AMYLOID PRECURSOR PROTEIN (APP) RNAi AGENT COMPOSITIONS AND METHODS OF USE THEREOF
20220002724 · 2022-01-06
Assignee
Inventors
- Stuart Milstein (Cambridge, MA)
- Kirk Brown (Cambridge, MA, US)
- Jayaprakash Nair (Cambridge, MA, US)
- Martin Maier (Cambridge, MA)
- Vasant Jadhav (Cambridge, MA)
- Mark Keating (Cambridge, MA, US)
- Adam CASTORENO (Cambridge, MA, US)
- Patrick Haslett (Cambridge, MA, US)
- Mangala Meenakshi Soundarapandian (Cambridge, MA, US)
- Kevin FITZGERALD (Cambridge, MA, US)
Cpc classification
C12N2750/14143
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K48/005
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The disclosure relates to double stranded ribonucleic acid (dsRNAi) agents and compositions targeting the APP gene, as well as methods of inhibiting expression of an APP gene and methods of treating subjects having an APP-associated disease or disorder, such as cerebral amyloid angiopathy (CAA) and early onset familial Alzheimer disease (EOFAD or eFAD), using such dsRNAi agents and compositions.
Claims
1-168. (canceled)
169. A double stranded ribonucleic acid (RNAi) agent comprising a sense strand and an antisense strand, wherein (a) the antisense strand comprises a region of complementarity comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence: TABLE-US-00053 (SEQ ID NO: 2743) 5′-UUAGGUTGGAUTUUCGUAGCCGU-3′ or (SEQ ID NO: 1870) 5′-UUAGGUTGGAUUUUCGUAGCCGU-3′; (b) the sense strand comprises one or more lipophilic moieties conjugated to one or more non-terminal nucleotide positions, excluding the cleavage site region of the sense strand; and (c) the double stranded RNAi agent comprises at least one modified nucleotide.
170. The double stranded RNAi agent of claim 169, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence 5′-GGCUACGAAAAUCCAACCUAA-3′ (SEQ ID NO: 2735).
171. The double stranded RNAi agent of claim 170, wherein (a) all of the nucleotides of the sense strand are modified nucleotides; (b) substantially all of the nucleotides of the antisense strand are modified nucleotides; (c) all of the nucleotides of the antisense strand are modified nucleotides; or (d) all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.
172. The double stranded RNAi agent of claim 170, wherein at least one of the modified nucleotides is selected from the group consisting of a deoxy-nucleotide, a 3′-terminal deoxy-thymidine (dT) nucleotide, a 2′-O-methyl modified nucleotide, a 2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2′-amino-modified nucleotide, a 2′-O-allyl-modified nucleotide, 2′-C-alkyl-modified nucleotide, 2′-hydroxy-modified nucleotide, a 2′-methoxyethyl modified nucleotide, a 2′-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, a nucleotide comprising a 5′-methylphosphonate group, a nucleotide comprising a 5′ phosphate or 5′ phosphate mimic, a nucleotide comprising vinyl phosphate, a nucleotide comprising adenosine-glycol nucleic acid (GNA), a nucleotide comprising thymidine-glycol nucleic acid (GNA)S-Isomer, a nucleotide comprising 2-hydroxymethyl-tetrahydrofurane-5-phosphate, a nucleotide comprising 2′-deoxythymidine-3′phosphate, a nucleotide comprising 2′-deoxyguanosine-3′-phosphate, and a terminal nucleotide linked to a cholesteryl derivative and a dodecanoic acid bisdecylamide group.
173. The double stranded RNAi agent of claim 172, wherein said modified nucleotide is selected from the group consisting of a 2′-deoxy-2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, 3′-terminal deoxy-thymidine nucleotides (dT), a locked nucleotide, an abasic nucleotide, a 2′-amino-modified nucleotide, a 2′-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide.
174. The double stranded RNAi agent of claim 172, wherein the modifications on the nucleotides are 2′-O-methyl, GNA, and 2′fluoro modifications.
175. The double stranded RNAi agent of claim 172, further comprising at least one phosphorothioate internucleotide linkage.
176. The double stranded RNAi agent of claim 175, wherein the double stranded RNAi agent comprises 6-8 phosphorothioate internucleotide linkages.
177. The double stranded RNAi agent of claim 169, wherein the region of complementarity is at least 17 nucleotides in length.
178. The double stranded RNAi agent of claim 169, wherein the region of complementarity is 19-23 nucleotides in length.
179. The double stranded RNAi agent of claim 169, wherein each strand is no more than 30 nucleotides in length.
180. The double stranded RNAi agent of claim 169, wherein at least one strand comprises a 3′ overhang of at least 1 nucleotide.
181. The double stranded RNAi agent of claim 169, wherein the antisense strand comprises a 3′ overhang of at least 2 nucleotides.
182. The double-stranded RNAi agent of claim 169, wherein the one or more lipophilic moieties are conjugated to one or more of positions 4-8 and 13-18 on the sense strand.
183. The double-stranded RNAi agent of claim 169, wherein one or more lipophilic moieties are conjugated to one or more of positions 5, 6, 7, 15, and 17 on the sense strand.
184. The double-stranded RNAi agent of claim 169, wherein the lipophilic moiety contains a saturated or unsaturated C.sub.4-C.sub.30 hydrocarbon chain, and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne.
185. The double-stranded RNAi agent of claim 184, wherein the lipophilic moiety contains a saturated or unsaturated C6-Cis hydrocarbon chain.
186. The double-stranded RNAi agent of claim 185, wherein the lipophilic moiety contains a saturated or unsaturated C16 hydrocarbon chain.
187. The double stranded RNAi agent of claim 169, wherein the one or more non-terminal nucleotide positions of the sense strand have the following structure: ##STR00018## wherein B is a nucleotide base or a nucleotide base analog.
188. The double-stranded RNAi agent claim 169, further comprising a phosphate or phosphate mimic at the 5′-end of the antisense strand.
189. The double-stranded RNAi agent of claim 188, wherein the phosphate mimic is a 5′-vinyl phosphonate (VP).
190. A cell containing the double stranded RNAi agent of claim 169.
191. A pharmaceutical composition comprising the double stranded RNAi agent of claim 169.
192. The pharmaceutical composition of claim 191, comprising a buffer solution.
193. The pharmaceutical composition of claim 192, wherein said buffer solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
194. The pharmaceutical composition of claim 192, wherein the buffer solution is phosphate buffered saline (PBS).
195. A method of inhibiting expression of an amyloid precursor protein (APP) gene in a cell, the method comprising: (a) contacting the cell with the double stranded RNAi agent of claim 169; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of an APP gene, thereby inhibiting expression of the APP gene in the cell.
196. The method of claim 195, wherein said cell is within a subject.
197. The method of claim 196, wherein the subject is a human.
198. The method of claim 197, wherein the human subject suffers from an APP-associated disorder.
199. The method of claim 198, wherein the APP-associated disease is cerebral amyloid angiopathy (CAA), early onset familial Alzheimer disease (EOFAD), or Alzheimer's disease (AD).
200. A method of treating a human subject having an APP-associated disorder, comprising administering to the subject a therapeutically effective amount of the double stranded RNAi agent of claim 169, thereby treating said subject.
201. The method of claim 200, wherein the APP-associated disease is cerebral amyloid angiopathy (CAA), early onset familial Alzheimer disease (EOFAD), or Alzheimer's disease (AD).
