COMPOSITION FOR ALLEVIATING SYMPTOMS OF ANDROPAUSE, CONTAINING EXTRACT OF FICUS AURICULATA LOUR. AS ACTIVE INGREDIENT
20220000957 · 2022-01-06
Inventors
- Young Bae RYU (Daejeon, KR)
- Sang Woo Lee (Daejeon, KR)
- Sang Ho Choi (Daejeon, KR)
- Ji Young PARK (Daejeon, KR)
- Hyung Jun KWON (Daejeon, KR)
- In Chul LEE (Daejeon, KR)
- Jong Sub Lee (Daejeon, KR)
- Woo Song LEE (Daejeon, KR)
- Wan Yi Li (Gonmyeong-si, CN)
Cpc classification
A23L33/105
HUMAN NECESSITIES
A61K2236/331
HUMAN NECESSITIES
A61K36/60
HUMAN NECESSITIES
International classification
Abstract
The present invention relates to a pharmaceutical composition, food composition, and food additive for preventing or alleviating symptoms of andropause containing extract of Ficus auriculata Lour. as an active ingredient.
The extract of Ficus auriculata Lour. of the present invention exhibits the effect of preventing and alleviating erectile dysfunction by inhibiting the activity of PDE5, and the effect of preventing and alleviating prostatic hyperplasia by suppressing the expression of AR and PSA. Therefore, the extract of Ficus auriculata Lour. of the present invention may be usefully used as an active ingredient of a pharmaceutical composition, food composition, and food additive for alleviating symptoms of andropause.
Claims
1. Pharmaceutical composition for preventing or alleviating symptoms of andropause containing extract of Ficus auriculata Lour. as an active ingredient
2. The pharmaceutical composition of claim 1, wherein the extract is a fruit extract of Ficus auriculata Lour.
3. The pharmaceutical composition of claim 1, wherein the symptoms of andropause is one or more selected from the group consisting of lower urinary tract symptoms, BPH, prostatitis, nervousness, emotional anxiety, depression, hot flashes, sleep disorders, decreased vitality, reduced work ability, erectile dysfunction, and alopecia.
4. The pharmaceutical composition of claim 1, wherein the extract is the hot water extract or ethanol extract
5. The pharmaceutical composition of claim 1, wherein the symptoms of andropause is caused by activation of PDE5, androgen receptor expression, or PSA (Prostate specific antigen) expression.
6. Food composition for alleviating symptoms of andropause containing extract of Ficus auriculata Lour. as an active ingredient
7. The food composition of claim 6, wherein the extract is a hot water extract or an ethanol extract.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
DETAILED DESCRIPTION
[0020] The present invention provides a pharmaceutical composition for preventing or alleviating symptoms of andropause containing extract of Ficus auriculata Lour. as an active ingredient.
[0021] However, the following Examples, Experimental Examples, and Preparation Examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following Examples, Experimental Examples, and Preparation Examples.
<Example 1> Preparation of Extracts of Ficus auriculata Lour
[0022] The extract of Ficus auriculata Lour. used in the present invention was prepared and prepared as follows.
[0023] Ethanol was added to each dried product of leaves, fruits, and stems obtained by applying for pre-sale from the International Biological Materials Research Center of the Korea Research Institute of Bioscience and Biotechnology, and the extracts were prepared by immersion and concentration under reduced pressure.
<Example 2> Cell Culture
[0024] Prostate cancer cell line (LNCaP cell) was cultured in RMPI-1640 medium containing 10% fetal bovine serum (FBS). Prostate cancer cell lines were placed in a 175 cm.sup.2 plastic flask (SPL life science Co., Ltd. Korea) and were cultured in RPMI-1640 medium containing 10% FBS and 1% antibiotic/antimycotics at 37° C. and 5% CO.sub.2. Cell lines were maintained by secondary culture once every 2-3 days.
<Example 3> Cell Quantification
[0025] After removing the medium solution from the 175 cm.sup.2 plastic flask in which the cells were grown, washing with CMF-PBS (calcium magnesium free-phosphate buffered saline, pH 7.2), the cells were removed from the bottom of the flask by treatment with 0.25% trypsin/EDTA, neutralized with a cell culture solution, and centrifuged (1000 rpm, 3 min). A culture solution was added to the remaining cell pellet, and then a single cell suspension was prepared by repeatedly aspirating with a sterile pipette. The prepared cell suspension and trypan blue were mixed at a ratio of 1:1 and measured using a hemocytometer on an optical microscope.
