METHOD FOR CONSTRUCTING SEQUENCING LIBRARY

20220002713 · 2022-01-06

    Inventors

    Cpc classification

    International classification

    Abstract

    Disclosed are a method and kit for constructing a second generation high-throughput sequencing library, wherein same can improve the utilization efficiency of the nucleic acid template and simplify the construction process of the sequencing library to make the sequencing results more accurate and the coverage more uniform.

    Claims

    1. A method for constructing a library of a deoxypolynucleotide substrate, the method comprising the following steps: (1) mixing a single strand of the deoxypolynucleotide substrate with the following substances to form a first mixture: a) a deoxynucleotide selected from one of dGTP, dCTP, dATP and dTTP; b) a terminal deoxynucleotidyl transferase and a DNA ligase; c) a tail-controlling component, wherein the tail-controlling component is a partially double-stranded nucleotide molecule composed of a polynucleotide homopolymer with a length of 5 to 20 nucleotides, and an X region, and a linker polynucleotide complementary to the X region, wherein the polynucleotide homopolymer is complementary to the deoxynucleotide in a); (2) incubating the first mixture, wherein the 3′ end of the single strand of the deoxypolynucleotide substrate undergoes a tailing reaction with the deoxynucleotides in a solution, and the 3′ end of the substrate, to which the homopolymeric polynucleotide tail has been added, is ligated to the linker of the tail-controlling component to obtain a tailed substrate; (3) adding a DNA polymerase, deoxynucleotides comprising dGTP, dCTP, dATP and dTTP, and a linear amplification primer to the reaction system of step (2) to form a second mixture; (4) incubating the second mixture, wherein the tailed substrate obtained from step (2) is used as a template to carry out a first linear extension reaction, a complementary strand of the substrate is synthesized and then melted, after the linear amplification primer is complementary to the substrate, a subsequent linear extension reaction is performed again, and the number of instances of linear extension reaction is not less than 3; (5) melting the product of step (4); (6) adding a 5′ sequencing adapter and a DNA ligase to the solution of step (5) to form a third mixture; (7) incubating the third mixture, wherein the 5′ sequencing adapter is connected to the complementary strand of the substrate to prepare and obtain a DNA library.

    2. The method of claim 1, wherein the deoxypolynucleotide in a) is dATP.

    3. The method of claim 1, the tail-controlling component in step (1) comprises a polynucleotide homopolymer with a length of 5 to 13 nucleotides.

    4. (canceled)

    5. (canceled)

    6. The method of claim 1, wherein the linear amplification primer in step (3) is complementary to 3′ terminus of the tailed substrate.

    7. The method of claim 6, wherein the linear amplification primer in step (3) is complementary to the linker of the tail-controlling component.

    8. The method of claim 1, wherein in the first linear extension reaction in step (4), the primer used is a tail-controlling molecule.

    9. The method of claim 1, wherein in the first linear extension reaction in step (4), the primer used is the linear amplification primer added in step (3).

    10. The method of claim 9, wherein in the first linear extension reaction in step (4), the sequence complementary to the substrate in the tail-controlling component is degraded or competes with the linear amplification primer added in step (3).

    11. (canceled)

    12. The method of claim 1, wherein a single-stranded polynucleotide with 2-30 random bases overhangs at the 3′ terminus of one strand of the 5′ sequencing adapter in step (6) and (7).

    13. (canceled)

    14. (canceled)

    15. The method of claim 1, wherein the polynucleotide homopolymer and the linker of the tail-controlling component comprise a 3′ blocking group.

    16. The method of claim 1, wherein the 5′ sequencing adapter comprises a 3′ blocking group.

    17. (canceled)

    18. The method of claim 1, the linker polynucleotide in the tail-controlling component comprising a 5′-end phosphate and the 3′-end blocking group.

    19. The method of claim 1, the strand complementary to the strand containing the random bases in the 5′ sequencing adapter comprising a 5′-end phosphate.

    20. (canceled)

    21. The method of claim 1, wherein after step (4), the double-stranded and single-stranded deoxypolynucleotide are separated from the second mixture, and after melting, the obtained single-stranded deoxypolynucleotide is used in the subsequent steps.

    22. The method of claim 1, wherein after step (7), PCR amplification is performed on the prepared DNA.

    23. (canceled)

    24. A kit, comprising: a first component, comprising a deoxynucleotide selected from one of dGTP, dCTP, dATP and dTTP, a terminal deoxynucleotidyl transferase, a DNA ligase and a tail-controlling component, wherein the tail-controlling component is a partially double-stranded nucleotide molecule composed of a polynucleotide homopolymer with a length of 5 to 20 nucleotides, and an X region, and a linker polynucleotide complementary to the X region, and the polynucleotide homopolymer is complementary to the deoxynucleotide selected from one of dGTP, dCTP, dATP and dGTP; a second component, comprising a DNA polymerase, deoxynucleotides comprising dGTP, dCTP, dATP and dTTP, and a linear amplification primer; and a third component, comprising a 5′ sequencing adapter and a DNA ligase.

    25. (canceled)

    26. The kit of claim 24, wherein the tail-controlling component comprises a polynucleotide homopolymer with a length of 5 to 13.

    27. The kit of claim 24, wherein the linear amplification primer is complementary to the 3′ end of the tail-controlling component.

    28. The kit of claim 24, wherein a single-stranded polynucleotide with 2-30 random bases, overhangs at the 3′ terminus of one strand of the 5′ sequencing adapter.

    29. The use of the kit of claim 24 for constructing a library of a deoxypolynucleotide substrate.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0025] FIG. 1: DNA library construction flowchart of the method of the present invention

    [0026] FIG. 2: Structure of a tail-controlling component

    [0027] FIG. 3: Structure of “5′ sequencing adapter” with 6 overhanging Ns

    [0028] FIG. 4: DNA methylation library construction flowchart of a traditional method

    [0029] FIG. 5: DNA methylation library construction flowchart of the Swift method

    DETAILED DESCRIPTION OF THE INVENTION

    [0030] In the description, the terms 3′, 3′ end and 3′ terminus have the same meaning, and the terms 5′, 5′ end and 5′ terminus have the same meaning, and refer to the 3′ end or 5′ end of a nucleotide sequence, respectively.

    Polynucleotide Substrate

    [0031] The polynucleotide substrate is a polynucleotide substrate fragment that requires a tailing reaction and library construction. In various embodiments, the polynucleotide substrate is single-stranded or double-stranded DNA. In additional embodiments, the polynucleotide substrate is a chemically treated nucleotide sequence, including, but not limited to, polynucleotide that has been treated with hydrosulfite.

    [0032] The polynucleotide substrate can be of natural origin or synthetic. The polynucleotide substrate of natural origin is a polynucleotide sequence derived from prokaryotes or eukaryotes, such as, derived from human, mouse, virus, plant, or bacterium. The polynucleotide substrate of the present invention may also be a severely damaged sample, such as an FFPE sample, ancient DNA, and a DNA sample treated with hydrosulfite. The polynucleotide substrate is tailed and can be used in assays involving microarrays and to generate a library for next-generation nucleic acid sequencing. The tailed polynucleotide substrate can also be used in the efficient cloning of the polynucleotide sequence.

    [0033] In some embodiments, the polynucleotide substrate is single-stranded or double-stranded and comprises a 3′-end free hydroxyl group. In some aspects, the polynucleotide substrate is double-stranded and comprises a blunt terminus. In other aspects, the double-stranded polynucleotide substrate comprises a 3′ recessed terminus. The length of a protruding terminus or recessed terminus of the polynucleotide substrate can vary. In various aspects, the length of the protruding terminus or recessed terminus of the polynucleotide substrate is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides.

    [0034] In some aspects, the length of the polynucleotide substrate is between about 10 and about 5000 nucleotides, or between about 40 and about 2000 nucleotides, or between about 50 and about 1000 nucleotides, or between about 100 and about 500 nucleotides. In additional aspects, the length of the polynucleotide substrate is at least 3 to at most about 50, 100 or 1000 nucleotides.

    DNA Dephosphorylation

    [0035] DNA dephosphorylation refers to the removal of phosphate groups of first amino acid residues at the 5′ end and 3′ end of DNA; generally, alkaline phosphatase is used to treat the DNA to achieve the dephosphorylation of the 5′-end and 3′-end residues.

    [0036] In some embodiments, in the present invention, the dephosphorylation reaction for the deoxypolynucleotide substrate is performed before the deoxypolynucleotide substrate is tailed.

