TUMOR CELL AGGREGATION INHIBITORS' FOR TREATING CANCER
20220002429 · 2022-01-06
Inventors
- Huiping Liu (Chicago, IL, US)
- Xia Liu (Chicago, IL, US)
- Valery Adorno-Cruz (Chicago, IL, US)
- Rokana Taftaf (Chicago, IL, US)
Cpc classification
C07K16/2863
CHEMISTRY; METALLURGY
C07K2317/76
CHEMISTRY; METALLURGY
A61K31/519
HUMAN NECESSITIES
C07K16/2821
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C07K16/28
CHEMISTRY; METALLURGY
A61K31/519
HUMAN NECESSITIES
Abstract
Disclosed are methods for treating cancer in a subject. The methods typically include administering to the subject a therapeutic agent that inhibits aggregation of tumor cells.
Claims
1. A method for treating cancer in a subject in need of treatment, the method comprising administered to the subject a therapeutic agent that inhibits aggregation of tumor cells.
2. The method of claim 1, wherein the cancer is characterized by circulating tumor cells (CTCs).
3. The method of claim 1, wherein the cancer is characterized by CTCs that express CD44, PAK2, EGFR, or ICAM1.
4. The method of claim 1, wherein the cancer is breast cancer.
5. The method of claim 1, wherein the cancer is estrogen receptor (ER)-negative breast cancer, the cancer is progesterone receptor (PR)-negative breast cancer, the cancer is human epidermal growth factor receptor 2 (HER2)-negative breast cancer, and/or the cancer is triple negative breast cancer (TNBC).
6. The method of claim 1, wherein the cancer is HER2-positive breast cancer.
7. The method of claim 1, wherein the therapeutic agent inhibits the biological activity of CD44.
8. The method of claim 1, wherein the therapeutic agent is an antibody or an antigen-binding fragment thereof that binds to CD44 and inhibits the biological activity of CD44.
9. The method of claim 1, wherein the therapeutic agent inhibits homophilic interactions between CD44 molecules present on the tumor cells.
10. The method of claim 1, wherein the therapeutic agent inhibits expression of CD44.
11. The method of claim 1, wherein the therapeutic agent inhibits the biological activity of protein activated kinase 2 (PAK2).
12. The method of claim 1, wherein the therapeutic agent inhibits the kinase activity of PAK2.
13. The method of claim 1, wherein the therapeutic agents is FRAX1036 (i.e., 6-[2-chloro-4-(6-methyl-2-pyrazinyl)phenyl]-8-ethyl-2-[[2-(1-methyl-4-piperidinyl)ethyl]amino]-pyrido[2,3-d]pyrimidin-7(8H)-one).
14. The method of claim 1, wherein the therapeutic target inhibits expression of PAK2.
15. The method of claim 1, wherein the therapeutic agent inhibits the biological activity of epidermal growth factor receptor (EGFR).
16. The method of claim 1, wherein the therapeutic agent is an antibody or an antigen-binding fragment thereof that binds to EGFR.
17. The method of claim 1, wherein the therapeutic agent inhibits the biological activity of intercellular adhesion molecule 1 (ICAM1).
18. The method of claim 1, wherein the therapeutic agent is an antibody or an antigen-binding fragment thereof that binds to ICAM1.
19. A method comprising detecting expression of one or more of CD44, PAK2, EGFR, and ICAM1 in circulating tumor cells of a subject having breast cancer.
20. The method of claim 19, further comprising identifying the subject as having a high risk for developing metastatic breast cancer.
21. The method of claim 19, further comprising administering to the subject a therapeutic agent that inhibits aggregation of tumor cells.
22. The method of claim 19, further comprising administering to the subject a therapeutic agent that inhibits the biological activity or expression of one or more of CD44, PAK2, EGFR, and ICAM1.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
DETAILED DESCRIPTION
[0045] The present invention is described herein using several definitions, as set forth below and throughout the application.
Definitions
[0046] Unless otherwise specified or indicated by context, the terms “a”, “an”, and “the” mean “one or more.” For example, “an inhibitor of tumor cell aggregation” should be interpreted to mean “one or more inhibitors of tumor cell aggregation.”
[0047] As used herein, “about,” “approximately,” “substantially,” and “significantly” will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which they are used. If there are uses of these terms which are not clear to persons of ordinary skill in the art given the context in which they are used, “about” and “approximately” will mean plus or minus <10% of the particular term and “substantially” and “significantly” will mean plus or minus >10% of the particular term.
[0048] As used herein, the terms “include” and “including” have the same meaning as the terms “comprise” and “comprising” in that these latter terms are “open” transitional terms that do not limit claims only to the recited elements succeeding these transitional terms. The term “consisting of,” while encompassed by the term “comprising,” should be interpreted as a “closed” transitional term that limits claims only to the recited elements succeeding this transitional term. The term “consisting essentially of,” while encompassed by the term “comprising,” should be interpreted as a “partially closed” transitional term which permits additional elements succeeding this transitional term, but only if those additional elements do not materially affect the basic and novel characteristics of the claim.
[0049] As used herein, a “subject” may be interchangeable with “patient” or “individual” and means an animal, which may be a human or non-human animal, in need of treatment, for example, treatment by include administering a therapeutic amount of one or more therapeutic agents that inhibit aggregation of tumor cells.
[0050] A “subject in need of treatment” may include a subject having a disease, disorder, or condition that is responsive to an inhibitor of tumor cell aggregation. For example, a “subject in need of treatment” may include a subject having a cell proliferative disease, disorder, or condition such as cancer. Cancers may include, but are not limited to adenocarcinoma, leukemia, lymphoma, melanoma, myeloma, sarcoma, and teratocarcinoma and particularly cancers of the adrenal gland, bladder, blood, bone, bone marrow, brain, breast, cervix, gall bladder, ganglia, gastrointestinal tract, heart, kidney, liver, lung, muscle, ovary, pancreas, parathyroid, prostate, skin, testis, thymus, and uterus.
[0051] A “subject in need of treatment” may include a subject having breast cancer. In particular, a “subject in need of treatment” may include a subject having breast cancer characterized as negative for expression of the estrogen receptor (ER), the progesterone receptor (PR), the human epidermal growth factor receptor 2 (HER2), or any combination thereof, for example, a cancer characterized as triple negative (TN) for the ER, the PR, and the HER2.
[0052] A “subject in need of treatment” may include a subject having a cancer characterized by expression of CD44, PAK2, EGFR, and ICAM1 (e.g., CD44.sup.+ CTCs).
[0053] A “subject in need of treatment” may include a subject exhibiting or at risk for developing circulating tumor cells (CTCs). In particular, a “subject in need of treatment” may include a subject exhibiting or at risk for developing CTCs that express CD44, PAK2, EGFR, and/or ICAM1 (e.g., CD44.sup.+ CTCs).
[0054] As used herein, the phrase “effective amount” shall mean that drug dosage that provides the specific pharmacological response for which the drug is administered in a significant number of patients in need of such treatment. An effective amount of a drug that is administered to a particular patient in a particular instance will not always be effective in treating the conditions/diseases described herein, even though such dosage is deemed to be a therapeutically effective amount by those of skill in the art.
[0055] The disclosed therapeutic agents may be effective in inhibiting cell aggregation of tumor cells including circulating tumor cells (CTCs) and migrating tumor cells. Cell aggregation and inhibition thereof by the presently disclosed therapeutic agents may be assessed by cell aggregation methods disclosed herein and known in the art. Preferably, the disclosed therapeutic agents have an IC.sub.50 of less than about 10 μM, 5 μM, 1 μM, or 0.5 μM in the selected aggregation assay. The therapeutic agents utilized in the methods disclosed herein may be formulated as pharmaceutical compositions that include: (a) a therapeutically effective amount of one or more of the therapeutic agents as disclosed herein; and (b) one or more pharmaceutically acceptable carriers, excipients, or diluents.
[0056] Therapeutic Targeting of Tumor Cell Aggregation for Treating Cancer
[0057] The disclosed subject matter relates to methods for treating cancer in a subject in need of treatment. The methods typically include administering to the subject a therapeutic agent that inhibits aggregation of tumor cells.
[0058] In some embodiments of the disclosed methods, the subject has a cancer or is at risk for developing a cancer that is characterized by circulating tumor cells (CTCs) and migrating tumor cells, and in particular CTCs and tumor cells that have properties associated with cancer stem cells (CSCs). CTCs are known in the art and are characterized as cells that have spread from established tumors and are circulating in the peripheral vasculature of a subject having the tumor, and have the capacity to form secondary tumors via metastasis. CTCs also are known in the art to account for ˜90% of solid-tumor mortality. Migrating tumor cells can be tumor cells that migrate outside the vasculature at the primary tumor site and the secondary tumor site. Both migrating tumor cells and CTCs can dynamically aggregate to increase metastatic spreading efficiencies.
[0059] In the disclosed methods, the subject typically has a cell proliferative disease or disorder such as cancer. In some embodiments of the disclosed methods, the subject has breast cancer. In particular, the subject may have a breast cancer that is characterized as being negative for one or more of the estrogen receptor (i.e., (ER)-negative breast cancer), the progesterone receptor (i.e., (PR)-negative breast cancer), the human epidermal growth factor receptor 2 (i.e., (HER2)-negative breast cancer), and/or a combination thereof (e.g., a cancer characterized as negative for all three of the ER, the PR, and the HER2 otherwise known as triple negative breast cancer (TNBC)). In some embodiments, the subject may have a breast cancer that is characterized as being positive for HER2 (i.e., HER2-positive breast cancer).
[0060] In some embodiments, the subject may have a breast cancer including circulating tumor cells (CTCs) or CTC cluster that are characterized as being negative for one or more of the estrogen receptor (i.e., (ER)-negative CTCs or CTC clusters), the progesterone receptor (i.e., (PR)-negative CTCs or CTC clusters), the human epidermal growth factor receptor 2 (i.e., (HER2)-negative CTCs or CTC clusters), and/or a combination thereof (e.g., CTCs or CTC clusters characterized as negative for all three of the ER, the PR, and the HER2 otherwise known as triple negative CTCs or CTC clusters). In some embodiments, the subject may have a breast cancer including CTCs or CTC clusters that are characterized as being positive for HER2 (i.e., HER2-positive CTCs or CTC clusters).
[0061] In the disclosed methods, the subject typically is administered a therapeutic agent that inhibits aggregation of tumor cells.
[0062] In some embodiments of the disclosed methods, the subject has a cancer or is at risk for developing a cancer that is characterized by detectable CTCs that express CD44, PAK2, EGFR, and/or ICAM1 (e.g., CD44.sup.+ CTCs).
[0063] CD44 is known in the art as a cell-surface transmembrane glycoprotein involved in cell-cell interactions, cell adhesion, and migration. CD44 is encoded by the CD44 presented on human chromosome 11. CD44 is known to be expressed in many mammalian cell types in the so-called “standard” isoform designated as CD44s, which comprises exons 1-5 and 16-20, as well as splicing isoform variants, so called CD44v, which comprises additional exons 6-15 as CD44v1-v10. Both CD44s and CD44v contain the N-terminal domain I (a.a. 21-97) which is required for its homophilic interactions and cellular aggregation. The self-binding regions are independent of the interaction with its known ligand hyaluronic acid.
[0064] In some embodiments of the disclosed methods, the subject is administered a therapeutic agent that is an agent that inhibits the biological activity and/or expression of CD44. In some embodiments, the therapeutic agent inhibits one or more biological activities of CD44. For example, in some embodiments, the therapeutic agent is an antibody or an antigen-binding fragment thereof that binds to CD44 and inhibits the biological activity of CD44. Antibodies that bind to CD44 are known in the art. (See, e.g., Becton Dickinson, Catalog No. 553130). In some embodiments, the therapeutic agent inhibits homophilic interactions between CD44 molecules present on the tumor cells.
[0065] In some embodiments of the disclosed methods, the subject is administered a therapeutic agent that is an agent that inhibits the biological activity and/or expression of protein activated kinase 2 (PAK2). PAK2 is one of three members of the Group I PAK family of serine/threonine kinases. PAK2 and cleaved fragments of PAK2 localize in both of the cytoplasm and nucleus. PAK2 is known in the art to modulate apoptosis, in cancers such as breast cancer. In some embodiments of the disclosed methods, the therapeutic agent inhibits the kinase activity of PAK2. Inhibitors of the kinase activity of PAK2 are known in the art and include the compound referred to as “FRAX1036” (i.e., 6-[2-chloro-4-(6-methyl-2-pyrazinyl)phenyl]-8-ethyl-2-[[2-(1-methyl-4-piperidinyl)ethyl]amino]-pyrido[2,3-d]pyrimidin-7(8H)-one). (See, e.g., Selleckchem, Catalog No. 7271).
[0066] In some embodiments of the disclosed methods, the subject is administered a therapeutic agent that is an agent that inhibits the biological activity and/or expression of epidermal growth factor receptor (EGFR). EGFR is a transmembrane protein that is a receptor for members of the epidermal growth factor family of extracellular protein ligands. EGFR is a member of the ErbB family of receptor tyrosine kinases. As known in the art, mutations affecting EGFR expression or activity are associated with many cancer types. In some embodiments of the disclosed methods, the therapeutic agent is an antibody or an antigen-binding fragment thereof that binds to EGFR. Antibodies against EGFR are known in the art. (See, e.g., Millipore, Catalog No. 05-101).