202. The method of claim 200, further comprising administering an additional therapeutic agent to the subject.
203. The method of claim 200, wherein the administering is by intrathecal administration.
204. The double-stranded RNAi agent claim 169, selected from the group consisting of AD-454973, AD-886864.1, AD-886865.1, AD-886866.1, AD-886867.1, AD-886868.1, AD-886869.1, AD-886872.1, AD-886876.1, AD-886878.1, AD-886879.1, AD-886886.1, and AD-886887.1.
205. The double-stranded RNAi agent claim 169, selected from the group consisting of AD-886870.1, AD-886871.1, AD-886873.1, AD-886874.1, AD-886875.1, AD-886877.1, AD-886877.2, AD-886880.1, AD-886881.1, AD-886888.1, AD-886889.1, or AD-886889.2.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0131] The following detailed description, given by way of example, but not intended to limit the disclosure solely to the specific embodiments described, may best be understood in conjunction with the accompanying drawings, in which:
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168]
[0169]
[0170]
[0171]
DETAILED DESCRIPTION OF THE INVENTION
[0172] The present disclosure provides RNAi compositions, which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of an amyloid precursor protein (APP) gene. The APP gene may be within a cell, e.g., a cell within a subject, such as a human. The present disclosure also provides methods of using the RNAi compositions of the disclosure for inhibiting the expression of an APP gene and/or for treating a subject having a disorder that would benefit from inhibiting or reducing the expression of an APP gene, e.g., an APP-associated diseases, for example, cerebral amyloid angiopathy (CAA) or Alzheimer's disease (AD), e.g., early onset familial Alzheimer disease (EOFAD).
[0173] The RNAi agents of the disclosure include an RNA strand (the antisense strand) having a region which is about 30 nucleotides or less in length, e.g., 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of an APP gene.
[0174] In certain embodiments, the RNAi agents of the disclosure include an RNA strand (the antisense strand) which can include longer lengths, for example up to 66 nucleotides, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, 27-53 nucleotides in length with a region of at least 19 contiguous nucleotides that is substantially complementary to at least a part of an mRNA transcript of an APP gene. These RNAi agents with the longer length antisense strands preferably include a second RNA strand (the sense strand) of 20-60 nucleotides in length wherein the sense and antisense strands form a duplex of 18-30 contiguous nucleotides.
[0175] The use of these RNAi agents enables the targeted degradation of mRNAs of an APP gene in mammals. Very low dosages of APP RNAi agents, in particular, can specifically and efficiently mediate RNA interference (RNAi), resulting in significant inhibition of expression of an APP gene. Using cell-based assays, the present inventors have demonstrated that RNAi agents targeting APP can mediate RNAi, resulting in significant inhibition of expression of an APP gene. Thus, methods and compositions including these RNAi agents are useful for treating a subject who would benefit by a reduction in the levels and/or activity of an APP protein, such as a subject having an APP-associated disease, for example, CAA or AD, including, e.g., EOFAD.
[0176] The following detailed description discloses how to make and use compositions containing RNAi agents to inhibit the expression of an APP gene, as well as compositions and methods for treating subjects having diseases and disorders that would benefit from inhibition and/or reduction of the expression of this gene.
I. Definitions
[0177] In order that the present disclosure may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this disclosure.
[0178] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements.
[0179] The term “including” is used herein to mean, and is used interchangeably with, the phrase “including but not limited to”. The term “or” is used herein to mean, and is used interchangeably with, the term “and/or,” unless context clearly indicates otherwise.
[0180] The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means ±10%. In certain embodiments, about means ±5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.
[0181] The term “at least” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, “at least 18 nucleotides of a 21 nucleotide nucleic acid molecule” means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range.
[0182] As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or intergers, as logical from context, to zero. For example, a duplex with an overhang of “no more than 2 nucleotides” has a 2, 1, or 0 nucleotide overhang. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range.
[0183] The term “APP” amyloid precursor protein (APP), also known as amyloid beta precursor protein, Alzheimer diseases amyloid protein and cerebral vascular amyloid peptide, among other names, having an amino acid sequence from any vertebrate or mammalian source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, and guinea pig, unless specified otherwise. The term also refers to fragments and variants of native APP that maintain at least one in vivo or in vitro activity of a native APP (including, e.g., the beta-amyloid peptide(1-40), beta-amyloid peptide(1-38) and beta-amyloid peptide(1-42) forms of Aβ peptide, among others), including variants of APP fragments that maintain one or more activities of an APP fragment that are neurotoxic in character (e.g., variant forms of A(342 peptide that maintain neurotoxic character are expressly contemplated). The term encompasses full-length unprocessed precursor forms of APP as well as mature forms resulting from post-translational cleavage of the signal peptide. The term also encompasses peptides that derive from APP via further cleavage, including, e.g., Aβ peptides. The nucleotide and amino acid sequence of a human APP can be found at, for example, GenBank Accession No. GI: 228008405 (NM_201414; SEQ ID NO: 1). The nucleotide and amino acid sequence of a human APP may also be found at, for example, GenBank Accession No. GI: 228008403 (NM_000484.3; SEQ ID NO: 2); GenBank Accession No. GI: 228008404 (NM_201413.2; SEQ ID NO: 3); GenBank Accession No. GI: 324021746 (NM_001136016.3; SEQ ID NO: 4); GenBank Accession No. GI: 228008402 (NM_001136129.2; SEQ ID NO: 5); GenBank Accession No. GI: 228008401 (NM_001136130.2; SEQ ID NO: 6); GenBank Accession No. GI: 324021747 (NM_001136131.2; SEQ ID NO: 7); GenBank Accession No. GI: 324021737 (NM_001204301.1; SEQ ID NO: 8); GenBank Accession No. GI: 324021735 (NM_001204302.1; SEQ ID NO: 9); and GenBank Accession No. GI: 324021739 (NM_001204303.1; SEQ ID NO: 10); and GenBank Accession No. GI: 1370481385 (XM_024452075.1; SEQ ID NO: 11).
[0184] The nucleotide and amino acid sequence of a Cynomolgus monkey APP can be found at, for example, GenBank Accession No. GI: 982237868 (XM 005548883.2; SEQ ID NO: 12). The nucleotide and amino acid sequence of a mouse APP can be found at, for example, GenBank Accession No. GI: 311893400 (NM_001198823; SEQ ID NO: 13). The nucleotide and amino acid sequence of a rat APP can be found at, for example, GenBank Accession No. GI: 402692725 (NM_019288.2; SEQ ID NO: 14). Additional examples of APP sequences are readily available using publicly available databases, e.g., GenBank, UniProt, and OMIM.