    Tailing Reaction

    [0037] The term “tailing” as used herein is interchangeable with the term “controlled tailing”. In step (2) of the method of the present invention, tailing is carried out on the deoxypolynucleotide substrate, and the method is used to add a required number of nucleotides to the 3′ end of the polynucleotide substrate in a controlled manner. By way of example and in a non-limiting manner, the tail of the polynucleotide substrate is controlled within a certain length range by adding the tail-controlling component (see FIG. 1). The tail-controlling component comprises a polynucleotide homopolymer with a length of 5 to 20 nucleotides, and the tail-controlling component and the newly added homopolymeric nucleotide tail sequence of the substrate form a double-stranded structure, thus, the speed of the polymerization process is reduced and the tail of the polynucleotide substrate is controlled within a certain length range (see FIG. 1).

    [0038] The nucleotide added in the tailing reaction is a deoxynucleotide selected from one of dGTP, dCTP, dATP and dTTP, and may be, for example a dGTP solution, or a dCTP solution, or a dATP solution, or a dTTP solution. In one specific embodiment, a tail-controlling component containing a poly (dT) homopolymeric nucleotide sequence is used to control the TdT enzyme (terminal deoxynucleotidyl transferase) to add a poly (dA) tail (also known as a homopolymeric nucleotide (dA) tail) to the 3′ end of the polynucleotide substrate. Further, the homopolymeric tail of the polynucleotide substrate is ligated to a linker of the tail-controlling component to form a 3′-end tailing region of the substrate.

    [0039] In one specific embodiment, the tail-controlling component comprises the homopolymer nucleotide sequence with 5-20, preferably 5-13, further preferably 7-10, and more preferably 7-9 identical nucleotides.

    [0040] In one specific embodiment, the molar concentration ratio of the polynucleotide substrate to the tail-controlling component ranges from 1:1-1:100, and preferably 1:5-1:50.

    [0041] In one specific embodiment, the pH of the tailing reaction in step (2) of the method of the present invention ranges from about 5.0 to about 9.0; the molar concentration ratio of the polynucleotide substrate to the single nucleotide ranges from 1:10-1:20,000, and preferably 1:100-1:2000; the incubation time is 1 minute to 120 minutes, preferably 0.5-60 minutes, 0.5-30 minutes, 1-20 minutes, 1-15 minutes or 1-10 minutes; the incubation temperature is 20° C.-50° C., preferably 25° C.-45° C., and more preferably 25° C.-37° C.

    Tail-Controlling Component

    [0042] In the present invention, the tailing length and efficiency of the polynucleotide substrate are controlled by adding a tail-controlling component. The tail-controlling component is composed of a tail-controlling region and an X region, and a linker sequence that can be complementary to the X region (see FIG. 2). The tail-controlling component is also known as a “tail-controlling adapter”. The single strand composed of the tail-controlling region and the X region is referred to as a “tail-controlling molecule”.

    [0043] The tail-controlling region of the present invention is a polynucleotide homopolymer with a length of 5-20 nucleotides. The polynucleotide homopolymer, also known as a “poly region”, is a polynucleotide strand formed by ligating identical nucleotides. The tail-controlling region of the present invention is a homopolymer nucleotide sequence composed of a deoxynucleotide of one of dGTP, dCTP, dATP and dTTP; preferably, the tail-controlling region is a poly (dT) tail-controlling region composed of dTTP. Preferably, the length of the polynucleotide homopolymer of the tail-controlling region of the present invention is 5-20 nucleotides, preferably 7-20, 9-20 nucleotides, and further preferably 5-10 nucleotides, 7-10 nucleotides, and more preferably 7-9 nucleotides. The dGTP or dCTP polynucleotide homopolymer with a certain length can effectively control the tailing for the polynucleotide substrate to be about 20 nucleotides.

    [0044] The “X region sequence” provides a priming sequence for the amplification or sequencing of nucleic acid fragments, and can also comprise a marker sequence for distinguishing different substrate molecules. The marker sequence can comprise 4-16 bases, and is used for next-generation sequencing applications in some aspects. In some embodiments of the present invention, the X region sequence can be, but is not limited to, a next-generation sequencing (NGS) adapter sequence which is compatible with an Illumina, Ion Torrent, Roche 454 or SOLiD sequencing platform. The X region sequence can be a DNA sequence, an RNA sequence, or a heteropolymeric sequence comprising DNA and RNA.

    [0045] For the linker in the tail-controlling component, only the linker that is complementary to the X region sequence is referred to as a “short linker”; a linker sequence that includes an extended primer binding region in addition to the sequence complementary to the X region is referred to as a “long linker”, and is as shown in Table 2.

    [0046] In the present invention, a method for deoxypolynucleotide substrate tailing is used, wherein the method is used to add a required number of nucleotides to the 3′ end of the polynucleotide substrate in a controlled manner. By way of example and in a non-limiting manner, by means of adding the tail-controlling component, wherein the tail-controlling component comprises a polynucleotide homopolymer with a length of 5-20 nucleotides, and the tail-controlling component is complementary to the newly added homopolymeric nucleotide tail sequence of the substrate, thereby forming a double-stranded structure, thus reducing the speed of the polymerization process, the tail of the polynucleotide substrate is controlled within a certain length range (see FIG. 1).

    [0047] In some embodiments of the present invention, a tail-controlling component containing a poly(dT) homopolymeric nucleotide sequence is used to control the TdT enzyme to add a poly(dA) tail (also known as a homopolymeric nucleotide (dA) tail) to the 3′ end of the polynucleotide substrate. Further, the poly (dA) tail of the polynucleotide substrate is ligated to the linker of the tail-controlling component to form the 3′-end tailing region of the substrate.

    [0048] In some embodiments of the present invention, the tail-controlling component comprises a blocking group. The blocking group used herein is a part that prevents extension by means of an enzyme. If there is no blocking group, the enzyme can synthesize the polynucleotide by adding nucleotides. The blocking group includes, but is not limited to, a phosphate group, a carbon 3 spacer, a dideoxynucleotide, a ribonucleotide, an amino and reverse deoxythymidine.

    [0049] In some embodiments of the present invention, the linker of the tail-controlling component has a phosphorylation modification at the 5′ end and a blocking group at the 3′ end; the tail-controlling region has a blocking group at 3′.

    Linear Amplification Reaction

    [0050] A linear amplification reaction is also known as a “linear extension reaction” or “linear extension”.

    [0051] In the present invention, after the deoxypolynucleotide substrate is tailed, the deoxypolynucleotide substrate is further used as a template to perform a linear amplification reaction. The present invention provides a method for the linear amplification of the deoxynucleotide substrate, and the method is used to increase the amount of deoxypolynucleotide substrates in a linear amplification manner (see FIG. 1).

    [0052] In some embodiments of the present invention, after the tailing reaction, a linear amplification primer is added; the tailed substrate is used as a template to carry out the extension reaction; the extension reaction may first be an extension reaction that takes place by means of a tail-controlling molecule. In some embodiments of the present invention, the linear amplification primer separates the tail-controlling molecule from the substrate polynucleotide substrate by means of competition, and then, the deoxypolynucleotide substrate is used as a template to perform the linear amplification reaction. In some specific embodiments, fragments of the polynucleotide homopolymer and X region in the tail-controlling component are degraded before the extension reaction of step (4) starts, and the linear extension reaction is carried out on the substrate by using the linear amplification primer added in step (3).

    [0053] In a specific embodiment, the method comprises: after the tailing reaction, the polynucleotide substrate being denatured to a single-stranded state, and adding the linear amplification primer complementary to the 3′ linker sequence of the substrate, DNA polymerase and deoxynucleotides to react with the polynucleotide substrate. a nucleotide extension reaction occurring at the 3′ end of the linear amplification primer to synthesize the complementary strand of the substrate and obtain a double-stranded deoxypolynucleotide; denaturing the double-stranded deoxypolynucleotide to separate the complementary strand of the substrate from the substrate; the substrate again undergoing an extension reaction with the linear amplification primer, the DNA polymerase and deoxynucleotides, wherein the number of times the extension reaction takes place is referred to as the number of linear amplification cycles. In some aspects, the DNA polymerase can efficiently amplify a deoxypolynucleotide substrate template containing a U base.

    [0054] In a specific embodiment, the number of linear amplification cycles is not less than 3, preferably not less than 4, preferably 4-50, further preferably 4-20 and more preferably 4-12 and 8-12.