<Experimental Example 1> Confirmation of Cell Viability of Ficus auriculata Lour
[0026] Toxicity to the prostate cancer cell line (LNCaP cell) of Ficus aurikulata Lour. was measured using the EzCytox kit. Specifically, the prostate cancer cell line was dispensed into a 96 well plate at 1×10.sup.4 cells/well. This was cultured in an incubator under conditions of 37° C. and 5% CO.sub.2, and then incubated for 24 hours by adding
[0027] Ficus aurikulata Lour. of various concentrations of 0, 6.25, 12.5, 25, 50, 100, 200, 400 μg/ml. The prostate cancer cell line (LNCaP cell) cultured for 24 hours were reacted for 1 hour using the EzCytox kit, and then the absorbance was measured. The cytotoxicity of Ficus auriculata Lour. was determined by calculating the cell viability based on the control.
[0028] As a result, as shown in
<Experimental Example 2> Confirmation of the Inhibitory Effect of the Fruit Extract of Ficus auriculata Lour. By Country of Origin Against Testosterone-Induced Prostate Specific Antigen (PSA)
[0029] Reverse transcription-real-time polymerase chain reaction (real-time RT-PCR) was used to measure the inhibition of expression of prostate-specific antigen (PSA) in testosterone-induced prostate cancer cell lines (LNCaP cells). Specifically, the prostate cancer cell line (LNCaP cells) was dispensed to a 6 well plate at 5×10.sup.5 cells/well. After incubating for 24 hours in an incubator under conditions of 37° C. and 5% CO.sub.2, Ficus auriculata Lour. fruit extract of each country of origin (Vietnam, Nepal, Myanmar, Bangladesh, China, Laos) was added at 100 μg/ml and incubated for 3 hours. Testosterone 100 nM was added to each well except for the control and incubated for 24 hours. After incubation for 24 hours, the supernatant was removed, total RNA was extracted using Trizol, and cDNA was synthesized using PrimeScript RT Master Mix (Takara, Japan). The synthesized cDNA was subjected to real-time polymerase chain reaction using TOPreal qPCR 2×PreMIX (Enzynomics, Korea). The primers and PCR conditions used are shown in Tables 1 and 2.
[0030] As a result, as shown in
<Experimental Example 3> Confirmation of the Inhibitory Effect of Ficus Auriculata Lour. On Testosterone-Induced Prostate Specific Antigen (PSA) by Site
[0031] Reverse transcription-real-time polymerase chain reaction (real-time RT-PCR) was used to measure the inhibition of expression of prostate-specific antigen (PSA) in testosterone-induced prostate cancer cell lines (LNCaP cells). Specifically, the prostate cancer cell line (LNCaP cells) was dispensed to a 6 well plate at 5×10.sup.5 cells/well. After incubating for 24 hours in an incubator under conditions of 37° C. and 5% CO.sub.2, extracts of each part of Ficus auriculata Lour. (leaf, fruit, stem) were added at 100 μg/ml and incubated for 3 hours. Testosterone 100 nM was added to each well except for the control and incubated for 24 hours. After incubation for 24 hours, the supernatant was removed, total RNA was extracted using Trizol, and cDNA was synthesized using PrimeScript RT Master Mix (Takara, Japan). The synthesized cDNA was subjected to real-time polymerase chain reaction using TOPreal qPCR 2×PreMIX (Enzynomics, Korea). The primers and PCR conditions used are shown in Tables 1 and 2.
TABLE-US-00001 TABLES 1 Gene Hot start Denaturation Annealing Prostate specific antigen 95° C. 95° C. 60° C. (PSA) 12 min 10 sec 30 sec Androgen receptor (AR) GAPDH
TABLE-US-00002 TABLES 2 Gene Primer Prostate Forward CAAGTTCATGCTGTGTGCTGGA specific Reverse AGGGCTGGCATGGTCAGTTC antigen (PSA) Androgen Forward TCCATTGCCCACCAAAGACTA receptor (AR) Reverse GCAAATCTGGCCTGTCACCTC GAPDH Forward GCACCGTCAAGGCTGAGAAC Reverse TGGTGAAGACGCCAGTGGA
[0032] As a result, as shown in
<Experimental Example 4> Confirmation of the Inhibitory Effect by Concentration of Ficus auriculata Lour. Fruit Extract Against Testosterone-Induced Prostate Specific Antigen (PSA)
[0033] Reverse transcription-real-time polymerase chain reaction (real-time RT-PCR) was used to measure the inhibition of expression of prostate-specific antigen (PSA) in testosterone-induced prostate cancer cell lines (LNCaP cells). Specifically, the prostate cancer cell (LNCaP cells) line was dispensed to a 6 well plate at 5×10.sup.5 cells/well. After incubating for 24 hours in an incubator under conditions of 37° C. and 5% CO.sub.2, 0 (control), 12.5, 25, 50, 100 μg/ml of various concentrations of Ficus auriculata Lour. fruit extracts were added and incubated for 3 hours. Testosterone 100 nM was added to each well except for the control and incubated for 24 hours. After incubation for 24 hours, the supernatant was removed, total RNA was extracted using Trizol, and cDNA was synthesized using PrimeScript RT Master Mix (Takara, Japan). The synthesized cDNA was subjected to real-time polymerase chain reaction using TOPreal qPCR 2×PreMIX (Enzynomics, Korea). The primers and PCR conditions used are shown in Tables 1 and 2.