[0185] The term“APP” as used herein also refers to a particular polypeptide expressed in a cell by naturally occurring DNA sequence variations of the APP gene, such as a single nucleotide polymorphism in the APP gene. Numerous SNPs within the APP gene have been identified and may be found at, for example, NCBI dbSNP (see, e.g., www.ncbi.nlm.nih.gov/snp). Non-limiting examples of SNPs within the APP gene may be found at, NCBI dbSNP Accession Nos. rs193922916, rs145564988, rs193922916, rs214484, rs281865161, rs364048, rs466433, rs466448, rs532876832, rs63749810, rs63749964, rs63750064, rs63750066, rs63750151, rs63750264, rs63750363, rs63750399, rs63750445, rs63750579, rs63750643, rs63750671, rs63750734, rs63750847, rs63750851, rs63750868, rs63750921, rs63750973, rs63751039, rs63751122 and rs63751263. Certain exemplary rare APP variants that have been previously described to play a role in development of EOFAD were identified in Hooli et al. (Neurology 78: 1250-57). In addition, various “non-classical” APP variants that harbor an intraexonic junction within sequenced cDNA have recently been identified as associated with the occurrence of somatic gene recombination in the brains of AD patients (PCT/US2018/030520, which is incorporated herein by reference in its entirety). Examples of such “non-classical” APP variants include cAPP-R3/16 (SEQ ID NO: 1865), cAPP-R3/16-2 (SEQ ID NO: 1866), cAPP-R2/18 (SEQ ID NO: 1867), cAPP-R6/18 (SEQ ID NO: 1868), cAPP-R3/14 (SEQ ID NO: 1869), cAPP-R3/17 (SEQ ID NO: 1870), cAPP-R1/11 (SEQ ID NO: 1871), cAPP-R1/13 (SEQ ID NO: 1872), cAPP-R1/11-2 (SEQ ID NO: 1873), cAPP-R1/14 (SEQ ID NO: 1874), cAPP-R2/17 (SEQ ID NO: 1875), cAPP-R2/16 (SEQ ID NO: 1876), cAPP-R6/17 (SEQ ID NO: 1877), cAPP-R2/14 (SEQ ID NO: 1878), cAPP-R14/17-d8 (SEQ ID NO: 1879) and cAPP-D2/18-3 (SEQ ID NO: 1880). It is expressly contemplated that RNAi agents of the instant disclosure can be used to target “non-classical” APP variants and/or that RNAi agents optionally specific for such “non-classical” APP variants can be designed and used, optionally in combination with other RNAi agents of the instant disclosure, including those that target native forms of APP. Such “non-classical” APP variants were described as notably absent from an assayed HIV patient population, with prevalence of AD in the HIV patient population significantly diminished as compared to expected levels, which indicated that reverse transcriptase inhibitors and/or other anti-retroviral therapies commonly used to treat HIV patients likely also exerted a therapeutic/preventative role against AD. It is therefore expressly contemplated that the RNAi agents of the instant disclosure can optionally be employed in combination with reverse transcriptase inhibitors and/or other anti-retroviral therapies, for therapeutic and/or preventative purposes.
[0186] As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an APP gene, including mRNA that is a product of RNA processing of a primary transcription product. In one embodiment, the target portion of the sequence will be at least long enough to serve as a substrate for RNAi-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an APP gene.
[0187] The target sequence may be from about 9-36 nucleotides in length, e.g., about 15-30 nucleotides in length. For example, the target sequence can be from about 15-30 nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.
[0188] As used herein, the term “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.
[0189] “G,” “C,” “A,” “T” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively. However, it will be understood that the term “ribonucleotide” or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 1). The skilled person is well aware that guanine, cytosine, adenine, thymidine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of dsRNA featured in the disclosure by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the disclosure.
[0190] The terms “iRNA”, “RNAi agent,” “iRNA agent,” “RNA interference agent” as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. RNA interference (RNAi) is a process that directs the sequence-specific degradation of mRNA. RNAi modulates, e.g., inhibits, the expression of APP in a cell, e.g., a cell within a subject, such as a mammalian subject.
[0191] In one embodiment, an RNAi agent of the disclosure includes a single stranded RNAi that interacts with a target RNA sequence, e.g., an APP target mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory it is believed that long double stranded RNA introduced into cells is broken down into double-stranded short interfering RNAs (siRNAs) comprising a sense strand and an antisense strand by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease-III-like enzyme, processes these dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3′ overhangs (Bernstein, et al., (2001) Nature 409:363). These siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Thus, in one aspect the disclosure relates to a single stranded RNA (ssRNA) (the antisense strand of a siRNA duplex) generated within a cell and which promotes the formation of a RISC complex to effect silencing of the target gene, i.e., an APP gene. Accordingly, the term “siRNA” is also used herein to refer to an RNAi as described above.
[0192] In another embodiment, the RNAi agent may be a single-stranded RNA that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind to the RISC endonuclease, Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded RNAs are described in U.S. Pat. No. 8,101,348 and in Lima et al., (2012) Cell 150:883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150:883-894.
[0193] In another embodiment, a “RNAi agent” for use in the compositions and methods of the disclosure is a double stranded RNA and is referred to herein as a “double stranded RNAi agent,” “double stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”. The term “dsRNA” refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., an APP gene. In some embodiments of the disclosure, a double stranded RNA (dsRNA) triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.
[0194] In general, a number of nucleotides of each strand of a dsRNA molecule are ribonucleotides, but as described in detail herein, each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide and/or a modified nucleotide. In addition, as used in this specification, an “RNAi agent” may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides. As used herein, the term “modified nucleotide” refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, and/or a modified nucleobase. Thus, the term modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases. The modifications suitable for use in the agents of the disclosure include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by “RNAi agent” for the purposes of this specification and claims.
[0195] In certain embodiments of the instant disclosure, inclusion of a deoxy-nucleotide—which is acknowledged as a naturally occurring form of nucleotide—if present within a RNAi agent can be considered to constitute a modified nucleotide.
[0196] The duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 9 to 36 base pairs in length, e.g., about 15-30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.
[0197] The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3′-end of one strand and the 5′-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.” A hairpin loop can comprise at least one unpaired nucleotide. In some embodiments, the hairpin loop can comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides. In some embodiments, the hairpin loop can be 10 or fewer nucleotides. In some embodiments, the hairpin loop can be 8 or fewer unpaired nucleotides. In some embodiments, the hairpin loop can be 4-10 unpaired nucleotides. In some embodiments, the hairpin loop can be 4-8 nucleotides.
[0198] Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. In certain embodiments where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3′-end of one strand and the 5′-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a “linker” (though it is noted that certain other structures defined elsewhere herein can also be referred to as a “linker”). The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, an RNAi may comprise one or more nucleotide overhangs. In one embodiment of the RNAi agent, at least one strand comprises a 3′ overhang of at least 1 nucleotide. In another embodiment, at least one strand comprises a 3′ overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In other embodiments, at least one strand of the RNAi agent comprises a 5′ overhang of at least 1 nucleotide. In certain embodiments, at least one strand comprises a 5′ overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In still other embodiments, both the 3′ and the 5′ end of one strand of the RNAi agent comprise an overhang of at least 1 nucleotide.
[0199] In one embodiment, an RNAi agent of the disclosure is a dsRNA, each strand of which comprises 19-23 nucleotides, that interacts with a target RNA sequence, e.g., an APP target mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory, long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3′ overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188).
[0200] As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide that protrudes from the duplex structure of a RNAi agent, e.g., a dsRNA. For example, when a 3′-end of one strand of a dsRNA extends beyond the 5′-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; alternatively the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5′-end, 3′-end or both ends of either an antisense or sense strand of a dsRNA.
[0201] In one embodiment, the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3′-end and/or the 5′-end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3′-end and/or the 5′-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.
[0202] In certain embodiments, the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., 0-3, 1-3, 2-4, 2-5, 4-10, 5-10, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3′-end and/or the 5′-end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3′-end and/or the 5′-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.
[0203] In certain embodiments, the overhang on the sense strand or the antisense strand, or both, can include extended lengths longer than 10 nucleotides, e.g., 1-30 nucleotides, 2-30 nucleotides, 10-30 nucleotides, or 10-15 nucleotides in length. In certain embodiments, an extended overhang is on the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 3′end of the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 5′end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 3′end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5′end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate. In certain embodiments, the overhang includes a self-complementary portion such that the overhang is capable of forming a hairpin structure that is stable under physiological conditions.
[0204] The terms “blunt” or “blunt ended” as used herein in reference to a dsRNA mean that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a dsRNA, i.e., no nucleotide overhang. One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt ended. To be clear, a “blunt ended” dsRNA is a dsRNA that is blunt at both ends, i.e., no nucleotide overhang at either end of the molecule. Most often such a molecule will be double stranded over its entire length.