[0067] In some embodiments of the disclosed methods, the subject is administered a therapeutic agent that is an agent that inhibits the biological activity and/or expression of intercellular adhesion molecule 1 (ICAM1). ICAM1 also known as CD54 (Cluster of Differentiation 54) is a protein that in humans is encoded by the ICAM1 gene. ICAM1 is a cell surface glycoprotein which is typically expressed on endothelial cells and cells of the immune system. ICAM1 binds to integrins of type CD11a/CD18, or CD11b/CD18 and is also utilized by rhinovirus as a receptor for entry into respiratory epithelium. ICAM1 is a type I transmembrane protein having an amino-terminus extracellular domain, a single transmembrane domain, and a carboxy-terminus cytoplasmic domain. ICAM-1 is a ligand for LFA-1, a receptor found on leukocytes. LFA-1 has also been found in a soluble form can bind and block ICAM1. In addition, antibodies against ICAM1 are known in the art and available commercially. (See, e.g. Abcam, Anti-ICAM1 antibody [EP1442Y]—Low endotoxin, Azide free; MyBioSource.com, ICAM1 Antibody; BosterBio Anti-ICAM1 Picoband Antibody; HuaBio, Ani-ICAM1 antibody).
[0068] The disclosed methods also may include diagnostic methods. In some embodiments, the disclosed methods include methods that include detecting expression of one or more of CD44, PAK2, EGFR, and/or ICAM1 in circulating tumor cells (CTCs) of a subject having a cancer such as breast cancer. The methods further may include identifying the subject as having a high risk for developing metastatic breast cancer, for example, after having identified in the subject CD44.sup.+ CTCs. Optionally, the subject, thus identified, subsequently may be administered treatment, for example, treatment for cancer such as treatment for breast cancer. In some embodiments, the subject thus identified, subsequently may be administered a therapeutic agent that inhibits aggregation of tumor cells. Suitable therapeutic agents may include, but are not limited to therapeutic agents that inhibit the biological activity or expression of one or more of CD44, PAK2, EGFR, and ICAM1.
Illustrative Embodiments
[0069] The following Embodiments are illustrative and should not be interpreted to limit the scope of the claimed subject matter.
[0070] Embodiment 1. A method for treating cancer in a subject in need of treatment, the method comprising administered to the subject a therapeutic agent that inhibits aggregation of tumor cells.
[0071] Embodiment 2. The method of embodiment 1, wherein the cancer is characterized by circulating tumor cells (CTCs).
[0072] Embodiment 3. The method of embodiment 1 or 2, wherein the cancer is characterized by CTCs that express CD44, PAK2, EGFR, or ICAM1.
[0073] Embodiment 4. The method of any of the foregoing embodiments, wherein the cancer is breast cancer.
[0074] Embodiment 5. The method of any of the foregoing embodiments, wherein the cancer is estrogen receptor (ER)-negative breast cancer, the cancer is progesterone receptor (PR)-negative breast cancer, the cancer is human epidermal growth factor receptor 2 (HER2)-negative breast cancer, and/or the cancer is triple negative breast cancer (TNBC).
[0075] Embodiment 6. The method of any of the foregoing embodiments, wherein the cancer is HER2-positive breast cancer.
[0076] Embodiment 7. The method of any of the foregoing embodiments, wherein the therapeutic agent inhibits the biological activity of CD44.
[0077] Embodiment 8. The method of any of the foregoing embodiments, wherein the therapeutic agent is an antibody or an antigen-binding fragment thereof that binds to CD44 and inhibits the biological activity of CD44.
[0078] Embodiment 9. The method of any of the foregoing embodiments, wherein the therapeutic agent inhibits homophilic interactions between CD44 molecules present on the tumor cells.
[0079] Embodiment 10. The method of any of the foregoing embodiments, wherein the therapeutic agent inhibits expression of CD44.
[0080] Embodiment 11. The method of any of the foregoing embodiments, wherein the therapeutic agent inhibits the biological activity of protein activated kinase 2 (PAK2).
[0081] Embodiment 12. The method of any of the foregoing embodiments, wherein the therapeutic agent inhibits the kinase activity of PAK2.
[0082] Embodiment 13. The method of any of the foregoing embodiments, wherein the therapeutic agents is FRAX1036 (i.e., 6-[2-chloro-4-(6-methyl-2-pyrazinyl)phenyl]-8-ethyl-2-[[2-(1-methyl-4-piperidinyl)ethyl]amino]-pyrido[2,3-d]pyrimidin-7(8H)-one).
[0083] Embodiment 14. The method of any of the foregoing embodiments, wherein the therapeutic target inhibits expression of PAK2.
[0084] Embodiment 15. The method of any of the foregoing embodiments, wherein the therapeutic agent inhibits the biological activity of epidermal growth factor receptor (EGFR).
[0085] Embodiment 16. The method of any of the foregoing embodiments, wherein the therapeutic agent is an antibody or an antigen-binding fragment thereof that binds to EGFR.
[0086] Embodiment 17. The method of any of the foregoing embodiments, wherein the therapeutic agent inhibits the biological activity of intercellular adhesion molecule 1 (ICAM1).
[0087] Embodiment 18. The method of any of the foregoing embodiments, wherein the therapeutic agent is an antibody or an antigen-binding fragment thereof that binds to ICAM1.
[0088] Embodiment 19. A method comprising detecting expression of one or more of CD44, PAK2, EGFR, and ICAM1 in circulating tumor cells of a subject having breast cancer.
[0089] Embodiment 20. The method of embodiment 19, further comprising identifying the subject as having a high risk for developing metastatic breast cancer.
[0090] Embodiment 21. The method of any of embodiments 19 or 20, further comprising administering to the subject a therapeutic agent that inhibits aggregation of tumor cells.
[0091] Embodiment 22. The method of any of embodiments 19-21, further comprising administering to the subject a therapeutic agent that inhibits the biological activity or expression of one or more of CD44, PAK2, EGFR, ICAM1.
EXAMPLES
[0092] The following Examples are illustrative and should not be interpreted to limit the scope of the claimed subject matter.
Example 1—Homophilic CD44 Interactions Mediate Tumor Cell Aggregation and Polyclonal Metastasis in Patient-Derived Breast Cancer Models
[0093] Reference is made to the manuscript authored by Liu et al., “Homophilic CD44 interactions mediate tumor cell aggregation and polyclonal metastasis in patient-derived cancer model,” to be published Oct. 25, 2018, which is incorporated herein by reference in its entirety and for which a copy is provided herewith as an Appendix to this application.
[0094] Abstract
[0095] Circulating tumor cells (CTCs) seed cancer metastases; however, the underlying cellular and molecular mechanisms remain unclear. CTC clusters were less frequently detected but more metastatic than single CTCs of triple negative breast cancer patients and representative patient-derived-xenograft (PDX) models. Using intravital multiphoton microscopic imaging, we found that clustered tumor cells in migration and circulation resulted from aggregation of individual tumor cells rather than collective migration and cohesive shedding. Aggregated tumor cells exhibited enriched expression of the breast cancer stem cell marker CD44 and promoted tumorigenesis and polyclonal metastasis. Depletion of CD44 effectively prevented tumor cell aggregation and decreased PAK2 levels. The intercellular CD44-CD44 homophilic interactions directed multicellular aggregation, requiring its N-terminal domain, and initiated CD44-PAK2 interactions for further activation of FAK signaling. Our studies highlight that CD44.sup.+ CTC clusters, whose presence is correlated with a poor prognosis of breast cancer patients, can serve as novel therapeutic targets of polyclonal metastasis.
[0096] Significance
[0097] CTCs not only serve as important biomarkers for liquid biopsies, but also mediate devastating metastases. CD44 homophilic interactions and subsequent CD44-PAK2 interactions mediate tumor cluster aggregation. This will lead to innovative biomarker applications to predict prognosis, facilitate development of new targeting strategies to block polyclonal metastasis, and improve clinical outcomes.
[0098] Introduction
[0099] Circulating tumor cells (CTCs) spread from established tumors, circulate within the peripheral vasculature, and lead to the development of distant metastases that account for 90% of solid tumor-related mortality. While many tumor cells may shed from a primary tumor, only an extremely small proportion of the CTCs can form secondary tumors (1-3). Both our studies and others' have shown that the clustered CTCs detectable in the peripheral blood of patients with breast cancer are associated with a worse prognosis than single CTCs (4,5). However, there is a lack of mechanistic understanding about which cellular and molecular properties enable tumor cluster formation and colonization and which targets may be employed to block this metastatic pathway.
[0100] Increasing evidence has demonstrated that cancer stem cell (CSC) properties contribute to tumor initiation, recurrence, and therapy resistance (6-17). CD44 is a well-known surface marker of CSCs in breast (9,18,19) and other tumors (20-22). However, the functional contributions of CSCs and CD44 to CTC cluster formation and polyclonal metastasis are yet to be elucidated.
[0101] We decided to dissect this mechanism of cancer metastasis by establishing and utilizing breast cancer patient-derived xenograft (PDX) models. We previously established five breast cancer PDX models (TN1-4 and E1) (17) and recently created two more orthotopic breast tumor PDXs (TN5-6), six of which (TN1-6) were triple negative (TN) for estrogen receptor, progesterone receptor, and HER2, that developed spontaneous lung micrometastases in NOD/SCID or NSG mice. Two PDXs (TN1 and TN2) showed basal-like subtype gene expression profiles based on cDNA microarray analyses (23). Human breast cancer MDA-MB-231 cells and mouse PyMT transgenic tumor models (24,25) have also been supplemented for the intravital imaging analyses as well as the cellular and molecular understanding of cluster formation.
[0102] Our studies here set out to determine how tumor cell clusters are generated in vivo, whether the CSC marker CD44 is enriched within CTC clusters and required for tumor cell cluster formation, and what downstream targets of CD44 are essential players to promote tumor cluster-mediated metastasis. Using mass spectrometry analyses, we have identified p21 protein (Cdc42/Rac)-activated kinase 2 (PAK2) as a new CD44 target. PAK2 is a member of the evolutionarily conserved group I PAK family of serine/threonine-protein kinases, along with PAK1/3 (26). The role of PAK2 in breast tumor cell cluster formation has been elucidated below.
[0103] Results
[0104] CTC cluster detection in humans and PDXs with metastatic breast cancer. CTC detection in humans is typically accomplished with blood analysis platforms such as the FDA-approved CellSearch™, which analyzes EpCAM-positive CTCs with additional cytokeratin (CK)-positive and CD45-negative markers (27). In mouse models of cancer, tumor cells are labeled by fluorescent proteins eGFP or tdTomato, and thus blood CTCs are detected in an unbiased manner using fluorescence microscopy of peripheral blood cells after depletion of erythrocytes. Complementary to blood CTC analyses, we also employed vascular CTC detection in tissue sections by histochemical staining as well as in tumor models by intravital fluorescence imaging, thereby enhancing our cellular and molecular understanding of the CTC clusters in human breast cancer.
[0105] Based on tissue section availability, we first employed immunohistochemical (IHC) staining-based analyses of tissue sections, including staining with hematoxylin and eosin (H&E), epithelial markers CK or EpCAM, and endothelial marker CD31, to detect in situ CTCs within the vasculature (
TABLE-US-00001 TABLE 1 Vascular CTC.sup.a counts in patients and PDXs with metastatic breast cancer (HE-based or IHC- based CK+ counts within CD31+ vasculature on one slide of tissue section per specimen) Single Clustered Tumor Cluster Patient .sup.b IHC Slide CTCs CTCs Subtype Ratio CW1 lung Lung Mets 88 33 TN 0.273 CW1 liver Liver Mets 21 43 TN 0.672 CW1 brain CNS Mets 6 10 TN 0.625 CW2 breast ‘S11-4172’ 39 32 TN 0.451 CW3 breast ‘S10-23891’ 2 10 TN 0.833 CW4 breast ‘S13-21915’ 9 1 TN 0.100 CW5 breast ‘S14-19994’ 2 23 TN 0.920 CW6 breast ‘S10-31779’ 7 1 ER−PR(2%) 0.125 Her2− CW7 breast ‘S12-20643’ 6 1 ER−PR(1-5%) 0.143 Her2− Average 46.02% Mouse IHC SLIDE SINGLE CLUSTERED Tumor Cluster PDX Tag Passage# NAME CTCs CTCs Subtype Ratio TN1 lung H2304 P3 (8) Slide 357 0 1 TN 1.000 TN1 lung E7564 P3 (49) Slide 10 13 TN 0.565 TN1 lung E7562 P3 (50) Slide 10 5 TN 0.333 TN1 lung E7576 P3 (47) Slide 0 0 TN TN1 lung E8094 P4 (46) Slide 1 0 TN TN1 lung H2054 P7 (28) Slide 326 14 0 TN TN1 lung H2229 P8 (16) Slide 343 1 0 TN TN1 lung H2227 P8 (17) Slide 342 4 0 TN TN1 lung H2225 P8 (18) Slide 341 0 0 TN TN1 lung H2219 P8 (19) Slide 339 19 7 TN 0.269 TN1 lung H2219 P8 (20) Slide 338 1 0 TN TN1 lung H2216 P8 (21) Slide 336 18 4 TN 0.182 TN1 lung H2200 P8 (22) Slide 335 2 2 TN 0.500 TN1 lung H2199 P8 (23) Slide 333 8 1 TN 0.111 TN1 lung H2189 P8 (24) Slide 332 4 2 TN 0.333 TN1 lung H2186 P8 (25) Slide 331 10 0 TN TN1 lung H2185 P8 (26) Slide 330 5 3 TN 0.375 TN1 lung H2221 P8 (35) Slide 306 13 13 TN 0.500 TN1 lung H2220 P8 (36) Slide 305 3 0 TN TN1 lung H2217 P8 (37) Slide 303 3 0 TN TN1 lung H2262 P9 (1) Slide 371 1 0 TN TN1 lung H2235/6 P9 (2) Slide 370 14 5 TN 0.263 TN1 lung H2261 P9 (3) slide 369 1 1 TN 0.500 TN1 lung H2280 P9 (4) slide 367 4 0 TN TN1 lung H2237 P10 (9) Slide 356 12 2 TN 0.143 TN1 lung H2336 P10 (11) Slide 352 2 0 TN TN2 lung H5064 P3 (12) Slide 350 4 0 TN TN2 lung H5063 P3 (13) Slide 348 8 1 TN 0.111 TN2 lung H5061 P3 (14) Slide 345 8 1 TN 0.111 TN2 lung H219.3 P4 (10) Slide 353 2 0 TN TN2 lung H2029 P4 (31) Slide 319 12 2 TN 0.143 TN3 lung H2162 P4 (27) Slide 328 4 1 TN 0.200 TN4 lung H5035 P2 (15) Slide 344 5 1 TN 0.167 TN4 lung H2009 P2 (38) Slide 302 55 24 TN 0.304 TN4 lung H2006 P2 (39) Slide 301 20 0 TN 0.000 TN4 lung H2005 P2 (40) Slide 300 16 5 TN 0.238 TN4 lung H2003 P2 (41) Slide 299 25 12 TN 0.324 TN4 lung H2003 P2 (42) Slide 298 5 3 TN 0.375 TN4 lung H2010 P2 (32) Slide 318 14 13 TN 0.481 TN5-H2 lung H310 P1 (33) Slide 315 28 4 TN 0.125 TN6-H3 lung H319 P1 (43) Slide 297 8 8 TN 0.500 TN6-H3 lung H316 P1 (44) Slide 296 9 2 TN 0.182 TN6-H3 lung H2332 P2 (6) Slide 363 4 2 TN 0.333 TN6-H3 lung H2333 P2 (7) Slide 360 1 0 TN E1 lung H253 P2 (45) Slide 295 17 5 hER.sup.−PR.sup.+ 0.227 (lost ER in mice) Average 31.77% .sup.aCTCs are defined as CD45.sup.−CK.sup.+ on Cell Search or vascular tumor cells surrounded by RBCs in situ. Counts are based on one CellSearch chip or one slide of tissue section per specimen. .sup.b CW patients: Age range: 40-70 y; Race: 2 Caucasian and 4 Black, Grade: 2/3; Stage pT1-T4; ER.sup.−PR.sup.−/weakHER2.sup.−; RFS: 6-14 months. .sup.cTN1-4 and E1 have been previously reported (Liu et al, PNAS 2010) and TN5-6 are newly established PDXs.