[0034] As a result, it was confirmed that, as shown in
<Experimental Example 5> Confirmation of the Effect of Inhibiting the Expression of Androgen Receptor (AR) of Ficus auriculata Lour. Fruit Extract
[0035] Reverse transcription-real-time polymerase chain reaction (real-time RT-PCR) was used to measure androgen receptor (AR) expression in prostate cancer cell lines (LNCaP cells).
[0036] Specifically, the prostate cancer cell line (LNCaP cells) was dispensed to a 6 well plate at 5×10.sup.5 cells/well. After incubating for 24 hours in an incubator under conditions of 37° C. and 5% CO.sub.2, 0 (control), 12.5, 25, 50, 100 μg/ml of various concentrations of Ficus auriculata Lour. fruit extracts were added and incubated for 24 hours. After incubation for 24 hours, the supernatant was removed, total RNA was extracted using Trizol, and cDNA was synthesized using PrimeScript RT Master Mix (Takara, Japan). The synthesized cDNA was subjected to real-time polymerase chain reaction using TOPreal qPCR 2×PreMIX (Enzynomics, Korea). The primers and PCR conditions used are shown in Tables 1 and 2.
[0037] As a result, it was confirmed that, as shown in
[0038] Additionally, Androgen Receptor (AR) is known to play an important role in Androgenetic Alopecia (male pattern baldness) (J Endocrinol. 1998 January; 156(1):59-65, Arch Dermatol Res. 2012 September; 304(7):499-510.), and in particular, higher AR is expressed than normal hair papilla cells in the alopecia area hair papilla cells of alopecia patients, and it has been reported that suppressing this can prevent the progression of alopecia. (J Endocrinol. 1998 January; 156(1):59-65, The Matabolic Basis of Inherited Disease. McGrwa-Hill; New York: 1989. pp. 1919-1944). Also, AR is known to play an important role in hirsutism and beard growth caused by increased body hair in normal areas. (Arch Dermatol Res. 2012 September; 304(7):499-510, Journal of cutaneous medicine and surgery, 3(1), 9-15). Therefore, inhibiting AR in body hair and hirsutism can relatively inhibit hair growth. (Journal of cutaneous medicine and surgery, 3(1), 9-15, Fertility and sterility 64.3(1995):511-517).
[0039] The fruit extract of Ficus auriculata Lour. of the present invention can exhibit the effect of inhibiting alopecia, which is one of the representative menopausal symptoms, by inhibiting AR.
<Experimental Example 6> Confirmation of the Inhibitory Effect of PDE5A1 Enzyme of Ficus auriculata Lour
[0040] In order to measure the inhibitory activity of the sample against PDE5A1, 10 μl of the assay buffer (10 mM Tris-HCl, pH 7.4, 10 mM MgCl.sub.2, 0.01 mg/ml BSA, 0.05% Tween20) was added to a 96-well black plate, and 5 μl of the sample diluted by 2 times(Final concentration 0-200 μg/ml) using the assay buffer was added to each well. After adding 20 μl of 200 ng/ml of PDE5A1 enzyme to each well and mixing 15 μl each of 20 μM FAM-Cyclic-3′,5′-GMP as a substrate, the fluorescence values are measured at intervals of 2 minutes for 30 to 60 minutes in kinetic mode at excetation 475-495 nm and emission 518-538 nm using a microplater reader.
[0041] As a result, as shown in
[0042] Although exemplary embodiments of the present invention have been described for illustrative purposes, those skilled in the art will appreciate that various modifications, additions and substitutions are possible, without departing from the scope and spirit of the invention as disclosed in the accompanying claims. Therefore, the embodiment disclosed in the present invention is intended to illustrate the scope of the technical idea of the present invention, and the scope of the present invention is not limited by the embodiment. The scope of the present invention shall be construed on the basis of the accompanying claims, and it shall be construed that all of the technical ideas included within the scope equivalent to the claims belong to the present invention.
INDUSTRIAL APPLICABILITY
[0043] The composition provided by the present invention has no cytotoxicity, inhibits the activity of PDE5, and inhibits the production of androgen receptors and prostate-specific antigens to improve and prevent erectile dysfunction, prostatic hyperplasia, and alopecia. Therefore it has high industrial applicability as food additives, etc.