[0205] The term “antisense strand” or “guide strand” refers to the strand of a RNAi agent, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., an APP mRNA.
[0206] As used herein, the term “region of complementarity” refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., an APP nucleotide sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5′- and/or 3′-terminus of the RNAi agent.
[0207] The term “sense strand” or “passenger strand” as used herein, refers to the strand of a RNAi agent that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.
[0208] As used herein, the term “cleavage region” refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13.
[0209] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.
[0210] Complementary sequences within a RNAi agent, e.g., within a dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein.
[0211] “Complementary” sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing.
[0212] The terms “complementary,” “fully complementary” and “substantially complementary” herein can be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of a RNAi agent and a target sequence, as will be understood from the context of their use.
[0213] As used herein, a polynucleotide that is “substantially complementary to at least part of” a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding APP). For example, a polynucleotide is complementary to at least a part of an APP mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding APP.
[0214] Accordingly, in some embodiments, the antisense strand polynucleotides disclosed herein are fully complementary to the target APP sequence. In other embodiments, the antisense strand polynucleotides disclosed herein are substantially complementary to the target APP sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NOs: 1-14, or a fragment of SEQ ID NOs: 1-14, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.
[0215] In other embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target APP sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to any one of the sense strand nucleotide sequences in any one of Tables 2A, 2B, 3, 5A, 5B, 6, 9, 10-15, 16A, 16B, or 26, or a fragment of any one of the sense strand nucleotide sequences in any one of Tables 2A, 2B, 3, 5A, 5B, 6, 9, 10-15, 16A, 16B, or 26, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.
[0216] In one embodiment, an RNAi agent of the disclosure includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is the same as a target APP sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NOs: 15-28, or a fragment of any one of SEQ ID NOs: 15-28, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.
[0217] In one embodiment, at least partial suppression of the expression of an APP gene, is assessed by a reduction of the amount of APP mRNA which can be isolated from or detected in a first cell or group of cells in which an APP gene is transcribed and which has or have been treated such that the expression of an APP gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells). The degree of inhibition may be expressed in terms of:
[0218] The phrase “contacting a cell with an RNAi agent,” such as a dsRNA, as used herein, includes contacting a cell by any possible means. Contacting a cell with an RNAi agent includes contacting a cell in vitro with the RNAi agent or contacting a cell in vivo with the RNAi agent. The contacting may be done directly or indirectly. Thus, for example, the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.
[0219] Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent. Contacting a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, e.g., the central nervous system (CNS), optionally via intrathecal, intravitreal or other injection, or to the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the RNAi agent may contain and/or be coupled to a ligand, e.g., a lipophilic moiety or moieties as described below and further detailed, e.g., in U.S. Application Nos. 62/668,072, 62/738,747 and/or 62/773,082, that directs and/or otherwise stabilizes the RNAi agent at a site of interest, e.g., the CNS. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject.
[0220] In one embodiment, contacting a cell with a RNAi agent includes “introducing” or “delivering the RNAi agent into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of a RNAi agent can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing a RNAi agent into a cell may be in vitro and/or in vivo. For example, for in vivo introduction, a RNAi agent can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and/or are known in the art.
[0221] The term “lipophile” or “lipophilic moiety” broadly refers to any compound or chemical moiety having an affinity for lipids. One way to characterize the lipophilicity of the lipophilic moiety is by the octanol-water partition coefficient, log K.sub.ow, where K.sub.ow is the ratio of a chemical's concentration in the octanol-phase to its concentration in the aqueous phase of a two-phase system at equilibrium. The octanol-water partition coefficient is a laboratory-measured property of a substance. However, it may also be predicted by using coefficients attributed to the structural components of a chemical which are calculated using first-principle or empirical methods (see, for example, Tetko et al., J. Chem. Inf. Comput. Sci. 41:1407-21 (2001), which is incorporated herein by reference in its entirety). It provides a thermodynamic measure of the tendency of the substance to prefer a non-aqueous or oily milieu rather than water (i.e. its hydrophilic/lipophilic balance). In principle, a chemical substance is lipophilic in character when its log K.sub.ow exceeds 0. Typically, the lipophilic moiety possesses a log K.sub.ow exceeding 1, exceeding 1.5, exceeding 2, exceeding 3, exceeding 4, exceeding 5, or exceeding 10. For instance, the log K.sub.ow of 6-amino hexanol, for instance, is predicted to be approximately 0.7. Using the same method, the log K.sub.ow of cholesteryl N-(hexan-6-ol) carbamate is predicted to be 10.7.
[0222] The lipophilicity of a molecule can change with respect to the functional group it carries. For instance, adding a hydroxyl group or amine group to the end of a lipophilic moiety can increase or decrease the partition coefficient (e.g., log K.sub.ow) value of the lipophilic moiety.
[0223] Alternatively, the hydrophobicity of the double-stranded RNAi agent, conjugated to one or more lipophilic moieties, can be measured by its protein binding characteristics. For instance, in certain embodiments, the unbound fraction in the plasma protein binding assay of the double-stranded RNAi agent could be determined to positively correlate to the relative hydrophobicity of the double-stranded RNAi agent, which could then positively correlate to the silencing activity of the double-stranded RNAi agent.
[0224] In one embodiment, the plasma protein binding assay determined is an electrophoretic mobility shift assay (EMSA) using human serum albumin protein. An exemplary protocol of this binding assay is illustrated in detail in, e.g., U.S. Application Nos. 62/668,072, 62/738,747 and/or 62/773,082. The hydrophobicity of the double-stranded RNAi agent, measured by fraction of unbound siRNA in the binding assay, exceeds 0.15, exceeds 0.2, exceeds 0.25, exceeds 0.3, exceeds 0.35, exceeds 0.4, exceeds 0.45, or exceeds 0.5 for an enhanced in vivo delivery of siRNA.
[0225] Accordingly, conjugating the lipophilic moieties to the internal position(s) of the double-stranded RNAi agent provides optimal hydrophobicity for the enhanced in vivo delivery of siRNA.
[0226] The term “lipid nanoparticle” or “LNP” is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., a rNAi agent or a plasmid from which a RNAi agent is transcribed. LNPs are described in, for example, U.S. Pat. Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are hereby incorporated herein by reference.
[0227] As used herein, a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), a non-primate (such as a cow, a pig, a camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, a mouse, a horse, and a whale), or a bird (e.g., a duck or a goose). In an embodiment, the subject is a human, such as a human being treated or assessed for a disease, disorder or condition that would benefit from reduction in APP expression; a human at risk for a disease, disorder or condition that would benefit from reduction in APP expression; a human having a disease, disorder or condition that would benefit from reduction in APP expression; and/or human being treated for a disease, disorder or condition that would benefit from reduction in APP expression as described herein.
[0228] As used herein, the terms “treating” or “treatment” refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more symptoms associated with APP gene expression and/or APP protein production, e.g., APP-associated diseases or disorders such as AD, CAA (e.g., hereditary CAA) and EOFAD, among others. “Treatment” can also mean prolonging survival as compared to expected survival in the absence of treatment.
[0229] The term “lower” in the context of the level of APP in a subject or a disease marker or symptom refers to a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more. In certain embodiments, a decrease is at least 20%. “Lower” in the context of the level of APP in a subject is preferably down to a level accepted as within the range of normal for an individual without such disorder.
