compared to the bombardment method by transient GUS transformation experiment. After transformation, GUS staining of the transformants has been performed.

[0320] Reference is now made to FIG. 3 photographically presenting GUS staining after transient transformation of the following Cannabis tissues (A) axillary buds (B) leaf (C) calli, and (D) cotyledons. FIG. 3 demonstrates that various Cannabis tissues have been successfully transiently transformed using biolistics system. Transformation has been performed into calli, leaves, axillary buds and cotyledons of Cannabis.

[0321] According to further embodiments of the present invention, additional transformation tools were used in Cannabis, including, but not limited to: [0322] Protoplast PEG transformation [0323] Extend RNP use [0324] Directed editing screening using fluorescent tags [0325] Electroporation

[0326] Stage 4: Regeneration in tissue-culture. When transforming DNA constructs into the plant, antibiotics is used for selection of positive transformed plants. An improved regeneration protocol was herein established for the Cannabis plant.

[0327] Reference is now made to FIG. 4A-C presenting regeneration of Cannabis tissue. In this figure, arrows indicate new meristem emergence.

[0328] Stage 5: Selection of positive transformants. Once regenerated plants appear in tissue culture, DNA is extracted from leaf sample of the transformed plant and PCR is performed using primers flanking the edited region. PCR products are then digested with enzymes recognizing the restriction site near the original gRNA sequence. If editing event occurred, the restriction site will be disrupted and the PCR product will not be cleaved. No editing event will result in a cleaved PCR product.

[0329] Reference is now made to FIG. 5 showing PCR detection of Cas9 DNA in shoots of transformed Cannabis plants. DNA extracted from shoots of plants transformed with Cas9 using biolistics. This figure shows that three weeks post transformation, Cas9 DNA was detected in shoots of transformed plants.

[0330] Screening for CRISPR/Cas9 gene editing events has been performed by at least one of the following analysis methods: [0331] Restriction Fragment Length Polymorphism (RFLP) [0332] Next Generation Sequencing (NGS) [0333] PCR fragment analysis [0334] Fluorescent-tag based screening [0335] High resolution melting curve analysis (HRMA)

[0336] Reference is now made to FIG. 6 presenting results of in vitro analysis of CRISPR/Cas9 cleavage activity. FIG. 6A schematically shows the genomic area targeted for editing (PAM is marked in red) and amplified by the reverse and forward designed primers FIG. 6B photographically presents a gel showing successful digestion of the resulted PCR amplicon containing the gene specific gRNA sequence, by RNP complex containing Cas9. The analysis included the following steps: [0337] 1) Amplicon was isolated from two exemplified Cannabis strains by primers flanking the sequence of the gene of interest targeted by the predesigned sgRNA. [0338] 2) RNP complex was incubated with the isolated amplicon. [0339] 3) The reaction mix was then loaded on agarose gel to evaluate Cas9 cleavage activity at the target site.

[0340] Stage 6: Selection of transformed Cannabis plants presenting reduced expression of at least one of Cannabis tetrahydrocannabinolic acid synthase (CsTHCAS), Cannabis cannabidiolic acid synthase (CsCBDAS), Cannabis aromatic prenyltransferase (CsPT), Cannabis olivetol synthase (CsOLS), Cannabis acyl-activating enzyme 1 (CsAAE1) as described above. It is within the scope that different gRNA promoters were tested in order to maximize editing efficiency.

[0341] Various embodiments have been presented. Each of these embodiments may of course include features from other embodiments presented, and embodiments not specifically described may include various features described herein.