[0106] Clustered and single CTCs were detected within the vasculature of tissue sections, at similar frequencies (30-40% cluster events) and with similar morphology between human TNBC and PDX specimens (
[0107] Using the CellSearch-based blood analysis which normally detects single CTCs, we also detected CTC clusters (
TABLE-US-00002 TABLE 2 Blood CTC.sup.a counts in patients.sup.b and PDXs with metastatic breast cancer Blood draw Total Cluster Cluster Patient # Age # CTCs # 2-cell 3 cells 4 cell Ratio NU04 41 3 27 1 1 0.036 NU06 52 2 135 7 4 2 1 0.049 NU06 52 3 121 8 6 2 0.062 NU 10 29 1 609 9 9 0.015 NU 017 47 2 23 3 2 1 0.115 NU 017 48 3 19 3 2 1 0.136 NU 044 63 1 13 1 1 0.071 Average 7.64% Blood draw Total Cluster Cluster PDX # # CTCs # 2-cell 3 cells 4 cell Ratio TN1 1 20 2 2 0.100 TN1 2 18 1 1 0.056 TN2 1 22 3 2 1 0.136 TN2 2 12 1 1 0.083 TN1 3 15 2 1 1 0.133 TN3 1 17 1 1 0.059 TN4 1 18 2 2 0.111 Average 9.66% .sup.aCTCs are based on the CellSearch platform or L2T/L2G labeled PDX cells. .sup.bNU patients: age range 29-63 y, stage III/IV.
[0108] To determine whether the blood CTCs cluster in PDXs, we transduced four breast tumor PDXs with optical reporters, including eGFP, tdTomato, luciferase 2-eGFP (L2G), and luciferase 2-tdTomato (L2T), as previously described (17). In the L2G and L2T single-color and mixed-color implants of PDXs and MDA-MB-231 models, we observed both single-color and dual-color CTC clusters as well as polyclonal lung metastases of both eGFP.sup.+ and tdTomato.sup.+ tumor cells (
[0109] We then compared the frequencies of dual-color, polyclonal lung colonies between mixed-color implants and the separate-color implants of TN1 PDXs as shown in
[0110] Breast tumor cell clusters arise from aggregation of individual tumor cells. In order to explore the cellular mechanisms of polyclonal cluster formation, we employed intravital multiphoton microscopic imaging of the TN1 PDX breast tumors, human MDA-MD-231 cell-derived tumor models, and mouse PyMT transgenic tumor models as described (24,25). We observed that individual migrating tumor cells aggregated into clusters near the vasculature in a dynamic touch-and-go manner (
[0111] Using the TN PDXs that display individual cell migration patterns (17,24) under intravital imaging (29,30), we collected invasive tumor cells in vivo from these models to examine the cellular patterns upon invasion into chemoattractant-containing Matrigel. We found that around 20% of all counted invasion events occurred as multicellular aggregates (
[0112] We then sought to determine whether the frequency of polyclonal CTC aggregation and lung colonization is dependent on the timing of multiple individual tumor cells entering into blood vessels and homed to the lungs. Upon co-infusion (0 minutes apart) of both eGFP.sup.+ and tdTomato.sup.+ single breast tumor cells (MDA-MB-231 cells) via the tail vein, most of the eGFP.sup.+ and tdTomato.sup.+ tumor cells co-homed, resulting in a high ratio of dual-color aggregates of up to 5 cells (92%) within 2 hours in the lungs (
[0113] Aggregated tumor cells promote tumorigenesis and metastasis. Following this finding, we hypothesized that CSCs contribute to tumor cell aggregation and sought to determine whether tumor cell aggregates have better CSC related properties (cancer stemness) and what molecular mechanisms might underlie this aggregation phenotype. To facilitate a mechanistic understanding, we optimized an ex vivo aggregation assay with dissociated PDX tumor cells and monitored real-time cell aggregation using time-lapse IncuCyte imaging (
[0114] We then set out to determine the CSC-related properties (32,33) of aggregated tumor cell clusters from TN PDXs, such as orthotopic tumorigenesis (gold standard CSC assay), mammosphere formation, and lung metastasis. We orthotopically implanted single and clustered PDX cells (TN1 and TN2) in equivalent cell numbers separately into the fourth left and right mammary fat pads of each NOD/SCID or NSG mouse. Compared to the respective single tumor cells, the clusters derived from both TN1 and TN2 PDXs were more capable of initiating tumor growth, measured by bioluminescence signal intensity over 2-4 weeks (
[0115] We continued to compare the stemness-requiring metastatic potential between single and clustered tumor cells derived from TN PDXs by directly injecting tumor cells into the tail vein and examining the lungs. Unlike single MDA-MB-231 breast tumor cells, which aggregated with high efficiency within two hours of tail vein infusion (
[0116] We then questioned whether markers of CSCs were detectable in clustered CTCs. CD44 and ALDH have been among the most commonly used markers of CSCs in breast and many epithelial tumors (9,18-22,34). While the ALDH signal was undetectable in TN PDXs (data not shown), we detected CD44 expression in the CTC clusters in situ within the endothelial CD31.sup.+ vasculatures of PDX tumor specimens and human tissues (
TABLE-US-00003 TABLE 3 CD44.sup.+ and CD44.sup.− CTC Counts SINGLE CTCs CLUSTERED CTCs Patient or PDX % (44.sup.+) CD44.sup.+ CD44.sup.− % (44.sup.+) CD44.sup.+ CD44.sup.− Patient Lung 32.95% 29 59 81.82% 27 6 Patient Liver 33.33% 7 14 81.40% 35 8 Patient Brain 50.00% 3 3 90.00% 9 1 Patient Breast (n = 5) 56.92% 37 28 72.06% 49 19 PDX lungs (TN½) 43.24% 16 21 100.00% 11 0 Subtotal Counts 42.40% 92 125 79.39% 131 34 T Test P 2.16E−05
[0117] CD44 is required for tumor cell aggregation and lung colonization. To determine the functional importance of CD44 in tumor cell aggregation and subsequent lung colonization, we evaluated the effects of modulated CD44 levels on breast tumor cell aggregation, spontaneous lung metastasis upon orthotopic implantation, and lung colonization via tail vein injection.
[0118] We first sorted CD44.sup.+ and CD44.sup.− tumor cells from L2G-labeled TN PDXs for aggregation assays ex vivo and observed that CD44.sup.+ tumor cells formed clusters not only of a bigger size but also in a larger quantity than CD44.sup.− tumor cells (
[0119] To examine the requirement of CD44 for tumor cell aggregation, we knocked down CD44 in L2G-labeled TN PDX tumor cells using a mixture of commercially available CD44 siRNAs. We found that PDX-derived tumor cells mainly expressed CD44 splicing variant forms (CD44v) at ˜150 kD (
[0120] Consistent with sorted CD44.sup.− cells (
[0121] Compared to the CD44 wild-type (WT) controls, the CD44 KO cells lost aggregation capacity in vitro when measured within 24 hours (
[0122] We proceeded to examine whether CD44 is required for lung colonization of aggregated CTCs in vivo. Upon tail vein infusion, the siCD44-transfected TN1 and TN2 PDX tumor cells as well as CD44 KO MDA-MB-231 cells led to a reduced efficiency of lung colonization as measured by bioluminescence imaging (
[0123] Using the lentiviral CRISPR/Cas9 and CD44 gRNAs, we also transduced CD44.sup.+ CSCs from TN1 PDXs and sorted the L2G/L2T-labeled KO cells based on surface CD44 expression and L2G/L2T (
[0124] CD44 mediates intercellular, homophilic protein interactions in tumor cell aggregates. CD44 is an adhesion molecule and a known receptor for hyaluronic acid (hyaluronan) in lymphocytes (36-38). We initially speculated that hyaluronan binding to CD44 underlies the intercellular interactions of CTC aggregates. However, a hyaluronan antagonist (o-HA, provided by Dr. Bryan P. Toole) failed to block TN1 PDX tumor cell aggregation but rather slightly promoted the cluster size of tumor cell aggregates (
[0125] We subsequently investigated the possibility if CD44 mediates CD44-CD44 homophilic, intercellular interactions within cell aggregates using multiple experimental approaches. Using anti-CD44 immunofluorescence staining, we first found that the residual CD44 protein was mainly located at the interface of a few tumor cell aggregates upon siCD44 knockdown (
[0126] To further determine the importance of CD44 homophilic interaction in cell aggregation and lung colonization, we analyzed the CD44 sequences and structure models for subsequent studies. Based on the computational analyses and machine learning-assisted modeling, the CD44s monomer shows an elongated four-domain structure with three extracellular domains (
[0127] CD44 maintains PAK2 levels in tumor cell aggregates. To better understand the CD44-mediated molecular targets and downstream pathways during tumor cell aggregation, we conducted mass spectrometry analyses of sorted CD44.sup.+ and CD44.sup.− PDX tumor cells prior to aggregation as well as the CD44 knockdown and control cells after aggregation. We identified 535 proteins and 382 proteins differentially expressed by more than 2-fold in the two comparisons (CD44+/− and siCon/siCD44), respectively (
[0128] To determine the importance of PAK2 in tumor cell aggregation and lung metastasis, we inhibited PAK activity using a chemical inhibitor and then knocked down its expression via siRNAs in multiple tumor cells. We found that the PAK inhibitor FRAX597 partially blocked the ex vivo aggregation of TN1 PDX tumor cells (
[0129] We then investigated the molecular mechanism by which CD44 regulates or sustains PAK2 protein levels. Considering that the PAK2 mRNA levels were not altered upon CD44 depletion (
[0130] To determine the downstream signaling effects of PAK2 interaction with CD44, we knocked down PAK2 in breast tumor cells and found that siPAK2 mimicked siCD44 transfection in decreasing the FAK protein levels as well as FAK activation and phosphorylation (
[0131] Human CD44.sup.+ CTC clusters associated with clinical outcomes. We next examined the clinical impact of CD44-mediated breast tumor aggregation and metastasis. Using PrognoScan (41) analyses, we observed that high levels of CD44 mRNA expression in breast tumors are associated with poor overall survival (OS), relapse-free survival (RFS), and distant metastasis-free survival (DMFS) of patients (
TABLE-US-00004 TABLE 4 Clinical annotation of GSE diabases via PrognoScan GSE3143 (CD44 GSE7390 (CD44 GSE7390 (CD44 GSE19615 Dataset 31615_i) 210916_s) 210916_s) (PAK2) Cancer_Type Breast cancer Breast cancer Breast cancer Breast cancer Subtype N 158 198 198 200 Endpoint Overall Survival Relapse Distant Metastasis Distant Metastasis Free Survival Free Survival Free Survival Period Months Days Days Months Cohort Duke Uppsala, Oxford, Uppsala, Oxford, DF/HCC Stockholm, IGR, Stockholm, IGR, GUYT, CRH GUYT, CRH (1980-1998) (1980-1998) Array Type HG-U95A HG-U133A HG-U133A HG-U133_Plus_2 Contributor Bild Desmedt Desmedt Li Data_Processing MAS5 MAS5 MAS5 dChip ER Positive: 68% Positive: 68% Lymph Node Status Positive: 0% Positive: 0% Sample Type Frozen Frozen Frozen Cutpoint 0.68 0.85 0.85 0.9 Minimum P-Value 0.000246 0.000734 0.001602 0.000564 Corrected P-Value 0.007690 0.019642 0.037726 0.031699 In(HR.sub.high/HR.sub.low) 1.01 0.83 0.89 1.71 COX P-Value 0.006336 0.025639 0.008221 0.013876 In(HR) 0.49 0.4 0.47 1.12 HR [95% CI] 1.63 [1.15-2.31] 1.49 [1.05-2.11] 1.60 [1.13-2.26] 3.05 [1.25-7.43]
[0132] Consistently, high levels of PAK2 mRNA expression coincided with poor DMFS of breast cancer patients (
TABLE-US-00005 TABLE 5 CTC test on CellSearch platform in MBC for protocol NU16B06 Time to Total Clusters Clusters cluster CTCs at number at detected detection ID baseline baseline longitudinally (months) 1 8 0 no 2 0 0 no 3 4 0 no 4 14 0 yes 4.93 5 0 0 no 6 158 7 yes 0.00 7 26 0 no 8 0 0 no 9 28 0 no 10 609 9 yes 0.00 11 2 0 yes 3.75 12 33 0 no 13 0 0 no 14 0 0 no 15 0 0 no 16 240 0 no 17 31 0 yes 2.10 18 1 0 no 19 72 0 no 20 0 0 no 21 0 0 no 22 3 0 no 23 0 0 no 24 0 0 no 25 12 1 yes 0.00 26 0 0 no 27 11 0 yes 4.83 28 0 0 no 29 0 0 no 30 0 0 no 31 0 0 no 32 5 0 yes 11.93 33 0 0 no 34 37 0 yes 3.88 35 0 0 no 36 0 0 no 37 0 0 no 38 41 3 yes 0.00 39 0 0 no 40 4 0 no 41 1 0 no 42 4 0 no 43 2 0 no 44 13 1 yes 0.00 45 0 0 no 46 1 0 no 47 72 0 no 48 0 0 no 49 0 0 no 50 1 0 no 51 0 0 no 52 2 0 no 53 24 0 no 54 5 1 yes 0.00 55 0 0 no 56 0 0 no 57 3 0 no 58 0 0 no 59 0 0 no 60 3 0 yes 5.19 61 0 0 no 62 0 0 no 63 904 140 yes 0.00 64 70 0 yes 4.67 65 7 0 no 66 5 0 no 67 30 0 yes 1.81 68 10 0 no 69 0 0 no 70 120 14 yes 0.00 71 0 0 no 72 0 0 no 73 0 0 no 74 0 0 no 75 0 0 no 76 0 0 no 77 0 0 no 78 0 0 no 79 0 0 no 80 2 0 no 81 0 0 no 82 17 5 yes 0.00 83 4 0 no 84 15 0 no 85 5 0 no 86 11 0 no 87 0 0 no 88 1 0 no 89 0 0 no 90 0 0 no 91 2 0 yes 3.16 92 409 9 yes 0.00 93 328 8 yes 0.00 94 5 0 no 95 45 2 yes 0.00 96 10 0 no 97 1000 0 no 98 9 0 no 99 12 0 no 100 0 0 no 101 22 0 no 102 634 6 yes 0.00 103 71 0 yes 1.61 104 1 0 no 105 1 0 no 106 0 0 no 108 137 11 yes 0.00 109 0 0 no 110 2 0 no 111 0 0 no 112 0 0 no 113 39 2 yes 0.00 114 251 14 yes 0.00 115 0 0 no 116 2 0 no 117 0 0 no 118 28 0 no