    Ligation Reaction of the 5′ Sequencing Adapter

    [0055] The 5′ sequencing adapter of the present invention is a deoxypolynucleotide with a partially double-stranded structure; “partially double-stranded” refers to a 5′ sequencing adapter with a random number of overhanging bases comprising a single-stranded part and a double-stranded part.

    [0056] The 5′ sequencing adapter provides a priming sequence for the amplification or sequencing of nucleic acid fragments, and is used for next-generation sequencing applications in some aspects.

    [0057] In the present invention, the 5′ sequencing adapter with overhanging random bases undergoes a ligation reaction with the complementary strand of the substrate obtained after the linear amplification reaction, and the 5′ sequencing adapter with overhanging random bases comprises a single-stranded polynucleotide of random bases at the 3′ terminus (see FIG. 3), therefore, the 5′ sequencing adapter with overhanging random bases has a partially double-stranded polynucleotide and is of a multi-molecular structure, and the 5′ sequencing adapter with overhanging random bases is also referred to as “5′ sequencing adapter with overhanging Ns”. For example, a 5′ sequencing adapter with 6 overhanging random bases is also referred to as a “5′ sequencing adapter with 6 overhanging Ns”, wherein N represents a deoxynucleotide base, that is to say, each of the 6 Ns is a deoxynucleotide base randomly selected from overhanging dGTP, dCTP, dATP and dTTP. The “5′ sequencing adapter with 6 overhanging Ns” is a mixed molecule by ligating different random bases.

    [0058] The number of overhanging random bases in the 5′ sequencing adapter of the present invention is 0-50, preferably 2-30, further preferably 2-17, 4-15 and 4-10, and more preferably 7-10 and 7-9.

    [0059] In a specific embodiment of the present invention, the 5′ sequencing adapter is formed by annealing two polynucleotide strands. A polynucleotide strand without random bases has a phosphorylation modification at the 5′ end, and a blocking group at the 3′ end; a polynucleotide strand containing random bases has a blocking group at the 3′ end (see FIG. 3).

    [0060] In a method for ligating an adapter to a single-stranded deoxypolynucleotide, the method is used for the complementing of the 3′ end of the complementary strand of the substrate obtained after the linear amplification reaction by the random base single-stranded polynucleotide portion of the 5′ sequencing adapter with overhanging random bases to obtain a partially double-stranded structure in addition to the double-stranded portion of the 5′ sequencing adapter. Under the effect of the DNA ligase, the 5′ end of the polynucleotide strand not containing random bases of the 5′ sequencing adapter is ligated to the 3′ end of the complementary strand of the polynucleotide substrate (see FIG. 1). After the linear amplification step and a purification step, the complementary strands of the substrate used to ligate with the 5′ sequencing adapter are increased, and ligation efficiency is improved.

    [0061] In a specific embodiment, the molar concentration ratio of the polynucleotide substrate to the 5′ sequencing adapter ranges from 1:100-1:4000, preferably 1:500-1:1000.

    Ligase

    [0062] The ligase that can be used in the method of the present invention can be DNA ligase and RNA ligase, including, but not limited to, T4 DNA ligase, Escherichia coli DNA ligase, T7 DNA ligase and T4 RNA ligase.

    [0063] The ligase of the present invention ligates the linker in the tail-controlling component with tailed polynucleotide of the substrate. In other embodiments, the ligase of the present invention ligates the 5′ sequencing adapter to the synthesized single-stranded deoxypolynucleotide, which is the complementary strand of the substrate.

    Separation Step

    [0064] In some embodiments, the polynucleotide product after step (7) of the present invention is purified. The purification of the polynucleotide product is carried out by any method known to and understood by those skilled in the art. The polynucleotide substrate of the present invention can be purified by adding magnetic beads with carboxy modified surfaces. In other specific embodiments, the polynucleotide substrate is purified by means of column purification and precipitation.

    DETAILED DESCRIPTION OF EMBODIMENTS

    [0065] For the sequences used in the examples, please see Table 1-Table 6, which follow:

    TABLE-US-00001 TABLE 1 DNA polynucleotides for the examples Serial number in the Serial sequence number Sequence (direction: 5′-3′) Description listing 001 AGACGTGTGCTCTTCCGATCTTTTTTTTTT*T*T*T- Tail-controlling SEQ ID C3 Spacer molecule having NO: 1 a 12b poly(dT) tail-controlling region 002 Phos-AGATCGGAAGAGCACACGTCTGAACTCCAGT*C*A* Long linker SEQ ID C-C3 Spacer NO: 2 003 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT Linear SEQ ID amplification NO: 3 primer 004 GTGACTGGAGTTCAGACGTGT qPCR reverse SEQ ID primer NO: 4 005 ACACTCTTTCCCTACACGACG qPCR forward SEQ ID primer NO: 5 006 Phos-NNNNNNNNNAGATCGGAAGAGCACACGTCTGAACT Long linker with SEQ ID CCAGT*C*A*C-C3 Spacer tag NO: 6 007 ACACTCTTTCCCTACACGACGCTCTTCCGATC*T*N*N- 5′ sequencing SEQ ID C3 Spacer adapter forward NO: 7 primer containing 2 random bases at the 3′ terminus 008 ACACTCTTTCCCTACACGACGCTCTTCCGATCT*N*N*N- 5′ sequencing SEQ ID C3 Spacer adapter forward NO: 8 primer containing 3 random bases at the 3′ terminus 009 ACACTCTTTCCCTACACGACGCTCTTCCGATCTN*N*N*N- 5′ sequencing SEQ ID C3 Spacer adapter forward NO: 9 primer containing 4 random bases at the 3′ terminus 010 ACACTCTTTCCCTACACGACGCTCTTCCGATCTNN*N*N*N- 5′ sequencing SEQ ID C3 Spacer adapter forward NO: 10 primer containing 5 random bases at the 3′ terminus 011 ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNN*N*N*N- 5′ sequencing SEQ ID C3 Spacer adapter forward NO: 11 primer containing 6 random bases at the 3′ terminus 012 ACACTCTTTCCCTACACGACGCTCTTCCGATCNNNN*N*N*N- 5′ sequencing SEQ ID C3 Spacer adapter forward NO: 12 primer containing 7 random bases at the 3′ terminus 013 ACACTCTTTCCCTACACGACGCTCTTCCGATCNNNNN*N*N*N- 5′ sequencing SEQ ID C3 Spacer adapter forward NO: 13 primer containing 8 random bases at the 3′ terminus 014 ACACTCTTTCCCTACACGACGCTCTTCCGATCNNNNNN*N*N*N- 5′ sequencing SEQ ID C3 Spacer adapter forward NO: 14 primer containing 9 random bases at the 3′ terminus 015 Phos-AGATCGGAAGAGCGTCGTGTAGGGAAAGAG*T*G*T- 5′ sequencing SEQ ID C3 Spacer adapter reverse NO: 15 primer 016 A/5mC/A/5mC/T/5mC/TTT/5mC//5mC//5mC/TA/5mC/A/ Traditional SEQ ID 5mC/GA/5mC/G/5mC/T/5mC/TT/5mC//5mC/GAT/5mC/T methylation NO: 16 sequencing adapter forward primer 017 Phos-GAT/5mC/GGAAGAG/5mC/A/5mC/A/5mC/GT/5mC/TG Traditional SEQ ID AA/5mC/T/5mC//5mC/AGT/5mC/A/5mC/ methylation NO: 17 sequencing adapter reverse primer 018 AATGATACGGCGACCACCGAGATCTACACACAGTGCTA P5 PCR label SEQ ID CACTCTTTCCCTACACGACG primer M501 NO: 18 019 AATGATACGGCGACCACCGAGATCTACACCGCATGTAA P5 PCR label SEQ ID CACTCTTTCCCTACACGACG primer M502 NO: 19 020 AATGATACGGCGACCACCGAGATCTACACTATCGCAGA P5 PCR label SEQ ID CACTCTTTCCCTACACGACG primer M503 NO: 20 021 AATGATACGGCGACCACCGAGATCTACACGTGCATACA P5 PCR label SEQ ID CACTCTTTCCCTACACGACG primer M504 NO: 21 022 AATGATACGGCGACCACCGAGATCTACACAGCTAGTCA P5 PCR label SEQ ID CACTCTTTCCCTACACGACG primer M505 NO: 22 023 AATGATACGGCGACCACCGAGATCTACACCTAGCTGAA P5 PCR label SEQ ID CACTCTTTCCCTACACGACG primer M506 NO: 23 024 CAAGCAGAAGACGGCATACGAGATGTCTTAGGGTGACT P7 PCR label SEQ ID GGAGTTCAGACG primer N726 NO: 24 025 CAAGCAGAAGACGGCATACGAGATTAGCTGCAGTGACT P7 PCR label SEQ ID GGAGTTCAGACG primer N728 NO: 25 026 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTA P5 PCR primer SEQ ID CACG*A*C NO: 26 027 CAAGCAGAAGACGGCATACGAGATTTGACTGTGACTGG P7 PCR label SEQ ID AGTTCAGA*C*G primer 13 NO: 27 028 CAAGCAGAAGACGGCATACGAGATTGACATGTGACTGG P7 PCR label SEQ ID AGTTCAGA*C*G primer 14 NO: 28 029 AGACGTGTGCTCTTCCGATCNNNNNNNNTTTTTTTTTT*T*T*T- Tagged SEQ ID C3 Spacer tail-controlling NO: 29 molecule having a 12b poly(dT) tail-controlling region Phos:Phosphate; *:Thio site; C3 Spacer:Carbon 3 Spacer; 5mC:5-methyl-cytosine deoxynucleotide; N:dA, dT, dC or dG nucleotide