[0230] As used herein, “prevention” or “preventing,” when used in reference to a disease, disorder or condition thereof, that would benefit from a reduction in expression of an APP gene and/or production of APP protein, refers to a reduction in the likelihood that a subject will develop a symptom associated with such a disease, disorder, or condition, e.g., a symptom of APP gene expression, such as the presence of various forms of Aβ (e.g., Aβ38, Aβ40 and/or Aβ42, etc.), amyloid plaques and/or cerebral amyloid angiopathy (CAA) or Alzheimer's disease (AD), including, e.g., early onset familial Alzheimer disease (EOFAD). The failure to develop a disease, disorder or condition, or the reduction in the development of a symptom associated with such a disease, disorder or condition (e.g., by at least about 10% on a clinically accepted scale for that disease or disorder), or the exhibition of delayed symptoms delayed (e.g., by days, weeks, months or years) is considered effective prevention.
[0231] As used herein, the term “APP-associated disease,” is a disease or disorder that is caused by, or associated with APP gene expression or APP protein production. The term “APP-associated disease” includes a disease, disorder or condition that would benefit from a decrease in APP gene expression, replication, or protein activity. Non-limiting examples of APP-associated diseases include, for example, cerebral amyloid angiopathy (CAA) and Alzheimer's disease (AD), including, e.g., early onset familial Alzheimer disease (EOFAD).
[0232] “Therapeutically effective amount,” as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject having an APP-associated disorder, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease). The “therapeutically effective amount” may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated.
[0233] “Prophylactically effective amount,” as used herein, is intended to include the amount of a RNAi agent that, when administered to a subject having an APP-associated disorder, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The “prophylactically effective amount” may vary depending on the RNAi agent, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.
[0234] A “therapeutically-effective amount” or “prophylacticaly effective amount” also includes an amount of a RNAi agent that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. A RNAi agent employed in the methods of the present disclosure may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.
[0235] The phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
[0236] The phrase “pharmaceutically-acceptable carrier” as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations.
[0237] The term “sample,” as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the brain (e.g., whole brain or certain segments of brain or certain types of cells in the brain, such as, e.g., neurons and glial cells (astrocytes, oligodendrocytes, microglial cells)). In some embodiments, a “sample derived from a subject” refers to blood or plasma drawn from the subject. In further embodiments, a “sample derived from a subject” refers to brain tissue (or subcomponents thereof) or retinal tissue (or subcomponents thereof) derived from the subject.
II. RNAi Agents of the Disclosure
[0238] Described herein are RNAi agents which inhibit the expression of an APP gene. In one embodiment, the RNAi agent includes double stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of an APP gene in a cell, such as a cell within a subject, e.g., a mammal, such as a human having an APP-associated disorder, e.g., cerebral amyloid angiopathy (CAA) or Alzheimer's disease (AD), including, e.g., early onset familial Alzheimer disease (EOFAD). The dsRNA includes an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of an APP gene, The region of complementarity is about 30 nucleotides or less in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 nucleotides or less in length). Upon contact with a cell expressing the APP gene, the RNAi agent inhibits the expression of the APP gene (e.g., a human, a primate, a non-primate, or a bird APP gene) by at least about 10% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, Western Blotting or flowcytometric techniques.
[0239] A dsRNA includes two RNA strands that are complementary and hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence. The target sequence can be derived from the sequence of an mRNA formed during the expression of an APP gene. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. As described elsewhere herein and as known in the art, the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides.
[0240] Generally, the duplex structure is between 15 and 30 base pairs in length, e.g., between, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. In certain preferred embodiments, the duplex structure is between 18 and 25 base pairs in length, e.g., 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-25, 20-24, 20-23, 20-22, 20-21, 21-25, 21-24, 21-23, 21-22, 22-25, 22-24, 22-23, 23-25, 23-24 or 24-25 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.
[0241] Similarly, the region of complementarity to the target sequence is between 15 and 30 nucleotides in length, e.g., between 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.
[0242] In some embodiments, the dsRNA is between about 15 and about 23 nucleotides in length, or between about 25 and about 30 nucleotides in length. In general, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNAs longer than about 21-23 nucleotides can serve as substrates for Dicer. As the ordinarily skilled person will also recognize, the region of an RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule. Where relevant, a “part” of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to allow it to be a substrate for RNAi-directed cleavage (i.e., cleavage through a RISC pathway).
[0243] One of skill in the art will also recognize that the duplex region is a primary functional portion of a dsRNA, e.g., a duplex region of about 9 to 36 base pairs, e.g., about 10-36, 11-36, 12-36, 13-36, 14-36, 15-36, 9-35, 10-35, 11-35, 12-35, 13-35, 14-35, 15-35, 9-34, 10-34, 11-34, 12-34, 13-34, 14-34, 15-34, 9-33, 10-33, 11-33, 12-33, 13-33, 14-33, 15-33, 9-32, 10-32, 11-32, 12-32, 13-32, 14-32, 15-32, 9-31, 10-31, 11-31, 12-31, 13-32, 14-31, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs. Thus, in one embodiment, to the extent that it becomes processed to a functional duplex, of e.g., 15-30 base pairs, that targets a desired RNA for cleavage, an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA. Thus, an ordinarily skilled artisan will recognize that in one embodiment, a miRNA is a dsRNA. In another embodiment, a dsRNA is not a naturally occurring miRNA. In another embodiment, a RNAi agent useful to target APP expression is not generated in the target cell by cleavage of a larger dsRNA.
[0244] A dsRNA as described herein can further include one or more single-stranded nucleotide overhangs e.g., 1, 2, 3, or 4 nucleotides. dsRNAs having at least one nucleotide overhang can have unexpectedly superior inhibitory properties relative to their blunt-ended counterparts. A nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5′-end, 3′-end or both ends of either an antisense or sense strand of a dsRNA.
[0245] A dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.
[0246] RNAi agents of the disclosure may be prepared using a two-step procedure. First, the individual strands of the double stranded RNA molecule are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide strands comprising unnatural or modified nucleotides can be easily prepared. Single-stranded oligonucleotides of the disclosure can be prepared using solution-phase or solid-phase organic synthesis or both.