[0133] We also found that CD44.sup.+ CTC clusters in human blood were associated with lower OS than CD44.sup.− CTCs (
TABLE-US-00006 TABLE 6 Blood CTC CD44 status and clinical information of Northwestern patient cohort, measured by CellSearch. OS Survival CD44+ CD44+ NU ID Age Sex Treatment information (months) status singles (%) clusters (%) 018 64 F lapatanib/capecitabine/ 11.38 alive 0 0 trastuzumab 052 68 F docetaxel/pertuzumab/ 3.45 deceased 2 (0) 3 (100%) trastuzumab 053 40 F everolimus/trastuzumab/ 5.75 alive 24 (0) 0 pertuzumab/navelbine 057 46 F carboplatin/everolimus 7.00 alive 3 (0) 0 063 69 F ixabepilone/trastuzumab/ 2.96 deceased 924 (16.1%) 164 (45%) pertuzumab 091 NA F abraxane/trastuzumab/ 0.81 alive 13 (21.4%) 1 (100%) lapatinib 096 NA F ipilumumab/nivolumab 0.56 alive 60 (19%) 255 (81%) 159 NA F capecitabine 2.68 alive 400 (4%) 4 (100%)
[0134] Overall, these results identify cellular aggregation of individually migrating and circulating tumor cells as a new mechanism of tumor cell cluster formation in breast cancer, which is directly mediated by intercellular CD44-CD44 homophilic interactions and dependent on CD44-PAK2 complex-activated downstream pathways (such as FAK and OCT3/4) to promote cancer stemness and metastasis (
[0135] Discussion
[0136] Taken together, our studies demonstrate a novel mechanism of human tumor cluster formation via CD44/PAK2-mediated cellular aggregation using representative PDX models and cell lines in combination with clinical studies.
[0137] Within the past decade, CTC analyses have become an important real-time approach for cancer diagnostic and prognostic studies. Multiple technologies have been developed for CTC detection and analysis (e.g., microchip-based capture) and have greatly advanced our understanding of the polyclonal biology of tumor metastasis (42-45). Polyclonal tumor cell clusters have also been detected in additional solid tumors such as pancreatic cancer (46). Our study has unveiled the dynamics of cellular migration and aggregation leading to tumor cell cluster formation prior to and after intravasation. We propose that this new mechanism may act in addition to the previously proposed model of collective migration and cohesive shedding of polyclonal CTC clusters (5,28,47) and that there may be a possible interplay or synergy between the two mechanisms in cluster formation and transportation. The retention of CTC clusters in the capillaries of distant organs may be capable of stopping blood flow and generating a new microenvironmental niche for metastatic tumor regeneration. It is also possible for CTC clusters to reversibly break down into individual cells prior to extravasation, similar to the process of individual cell departure from clusters with subsequent intravasation. An in vitro study using microfluidic devices designed to mimic human capillary constrictions indicated that CTC clusters have the ability to dynamically break down and reform cell-cell junctions and traverse capillary-sized vessels (48).
[0138] Our studies suggest a new mechanism of homophilic interactions by which the CSC marker CD44 directs CTC aggregation to promote polyclonal metastasis. CD44 is known to bind to its ligand hyaluronan in lymphocytes; however, CD44-mediated tumor cell aggregation is independent of the hyaluronan-ligand binding, but is mediated by its intercellular, homophilic interactions, similar to other adhesion molecules such as E-cadherin (49) and PECAM1 (50). Notably, the N-terminal domain responsible for CD44 homophilic interactions also harbors most of the known hyaluronan-binding sites (51). While E-cadherin and other tight junction components mediate collective migration of tumor cell clusters (5,28), CD44-mediated cell aggregation to form tumor cell clusters is E-cadherin-independent and occurs through a distinct pathway that interacts with and activates PAK2 kinase and subsequently FAK signaling. While FAK is known to play an important role in cancer stem cells and cancer progression (39,40), PAK2 is relatively less studied. Limited studies have reported that mouse Pak2 KO results in embryonic lethality with impaired somite development and growth retardation (52). Murine Pak2 and its kinase activity are required for homing of hematopoietic stem and progenitor cells to the bone marrow (53). Human PAK2 regulates apoptosis (54) and drives tamoxifen resistance in breast cancer (55). All of these implicate a pivotal role of PAK2 in normal stem cell functions and cancer progression. Our studies further demonstrate the role of PAK2 in tumor cell aggregation and CSC-mediated metastasis.
[0139] Our work indicates that the high efficiency of CTC clusters in mediating metastasis is due not only to their advantageous survival, but also to their CSC properties and CD44-mediated signaling pathways. We propose that the increased sternness of clusters enables their plasticity and regenerative potential (32,33), leading to enhanced adaptation to new microenvironments and improved secondary tumor growth. While CTCs provide advantages for non-invasive dynamic monitoring of cancer progression, the understanding of the sternness and molecular mechanisms of CTC clusters will also improve both diagnostic prediction and development of therapeutics that prevent and block polyclonal metastasis. Regardless, our results show that CD44-mediated cell aggregation can, in parallel or subsequently, promote cell survival which is certainly required for CSC functions such as self-renewal and metastasis. Future studies may address how CTC clusters crosstalk with other blood cells such as macrophages (56) and platelets (57) in metastasis.
[0140] Methods
[0141] Human specimen analyses. All human blood and tumor specimen analyses complied with NIH guidelines for human subject studies and were approved by the Institutional Review Boards at Northwestern University and Case Western Reserve University/University Hospitals. The investigators obtained informed written consent from all subjects whose blood specimens were analyzed. Consent was waived for the IHC staining of archived tumor specimens.
[0142] Animal studies. All mice used in this study were kept in specific pathogen-free facilities in the Animal Resources Center at Northwestern University, Case Western Reserve University and Albert Einstein College of Medicine. All animal procedures complied with the NIH Guidelines for the Care and Use of Laboratory Animals and were approved by the respective Institutional Animal Care and Use Committees. Animals were randomized by age and weight. The exclusion criterion of mice from experiments was sickness or conditions unrelated to tumors. Sample sizes were determined based on the results of preliminary experiments, and no statistical method was used to predetermine sample size. All of the patient-derived xenograft (PDX) tumors were established and orthotopic tumor implantation was performed as described previously (9,17).
[0143] Cell lines and transfections. MDA-MB-231 and HEK-293 cells were purchased commercially from ATCC, and periodically verified to be mycoplasma-negative using Lonza's MycoAlert Mycoplasma Detection Kit (Cat #LT07-218). Cell morphology, growth characteristics, and microarray gene expression analyses were compared to published information to ensure their authenticity. Early passage of cells (<20 passages) were maintained in DMEM with 10% FBS+1% penicillin-streptomycin (P/S). Primary tumor cells were cultured in HuMEC-ready medium (Life Technologies) plus 5% FBS and 0.5% P/S in collagen type I (BD Biosciences) coated plates. miRNAs (Dharmacon, negative control #4) and siRNAs (pooled) (Dharmacon, negative control A) were transfected using Dharmafect (Dharmacon) at 100 nM, and re-transfected on the following day. For overexpression experiments in HEK-293 cells, pCMV6-Flag-CD44 (OriGene), pCMV3-HA-CD44, pCMV3-Flag-PAK2 and pCMV3-HA-PAK2 (Sino Biological) plasmids were transfected into cells by PolyJet (SignaGen Laboratories). After 48 hours, cells were collected for Co-immunoprecipitation and western blotting.
[0144] CD44 Structure Modeling. A 3-dimensional structure model of CD44 antigen isoform 4 precursor (CD44s) (https://www.ncbi.nlm.nih.gov/protein/48255941) was first built using the webserver iTasser (58). Two copies of CD44s monomer models were rigidly docked into each other using the webserver ClusPro (59) under the homodimer mode. The top 10 distinct homodimer models were then subject to flexible refinement using a Bayesian active learning (BAL) method where the direction and the extent of backbone conformational flexibility is sampled with protein complex-based normal mode analysis cNMA (60,61). The 10 refined models were re-ranked with BAL-determined probabilities as weights. Moreover, residues were also assigned probabilities based on the weighted models. Specifically, each residue in each model was assigned the model's probability if it is at the model's putative interface (defined by a 5-A distance cutoff between homodimeric heavy atom pairs) and a zero otherwise; and each residue had these values across all 10 models summed into the residue's probability ranging from 0 to 1. For instance, if a residue appears at the putative interface of all 10 distinct models, its probability score will be 1. Due to the symmetry of the homodimer, each residue's probability is further averaged over both chains in this study. Structure models were visualized using the molecular graphics program PyMol (62). The predicted “hotspot” residues are concentrated over the first 97 residues where C97 at the first inter-domain linker is suggested to form disulfide bonds across some predicted dimer interfaces. As protein docking was performed without the environment of the membrane, the first two homodimer models in
[0145] Statistical analysis. For all assays and analyses in vitro, if not specified, a two-tailed Student's t-test performed using Microsoft Excel was used to evaluate the p-values, and p<0.05 was considered statistically significant. Data are presented as mean±standard deviation (SD). For all the IncuCyte clustering assays, biological triplicates were performed. For all other cell-based in vitro experiments, three technical replicates were analyzed. For animal studies in vivo, cluster curves were analyzed using Wilcoxon rank sum tests and MANOVA analyses in R software. For the fluorescence lung imaging, at least 5 random fields of the lung from each mouse were taken, and at least 3 mice were used. Spearman-Brown reliability coefficients were calculated for varying number of repeats in order to find the number of technical replicates required to attain a reliability of 90% (63,64). For animal studies, we determined the group size using Bonferroni correction for multiplicity, we set α=0.05/4=0.0125. We assumed the mean difference between the groups was at least twice as much as the standard deviation (effect size=2.0). For clinical association studies, please refer to supplementary methods.
[0146] Details included in the Supplementary Methods. Mouse models and tumor dissociation; intravital imaging; bioluminescence imaging; blood collection and CTC analysis; invasive cell collection in vivo; cell culture and transfections; CD44 knockout using CRISPR-Cas9 technology; flow cytometry and cell sorting; cell clustering assay; mammosphere assay; lung imaging; RNA extraction and real-time PCR; mass spectrometry; anoikis assay; western blotting; immunohistochemistry; immunofluorescence; clinical outcome association analysis; statistical analysis; and data availability.