    TABLE-US-00002 TABLE 2  Tail-controlling component with overhanging poly(dT) for constructing a methylation sequencing library Serial  number of poly- nucleotide Structure of adapter 002 001 [00001]embedded image Phos: Phosphate; C3 Spacer: Carbon 3 Spacer; *: Thio site [00002]text missing or illegible when filed

    TABLE-US-00003 TABLE 3 5′ sequencing adapters with different  numbers of overhanging Ns for example 1 Serial number of polynucleotide Structure of adapter 012 5′ sequencing- text missing or illegible when filed 015 adapter with 7 text missing or illegible when filed overhanging Ns  007 5′ sequencing- text missing or illegible when filed 015 adapter with 2 text missing or illegible when filed overhanging Ns 008 5′ sequencing- text missing or illegible when filed 015 adapter with 3 text missing or illegible when filed overhanging Ns 009 5′ sequencing- text missing or illegible when filed 015 adapter with 4 text missing or illegible when filed overhanging Ns 010 5′ sequencing- text missing or illegible when filed 015 adapter with 5 text missing or illegible when filed overhanging Ns 011 5′ sequencing- text missing or illegible when filed 015 adapter with 6 text missing or illegible when filed overhanging Ns 013 5′ sequencing- 015 adapter with 8 text missing or illegible when filed overhanging Ns 014 5′ sequencing- text missing or illegible when filed 015 adapter with 9 text missing or illegible when filed overhanging Ns Phos:Phosphate; C3 Spacer:Carbon 3 Spacer; *:Thio site; N:dA dT dC or dG nucleotide text missing or illegible when filed indicates data missing or illegible when filed

    TABLE-US-00004 TABLE 4 Tail-controlling component with overhanging poly (dT) and  molecular tag for constructing a methylation sequencing library Serial number of poly- nucle- otide Structure of adapter 006 029 [00003]embedded image Phos: Phosphate; C3 Spacer: Carbon 3 Spacer; *: Thio site; N: dA, dT, dC or dG nucleotide [00004]text missing or illegible when filed

    TABLE-US-00005 TABLE 5 “Traditional methylation sequencing  adapter” for constructing a methylation sequencing library Serial number of Structure  polynucleotide of adapter 016 text missing or illegible when filed 017 text missing or illegible when filed Phos:Phosphate; 5mC:5-methyl-cytosine deoxynucleotide text missing or illegible when filed indicates data missing or illegible when filed

    EXAMPLES

    Example 1. The Effect of 5′ Sequencing Adapters with Different Numbers of Overhanging Random Bases on the Ligation of 5′ Sequencing Adapter

    Materials:

    [0066] 5× annealing buffer (Beyotime, Catalog No. D0251)

    [0067] Enzyme-free water (Solarbio, Catalog No. R1600-100)

    [0068] λ-DNA (Takara, Catalog No. 3019)

    [0069] Hydrosulfite treatment kit (Zymo Research, Catalog No. D5005)

    [0070] FastAP thermo-sensitive alkaline phosphatase (ThermoFisher, EF0651, 1 U/μL)

    [0071] 10× CutSmart buffer (New England Biolabs, Catalog No. B7204S)

    [0072] 10× green buffer (Enzymatics, Catalog No. B0120, 20 mM Tris-acetate, 50 mM potassium acetate and 10 mM magnesium acetate, pH 7.9)

    [0073] β-nicotinamide adenine dinucleotide (New England Biolabs, Catalog No. B9007S, 50 mM)

    [0074] dATP (Takara, Catalog No. 4026, 100 mM)

    [0075] TdT enzyme (Enzymatics, Catalog No. P7070L, 20 U/μL)

    [0076] Escherichia coli DNA ligase (Takara, Catalog No. 2161, 60 U/μL)

    [0077] EB buffer (Qiagen, Catalog No. 19086)

    [0078] dNTP (Takara, Catalog No. 4030, 2.5 mM each)

    [0079] Phusion U Hot Start DNA polymerase (ThermoFisher, Catalog No. F555L, 2 U/μL)

    [0080] 5× Phusion HF buffer (ThermoFisher, Catalog No. F555L)

    [0081] Beckman Ampure XP magnetic bead (Beckman, Catalog No. A63882)

    [0082] SB buffer: 20% PEG8000, 2.5 M NaCl, 10 mM Tris-hydrochloric acid, 1 mM EDTA

    [0083] 2×T4 DNA quick ligation reaction buffer (Enzymatics, Catalog No. B1010)

    [0084] T4 DNA quick ligase (Enzymatics, Catalog No. L6030-HC-L, 600 U/μl)

    Method:

    [0085] (1) Adapter preparation: Polynucleotide pairs (001/002, 007/015, 008/015, 009/015, 010/015, 011/015, 012/015, 013/015, 014/015) were mixed in equimolar amounts, incubated in 1× annealing buffer at 95° C. for 2 minutes, then cooled slowly to room temperature to obtain the tail-controlling adapter (as shown in Table 2) and the 5′ sequencing adapters with different numbers of overhanging random bases at the 3′ terminus (as shown in Table 3).

    [0086] (2) 40 ng of λ-DNA (Takara, Catalog No. 3019) was treated with hydrosulfite by using a hydrosulfite treatment kit.

    [0087] (3) The DNA product of step (2) was fragmented to 300 bp by using a focused ultrasonic apparatus (Covaris, Catalog No. S220), and retained for use.

    [0088] (4) A DNA dephosphorylation reaction mixture was prepared as shown in Table 1-1. The reaction mixture was placed in a warm bath at 37° C. for 30 minutes, treated at 95° C. for 5 minutes, then immediately inserted into ice and incubated for 2 minutes, then retained for use, so that the substrate remained in a single-stranded state.

    TABLE-US-00006 TABLE 1-1 DNA dephosphorylation reaction mixture DNA (from step (3)) 17 μl 10 x CutSmart buffer 2 μl FastAP thermo-sensitive 1 μl alkaline phosphatase Total volume 20 μl

    [0089] (5) Tailing the polynucleotide substrate: A tailing and ligation reaction mixture was prepared as shown in Table 1-2. The reaction mixture was placed in a warm bath at 37° C. for 30 minutes, treated at 95° C. for 5 minutes, and then kept at 4° C.

    TABLE-US-00007 TABLE 1-2 Tailing and ligation reaction mixture DNA (from step (4)) 20 μl Enzyme-free water 4 μl 2.5 x green buffer plus 12.5% PEG 8000 8 μl 2 mM dATP plus 2 mM β-nicotinamide adenine dinucleotide 2 μl 10 μM tail-controlling adapter (001/002 as shown in Table 2) 2 μl 1:33 diluted TdT enzyme (1 μl TdT enzyme plus 32 μl EB 2 μl buffer) 1:6 diluted Escherichia coli DNA ligase (1 μl TdT enzyme 2 μl plus 5 μl EB buffer) Total volume 40 μl

    [0090] (6) Linear amplification: The reaction mixture for linear amplification as shown in Table 1-3 was prepared, and 4 linear amplifications were run according to the PCR amplification program as shown in Table 1-4. The linear amplification product was purified and recovered by using 166 μl of 1:6 diluted Beckman Ampure XP magnetic beads (1 volume of Beckman Ampure XP magnetic beads plus 5 volumes of SB buffer) and 280 μl of 1.8:1 diluted SB buffer (1.8 volume of SB buffer plus 1 volume of enzyme-free water), then eluted by adding 100 μl of EB buffer. 100 μl of eluent was divided into 5 μl/part, with each part being charged into a 200 μl PCR tube, and 18 parts were separated and used for a next-step reaction.