[0247] In one aspect, a dsRNA of the disclosure includes at least two nucleotide sequences, a sense sequence and an antisense sequence. The sense strand sequence may be selected from the group of sequences provided in any one of Tables 2A, 2B, 3, 5A, 5B, 6, 9, 10-15, 16A, 16B, and 26 and the corresponding nucleotide sequence of the antisense strand of the sense strand may be selected from the group of sequences of any one of Tables 2A, 2B, 3, 5A, 5B, 6, 9, 10-15, 16A, 16B, and 26. In this aspect, one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of an APP gene. As such, in this aspect, a dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand (passenger strand) in any one of Tables 2A, 2B, 3, 5A, 5B, 6, 9, 10-15, 16A, 16B, and 26, and the second oligonucleotide is described as the corresponding antisense strand (guide strand) of the sense strand in any one of Tables 2A, 2B, 3, 5A, 5B, 6, 9, 10-15, 16A, 16B, and 26. Accordingly, by way of example, the following pairwise selections of sense and antisense strand sequences of Table 3 are expressly contemplated as forming duplexes of the instant disclosure: SEQ ID NOs: 855 and 856; SEQ ID NOs: 857 and 858; SEQ ID NOs: 859 and 860; SEQ ID NOs: 861 and 862; SEQ ID NOs: 863 and 864; SEQ ID NOs: 865 and 866; SEQ ID NOs: 867 and 868; SEQ ID NOs: 869 and 870; SEQ ID NOs: 871 and 872; SEQ ID NOs: 873 and 874; SEQ ID NOs: 875 and 876; SEQ ID NOs: 877 and 878; SEQ ID NOs: 879 and 880; SEQ ID NOs: 881 and 882; SEQ ID NOs: 883 and 884; SEQ ID NOs: 885 and 886; SEQ ID NOs: 887 and 888; SEQ ID NOs: 889 and 890; SEQ ID NOs: 891 and 892; SEQ ID NOs: 893 and 894; SEQ ID NOs: 895 and 896; SEQ ID NOs: 897 and 898; SEQ ID NOs: 899 and 900; SEQ ID NOs: 901 and 902; SEQ ID NOs: 903 and 904; SEQ ID NOs: 905 and 906; SEQ ID NOs: 907 and 908; SEQ ID NOs: 909 and 910; SEQ ID NOs: 911 and 912; SEQ ID NOs: 913 and 914; SEQ ID NOs: 915 and 916; SEQ ID NOs: 917 and 918; SEQ ID NOs: 919 and 920; SEQ ID NOs: 921 and 922; SEQ ID NOs: 923 and 924; SEQ ID NOs: 925 and 926; SEQ ID NOs: 927 and 928; SEQ ID NOs: 929 and 930; SEQ ID NOs: 931 and 932; SEQ ID NOs: 933 and 934; SEQ ID NOs: 935 and 936; SEQ ID NOs: 937 and 938; SEQ ID NOs: 939 and 940; SEQ ID NOs: 941 and 942; SEQ ID NOs: 943 and 944; SEQ ID NOs: 945 and 946; SEQ ID NOs: 947 and 948; SEQ ID NOs: 949 and 950; SEQ ID NOs: 951 and 952; SEQ ID NOs: 953 and 954; SEQ ID NOs: 955 and 956; SEQ ID NOs: 957 and 958; SEQ ID NOs: 959 and 960; SEQ ID NOs: 961 and 962; SEQ ID NOs: 963 and 964; SEQ ID NOs: 965 and 966; SEQ ID NOs: 967 and 968; SEQ ID NOs: 969 and 970; SEQ ID NOs: 971 and 972; SEQ ID NOs: 973 and 974; SEQ ID NOs: 975 and 976; SEQ ID NOs: 977 and 978; SEQ ID NOs: 979 and 980; SEQ ID NOs: 981 and 982; SEQ ID NOs: 983 and 984; SEQ ID NOs: 985 and 986; SEQ ID NOs: 987 and 988; SEQ ID NOs: 989 and 990; SEQ ID NOs: 991 and 992; SEQ ID NOs: 993 and 994; SEQ ID NOs: 995 and 996; SEQ ID NOs: 997 and 998; SEQ ID NOs: 999 and 1000; SEQ ID NOs: 1001 and 1002; SEQ ID NOs: 1003 and 1004; SEQ ID NOs: 1005 and 1006; SEQ ID NOs: 1007 and 1008; SEQ ID NOs: 1009 and 1010; SEQ ID NOs: 1011 and 1012; SEQ ID NOs: 1013 and 1014; SEQ ID NOs: 1015 and 1016; SEQ ID NOs: 1017 and 1018; SEQ ID NOs: 1019 and 1020; SEQ ID NOs: 1021 and 1022; SEQ ID NOs: 1023 and 1024; SEQ ID NOs: 1025 and 1026; SEQ ID NOs: 1027 and 1028; SEQ ID NOs: 1029 and 1030; SEQ ID NOs: 1031 and 1032; SEQ ID NOs: 1033 and 1034; SEQ ID NOs: 1035 and 1036; SEQ ID NOs: 1037 and 1038; SEQ ID NOs: 1039 and 1040; SEQ ID NOs: 1041 and 1042; SEQ ID NOs: 1043 and 1044; SEQ ID NOs: 1045 and 1046; SEQ ID NOs: 1047 and 1048; SEQ ID NOs: 1049 and 1050; SEQ ID NOs: 1051 and 1052; SEQ ID NOs: 1053 and 1054; SEQ ID NOs: 1055 and 1056; SEQ ID NOs: 1057 and 1058; SEQ ID NOs: 1059 and 1060; SEQ ID NOs: 1061 and 1062; SEQ ID NOs: 1063 and 1064; SEQ ID NOs: 1065 and 1066; SEQ ID NOs: 1067 and 1068; SEQ ID NOs: 1069 and 1070; SEQ ID NOs: 1071 and 1072; SEQ ID NOs: 1073 and 1074; SEQ ID NOs: 1075 and 1076; SEQ ID NOs: 1077 and 1078; SEQ ID NOs: 1079 and 1080; SEQ ID NOs: 1081 and 1082; SEQ ID NOs: 1083 and 1084; SEQ ID NOs: 1085 and 1086; SEQ ID NOs: 1087 and 1088; SEQ ID NOs: 1089 and 1090; SEQ ID NOs: 1091 and 1092; SEQ ID NOs: 1093 and 1094; SEQ ID NOs: 1095 and 1096; SEQ ID NOs: 1097 and 1098; SEQ ID NOs: 1099 and 1100; SEQ ID NOs: 1101 and 1102; SEQ ID NOs: 1103 and 1104; SEQ ID NOs: 1105 and 1106; SEQ ID NOs: 1107 and 1108; SEQ ID NOs: 1109 and 1110; SEQ ID NOs: 1111 and 1112; SEQ ID NOs: 1113 and 1114; SEQ ID NOs: 1115 and 1116; SEQ ID NOs: 1117 and 1118; SEQ ID NOs: 1119 and 1120; SEQ ID NOs: 1121 and 1122; SEQ ID NOs: 1123 and 1124; SEQ ID NOs: 1125 and 1126; SEQ ID NOs: 1127 and 1128; SEQ ID NOs: 1129 and 1130; SEQ ID NOs: 1131 and 1132; SEQ ID NOs: 1133 and 1134; SEQ ID NOs: 1135 and 1136; SEQ ID NOs: 1137 and 1138; SEQ ID NOs: 1139 and 1140; SEQ ID NOs: 1141 and 1142; SEQ ID NOs: 1143 and 1144; SEQ ID NOs: 1145 and 1146; SEQ ID NOs: 1147 and 1148; SEQ ID NOs: 1149 and 1150; SEQ ID NOs: 1151 and 1152; SEQ ID NOs: 1153 and 1154; SEQ ID NOs: 1155 and 1156; SEQ ID NOs: 1157 and 1158; SEQ ID NOs: 1159 and 1160; SEQ ID NOs: 1161 and 1162; SEQ ID NOs: 1163 and 1164; SEQ ID NOs: 1165 and 1166; SEQ ID NOs: 1167 and 1168; SEQ ID NOs: 1169 and 1170; SEQ ID NOs: 1171 and 1172; SEQ ID NOs: 1173 and 1174; SEQ ID NOs: 1175 and 1176; SEQ ID NOs: 1177 and 1178; SEQ ID NOs: 1179 and 1180; SEQ ID NOs: 1181 and 1182; SEQ ID NOs: 1183 and 1184; SEQ ID NOs: 1185 and 1186; SEQ ID NOs: 1187 and 1188; SEQ ID NOs: 1189 and 1190; SEQ ID NOs: 1191 and 1192; SEQ ID NOs: 1193 and 1194; SEQ ID NOs: 1195 and 1196; SEQ ID NOs: 1197 and 1198; SEQ ID NOs: 1199 and 1200; SEQ ID NOs: 1201 and 1202; SEQ ID NOs: 1203 and 1204; SEQ ID NOs: 1205 and 1206; SEQ ID NOs: 1207 and 1208; SEQ ID NOs: 1209 and 1210; SEQ ID NOs: 1211 and 1212; SEQ ID NOs: 1213 and 1214; SEQ ID NOs: 1215 and 1216; SEQ ID NOs: 1217 and 1218; SEQ ID NOs: 1219 and 1220; SEQ ID NOs: 1221 and 1222; SEQ ID NOs: 1223 and 1224; SEQ ID NOs: 1225 and 1226; SEQ ID NOs: 1227 and 1228; SEQ ID NOs: 1229 and 1230; SEQ ID NOs: 1231 and 1232; SEQ ID NOs: 1233 and 1234; SEQ ID NOs: 1235 and 1236; SEQ ID NOs: 1237 and 1238; SEQ ID NOs: 1239 and 1240; SEQ ID NOs: 1241 and 1242; SEQ ID NOs: 1243 and 1244; SEQ ID NOs: 1245 and 1246; SEQ ID NOs: 1247 and 1248; SEQ ID NOs: 1249 and 1250; SEQ ID NOs: 1251 and 1252; SEQ ID NOs: 1253 and 1254; SEQ ID NOs: 1255 and 1256; SEQ ID NOs: 1257 and 1258; SEQ ID NOs: 1259 and 1260; SEQ ID NOs: 1261 and 1262; SEQ ID NOs: 1263 and 1264; SEQ ID NOs: 1265 and 1266; SEQ ID NOs: 1267 and 1268; SEQ ID NOs: 1269 and 1270; SEQ ID NOs: 1271 and 1272; SEQ ID NOs: 1273 and 1274; SEQ ID NOs: 1275 and 1276; SEQ ID NOs: 1277 and 1278; SEQ ID NOs: 1279 and 1280; SEQ ID NOs: 1281 and 1282; SEQ ID NOs: 1283 and 1284; SEQ ID NOs: 1285 and 1286; SEQ ID NOs: 1287 and 1288; SEQ ID NOs: 1289 and 1290; SEQ ID NOs: 1291 and 1292; SEQ ID NOs: 1293 and 1294; SEQ ID NOs: 1295 and 1296; SEQ ID NOs: 1297 and 1298; SEQ ID NOs: 1299 and 1300; SEQ ID NOs: 1301 and 1302; SEQ ID NOs: 1303 and 1304; SEQ ID NOs: 1305 and 1306; SEQ ID NOs: 1307 and 1308; SEQ ID NOs: 1309 and 1310; SEQ ID NOs: 1311 and 1312; SEQ ID NOs: 1313 and 1314; SEQ ID NOs: 1315 and 1316; SEQ ID NOs: 1317 and 1318; SEQ ID NOs: 1319 and 1320; SEQ ID NOs: 1321 and 1322; SEQ ID NOs: 1323 and 1324; SEQ ID NOs: 1325 and 1326; SEQ ID NOs: 1327 and 1328; SEQ ID NOs: 1329 and 1330; SEQ ID NOs: 1331 and 1332; SEQ ID NOs: 1333 and 1334; SEQ ID NOs: 1335 and 1336; SEQ ID NOs: 1337 and 1338; SEQ ID NOs: 1339 and 1340; SEQ ID NOs: 1341 and 1342; SEQ ID NOs: 1343 and 1344; SEQ ID NOs: 1345 and 1346; SEQ ID NOs: 1347 and 1348; SEQ ID NOs: 1349 and 1350; SEQ ID NOs: 1351 and 1352; SEQ ID NOs: 1353 and 1354; SEQ ID NOs: 1355 and 1356; SEQ ID NOs: 1357 and 1358; SEQ ID NOs: 1359 and 1360; SEQ ID NOs: 1361 and 1362; SEQ ID NOs: 1363 and 1364; SEQ ID NOs: 1365 and 1366; SEQ ID NOs: 1367 and 1368; SEQ ID NOs: 1369 and 1370; SEQ ID NOs: 1371 and 1372; SEQ ID NOs: 1373 and 1374; SEQ ID NOs: 1375 and 1376; SEQ ID NOs: 1377 and 1378; SEQ ID NOs: 1379 and 1380; SEQ ID NOs: 1381 and 1382; SEQ ID NOs: 1383 and 1384; SEQ ID NOs: 1385 and 1386; SEQ ID NOs: 1387 and 1388; SEQ ID NOs: 1389 and 1390; SEQ ID NOs: 1391 and 1392; SEQ ID NOs: 1393 and 1394; SEQ ID NOs: 1395 and 1396; SEQ ID NOs: 1397 and 1398; SEQ ID NOs: 1399 and 1400; and SEQ ID NOs: 1401 and 1402. Similarly, pairwise combinations of sense and antisense strands of Tables 2A, 2B, 3, 5A, 5B, 6, 9, 10-15, 16A, 16B, and 26 of the instant disclosure are also expressly contemplated, including, e.g., a sense strand selected from Table 2A together with an antisense strand selected from Table 2B, or vice versa, etc.
[0248] In one embodiment, the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides. In another embodiment, the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.
[0249] It will be understood that, although the sequences in Tables 2A, 2B, 5A, 5B, 9, 10, 12, 14, 16A, 16B, and 26 are described as modified and/or conjugated sequences, the RNA of the RNAi agent of the disclosure e.g., a dsRNA of the disclosure, may comprise any one of the sequences set forth in any one of Tables 2A, 2B, 3, 5A, 5B, 6, 9, 10-15, 16A, 16B, and 26 that is un-modified, un-conjugated, and/or modified and/or conjugated differently than described therein.
[0250] The skilled person is well aware that dsRNAs having a duplex structure of between about 20 and 23 base pairs, e.g., 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., (2001) EMBO J., 20:6877-6888). However, others have found that shorter or longer RNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided herein, dsRNAs described herein can include at least one strand of a length of minimally 21 nucleotides. It can be reasonably expected that shorter duplexes minus only a few nucleotides on one or both ends can be similarly effective as compared to the dsRNAs described above. Hence, dsRNAs having a sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides derived from one of the sequences provided herein, and differing in their ability to inhibit the expression of an APP gene by not more than about 5, 10, 15, 20, 25, or 30% inhibition from a dsRNA comprising the full sequence, are contemplated to be within the scope of the present disclosure.
[0251] In addition, the RNAs described herein identify a site(s) in an APP transcript that is susceptible to RISC-mediated cleavage. As such, the present disclosure further features RNAi agents that target within this site(s). As used herein, a RNAi agent is said to target within a particular site of an RNA transcript if the RNAi agent promotes cleavage of the transcript anywhere within that particular site. Such a RNAi agent will generally include at least about 15 contiguous nucleotides from one of the sequences provided herein coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in an APP gene.
[0252] A RNAi agent as described herein can contain one or more mismatches to the target sequence. In one embodiment, a RNAi agent as described herein contains no more than 3 mismatches. In certain embodiments, if the antisense strand of the RNAi agent contains mismatches to the target sequence, the mismatch can optionally be restricted to be within the last 5 nucleotides from either the 5′- or 3′-end of the region of complementarity. For example, in such embodiments, for a 23 nucleotide RNAi agent, the strand which is complementary to a region of an APP gene, generally does not contain any mismatch within the central 13 nucleotides. The methods described herein or methods known in the art can be used to determine whether a RNAi agent containing a mismatch to a target sequence is effective in inhibiting the expression of an APP gene. Consideration of the efficacy of RNAi agents with mismatches in inhibiting expression of an APP gene is important, especially if the particular region of complementarity in an APP gene is known to have polymorphic sequence variation within the population.