REFERENCES
[0147] 1. Poste G, Fidler I J. The pathogenesis of cancer metastasis. Nature 1980; 283(5743): 139-46. [0148] 2. Chambers A F, Groom A C, MacDonald I C. Dissemination and growth of cancer cells in metastatic sites. Nature reviews 2002; 2(8):563-72 doi 10.1038/nrc865. [0149] 3. Gupta G P, Massague J. Cancer metastasis: building a framework. Cell 2006; 127(4):679-95 doi 10.1016/j.cell.2006.11.001. [0150] 4. Mu Z, Wang C, Ye Z, Austin L, Civan J, Hyslop T, et al. Prospective assessment of the prognostic value of circulating tumor cells and their clusters in patients with advanced-stage breast cancer. Breast Cancer Res Treat 2015; 154(3):563-71 doi 10.1007/s10549-015-3636-4. [0151] 5. Aceto N, Bardia A, Miyamoto D T, Donaldson M C, Winner B S, Spencer J A, et al. Circulating tumor cell clusters are oligoclonal precursors of breast cancer metastasis. Cell 2014; 158(5):1110-22 doi S0092-8674(14)00927-1 [pii] 10.1016/j.cell.2014.07.013. [0152] 6. Bonnet D, Dick J E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med 1997; 3(7):730-7. [0153] 7. Kreso A, Dick J E. Evolution of the cancer stem cell model. Cell Stem Cell 2014; 14(3):275-91 doi 10.1016/j.stem.2014.02.006. [0154] 8. Lapidot T, Sirard C, Vormoor J, Murdoch B, Hoang T, Caceres-Cortes J, et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature 1994; 367(6464):645-8 doi 10.1038/367645a0. [0155] 9. Al-Hajj M, Wicha M S, Benito-Hernandez A, Morrison S J, Clarke M F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci USA 2003; 100(7):3983-8. [0156] 10. Diehn M, Cho R W, Lobo N A, Kalisky T, Dorie M J, Kulp A N, et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature 2009; 458(7239):780-3. [0157] 11. Chao M P, Alizadeh A A, Tang C, Myklebust J H, Varghese B, Gill S, et al. Anti-CD47 antibody synergizes with rituximab to promote phagocytosis and eradicate non-Hodgkin lymphoma. Cell 2010; 142(5):699-713 doi S0092-8674(10)00892-5 [pii] 10.1016/j.cell.2010.07.044. [0158] 12. Jaiswal S, Jamieson C H, Pang W W, Park C Y, Chao M P, Majeti R, et al. CD47 is upregulated on circulating hematopoietic stem cells and leukemia cells to avoid phagocytosis. Cell 2009; 138(2):271-85 doi S0092-8674(09)00651-5 [pii] 10.1016/j.cell.2009.05.046. [0159] 13. Bao S, Wu Q, McLendon R E, Hao Y, Shi Q, Hjelmeland A B, et al. Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature 2006; 444(7120):756-60. [0160] 14. Eyler C E, Rich J N. Survival of the fittest: cancer stem cells in therapeutic resistance and angiogenesis. J Clin Oncol 2008; 26(17):2839-45. [0161] 15. Chen J, Li Y, Yu T S, McKay R M, Burns D K, Kernie S G, et al. A restricted cell population propagates glioblastoma growth after chemotherapy. Nature 2012; 488(7412):522-6 doi 10.1038/nature11287. [0162] 16. Kurtova A V, Xiao J, Mo Q, Pazhanisamy S, Krasnow R, Lerner S P, et al. Blocking PGE2-induced tumour repopulation abrogates bladder cancer chemoresistance. Nature 2015; 517(7533):209-13 doi 10.1038/nature14034. [0163] 17. Liu H, Patel M R, Prescher J A, Patsialou A, Qian D, Lin J, et al. Cancer stem cells from human breast tumors are involved in spontaneous metastases in orthotopic mouse models. Proc Natl Acad Sci USA 2010; 107(42):18115-20 doi 1006732107 [pii] 10.1073/pnas.1006732107. [0164] 18. Godar S, Ince T A, Bell G W, Feldser D, Donaher J L, Bergh J, et al. Growth-inhibitory and tumor-suppressive functions of p53 depend on its repression of CD44 expression. Cell 2008; 134(1):62-73 doi 10.1016/j.cell.2008.06.006. [0165] 19. Mani S A, Guo W, Liao M J, Eaton E N, Ayyanan A, Zhou A Y, et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 2008; 133(4):704-15 doi 10.1016/j.cell.2008.03.027. [0166] 20. Dalerba P, Dylla S J, Park I K, Liu R, Wang X, Cho R W, et al. Phenotypic characterization of human colorectal cancer stem cells. Proc Natl Acad Sci USA 2007; 104(24):10158-63 doi 10.1073/pnas.0703478104. [0167] 21. Prince M E, Sivanandan R, Kaczorowski A, Wolf G T, Kaplan M J, Dalerba P, et al. Identification of a subpopulation of cells with cancer stem cell properties in head and neck squamous cell carcinoma. Proc Natl Acad Sci USA 2007; 104(3):973-8 doi 10.1073/pnas.0610117104. [0168] 22. Li C, Heidt D G, Dalerba P, Burant C F, Zhang L, Adsay V, et al. Identification of pancreatic cancer stem cells. Cancer research 2007; 67(3):1030-7 doi 10.1158/0008-5472.CAN-06-2030. [0169] 23. Bockhorn J, Prat A, Chang Y F, Liu X, Huang S, Shang M, et al. Differentiation and loss of malignant character of spontaneous pulmonary metastases in patient-derived breast cancer models. Cancer research 2014; 74(24):7406-17 doi 10.1158/0008-5472.CAN-14-1188. [0170] 24. Patsialou A, Bravo-Cordero J J, Wang Y, Entenberg D, Liu H, Clarke M, et al. Intravital multiphoton imaging reveals multicellular streaming as a crucial component of in vivo cell migration in human breast tumors. Intravital 2013; 2(2):e25294 doi 10.4161/intv.25294. [0171] 25. Harney A S, Arwert E N, Entenberg D, Wang Y, Guo P, Qian B Z, et al. Real-Time Imaging Reveals Local, Transient Vascular Permeability, and Tumor Cell Intravasation Stimulated by TIE2hi Macrophage-Derived VEGFA. Cancer discovery 2015; 5(9):932-43 doi 10.1158/2159-8290.CD-15-0012. [0172] 26. Kumar A, Molli P R, Pakala S B, Bui Nguyen T M, Rayala S K, Kumar R. PAK thread from amoeba to mammals. Journal of cellular biochemistry 2009; 107(4):579-85 doi 10.1002/jcb.22159. [0173] 27. Alix-Panabieres C, Pantel K. Challenges in circulating tumour cell research. Nature reviews 2014; 14(9):623-31 doi 10.1038/nrc3820. [0174] 28. Cheung K J, Padmanaban V, Silvestri V, Schipper K, Cohen J D, Fairchild A N, et al. Polyclonal breast cancer metastases arise from collective dissemination of keratin 14-expressing tumor cell clusters. Proc Natl Acad Sci USA 2016; 113(7):E854-63 doi 10.1073/pnas.1508541113. [0175] 29. Wyckoff J B, Wang Y, Lin E Y, Li J F, Goswami S, Stanley E R, et al. Direct visualization of macrophage-assisted tumor cell intravasation in mammary tumors. Cancer Res 2007; 67(6):2649-56 doi 10.1158/0008-5472.CAN-06-1823. [0176] 30. Williams J K, Entenberg D, Wang Y, Avivar-Valderas A, Padgen M, Clark A, et al. Validation of a device for the active manipulation of the tumor microenvironment during intravital imaging. Intravital 2016; 5(2) doi 10.1080/21659087.2016.1182271. [0177] 31. Yu M, Bardia A, Winner B S, Stott S L, Smas M E, Ting D T, et al. Circulating breast tumor cells exhibit dynamic changes in epithelial and mesenchymal composition. Science 2013; 339(6119):580-4 doi 10.1126/science.1228522. [0178] 32. Ramos E K, Hoffmann A D, Gerson S L, Liu H. New Opportunities and Challenges to Defeat Cancer Stem Cells. Trends Cancer 2017; 3(11):780-96 doi 10.1016/j.trecan.2017.08.007. [0179] 33. Dashzeveg N K, Taftaf R, Ramos E K, Torre-Healy L, Chumakova A, Silver D J, et al. New Advances and Challenges of Targeting Cancer Stem Cells. Cancer Res 2017; 77(19):5222-7 doi 10.1158/0008-5472.CAN-17-0054. [0180] 34. Vassilopoulos A, Chisholm C, Lahusen T, Zheng H, Deng C X. A critical role of CD29 and CD49f in mediating metastasis for cancer-initiating cells isolated from a Brca1-associated mouse model of breast cancer. Oncogene 2014; 33(47):5477-82 doi 10.1038/onc.2013.516. [0181] 35. Sanjana N E, Shalem O, Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nature methods 2014; 11(8):783-4 doi 10.1038/nmeth.3047. [0182] 36. Ponta H, Sherman L, Herrlich P A. CD44: from adhesion molecules to signalling regulators. Nature reviews Molecular cell biology 2003; 4(1):33-45. [0183] 37. Toole B P. Hyaluronan: from extracellular glue to pericellular cue. Nature reviews 2004; 4(7):528-39 doi 10.1038/nrc1391. [0184] 38. Slomiany M G, Dai L, Tolliver L B, Grass G D, Zeng Y, Toole B P. Inhibition of Functional Hyaluronan-CD44 Interactions in CD133-positive Primary Human Ovarian Carcinoma Cells by Small Hyaluronan Oligosaccharides. Clin Cancer Res 2009; 15(24):7593-601 doi 10.1158/1078-0432.CCR-09-2317. [0185] 39. Kolev V N, Tam W F, Wright Q G, McDermott S P, Vidal C M, Shapiro I M, et al. Inhibition of FAK kinase activity preferentially targets cancer stem cells. Oncotarget 2017; 8(31):51733-47 doi 10.18632/oncotarget.18517. [0186] 40. Golubovskaya V M. FAK and Nanog cross talk with p53 in cancer stem cells. Anticancer Agents Med Chem 2013; 13(4):576-80. [0187] 41. Mizuno H, Kitada K, Nakai K, Sarai A. PrognoScan: a new database for meta-analysis of the prognostic value of genes. BMC medical genomics 2009; 2:18 doi 10.1186/1755-8794-2-18. [0188] 42. van der Toom E E, Verdone J E, Gorin M A, Pienta K J. Technical challenges in the isolation and analysis of circulating tumor cells. Oncotarget 2016 doi 10.18632/oncotarget.11191. [0189] 43. Yu M, Stott S, Toner M, Maheswaran S, Haber D A. Circulating tumor cells: approaches to isolation and characterization. The Journal of cell biology 2011; 192(3):373-82 doi 10.1083/jcb.201010021. [0190] 44. Warkiani M E, Khoo B L, Wu L, Tay A K, Bhagat A A, Han J, et al. Ultra-fast, label-free isolation of circulating tumor cells from blood using spiral microfluidics. Nature protocols 2016; 11(1):134-48 doi 10.1038/nprot.2016.003. [0191] 45. Karabacak N M, Spuhler P S, Fachin F, Lim E J, Pai V, Ozkumur E, et al. Microfluidic, marker-free isolation of circulating tumor cells from blood samples. Nature protocols 2014; 9(3):694-710 doi 10.1038/nprot.2014.044. [0192] 46. Maddipati R, Stanger B Z. Pancreatic Cancer Metastases Harbor Evidence of Polyclonality. Cancer discovery 2015; 5(10):1086-97 doi 10.1158/2159-8290.CD-15-0120. [0193] 47. Salhia B, Trippel M, Pfaltz K, Cihoric N, Grogg A, Ladrach C, et al. High tumor budding stratifies breast cancer with metastatic properties. Breast Cancer Res Treat 2015; 150(2):363-71 doi 10.1007/s10549-015-3333-3. [0194] 48. Au S H, Storey B D, Moore J C, Tang Q, Chen Y L, Javaid S, et al. Clusters of circulating tumor cells traverse capillary-sized vessels. Proc Natl Acad Sci USA 2016; 113(18):4947-52 doi 10.1073/pnas.1524448113. [0195] 49. Perrais M, Chen X, Perez-Moreno M, Gumbiner B M. E-cadherin homophilic ligation inhibits cell growth and epidermal growth factor receptor signaling independently of other cell interactions. Mol Biol Cell 2007; 18(6):2013-25 doi 10.1091/mbc. e06-04-0348. [0196] 50. Muller W A, Weigl S A, Deng X, Phillips D M. PECAM-1 is required for transendothelial migration of leukocytes. J Exp Med 1993; 178(2):449-60. [0197] 51. Peach R J, Hollenbaugh D, Stamenkovic I, Aruffo A. Identification of hyaluronic acid binding sites in the extracellular domain of CD44. The Journal of cell biology 1993; 122(1):257-64. [0198] 52. Marlin J W, Chang Y W, Ober M, Handy A, Xu W, Jakobi R. Functional PAK-2 knockout and replacement with a caspase cleavage-deficient mutant in mice reveals differential requirements of full-length PAK-2 and caspase-activated PAK-2p34. Mamm Genome 2011; 22(5-6):306-17 doi 10.1007/s00335-011-9326-6. [0199] 53. Reddy P N, Radu M, Xu K, Wood J, Harris C E, Chemoff J, et al. p21-activated kinase 2 regulates HSPC cytoskeleton, migration, and homing via CDC42 activation and interaction with beta-Pix. Blood 2016; 127(16):1967-75 doi 10.1182/blood-2016-01-693572. [0200] 54. Rudel T, Bokoch G M. Membrane and morphological changes in apoptotic cells regulated by caspase-mediated activation of PAK2. Science (New York, N.Y. 1997; 276(5318):1571-4. [0201] 55. Zhang Y, Wester L, He J, Geiger T, Moerkens M, Siddappa R, et al. IGF1R signaling drives antiestrogen resistance through PAK2/PIX activation in luminal breast cancer. Oncogene 2018 doi 10.1038/s41388-017-0027-9. [0202] 56. Sarioglu A F, Aceto N, Kojic N, Donaldson M C, Zeinali M, Hamza B, et al. A microfluidic device for label-free, physical capture of circulating tumor cell clusters. Nature methods 2015; 12(7):685-91 doi 10.1038/nmeth.3404. [0203] 57. Labelle M, Begum S, Hynes R O. Direct signaling between platelets and cancer cells induces an epithelial-mesenchymal-like transition and promotes metastasis. Cancer Cell 2011; 20(5):576-90 doi 10.1016/j.ccr.2011.09.009. [0204] 58. Yang J, Yan R, Roy A, Xu D, Poisson J, Zhang Y. The I-TASSER Suite: protein structure and function prediction. Nat Methods 2015; 12(1):7-8 doi 10.1038/nmeth.3213. [0205] 59. Kozakov D, Hall D R, Xia B, Porter K A, Padhorny D, Yueh C, et al. The ClusPro web server for protein-protein docking. Nat Protoc 2017; 12(2):255-78 doi 10.1038/nprot.2016.169. [0206] 60. Chen H, Sun Y, Shen Y. Predicting protein conformational changes for unbound and homology docking: learning from intrinsic and induced flexibility. Proteins 2017; 85(3):544-56 doi 10.1002/prot.25212. [0207] 61. Oliwa T, Shen Y. cNMA: a framework of encounter complex-based normal mode analysis to model conformational changes in protein interactions. Bioinformatics 2015; 31(12):i151-60 doi 10.1093/bioinformatics/btv252. [0208] 62. Alexander N, Woetzel N, Meiler J. bcl::Cluster: A method for clustering biological molecules coupled with visualization in the Pymol Molecular Graphics System. IEEE Int Conf Comput Adv Bio Med Sci 2011; 2011:13-8 doi 10.1109/ICCABS.2011.5729867. [0209] 63. Brown W. Some experimental results in the correlation of mental abilities. British Journal of Psychology 1910; 3:296-322. [0210] 64. Spearman C C. Correlation calculated from faulty data. British Journal of Psychology 1910; 3:271-95.