    TABLE-US-00008 TABLE 1-3 Reaction mixture for linear amplification DNA (from step (5)) 40 μl Enzyme-free water 29 μl 5 x Phusion HF buffer 20 μl 100 μM linear amplification primer (003) 2 μl 2.5 mM dNTP 8 μl Phusion U Hot Start DNA polymerase 1 μl Total volume 100 μl

    TABLE-US-00009 TABLE 1-4 PCR reaction condition Number of Temperature Time cycles 95° C 3 minutes 1 95° C 30 seconds 4 60° C 30 seconds 68° C 1 minute 68° C 5 minutes 1 4 Preservation 1

    [0091] (7) The 18 parts of DNA in step (6) were reacted at 95° C. for 5 minutes, and immediately placed on ice for 2 minutes and retained for use, so that the two strands were melted and maintained as a single strand for use.

    [0092] (8) The ligation reaction mixture of the DNA from step (7) and a “5′ sequencing adapter” with 2-9 overhanging Ns was prepared as shown in Table 1-5. Two of each type of adapter were in parallel. The reaction mixture was placed in a warm bath at 25° C. for 15 minutes. The ligated DNA was recovered by using 17 μl of Beckman Ampure XP magnetic beads, and then eluted by adding 26 μl of enzyme-free water to obtain a PCR amplification pre-library.

    TABLE-US-00010 TABLE 1-5 “5′ sequencing adapter” ligation reaction mixture DNA (from step (7)) 5 μl Enzyme-free water 2 μl 2 x T4 DNA quick ligation reaction buffer 10 μl 10 μM “5′ sequencing adapter” with n 2 μl overhanging Ns (Table 3) T4 DNA quick ligase 1 μl Total volume 20 μl

    [0093] (9) The molar concentration of the PCR amplification pre-library was detected by using a library quantification kit (KAPA Biosystems, Catalog No. KK4824) and a DNA quantification standard and premix primer kit (KAPA Biosystems, Catalog No. KK4808) plus a qPCR forward primer/qPCR reverse primer (005/004, as shown in Table 1, the use concentration thereof being the same as that of the premix primer kit), and during calculation, the size of the fragment of the PCR amplification pre-library was 320 bp.

    [0094] Experiment results: As shown in able 1-6, the concentration of the PCR amplification pre-library constructed by using the “5′ sequencing adapter” with 2 overhanging Ns was the lowest, at 0.000780 nM, and as the number of overhanging Ns in “5′ sequencing adapter” increased from 2 to 4, the concentration of the PCR amplification pre-library increased from 0.000780 nM to 0.0254 nM, this being an exponential increase. T The increase of the concentration of the PCR amplification pre-library was weakened as the number of overhanging Ns in “5′ sequencing adapter” increased from 4 to 7; and the concentration of the PCR amplification pre-library constructed by using the “5′ sequencing adapter” with 7 overhanging Ns was the highest, at 0.0653 nM. The concentrations of the PCR amplification pre-libraries constructed by using the “5′ sequencing adapters” with 7 overhanging Ns, 8 overhanging Ns and 9 overhanging Ns (see Table 3) were substantially the same, at 0.0653 nM, 0.0627 nM and 0.0646 nM, respectively.

    [0095] Conclusion: All “5′ sequencing adapters” with 2-9 overhanging Ns can effectively undergo a ligation reaction with the complementary strands of the nucleotide substrate obtained after linear amplification, and can be used to construct the methylation library for DNA treated with hydrosulfite.

    TABLE-US-00011 TABLE 1-6 Number of overhanging random bases (Ns) in “5′ sequencing adapter” 2 3 4 5 6 7 8 9 Concentration 0.000780 0.00503 0.0254 0.0404 0.0503 0.0653 0.0627 0.0646 of library (nM)

    Example 2. The Effect of Different Concentrations of the Adapter on the Ligation of 5′ Sequencing Adapter

    Methods:

    [0096] (1) Adapter preparation: A tail-controlling adapter (001/002, as shown in Table 2) and a “5′ sequencing adapter” with 6 overhanging Ns at the 3′ terminus (011/015, as shown in table 3) were prepared according to the adapter preparation method in example 1.

    [0097] (2) 24 ng of λ-DNA was treated with hydrosulfite by using a hydrosulfite treatment kit.

    [0098] (3) Preparation of linear amplification product: The linear amplification product was prepared according to the method described in example 1. During the purification and recovery of the linear amplification product, 31.2 μl of EB buffer was added for elution. 31.2 μl of the eluent was divided into 2.6 μl/part, with each part being charged into a 200 μl PCR tube, and 10 parts were separated and used for a next-step reaction.

    [0099] (4) The DNA in step (3) was reacted at 95° C. for 5 minutes, and immediately placed on ice for 2 minutes and retained for use.

    [0100] (5) Reaction: The reaction mixture for the ligation of the “5′ sequencing adapter” was prepared as shown in Table 2-1. The reaction mixture was placed in a warm bath at 25° C. for 15 minutes. The ligated DNA was recovered by using 17 μl of Beckman Ampure XP magnetic beads, and then eluted by adding 26 μl of enzyme-free water to obtain a PCR amplification pre-library.

    TABLE-US-00012 TABLE 2-1 “5′ sequencing adapter” ligation reaction mixture Proportion of DNA 1:100 1:500 1:1000 1:2000 1:4000 substrate: 5′ sequencing adapter DNA (from step (4)) 2.6 μl 2.6 μl 2.6 μl 2.6 μl 2.6 μl Enzyme-free water 6 μl 4.4 μl 2.4 μl 3.2 μl — 2 x T4 DNA quick 10 μl 10 μl 10 μl 10 μl 10 μl ligation reaction buffer 10 μM “5′ sequencing 0.4 μl 2 μl 4 μl adapter” with 6 overhanging Ns 25 μM “5′ sequencing 3.2 μl 6.4 μl adapter” with 6 overhanging Ns T4 DNA quick ligase 1 μl 1 μl 1 μl 1 μl 1 μl Total volume 20 μl 20 μl 20 μl 20 μl 20 μl

    [0101] (6) The molar concentration of the PCR amplification pre-library was detected according to the method described in Example 1.

    [0102] Experiment results: As shown in Table 2-2, when the proportion of the DNA substrate to the 5′ sequencing adapter was 1:100, the concentration of the constructed PCR amplification pre-library was the lowest, at 0.0210 nM, and when the proportion was 1:4000, the concentration of the constructed PCR amplification pre-library was the highest, at 0.0836 nM.

    [0103] Conclusion: When the proportion of the DNA substrate to the 5′ sequencing adapter is from 1:100 to 1:4000, the methylation library for DNA which has been treated with hydrosulfite can be effectively constructed.

    TABLE-US-00013 TABLE 2-2 Proportion of DNA substrate: 5′ sequencing adapter 1:100 1:500 1:1000 1:2000 1:4000 Concentration 0.0210 0.0499 0.0641 0.0693 0.0836 of library (nM)

    Example 3. The Effect of Different Numbers of Linear Amplification Cycles on Methylation PCR Amplification Pre-Library Construction

    [0104] (1) Adapter preparation: The tail-controlling adapter (001/002, as shown in Table 2) and the “5′ sequencing adapter” with 7 overhanging Ns at the 3′ terminus (012/015, as shown in Table 3) were prepared according to the adapter preparation method in Example 1.

    [0105] (2) 20 ng of λ-DNA was treated with hydrosulfite by using a hydrosulfite treatment kit.

    [0106] (3) The DNA product of step (2) was fragmented to 300 bp by using a focused ultrasonic apparatus (Covaris, Catalog No. S220), and retained for use.

    [0107] (4) The DNA dephosphorylation reaction mixture was prepared as shown in Table 3-1. The reaction mixture was placed in a warm bath at 37° C. for 30 minutes, treated at 95° C. for 5 minutes, then immediately inserted in ice and incubated for 2 minutes, then retained for use.

    TABLE-US-00014 TABLE 3-1 DNA dephosphorylation reaction mixture DNA (from step (3)) 17 μl 10 x CutSmart buffer 2 μl FastAP thermo-sensitive alkaline phosphatase 1 μl Total volume 20 μl

    [0108] (5) The tailing and ligation reaction mixture was prepared as shown in Table 3-2. The reaction mixtures were placed in a mixed bath at 37° C. for 30 minutes, treated at 95° C. for 5 minutes, and then kept at 4° C. The reaction mixtures were equally divided into 4 parts after the reaction was completed, each part being 10 μl, and retained use.

    TABLE-US-00015 TABLE 3-2 Tailing and ligation reaction mixture DNA (from step (4)) 20 μl Enzyme-free water 4 μl 2.5 x green buffer plus 12.5% PEG 8000 8 μl 2 mM dATP plus 2 mM β-nicotinamide adenine dinucleotide 2 μl 10 μM tail-controlling adapter (001/002) 2 μl 1:33 diluted TdT enzyme (1 μl TdT enzyme plus 32 μl EB 2 μl buffer) 1:6 diluted Escherichia coli DNA ligase (1 μl TdT enzyme 2 μl plus 5 μl EB buffer) Total volume 40 μl

    [0109] (6) The reaction mixture for linear amplification as shown in Table 3-3 was prepared, and ran according to the PCR amplification program as shown in Table 3-4, wherein the number of reaction cycles for 95° C. for 30 seconds, 60° C. for 30 seconds and 68° C. for 1 minute were 4, 6, 8 and 12, respectively. All the linear amplification product was purified and recovered by using 166 μl of 1:6 diluted Beckman Ampure XP magnetic beads (1 volume of Beckman Ampure XP magnetic beads plus 5 volumes of SB buffer) and 280 μl of 1.8:1 diluted SB buffer (1.8 volume of SB buffer plus 1 volume of enzyme-free water), then eluted by adding 12.5 μl of EB buffer. For each of the four numbers of linear amplification cycles above, 12.5 μl of eluent was divided into 5 μl/part, with each part being charged into a 200 μl PCR tube, and 2 parts were separated and used for a next-step reaction.

    TABLE-US-00016 TABLE 3-3 Reaction mixture for linear amplification DNA (from step (5)) 10 μl Enzyme-free water 59 μl 5 x Phusion HF buffer 20 μl 100 μM linear amplification primer (003) 2 μl 2.5 mM dNTP 8 μl Phusion U Hot Start DNA polymerase 1 μl Total volume 100 μl

    TABLE-US-00017 TABLE 3-4 Number of Temperature Time cycles 95° C 3 minutes 1 95° C 30 seconds 4 or 6 60° C 30 seconds or 8 68° C 1 minute or 12 68° C 5 minutes 1 4° C Preservation 1

    [0110] (7) The DNA prepared in step (6) was reacted at 95° C. for 5 minutes, and immediately placed on ice for 2 minutes for use.

    [0111] (8) The four reaction mixtures for the ligation of the “5′ sequencing adapter” were prepared as shown in Table 3-5. The reaction mixtures were respectively placed in a warm bath at 25° C. for 15 minutes. The ligated pieces of DNA were respectively recovered by using 17 μl of Beckman Ampure XP magnetic beads, and then eluted by adding 26 μl of adding enzyme-free water to obtain the PCR amplification pre-library.

    TABLE-US-00018 TABLE 3-5 “5′ sequencing adapter” ligation reaction mixture Number of linear amplification cycles 4 6 8 12 DNA (from step (7)) 5 μl 5 μl 5 μl 5 μl Enzyme-free water 3.2 μl 2.8 μl 2.4 μl 1.6 μl 2 x T4 DNA quick ligation 10 μl 10 μl 10 μl 10 μl reaction buffer 25 μM “5′ sequencing 0.8 μl 1.2 μl 1.6 μl 2.4 μl adapter” with 7 overhanging Ns (012/015) T4 DNA quick ligase 1 μl 1 μl 1 μl 1 μl Total volume 20 μl 20 μl 20 μl 20 μl

    [0112] (9) The molar concentration of the PCR amplification pre-library was detected according to the method described in Example 1.

    [0113] Experiment results: As shown in Table 3-6, the number of linear amplification cycles were 4, 6, 8, and 12. The molar concentrations of the PCR amplification pre-library were 0.0553 nM, 0.0947 nM, 0.131 nM and 0.199 nM, respectively. When the number of linear amplification cycles was 12, the concentration of the constructed library was the highest.

    TABLE-US-00019 TABLE 3-6 Number of linear amplification cycles used 4 6 8 12 Concentration 0.0553 0.0947 0.131 0.199 of library (nM)

    [0114] Conclusion: The tailed deoxypolynucleotide substrate was subjected to linear amplification, with there being 4-12 cycles of linear amplification, and then ligated to the “5′ sequencing adapter” with 7 overhanging Ns, This can obtain an effective methylation library.

    Example 4. NGS Detection of the Effect of Different Numbers of Linear Amplification Cycles on the Construction of Methylation Sequencing Library

    Materials:

    [0115] 2× high-fidelity hot start PCR mixture (KAPA Biosystems, Catalog No. KK2602)

    Method:

    [0116] (1) Adapter preparation: The tail-controlling adapter with a random molecular tag (006/029, as shown in Table 4) and the “5′ sequencing adapter” with 7 overhanging Ns at the 3′ terminus (012/015, as shown in Table 3) were prepared according to the method described in Example 1.

    [0117] (2) Preparation of methylation sequencing library: The methylation sequencing library was constructed according to the method described in Example 3 until the “5′ sequencing adapter” ligation reaction was completed; then, the ligated DNA was recovered by using 17 μl Beckman Ampure XP magnetic beads, and the ligated DNA was then eluted by adding 20 μl enzyme-free water; 2 μl of eluent was diluted 10 times in 18 μl of enzyme-free water to obtain a ten-fold diluent and 2 μl of the ten-fold diluent was then diluted 10 times in 18 μl of enzyme-free water to obtain a hundred-fold diluent; and the obtained diluent was diluted sequentially to obtain a ten-thousand-fold diluent. 5.34 μl of the ten-thousand-fold diluent was taken out and retained for use.

    [0118] (3) The PCR amplification reaction mixture was prepared as shown in Table 4-1 and ran according to the PCR amplification program as shown in Table 4-2. The PCR product was recovered by using 80 μl of Beckman Ampure XP magnetic beads and then eluted by adding 50 μl enzyme-free water, and then, 50 μl of the eluted product was recovered by using 40 μl of Beckman Ampure XP magnetic beads, and the product was finally eluted by adding 25 μl of EB buffer to obtain the final sequencing library.

    TABLE-US-00020 TABLE 4-1 PCR amplification reaction mixture DNA (from step (2)) 5.34 μl Enzyme-free water 40.66 μl 50 μM P5 PCR tag primer (each library uses one 2 μl (added separately) of the primers 018, 019, 020, 021, 022, and 023, and the concentration of each primer is 50 μM) 25 μM P7 PCR tag primer (each library uses one 2 μl (added separately) of the primers 024 and 025, and the concentration of each primer is 25 μM) 2 x high-fidelity hot start PCR mixture 50 μl Total volume 100 μl

    TABLE-US-00021 TABLE 4-2 PCR amplification program Number of Temperature Time cycles 98° C. 45 seconds 1 98° C. 15 seconds 28 60° C. 30 seconds 72° C. 30 seconds 72° C. 5 minutes 1 4° C. Preservation 1

    [0119] (4) The distribution of library fragments was detected by using Agilent 2100 bioanalyzer (Agilent Technologies, Catalog No. G2939BA) and Agilent high-sensitivity DNA kit (Agilent Technologies, Catalog No. 5067-4626); the molar concentration of the library was detected by using a library quantification kit (KAPA Biosystems, Catalog No. KK4808) and a DNA quantification standard and premixed primer kit (KAPA Biosystems, Catalog No. KK4808).

    [0120] (5) An Illumina-NS500 sequencer was used to sequence, in an 75PE mode, the library obtained in step (3); the software Cutadapt (v1.12) was used to remove the adapter sequence; the software Bwa-Meth (v0.2.0) was used to perform genomic comparison of the methylation sequencing sequence; the software package Sambamba (v0.5.4) was used to mark repeated sequences; finally, the software package bedtods (v2.25.0) was used to compile statistics on the sequencing depth.

    [0121] The experimental results are as shown in Table 4-3 below. When the numbers of linear amplification cycles are 4, 6, 8 and 12, the concentrations of the constructed methylation sequencing libraries are 32.22 nM, 54.90 nM, 134.24 nM and 139.95 nM, respectively. When the amount of sequenced data shown in high-throughput sequencing results is 4 Mb, the library construction efficiencies are 30.35%, 48.36%, 70.36%, and 92.63%, respectively, and the variation coefficients are 0.455, 0.275, 0.999 and 0.637, respectively.

    [0122] Specifically, the library is constructed from 1000 template λ-DNA genomes, and finally, an average of 100 unique sequencing fragments is obtained at each λ-DNA genome site by means of sequencing, which is referred to as a library construction efficiency of 10%. Statistics are compiled on number of unique sequencing fragments obtained at each λ-DNA genome site, and the average value and standard deviation thereof are calculated; and the “variation coefficient” is obtained by dividing the standard deviation by the average value. The variation coefficient represents the uniformity of the method for constructing a library; the lower the variation coefficient, the better the uniformity. The library construction efficiency refers to the effectiveness of the method for constructing a library; the higher the library construction efficiency, the better the effectiveness.

    [0123] Conclusion: The numbers of linear amplification cycles being 4, 6, 8 and 12 can effectively complete linear amplification, and can be used to construct the methylation sequencing library for DNA treated with hydrosulfite. When the number of linear amplification cycles is 12, the library construction efficiency is the highest, and reaches 92.63%.

    TABLE-US-00022 TABLE 4-3 Type of DNA λ-DNA λ-DNA λ-DNA λ-DNA Amount of 2 ng 2 ng 2 ng 2 ng DNA added Number of 4 6 8 12 linear amplification cycles Amount of 5.34 μl of the 5.34 μl of the 5.34 μl of the 5.34 μl of the DNA added ten-thousand-fold ten-thousand-fold ten-thousand-fold ten-thousand-fold during PCR diluent of 20 μl diluent of 20 μl diluent of 20 μl diluent of 20 μl amplification of the ligated of the ligated of the ligated of the ligated purification purification purification purification product described product described product described product described in step (2) in step (2) in step (2) in step (2) Concentration 32.22 54.90 134.24 139.95 of library (nM) Sequencer Illumina-NS500 Illumina-NS500 Illumina-NS500 Illumina-NS500 Sequencing 75PE 75PE 75PE 75PE mode Amount of 4 Mb 4 Mb 4 Mb 4 Mb sequenced data Library 30.35% 48.36% 70.36% 92.63% construction efficiency Variation 0.455 0.275 0.999 0.637 coefficient

    Example 5

    [0124] Comparison of the difference in efficiency between the method of the present invention, the traditional method and the Swift method in constructing a methylation sequencing library

    Materials:

    [0125] 10× end repairing buffer (New England Biolabs, Catalog No. B6052S, 50 mM Tris-hydrochloric acid, 10 mM magnesium chloride, 10 mM dithiothreitol, 1 mM adenosine triphosphate, 0.4 mM dATP, 0.4 mM dCTP, 0.4 mM dGTP and 0.4 mM dTTP, pH 7.5)

    [0126] T4 DNA polymerase (Enzymatics, Catalog No. P7080L, 3 U/μL)

    [0127] T4 polynucleotide kinase (Enzymatics, Catalog No. Y9040L, 10 U/μL)

    [0128] 10× dA tailing buffer (New England Biolabs, Catalog No. B6059S, 10 mM Tris-hydrochloric acid, 10 mM magnesium chloride, 50 mM sodium chloride, 1 mM dithiothreitol and 0.2 mM dATP, pH 7.9)

    [0129] Klenow fragment (Exo-) (Enzymatics, Catalog No. P7010-LC-L, 10 U/μL)

    [0130] (1) Construction of λ-DNA methylation sequencing library using the method of the present invention

    [0131] (1-1) Adapter preparation: The tail-controlling adapter (001/002, as shown in Table 2) and the “5′ sequencing adapter” with 7 overhanging Ns at the 3′ terminus (012/015, as shown in Table 3) were prepared according to the adapter preparation method in Example 1.

    [0132] (1-2) 20 ng of λ-DNA was treated with hydrosulfite by using a hydrosulfite treatment kit.

    [0133] (1-3) The DNA product of step (1-2) was fragmented to 300 bp by using a focused ultrasonic apparatus (Covaris, Catalog No. S220); and divided equally into two parts (i.e., two parallels) and retained for use.

    [0134] (1-4) The DNA dephosphorylation reaction mixture was prepared as shown in Table 5-1. The reaction mixture was placed in a warm bath at 37° C. for 30 minutes, treated at 95° C. for 5 minutes, then immediately inserted in ice and incubated for 2 minutes and retained for use.

    TABLE-US-00023 TABLE 5-1 DNA dephosphorylation reaction reaction DNA (from step (1-3)) 17 μl 10 x CutSmart buffer 2 μl FastAP thermo-sensitive alkaline phosphatase 1 μl Total volume 20 μl

    [0135] (1-5) The tailing and ligation reaction mixture was prepared as shown in Table 5-2. The reaction mixture was placed in a mixed bath at 37° C. for 30 minutes, treated at 95° C. for 5 minutes, and then kept at 4° C. and retained for use.

    TABLE-US-00024 TABLE 5-2 Tailing and ligation reaction mixtures DNA (from step (1-4)) 20 μl Enzyme-free water 4 μl 2.5 x green buffer plus 12.5% PEG 8000 8 μl 2 mM dATP plus 2 mM β-nicotinamide adenine dinucleotide 2 μl 10 μM tail-controlling adapter (001/002) 2 μl 1:33 diluted TdT enzyme (1 μl TdT enzyme plus 32 μl EB 2 μl buffer) 1:6 diluted Escherichia coli DNA ligase (1 μl TdT enzyme plus 2 μl 5 μl EB buffer) Total volume 40 μl

    [0136] (1-6) The reaction mixture for linear amplification as shown in Table 5-3 was prepared, and ran according to the PCR amplification program as shown in Table 5-4. After the reaction was completed, the linear amplification product was purified and recovered by using 166 μl of 1:6 diluted Beckman Ampure XP magnetic beads (1 volume of Beckman Ampure XP magnetic beads plus 5 volumes of SB buffer) and 280 μl of 1.8:1 diluted SB buffer (1.8 volume of SB buffer plus 1 volume of enzyme-free water), then eluted using 6.6 μl of EB buffer.

    TABLE-US-00025 TABLE 5-3 Reaction mixture for linear amplification DNA (from step (1-5)) 40 μl Enzyme-free water 29 μl 5 x Phusion HF buffer 20 μl 100 μM linear amplification primer (003) 2 μl 2.5 mM dNTP 8 μl Phusion U Hot Start DNA polymerase 1 μl Total volume 100 μl

    TABLE-US-00026 TABLE 5-4 Number of Temperature Time cycles 95° C. 3 minutes 1 95° C. 30 seconds 12 60° C. 30 seconds 68° C. 1 minute 68° C. 5 minutes 1 4° C. Preservation 1

    [0137] (1-7) The DNA eluent in step (1-6) were reacted at 95° C. for 5 minutes, and immediately placed on ice for 2 minutes and retained for use.

    [0138] (1-8) The reaction mixture for the ligation of the “5′ sequencing adapter” was prepared as shown in Table 5-5. The reaction mixture was placed in a warm bath at 25° C. for 15 minutes. The ligated DNA was recovered by using 17 μl of

    [0139] Beckman Ampure XP magnetic beads, and then eluted by adding 100 μl of enzyme-free water. 2 μl of eluent was diluted 10 times in 18 μl of enzyme-free water to obtain a ten-fold diluent, then, 2 μl of the ten-fold diluent was diluted 10 times in 18 μl of enzyme-free water to obtain a hundred-fold diluent, and the obtained diluent was sequentially diluted to obtain a ten-thousand-fold diluent. 5.34 μl of the ten-thousand-fold diluent was taken out and retained for use.

    TABLE-US-00027 TABLE 5-5 DNA (from step (1-7)) 6.6 μl 2 x T4 DNA quick ligation reaction buffer 10 μl 25 μM “5′ sequencing adapter” with 7 2.4 μl overhanging Ns (012/015) T4 DNA quick ligase 1 μl Total volume 20 μl

    [0140] (1-9) The PCR amplification reaction mixture was prepared as shown in Table 5-6 and ran according to the PCR amplification program as shown in Table 5-7. The PCR product was recovered by using 80 μl of Beckman Ampure XP magnetic beads and then eluted by adding 50 μl enzyme-free water, and then, 50 μl of the eluted product was recovered by using 40 μl of Beckman Ampure XP magnetic beads, and same was finally eluted by adding 25 μl of EB buffer to obtain the final sequencing library.