[0211] Supplementary Methods and Materials
[0212] Mouse models and tumor dissociation. NOD/SCID mice 8-10 weeks of age were used for PDXs and human MDA-MB-231 cell-based xenograft studies. The triple negative (TN) PDXs and MDA-MB-231 cells were lentivirally labeled by eGFP, tdTomato, Luc2-eGFP (L2G), or Luc2-tdTomato (L2T) using the lentiviruses and labeling protocol previously described (1,2). PyMT (MMTV-PyMT) transgenic mice (3) were bred and crossed with MacBlue mice [Csflr-GAL4-VP16/UAS-enhanced cyan fluorescent protein (ECFP)](4) in the animal facility of Albert Einstein College of Medicine.
[0213] PDX tumors were harvested and dissociated either with collagenase III (TN1 model) or liberase TH and TM research grade enzyme blends (TN2 model and lung tissues). Briefly, tumors or lung tissues were minced and incubated for 2-4 h at 37° C. with collagenase III (Worthington Biochemical) or liberase TH and TM (Roche) and 100 Kunitz U of DNase I (Sigma) in 20 mL of RPMI medium with 20 mM HEPES buffer. Single-cell suspensions were filtered through 40-μm nylon cell strainers and washed with Hank's balanced salt solution (HBSS; Sigma) containing 2% heat-inactivated fetal bovine serum (FBS). Red blood cells were lysed with ACK lysis buffer, and dissociated bulk tumor cells were either cultured or stained with various antibodies in HBSS/2% FBS for further flow analysis or sorting on a BD FacsAria (BD Biosciences). 4′,6-diamidino-2-phenylindole (DAPI) and H2Kd were used as markers for viability and mouse stromal cells, respectively.
[0214] Intravital imaging. For PyMT mice, the multiphoton intravital imaging was performed using a skin flap procedure as previously described with a custom-built 2-laser multiphoton microscope (3,5). The animal was placed in a heated chamber maintained at physiologic temperature during the course of imaging and monitored using MouseOx (Starr Life Sciences). In order to label the blood vessels, three milligrams of 155-kDa TMR-dextran or 100 μL of 8 μmol/L Qdots 705 was administered via a tail vein catheter (Qdots [Qdots ITK 705] were obtained from Life Technologies or A. Smith, University of Illinois Urbana-Champaign).
[0215] For TN PDX models, the intravital imaging was performed on tumors that had reached 0.7-1 cm in diameter as the optimal time window, using an Olympus FV1000-MPE microscope with a 25×, 1.05 NA water immersion objective with correction collar as described (6). The laser-light source consists of a standard femtosecond-pulsed laser system (Mai Tai HP with DeepSee, Newport/Spectra-Physics). Texas Red 2 dextran (70 kDa; Invitrogen, cat #D1830) was used to mark the blood vasculature through the lateral tail veins of the mice, just prior to an imaging session. In vivo migration images were collected in random fields of 512×512 μm at 512×512 pixels for a depth of 100 μm (21 slices at steps of 5 μm) beginning at the edge of the tumor. Images were taken at 2 min intervals for a total of 30 min. TN1 cells analyzed in this study expressed eGFP (L2G) and were visualized based on their fluorescence expression. Images were reconstructed in 3D and through time using ImageJ.
[0216] Intravital multiphoton imaging of MDA-MB-231 tumor-bearing mice was performed with methods similar to previous studies (6) using an Olympus FV1000-MPE microscope with a 25×, 1.05 NA water immersion objective with correction collar. Imaging was performed on fields of 512×512 μm at 512×512 pixels for a depth of 100 μm (21 slices at steps of 5 μm) beginning at the edge of the tumor. The edge of the tumor was defined as the junction of the GFP-labeled tumor cells with the absence of GFP signal. Collagen I fibers were captured using the second harmonic signal excited at 880 nm and imaged through a 410-440 nm bandpass filter. Images were acquired at 2 min intervals for a total of 30 min. Blood vessels were visualized by direct injection of Texas Red dextran (Invitrogen) through the lateral tail veins of the mice just prior to intravital imaging.
[0217] Bioluminescence imaging. Mice were injected intraperitoneally with 100 μL of D-luciferin (30 mg/mL, Gold Biotechnology). After 5-10 min, mice were anesthetized with isoflurane, and bioluminescence images were acquired using the Xenogen IVIS spectrum system (Caliper Life Sciences). Acquisition times ranged from 5 s to 5 min. Signals are presented as total photon flux and analyzed using Living Image 3.0 software (Caliper Life Sciences).
[0218] Blood collection and CTC analysis. This study was approved by the Institutional Review Board (IRB) of Northwestern University. All patients signed informed consent to participate in this study. Approximately 8-10 mL of whole blood was collected from breast cancer patients into a 10-mL CellSave Preservative tube containing a cellular fixative (Janssen Diagnostics, LLC, Raritan, N.J.). Blood specimens were maintained at room temperature (RT) and processed within 96 h of being drawn. CTC analysis was performed using CellSearch® CTC kits on the FDA-approved CellSearch System (Janssen Diagnostics), as previously described (7). CTCs were identified by positive staining for both cytokeratins (CK) and DAPI and negative staining for CD45 (CK+/DAPI+/CD45−). CTC clusters were defined as an aggregation of two or more individual CTCs containing distinct nuclei and intact cytoplasmic membranes. To determine the expression of CD44 on CTCs, the FITC-conjugated anti-CD44 antibody (BD) was also added.
[0219] For the PDXs, after tumors reached about 2 cm in diameter, up to 1 mL fresh whole blood was collected via terminal cardiac puncture of the right ventricle using a 25G or 26G needle attached to a 1 mL syringe prefilled with 100 μL phosphate-buffered saline (PBS)/EDTA, and rapidly injected to a falcon tube with an equal volume of PBS/10 mM EDTA. Red blood cells were optionally depleted with 2% (weight/volume) dextran incubation for 30 min at 37° C. Unsettled cells were spun and followed by red blood cell lysis with ACK buffer (Invitrogen). The rest of the cells were stained with 1 μg/mL Hoechst 33342 (optional) and spread onto a 24-well plate, and live CTCs were imaged under fluorescence microscopy (Nikon).
[0220] Invasive cell collection in vivo. Micro-needle collection of breast tumor cells in live anesthetized mice was carried out as described previously (8,9). Human recombinant EGF (Invitrogen) (25 nmol/L) was used as a chemoattractant for active collection. Cells can only be collected into the needles by active migration and invasion because a Matrigel block is used to prevent passive collection of cells and tissue during insertion of the needle into the tissue. After 4 h, the needles were removed from the xenograft tumors and the total number of cells collected was determined by DAPI staining and microscopy analysis.
[0221] Hyaluronan inhibition. Two complementary approaches were utilized to inhibit hyaluronan, the known CD44 ligand, in the two models. First, for the TN PDX model, dissociated cells were treated with hyaluronan antagonist (o-HA, HA oligomers) at 100 μg/mL during the 72-hour aggregation assays. For MDA-MB-231 cells, the hyaluronic acid synthase inhibitor 4-methylumbelliferone (4-MU, 0.4 mM/L) was added to the adherent culture. After 48 h of treatment, the cells were trypsinized and transferred to a poly-hydroxyethyl methacrylate (Poly-HEMA, Sigma-Aldrich) coated plate, and the images were taken at the indicated times by Leica microscopy.
[0222] CD44 knockout using CRISPR-Cas9 technology. CRISPR/Cas9 targeting was performed using the LentiCrisprV2 system (10). Guides to knock out CD44 were selected using the online sgRNA analysis tool located at crispr.mit.edu. High ranking guides (>80) in the first three exons that had an in-frame PAM sequence were selected and cloned as previously described into LentiCrisprV2. Following sequence verification, virus was produced by transfection of the LentiCrisprV2 construct, PsPax, and pMD2 in a 1:0.75:0.3 ratio into HEK293T cells. Two days after transfection, supernatants containing virus were harvested, passed through a 0.45 μm filter, and incubated with recipient cells for two days before initiation of puromycin selection. The vector and virus with gRNA1 targeting CD44 exon 2 (F—CACCG TCGCTACAGCATCTCTCGGA; R—AAAC TCCGAGAGATGCTGTAGCGA C) was used in most of the knockout experiments.
[0223] Flow cytometry and cell sorting. Dissociated tumor cells from PDXs or cultured MDA-MB-231 cells were resuspended at 10 million per mL in PBS/2% FBS or HBSS/2% FBS. Cells were blocked with IgG prior to incubation with specific antibodies, such as mouse anti-human CD44-APC (BD #559942), isotype control mouse IgG2b-APC (BD #555745), isotype control mouse IgG2b-PE (BD #555743), and for PDXs, the mouse stromal cell marker anti-H2Kd (BD), for 20 min at 4° C., followed by washing twice with PBS. Finally, the cells were diluted in PBS and analyzed on a BD-LSR II flow cytometer (BD Biosciences). Sterile cell preparations were filtered prior to flow analyses, with indicated populations sorted on a BDAria cell sorter (BD Biosciences) and collected in HBSS/20% FCS.
[0224] Cell clustering assay. Freshly dissociated primary tumor cells in single cell suspension were seeded in collagen type I-coated 96-well plates. The plates were put into the IncuCyte live cell imaging system (Essen BioScience), and live images were taken every 2-4 h for up to one week. The cluster number and size were analyzed by Incucyte ZOOM software (Essen BioScience). In specific experiments, primary tumor cells might be sorted based on the expression of CD44 prior to seeding. In other experiments, seeded tumor cells might be transfected with siRNAs (100 nM) or treated with various inhibitors during the clustering assays. For cell viability analysis during clustering, the IncuCyte Cytotox Red reagent (Essen BioScience) was added to the medium according to the manufacturer's instructions. For MDA-MB-231 cell-mediated clustering assays, cells were trypsinized into single cell suspension and transferred to poly-hydroxyethyl methacrylate (Poly-HEMA, Sigma-Aldrich)-coated plates. In anti-CD44 blocking experiments, cells were pretreated with IgG control or anti-CD44 antibody (400 μg/ml) for 30 mins, and then transferred to Poly-HEMA-coated plates. For overexpression experiments, HEK-293 cells were transfected with pCMV6-Flag-CD44 or pCMV6-Flag-ΔN21-97 CD44 plasmids for 48 h, and then trypsinized and incubated on the Poly-HEMA coated dishes. Images were taken at the indicated times within 60 min or 24 h by Leica microscopy. For gene modulations, cells were first transfected with siRNAs (100 nM). After 48 h, the cells were then trypsinized prior to clustering assays.
[0225] Mammosphere assay. Freshly isolated primary tumor cells were cultured overnight, and then clustered cells were collected by gentle pipetting and centrifugation at 400 rpm for 2 min. One half of the clustered cells were further dissociated by a quick trypsinization into single cells. Then 250 single cells or clusters containing an estimated 250 cells were plated in 96-well tissue culture plates covered with poly-HEMA in PRIME-XV® Tumorsphere serum-free medium (IrvineScientific). After 10 days of culture, the number of spheres with diameter >50 μm was counted.
[0226] Lung imaging. For spontaneous lung metastatic foci imaging from orthotopic breast tumor models, 1-5×105 eGFP-TN1 and 1-5×105 dTomato-TN1 tumor cells were prepared separately or mixed 1:1 and injected orthotopically into NOD/SCID mouse mammary fat pads (along with an equal volume of Matrigel from BD). After 8-12 weeks, the lungs were removed and the metastatic foci (single or mixed color) were captured and counted by two-photon or confocal microscopy. For assessment of the metastatic potential single CTCs and CTC clusters, freshly isolated primary tumor cells were cultured overnight, and then cells were collected by gentle pipetting and centrifugation at 400 rpm for 2 min (clustered cells). Half of the clustered cells were further dissociated by a quick trypsinization into single cells. Then 1×106 single cells or clustered equivalent were injected into NOD/SCID mice via tail vein. The mice were euthanized after 2 and 24 h, and lung were removed and imaged by fluorescence microscopy.
[0227] For the MDA-MB-231 cell-mediated colonization experiment, 5×105 L2T-labeled and 5×105 L2G-labeled cells were co-injected or separately injected (5 min apart, 10 min apart, and 2 h apart) into NOD/SCID mice via the tail vein. At the indicated times post-injection, the lungs were removed and imaged by fluorescence microscopy. To quantify the single and clustered colonies or the single- and mixed-color colonies in the lung, five or more images of the lungs were taken, and the number per image was counted.