    TABLE-US-00028 TABLE 5-6 PCR amplification reaction mixture DNA (from step (1-8)) 5.34 μl Enzyme-free water 40.66 μl 50 μM P5 PCR tag primer (023) 2 μl (added separately) 25 μM P7 PCR tag primer (each library 2 μl (added separately) uses primer 024 or 025, and the concentration of each primer is 25 μM) 2 x high-fidelity hot start PCR mixture 50 μl Total volume 100 μl

    TABLE-US-00029 TABLE 5-7 PCR amplification program Number of Temperature Time cycles 98° C. 45 seconds 1 98° C. 15 seconds 28 60° C. 30 seconds 72° C. 30 seconds 72° C. 5 minutes 1 4° C. Preservation 1

    [0141] (1-10) The method for detecting the library concentration was the same as in Example 4.

    [0142] (1-11) The Illumina-Nova sequencer was used to sequence, in a 150 PE mode, the library obtained in step (1-9). The analysis method was the same as step (5) in Example 4.

    [0143] (2) Construction of a λ-DNA methylation sequencing library using the traditional method (The schematic diagram of the library construction process is shown in FIG. 4)

    [0144] (2-1) Adapter preparation: the “traditional methylation sequencing adapter” was prepared according to the adapter preparation method in Example 1 (016/017, as shown in Table 5).

    [0145] (2-2) 20 ng λ-DNA was taken, and the DNA was fragmented to 300 bp by using a focused ultrasonic apparatus and was equally divided into two parts (i.e., two parallels) and retained for use.

    [0146] (2-3) The end repairing reaction mixture was prepared as shown in Table 5-8 and reacted at 20° C. for 30 minutes. Then, the repaired DNA was recovered by adding 45 μl of Beckman Ampure XP magnetic beads, and eluted using 26 μl of enzyme-free water.

    TABLE-US-00030 TABLE 5-8 End repairing reaction mixture DNA (from step (2-2)) 24 μl 10 x end repairing buffer 3 μl T4 DNA polymerase 1.5 μl T4 polynucleotide kinase 1.5 μl Total volume 30 μl

    [0147] (2-4) The dA tailing reaction mixture was prepared as shown in Table 5-9 and reacted at 37° C. for 30 minutes. Then, the DNA, the dA tailing thereof being complete, was recovered by adding 45 μl of Beckman Ampure XP magnetic beads, and eluted using 12 μl of enzyme-free water.

    TABLE-US-00031 TABLE 5-9 dA tailing reaction mixture DNA (from step (2-3)) 26 μl 10 x dA tailing reaction buffer 3 μl Klenow fragment (Exo-) 1 μl Total volume 30 μl

    [0148] (2-5) The adapter ligation reaction mixture was prepared as shown in Table 5-10 and reacted at 25° C. for 15 minutes. Then, the DNA, the ligation of which to the adapter is complete, was recovered by adding 21 μl of Beckman Ampure XP magnetic beads, and eluted using 20 μl of enzyme-free water.

    TABLE-US-00032 TABLE 5-10 Adapter ligation reaction mixture DNA (from step (2-4)) 12 μl 2 x T4 DNA quick ligation buffer 15 μl 1.5 μM “traditional methylation 2 μl sequencing adapter” (016/017) T4 DNA quick ligase 1 μl Total volume 30 μl

    [0149] (2-6) The DNA (from step (2-5)) was treated with hydrosulfite using the hydrosulfite treatment kit and eluted using 100 μl of enzyme-free water; 2 μl of the eluent was diluted according to the dilution method described in step (1-8) to obtain a ten-thousand-fold diluent; 5.34 μl of the ten-thousand-fold diluent was taken out and retained for use.

    [0150] (2-7) The PCR amplification reaction mixture was prepared as shown in Table 5-11 and ran according to the PCR amplification program as shown in Table 5-12. The PCR product was recovered by using 40 μl of Beckman Ampure XP magnetic beads and then eluted by adding 50 μl enzyme-free water, and then 50 μl of the eluted product was recovered by using 40 μl of Beckman Ampure XP magnetic beads, and same was finally eluted by adding 25 μl of EB buffer to obtain the final sequencing library.

    TABLE-US-00033 TABLE 5-11 PCR amplification reaction mixture DNA (from step (2-6)) 5.34 μl Enzyme-free water 17.66 μl 2 x high-fidelity hot start methylation PCR mixture 25 μl 20 μM P5 PCR primer (026) 1 μl 20 μM P7 PCR tag primer (each library uses primer 1 μl 027 or 028, and the concentration of each primer is 20 μM) Total volume 50 μl

    TABLE-US-00034 TABLE 5-12 PCR amplification program Number of Temperature Time cycles 98° C. 45 seconds 1 98° C. 15 seconds 28 62° C. 30 seconds 72° C. 30 seconds 72° C. 2 minutes 1 4° C. Preservation 1

    [0151] (2-8) The method for detecting the library concentration was the same as in Example 4.

    [0152] (2-9) The Illumina-Nova sequencer was used to sequence, in a 150 PE mode, the library obtained in step (2-7). The analysis method was the same as step (5) in example 4.

    [0153] (3) Construction of a λ-DNA methylation sequencing library using the Swift method (the schematic diagram of the library construction process is shown in FIG. 5) (3-1) 20 ng of λ-DNA was treated with hydrosulfite by using a hydrosulfite treatment kit.

    [0154] (3-2) The product of step (3-1) was fragmented to 300 bp by using a focused ultrasonic apparatus and divided equally into two parts (i.e., two parallels) and retained for use.

    [0155] (3-3) The methylation library for DNA from step (3-2) was constructed according to the library construction steps of a Swift DNA methylation library construction kit (Swift Biosciences, Catalog No. 30024), with the difference being using 100 μl of enzyme-free water for elution after the 5′ sequencing adapter was ligated and purified and during library construction (before Index PCR); 2 μl of the eluent was diluted according to the dilution method described in step (1-8) to obtain a ten-thousand-fold diluent; 5.34 μl of the ten-thousand-fold diluent was taken out and 14.66 μl of enzyme-free water was added to a final volume of 20 μl, and same was retained for use.

    [0156] (3-4) The DNA from step (3-3) was subjected to PCR amplification according to the Index PCR steps in the Swift DNA methylation library construction kit (Swift Biosciences, Catalog No. 30024), and the Index used was I16 or I19 in the Index kit (Swift Biosciences, Catalog No. 36024), with the difference being that the number of PCR amplification cycles was 28.

    [0157] (3-5) The PCR product from step (3-4) was purified and recovered according to the PCR product purification method shown in step (2-7) to obtain a final sequencing library.

    [0158] (3-6) The molar concentration of the library was detected according to the method described in Example 4.

    [0159] (3-7) The Illumina-Nova sequencer was used to sequence, in a 150PE mode, the library obtained in step (2-7). The analysis method was the same as step (5) in Example 4.

    [0160] The experimental results are shown in Table 5-13. When respectively using the method of the present invention, the Swift method, and the traditional method, concentrations of the constructed methylation sequencing libraries are 18.684 nM, 1.641 nM and 0.146 nM, respectively. When the amount of sequenced data is 4 Mb, the library construction efficiencies are 56.1%, 22%, and 3.92%, respectively, and the variation coefficients are 0.463, 8.49, and 3.73, respectively.

    TABLE-US-00035 TABLE 5-13 Method for constructing a library Method of the Traditional present invention Swift Method method Type of DNA λ-DNA λ-DNA λ-DNA Initial amount 10 ng 10 ng 10 ng of DNA added for constructing a library Actual addition 5.34 μl of the 5.34 μl of the 5.34 μl of the amount for ten-thousand-fold ten-thousand-fold ten-thousand-fold PCR diluent of 100 μl diluent of 100 μl diluent of 100 μl of the ligated of the ligated of the ligated purification purification purification product described product described product described in step (1-8) in step (2-6) in step (3-3) Time point of Before Before After hydrosulfite constructing constructing constructing treatment library library library Number of 12 1 None linear amplification cycles 5′ sequencing with 7 with with adapter overhanging overhanging overhanging random bases T T Concentration 18.684 nM 1.641 nM 0.146 nM of library Sequencer Illumina-nova Illumina-nova Illumina-nova Sequencing 150 PE 150 PE 150 PE mode Amount of 4 Mb 4 Mb 4 Mb sequenced data Library 56.1% 22% 3.92% construction efficiency Variation 0.463 8.49 3.73 coefficient

    [0161] Conclusion: The method of the present invention can be used to efficiently construct a methylation sequencing library of a small amount of genomic DNA, and the library construction efficiency and the uniformity of the method for constructing a library are far superior to those of Swift method and the traditional method.