[0228] For anti-CD44 blocking experiment, freshly isolated primary tumor cells (TN1 PDXs) were pretreated with IgG control or anti-CD44 antibody (400 μg/ml) for 30 mins, and then cultured in collagen type I-coated plates in the presence of antibody. NOD/SCID or NSG mice were treated (i.p.) with IgG or anti-CD44 antibody (100 μg/mouse) 6 hours before tumor injection via tail vein. For HEK-293 cells, CD44s-FLAG and ΔN21-97-FLAG were overexpressed via transient transfection 48 hours prior to collection and 5×105 cells were subsequent injected into each of the recipient NSG mice via tail vein infusion. The mice were euthanized 24 h post tail vein injection, and lung were removed and imaged by fluorescence microscopy. Five or more images of the lungs per mouse were taken, and the number of tumor cell clusters per image was counted.
[0229] RNA extraction and real-time PCR. Total RNAs were extracted using Trizol (Invitrogen), and RNA was precipitated with isopropanol and glycogen (Invitrogen). After reverse transcription reactions, real-time PCR for miRNAs/genes was performed using individual miRNA/gene Taqman primers (Applied Biosystems) with an ABI 7500 real-time PCR system. RNU44 and U6 primers were used for miRNA internal controls and GAPDH for a housekeeping gene control.
[0230] To identify the CD44 variants, total RNAs of TN1 and TN2 tumors were isolated using Trizol, and cDNAs were synthesized using gScript™ cDNA SuperMix (Bio-Rad). Real-time PCR was performed on an ABI 7500 system with iQ SYBR Green Supermix (Bio-Rad). The primer sequences were: CD44v3 forward primer, 5′-GCAGGCTGGGAG CCAAAT-3′; and reverse primer, 5′-GAGGTGTCTGTCTCTTT CATCTTCATT-3; CD44v6 forward primer, 5′-GGAACAGTGGTTTGGCAACAG-3′; and reverse primer, 5′-TTGGGTGTTTGGCGATATCC-3′. Results were analyzed with ABI Sequence Detection Software and the PCR products were also visualized in a 2% agarose gel stained with ethidium bromide. GAPDH was used as the housekeeping gene control.
[0231] Mass spectrometry. Tumor cell pellets were collected from cell sorting runs or siRNA transfections and then lysed with 2% SDS and protease inhibitor cocktail. Proteins were extracted using pulse sonication, and cleaned up by filter-aided sample preparation (FASP) to remove detergents. After LysC/Trypsin digestion, 500 ng proteins were analyzed via a 4-h LC/MS/MS method at Case Western Proteomics Core facility and the data processed using Scaffold. The fold change was calculated based on total unique spectrum counts.
[0232] Solid-phase homophilic interaction assay. High binding EIA/RIA microplate (Corning) were coated with purified CD44 protein (extracellular domain) (Thermo Scientific, 1 μg/well), or bovine serum albumin (BSA; 1 μg/well) in TBS (pH 7.4) overnight, and then blocked with 5% BSA/TBS for 2 h at room temperature. Different concentration of biotin-labeled CD44 (EZ-Link Sulfo-NHS-LC-Biotinylation Kit, Thermo Scientific) in binding buffer (TBS, 0.1% BSA, 1 mM MgCl2, 1 mM CaCl2) was added into coated wells, and incubated for 2 h at room temperature. Bound biotin-labeled CD44 was detected with streptavidin-HRP (Thermo Scientific) and quantified using the tetramethylbenzidine (TMB) substrate reagent kit (Pierce) at 450 nm.
[0233] Anoikis assay. Poly-HEMA was reconstituted in 95% ethanol to a concentration of 20 mg/mL. To prepare poly-HEMA-coated plates, 150 μL of poly-HEMA solution was added to each well of a 24-well plate and allowed to dry overnight in a laminar flow tissue culture hood. Cells were transfected and plated in triplicate in poly-HEMA-coated 24-well plates using regular culture medium. After 48 h, cells were collected and apoptosis was assayed by annexin V staining (BD Biosciences) according to the manufacturer's instructions.
[0234] Western blotting. Cells were washed twice in cold PBS, and then lysed in RIPA buffer with protein inhibitor cocktail (Sigma-Aldrich) or a buffer containing 50 mM Tris-HCl pH 7.4, 1% NP-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM NaF, 2 mM Na3VO4, 1 mM PMSF, 10 μg/mL aprotinin and 10 μg/mL leupeptin at 4° C. for 30 min. Equal amounts of protein of each sample were run on an SDS-PAGE gel, transferred to PVDF or Nitrocellulose membranes, blocked with 2% BSA/PBS for 1 h at RT, and then incubated with primary antibodies for 1 h at RT or 4° C. overnight and horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at RT. The primary antibodies that were used in our experiments include CD44 (Thermo Fisher Scientific; 156-3C11), PAK2 (Thermo Fisher Scientific, MA5-15527), FAK (Cell Signaling Technology, #3285), Oct 4 (Santa Cruz, sc-5279), FLAG (Sigma-Aldrich, F7425), HA-probe (Santa Cruz, 12CA5), and β-actin (Sigma, A5441).
[0235] Co-immunoprecipitation. For overexpression experiments, the cells were trypsinized after transfections, and incubated on the Poly-HEMA coated dishes for 3 h to aggregate. Aggregated cells were then collected, and lysed in Pierce IP lysis buffer (Thermo Fisher Scientific) with protease inhibitor cocktail at 4° C. for 30 min. One mg protein of each sample was incubated with 5 μg of anti-FLAG antibody (Sigma-Aldrich) or 25 μl of anti-HA magnetic beads (Thermo Fisher Scientific). For anti-FLAG immunoprecipitation, 25 μl of protein A/G plus-agarose (Santa Cruz, sc-2003) were added into samples after 1 h, and then further incubation for overnight at 4° C. Anti-HA magnetic bead-based immunoprecipitation was performed following the manufacturer's instruction. Beads were washed four times with washing buffer (1% Triton-100X in 0.1% TBS-T), and binding proteins were eluted with 0.1 M glycine pH 2-3 for 5-10 minutes and added with same amount of TBS to neutralize.
[0236] Immunohistochemistry. Formalin-fixed and paraffin-embedded mouse tissues (mouse xenografts primary tumors, lungs) and human tissues (primary tumors, lung, brain, and liver) were processed and sectioned by routine procedures. Heat-mediated antigen retrieval was used for all staining procedures. The tissues were incubated and stained overnight at 4° C. with different primary antibodies. The primary antibodies that were used include CD44 (Thermo Fisher Scientific, 156-3C11), Cytokeratin (Dako; AE1/AE3 (M3515) or CK34BE12), E-cadherin (BD biosciences; 610181), CD31 (abcam, ab28364), and EpCAM (Thermo Fisher Scientific, MA1-10195). All specimens were counterstained with Hematoxylin. Images of the whole tissue were taken with ScanScope (Aperio). CTCs were identified in the pulmonary vasculatures by tumor cell morphology, size and human cell surface markers. Quantitative analysis of CD44 expression in single CTCs and CTC clusters was calculated by the percentage of CD44 positive stained cells in the total population of single CTCs or CTC clusters.
[0237] Immunofluorescence. Cells were cultured in the Poly-HEMA coated plates for 48 h, and then were spun onto Cell-Tak (Corning) coated cover slides. Cells were fixed in 4% paraformaldehyde (PFA) for 10 min. After fixation, cells were permeabilized with 0.25% Triton X-100 in PBS, and then blocked with 2% bovine serum albumin in PBS for 1 h. All primary antibodies were incubated at RT for 1 h or at 4° C. overnight. Cells were then washed 3 times with PBS and incubated with Alexa 488- or Alexa 568-conjugated secondary antibodies (Thermo Fisher Scientific) for 1 h. Nuclei were counterstained with DAPI. The images were taken on a Leica TCS SP8 confocal microscope (Leica Microsystems). The primary antibodies that were used included CD44 (Thermo Fisher Scientific, 156-3C11) and the CellSearch kit (CD45 and CK).
[0238] Clinical outcome association analysis. Overall survival of Northwestern University cohort patients was defined as the time between CTC assessment blood draw and death from any cause. Differences in survival were tested by log-rank test and represented by Kaplan-Meier estimator plot. Statistical analysis was performed using STATA (StataCorp. (2015) Stata Statistical Software: Release 14.2. College Station, Tex.: StataCorp LP).
[0239] Overall survival, relapse-free survival, and distant metastasis-free survival of breast cancer patient cohorts in publicly or selectively available databases were analyzed via the online program Prognoscan using the optimal cutoff (11). The clinical information chart is referred to in Table 4.
[0240] Statistical Analysis
[0241] Inclusion and exclusion criteria for samples and animals. Animals with sickness and injury unrelated to implanted tumors were excluded from further studies and data analysis, based on a veterinarian's order. One clinical blood specimen with solely CTC clusters without single CTC counts at the first examination was excluded after the second examination report of zero CTC counts. Randomization of animal groups. Female NOD/SCID or NSG mice were randomized by cages with matched age and weight for different tumor implantations. For treatment groups and controls, equivalent tumor burden was also matched for randomized pre-clinical trials. Tumor growth and treatment response were objectively analyzed by bioluminescence and fluorescence imaging.
[0242] Blinded experimental design. One team of investigators performed the tumor implantation and another team was assigned to conduct blinded tumor imaging under non-blinded supervision. The imaging results were analyzed by multiple people in a blinded and non-blinded combination.
[0243] Data availability. All of the data included in the manuscript are available to be shared upon request. Information on the public databases of breast tumors is provided in the Table 5.
REFERENCES
[0244] 1. Liu H, Patel M R, Prescher J A, Patsialou A, Qian D, Lin J, et al. Cancer stem cells from human breast tumors are involved in spontaneous metastases in orthotopic mouse models. Proc Natl Acad Sci USA 2010; 107(42):18115-20 doi 1006732107 [pii] 10.1073/pnas.1006732107. [0245] 2. Bockhorn J, Dalton R, Nwachukwu C, Huang S, Prat A, Yee K, et al. MicroRNA-30c inhibits human breast tumour chemotherapy resistance by regulating TWF1 and IL-11. Nat Commun 2013; 4:1393 doi http://www.nature.com/ncomms/jouirnal/v4/n1/suppinfo/ncomms2393_S1.html. [0246] 3. Harney A S, Arwert E N, Entenberg D, Wang Y, Guo P, Qian B Z, et al. Real-Time Imaging Reveals Local, Transient Vascular Permeability, and Tumor Cell Intravasation Stimulated by TIE2hi Macrophage-Derived VEGFA. Cancer Discov 2015; 5(9):932-43 doi 10.1158/2159-8290.CD-15-0012. [0247] 4. Ovchinnikov D A, van Zuylen W J, DeBats C E, Alexander K A, Kellie S, Hume D A. Expression of Gal4-dependent transgenes in cells of the mononuclear phagocyte system labeled with enhanced cyan fluorescent protein using Csflr-Gal4VP16/UAS-ECFP double-transgenic mice. Journal of leukocyte biology 2008; 83(2):430-3 doi 10.1189/jlb.0807585. [0248] 5. Entenberg D, Wyckoff J, Gligorijevic B, Roussos E T, Verkhusha V V, Pollard J W, et al. Setup and use of a two-laser multiphoton microscope for multichannel intravital fluorescence imaging. Nature protocols 2011; 6(10): 1500-20 doi 10.1038/nprot. 2011.376. [0249] 6. Patsialou A, Bravo-Cordero J J, Wang Y, Entenberg D, Liu H, Clarke M, et al. Intravital multiphoton imaging reveals multicellular streaming as a crucial component of in vivo cell migration in human breast tumors. Intravital 2013; 2(2):e25294 doi 10.4161/intv.25294. [0250] 7. Mu Z, Wang C, Ye Z, Austin L, Civan J, Hyslop T, et al. Prospective assessment of the prognostic value of circulating tumor cells and their clusters in patients with advanced-stage breast cancer. Breast Cancer Res Treat 2015; 154(3):563-71 doi 10.1007/s10549-015-3636-4. [0251] 8. Wyckoff J, Wang W, Lin E Y, Wang Y, Pixley F, Stanley E R, et al. A paracrine loop between tumor cells and macrophages is required for tumor cell migration in mammary tumors. Cancer research 2004; 64(19):7022-9. [0252] 9. Wyckoff J B, Segall J E, Condeelis J S. The collection of the motile population of cells from a living tumor. Cancer research 2000; 60(19):5401-4. [0253] 10. Sanjana N E, Shalem O, Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nature methods 2014; 11(8):783-4 doi 10.1038/nmeth.3047. [0254] 11. Mizuno H, Kitada K, Nakai K, Sarai A. PrognoScan: a new database for meta-analysis of the prognostic value of genes. BMC medical genomics 2009; 2:18 doi 10.1186/1755-8794-2-18.
Example 2—EGFR Promotes CD44-Mediated Breast Tumor Cluster Formation in Metastasis
[0255] Abstract
[0256] The epidermal growth factor receptor (EGFR) is known to be involved in several cancers, however, it is unclear whether it has a role in promoting circulating tumor cell (CTC) cluster-mediated metastasis. Our previous research demonstrated CD44 as a promoter of CTC clustering, which increases survival and drives metastasis. Our data demonstrates that EGFR contributes to the formation of this cell aggregation in a synergy with CD44. We found an EGFR monoclonal antibody (anti-EGFR, clone LA1, Millipore) that effectively blocks clustering in vitro and reduces lung metastasis. Furthermore, we present miR-30c as a potential therapeutic to disrupt CD44 and EGFR mediated clustering.
[0257] Introduction
[0258] Metastasis remains as the major cause of cancer mortality and it demands a better understanding for more effective treatments. In order for tumor cells to metastasize, they must overcome several barriers. One of the first a few steps are invasion and intravasation from the primary tumor in order to circulate through the peripheral vasculature. Circulating tumor cells (CTCs) are associated with a poor prognosis. In addition to the dogma of single cell-mediated dissemination, we recently demonstrated that clustered CTCs are more tumorigenic and metastatic than single CTCs with advantages of enhanced regenerative power or stem cell properties (stemness).sup.1. However, there is no existing therapeutics targeting CTC clusters to our knowledge.
[0259] Stemness has been demonstrated to be one of the requisites for successful cancer metastasis.sup.1-3. Within a tumor, such subpopulations of cancer cells with regenerative stemness have the potential of self-renewal, proliferation, plasticity, and differentiation, giving rise to heterogeneous progenies.sup.4,5. Many molecular markers of stemness have been identified in various cancer types, such as CD44 in breast cancer.sup.6 and LGR5 in colon cancer.sup.2,7-10, whereas the functional contribution of CD44 to stemness and metastasis has been elusive. Notably, our recent studies have unveiled a new role of CD44 in circulating tumor cell cluster aggregation via its homophilic interactions that drive polyclonal metastases.sup.1. However, the regulatory network surrounding CD44's function in CTC clusters and subsequent therapeutic targeting strategies are largely unknown and yet to be determined.
[0260] The epidermal growth factor receptor (EGFR) is a tyrosine kinase that has been known to be involved in several cancers by promoting its growth, differentiation and migration.sup.11. Several targeted treatments have been developed to target EGFR through tyrosine kinase inhibitors and monoclonal antibodies. FDA approved drugs such as Cetuximab and Erlotinib have proven to be effective in squamous cell carcinoma of the head and neck and lung cancer respectively, however, an effective treatment blocking EGFR in breast cancer remains to be identified.sup.11. Although the importance of EGFR in cancer formation is well established, its role in CTC cluster-mediated metastasis and cross talk with CD44 are not well understood. Here, we seek to identify the role of EGFR in breast cancer clustering. We have identified a CD44-targeting microRNA, miR-30c and a monoclonal antibody of EGFR that has a potential efficacy to inhibit breast cancer metastasis.
[0261] Results
[0262] EGFR promotes cell clustering. Through a selected screening of neutralizing antibodies we identified an EGFR monoclonal antibody, clone LA1 instead of Cetuximab, as a strong inhibitor of clustering formation (
[0263] CD44 promotes EGFR stability and activity in clusters. Since we had previously identified CD44 as an essential mediator of CTC cluster formation, we examined if EGFR strengthens CD44 functions in this process. We first observed that EGFR+ PDX tumor cells were all CD44+ (
[0264] We then found that during the tumor clustering course, EGFR was phosphorylated (
[0265] Upon knockdown of CD44 there is a reduction in the total EGFR expression and hence phosphorylation (Y845) in TN1 PDX cells (
[0266] miR-30c reduces cell clustering and metastasis by targeting CD44. In our previous work we observed that microRNA 30c induction in breast cancer cells is effective in reducing metastasis in vivo and to inhibit chemotherapy resistance.sup.12,13. Now we further found that overexpression of miR-30c in patient derived xenograft (PDX) models results in a reduction in size and counts of breast tumor cell cluster formation in vitro (
[0267] Inhibition of EGFR successfully blocks clustering and lung colonization. Using flow cytometry, we found enriched EGFR expression in clustered cells in the blood of breast cancer patients (
[0268] Methods
[0269] Cell culture and transfections. MDA-MB-231 cells were purchased commercially from ATCC, and verified to be mycoplasma-negative using Lonza's MycoAlert Mycoplasma Detection Kit. Cells were maintained in DMEM with 10% FBS+1% Penicillin-Streptomycin (P/S). Primary tumor cells were cultured in HuMEC ready medium (Life technologies)+5% FBS and 0.5% P/S, and Collagen type I (BD Biosciences) coated plates. MiRNAs (Dharmacon, negative control #4), and siRNAs (pooled) (Dharmacon, negative control A) were transfected using Dharmafect (Dharmacon) at 100 nM.
[0270] Western blot. Cells were lysed by RIPA buffer supplemented with Amresco protease inhibitor cocktail (1:100 diluted) and centrifuged for 10 mins at 4 degrees and 10,000 RPM. Protein concentration was measured and 20 ug of protein was loaded for each sample. Antibodies used: EGFR, p-EGFR, b-actin (abcam).
[0271] RNA extraction and real-time PCR. Total RNAs were extracted using Trizol (Invitrogen), and RNA was precipitated with isopropanol and glycogen (Invitrogen). After reverse transcription reactions, real-time PCR for miRNAs/genes were performed using individual miRNA/gene Taqman primers (Applied Biosystems) with ABI 7500 real time PCR system. RNU44 and U6 primers were used for miRNA internal controls and GAPDH for housekeeping gene control.
[0272] Mouse models and tumor dissociation. 8-10 weeks old NOD/SCIDmice were used for PDXs and human MDA-MB-231 cell-based xenograft studies. The triple negative PDXs and MDA-MB-231 cells were lentivirally labeled by eGFP, tdTomato, Luc2-eGFP (L2G), or Luc2-tdTomato (L2T) using the lentiviruses and labeling protocol as described previously.sup.3. PDX tumors were harvested and dissociated either with Collagenase III (TN1 model) or Liberase TH and TM research grade (TN2 model and lung tissues). Briefly, tumors were minced and incubated for 2-4 h at 37° C. with Collagenase III (Wortington Biomedical) or Liberase TH and TM (Roche) and 100 Kunitz U of DNase I (Sigma) in 20 mL of RPMI medium with 20 mM Hepes buffer. Single-cell suspensions were filtered through 40-μm nylon cell strainers and washed with Hanks' balanced saline solution (HBSS; Sigma) containing 2% heat-inactivated fetal bovine serum (FBS). Red blood cells were lysed with ACK lysis buffer, and dissociated bulk tumor cells were either cultured or stained with various antibodies in HBSS/2% FBS for further flow analysis or sorting on a BD FacsAria (BD Biosciences). DAPI and H2Kd were used as markers for viability and mouse stromal cells, respectively.
[0273] Bioluminescence imaging. Mice were injected intraperitoneally (i.p.) with 100 μL of D-luciferin (30 mg/mL, Gold biotechnology). After 5-10 mins, mice were anesthetized with isoflurane, and bioluminescence images were acquired using the Xenogen IVIS spectrum system (Caliper Life Sciences). Acquisition times ranged from 1 s-5 min. Signals are presented as total photon flux and analyzed using Living Image 3.0 software (Caliper Life Sciences).
[0274] Cell clustering assay. Freshly dissociated primary tumor cells in single cell suspension were seeded in Collagen type I-coated 96 well plates. The plates were put into the IncuCyte live cell imaging system (Essen BioScience), and live images were taken every 2-4 hours for up to one week. The cluster number and size were analyzed by Incucyte ZOOM software (Essen BioScience). In specific experiments, primary tumor cells might be sorted based on the expression of CD44 prior to seeding. In other experiments, seeded tumor cells might be transfected with siRNAs (100 nM) or treated with various inhibitors during the clustering assays. For cell viability analysis during clustering, the IncuCyte® Cytotox Red reagent (Essen BioScience) was added into the medium according to the instruction.
[0275] Statistical analysis. Student's T test was performed and probabilities under 0.05 were considered significant and represented with one star (*). Probabilities under 0.001 were represented with two stars (**).
REFERENCES
[0276] 1. Liu, X. et al. Homophilic CD44 Interactions Mediate Tumor Cell Aggregation and Polyclonal Metastasis in Patient-Derived Breast Cancer Models. Cancer Discov 9, 96-113, doi:10.1158/2159-8290.CD-18-0065 (2019). [0277] 2. Melo, F. S. et al. A distinct role for LgrS+ stem cells in primary and metastatic colon cancer. Nature 543, 676-680, doi:10.1038/nature21713 (2017). [0278] 3. Liu, H. et al. Cancer stem cells from human breast tumors are involved in spontaneous metastases in orthotopic mouse models. Proc Natl Acad Sci USA 107, 18115-18120, doi:10.1073/pnas.1006732107 (2010). [0279] 4. Adorno-Cruz, V. et al. Cancer stem cells: targeting the roots of cancer, seeds of metastasis, and sources of therapy resistance. Cancer Res 75, 924-929, doi:10.1158/0008-5472.CAN-14-3225 (2015). [0280] 5. Mani, S. A. et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 133, 704-715, doi:10.1016/j.cell.2008.03.027 (2008). [0281] 6. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J. & Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci USA 100, 3983-3988, doi:10.1073/pnas.0530291100 (2003). [0282] 7. de Lau, W. et al. Lgr5 homologues associate with Wnt receptors and mediate R-spondin signalling. Nature 476, 293-297, doi:10.1038/nature10337 (2011). [0283] 8. Tian, H. et al. A reserve stem cell population in small intestine renders Lgr5-positive cells dispensable. Nature 478, 255-259, doi:10.1038/nature10408 (2011). [0284] 9. Gregorieff, A., Liu, Y., Inanlou, M. R., Khomchuk, Y. & Wrana, J. L. Yap-dependent reprogramming of Lgr5(+) stem cells drives intestinal regeneration and cancer. Nature 526, 715-718, doi:10.1038/nature15382 (2015). [0285] 10. Shimokawa, M. et al. Visualization and targeting of LGRS+ human colon cancer stem cells. Nature, doi:10.1038/nature22081 (2017). [0286] 11. Seshacharyulu, P. et al. Targeting the EGFR signaling pathway in cancer therapy. Expert Opin Ther Targets 16, 15-31, doi:10.1517/14728222.2011.648617 (2012). [0287] 12. Bockhorn, J. et al. MicroRNA-30c inhibits human breast tumour chemotherapy resistance by regulating TWF1 and IL-11. Nat Commun 4, 1393, doi:10.1038/ncomms2393 (2013). [0288] 13. Bockhorn, J. et al. MicroRNA-30c targets cytoskeleton genes involved in breast cancer cell invasion. Breast Cancer Res Treat 137, 373-382, doi:10.1007/s10549-012-2346-4 (2013).
Example 3—ICAM1 as a New Therapeutic Target of Tumor Clusters in Cancer Metastasis
[0289] In search of new molecular targets that are responsible for mediating breast cancer metastasis, we identified ICAM1, intercellular adhesion molecule 1, highly enriched in the lung metastatic cells and circulating tumor cell clusters. ICAM1 directs intercellular homophilic interactions between tumor-tumor cells as well as tumor-endothelial cells. ICAM1 knockdown abolishes the tumor cell clustering and lung colonization of breast cancer cells. We further two anti-ICAM1 neutralizing antibodies (one polyclonal antibody, R&D Cat #AF720; and one mouse mAb IgG2a, anti-ICAM1 R6.5 from ATCC) that can block tumor clustering as well as transendothelial migration of breast cancer cells during metastasis.
[0290] ICAM1 is highly expressed in lung metastatic triple negative breast cancer (TNBC) cells, and correlates with worse patient outcome. We have generated multiple triple negative breast cancer (TNBC) patient-derived-xenograft (PDX) mouse models, which spontaneously metastasize to the lungs [1]. To further determine the mechanisms of TNBC metastasis, we performed single cell RNA sequencing to compare transcriptomes of PDX primary tumor cells to that of lung metastatic cells (
[0291] ICAM1 knockdown reduces metastatic and tumorigenic abilities of TNBCs. Next, we determined whether ICAM1 mediates metastasis in vivo. As expected, ICAM1 knockdown dramatically inhibited lung colonization of tail-vein-infused MDA-MB-231 and E0711 mouse tumor cells (
[0292] ICAM1 mediates tumor cell clustering through homophilic interactions.
[0293] Recently, we found that CTC clusters enrich sternness for a higher metastatic potential compared to single CTCs [2]. To further understand the role of ICAM1 in metastasis, we measured the expression of ICAM1 on CTCs from breast cancer patients using the CellSearch platform as well as flow cytometry. Compared to single CTCs, the percentage of ICAM1.sup.+ cells increased in CTC clusters (
[0294] Next step was to determine how ICAM-1 mediates tumor cell clustering. We overexpressed ICAM1 with two different tags at its C-terminal (ICAM1-Flag and ICAM1-Myc) into two separate sets of HEK-293 cells. Upon dissociation, we mixed two sets of ICAM-Flag-expressing and ICAM1-Myc-expressing to form aggregated clusters (
[0295] ICAM1 downstream pathways and target genes. To elucidate the downstream pathways, we compared the transcriptome and proteomics of MDA-MB-231 cells upon siICAM1-mediated knockdown. RNA sequencing revealed multiple downregulated pathways (biosynthesis, cell proliferation and sternness-related Smoothened signaling) as well as upregulated pathways (stress-activated signaling, cell junction, and apoptosis) (
[0296] ICAM1 mediates transendothelial migration (TEM) of breast cancer cells. To metastasize, tumor cells have to transmigrate through the endothelium, where ICAM1 can be highly expressed. Since we found that ICAM-1 directs intercellular homophilic interactions, we hypothesize that ICAM1 enhances TEM through its heterotypic interactions between a tumor cell and an endothelial cell. To test this hypothesis, ICAM1 was knock downed in MDA-MB-231 cells, or HUVEC endothelial cells, or both. The TEM analyses demonstrated that knockdown ICAM1 in both cells completely inhibited TEM. Knockdown ICAM1 in either MDA-MB-231 cells, or HUVEC cells also dramatically inhibited TEM (
REFERENCES
[0297] 1. Liu, H., et al., Cancer stem cells from human breast tumors are involved in spontaneous metastases in orthotopic mouse models. Proc Natl Acad Sci USA, 2010. 107(42): p. 18115-20. [0298] 2. Liu, X., et al., Homophilic CD44 Interactions Mediate Tumor Cell Aggregation and Polyclonal Metastasis in Patient-Derived Breast Cancer Models. Cancer Discov, 2019. 9(1): p. 96-113.
[0299] In the foregoing description, it will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention. Thus, it should be understood that although the present invention has been illustrated by specific embodiments and optional features, modification and/or variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[0300] Citations to a number of patent and non-patent references are made herein. The cited references are incorporated by reference herein in their entireties. In the event that there is an inconsistency between a definition of a term in the specification as compared to a definition of the term in a cited reference, the term should be interpreted based on the definition in the specification.