III. Modified RNAi Agents of the Disclosure
[0253] In one embodiment, the RNA of the RNAi agent of the disclosure e.g., a dsRNA, is un-modified, and does not comprise, e.g., chemical modifications and/or conjugations known in the art and described herein. In another embodiment, the RNA of a RNAi agent of the disclosure, e.g., a dsRNA, is chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the disclosure, substantially all of the nucleotides of a RNAi agent of the disclosure are modified. In other embodiments of the disclosure, all of the nucleotides of a RNAi agent of the disclosure are modified. RNAi agents of the disclosure in which “substantially all of the nucleotides are modified” are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides. In still other embodiments of the disclosure, RNAi agents of the disclosure can include not more than 5, 4, 3, 2 or 1 modified nucleotides.
[0254] The nucleic acids featured in the disclosure can be synthesized and/or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5′-end modifications (phosphorylation, conjugation, inverted linkages) or 3′-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2′-position or 4′-position) or replacement of the sugar; and/or backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of RNAi agents useful in the embodiments described herein include, but are not limited to RNAs containing modified backbones or no natural internucleoside linkages. RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified RNAi agent will have a phosphorus atom in its internucleoside backbone.
[0255] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3′-5′ linkages, 2′-5′-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. Various salts, mixed salts and free acid forms are also included.
[0256] Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Pat. RE39464, the entire contents of each of which are hereby incorporated herein by reference.
[0257] Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH.sub.2 component parts.
[0258] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.
[0259] In other embodiments, suitable RNA mimetics are contemplated for use in RNAi agents, in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the RNAi agents of the disclosure are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.
[0260] Some embodiments featured in the disclosure include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular —CH.sub.2—NH—CH.sub.2—, —CH.sub.2—N(CH.sub.3)—O—CH.sub.2— [known as a methylene (methylimino) or MMI backbone], —CH.sub.2—O—N(CH.sub.3)—CH.sub.2—, —CH.sub.2—N(CH.sub.3)—N(CH.sub.3)—CH.sub.2— and —N(CH.sub.3)—CH.sub.2—CH.sub.2 [wherein the native phosphodiester backbone is represented as —O—P—O—CH.sub.2—] of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the RNAs featured herein have morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.
[0261] Modified RNAs can also contain one or more substituted sugar moieties. The RNAi agents, e.g., dsRNAs, featured herein can include one of the following at the 2′-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2)..sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2′ position: C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of a RNAi agent, or a group for improving the pharmacodynamic properties of a RNAi agent, and other substituents having similar properties. In some embodiments, the modification includes a 2′-methoxyethoxy (2′-O—CH.sub.2CH.sub.2OCH.sub.3, also known as 2′-O-(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2′-dimethylaminooxyethoxy, i.e., a O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2′-DMAOE, as described in examples herein below, and 2′-dimethylaminoethoxyethoxy (also known in the art as 2′-O-dimethylaminoethoxyethyl or 2′-DMAEOE), i.e., 2′-O—CH.sub.2—O—CH.sub.2—N(CH.sub.2).sub.2. Further exemplary modifications include: 5′-Me-2′-F nucleotides, 5′-Me-2′-OMe nucleotides, 5′-Me-2′-deoxynucleotides, (both R and S isomers in these three families); 2′-alkoxyalkyl; and 2′-NMA (N-methylacetamide).
[0262] Other modifications include 2′-methoxy (2′-OCH.sub.3), 2′-aminopropoxy (2′-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), 2′-O-hexadecyl, and 2′-fluoro (2′-F). Similar modifications can also be made at other positions on the RNA of a RNAi agent, particularly the 3′ position of the sugar on the 3′ terminal nucleotide or in 2′-5′ linked dsRNAs and the 5′ position of 5′ terminal nucleotide. RNAi agents can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference.
[0263] A RNAi agent of the disclosure can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.
[0264] Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.
[0265] A RNAi agent of the disclosure can also be modified to include one or more locked nucleic acids (LNA). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2′ and 4′ carbons. This structure effectively “locks” the ribose in the 3′-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther 6(3): 833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).
[0266] A RNAi agent of the disclosure can also be modified to include one or more bicyclic sugar moities. A “bicyclic sugar” is a furanosyl ring modified by the bridging of two atoms. A “bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4′-carbon and the 2′-carbon of the sugar ring. Thus, in some embodiments an agent of the disclosure may include one or more locked nucleic acids (LNA). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2′ and 4′ carbons. In other words, an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4′-CH2-O-2′ bridge. This structure effectively “locks” the ribose in the 3′-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the disclosure include without limitation nucleosides comprising a bridge between the 4′ and the 2′ ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agents of the disclosure include one or more bicyclic nucleosides comprising a 4′ to 2′ bridge. Examples of such 4′ to 2′ bridged bicyclic nucleosides, include but are not limited to 4′-(CH2)-O-2′ (LNA); 4′-(CH2)-S-2; 4′-(CH2)2-O-2′ (ENA); 4′-CH(CH3)-O-2′ (also referred to as “constrained ethyl” or “cEt”) and 4′-CH(CH2OCH3)-O-2′ (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4′-C(CH3)(CH3)-O-2′ (and analogs thereof; see e.g., U.S. Pat. No. 8,278,283); 4′-CH2-N(OCH3)-2′ (and analogs thereof; see e.g., U.S. Pat. No. 8,278,425); 4′-CH2-O—N(CH3)-2′ (see, e.g., U.S. Patent Publication No. 2004/0171570); 4′-CH2-N(R)—O-2′, wherein R is H, C1-C12 alkyl, or a protecting group (see, e.g., U.S. Pat. No. 7,427,672); 4′-CH2-C(H)(CH3)-2′ (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4′-CH2-C(═CH2)-2′ (and analogs thereof; see, e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.
[0267] Additional representative U.S. Patents and US Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008/0039618; and US 2009/0012281, the entire contents of each of which are hereby incorporated herein by reference.
[0268] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and (3-D-ribofuranose (see WO 99/14226).
[0269] A RNAi agent of the disclosure can also be modified to include one or more constrained ethyl nucleotides. As used herein, a “constrained ethyl nucleotide” or “cEt” is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4′-CH(CH3)-O-2′ bridge. In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as “S-cEt.”
[0270] A RNAi agent of the disclosure may also include one or more “conformationally restricted nucleotides” (“CRN”). CRN are nucleotide analogs with a linker connecting the C2′ and C4′ carbons of ribose or the C3 and -C5′ carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.
[0271] Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, US Patent Publication No. 2013/0190383; and PCT publication WO 2013/036868, the entire contents of each of which are hereby incorporated herein by reference.
[0272] In some embodiments, a RNAi agent of the disclosure comprises one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked “sugar” residue. In one example, UNA also encompasses monomer with bonds between C1′-C4′ have been removed (i.e. the covalent carbon-oxygen-carbon bond between the C1′ and C4′ carbons). In another example, the C2′-C3′ bond (i.e. the covalent carbon-carbon bond between the C2′ and C3′ carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference).
[0273] Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Pat. No. 8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.
[0274] Potentially stabilizing modifications to the ends of RNA molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2′-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3″-phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011/005861.
[0275] Other modifications of a RNAi agent of the disclosure include a 5′ phosphate or 5′ phosphate mimic, e.g., a 5′-terminal phosphate or phosphate mimic on the antisense strand of a RNAi agent. Suitable phosphate mimics are disclosed in, for example US Patent Publication No. 2012/0157511, the entire contents of which are incorporated herein by reference.
A. Modified RNAi Agents Comprising Motifs of the Disclosure
[0276] In certain aspects of the disclosure, the double-stranded RNAi agents of the disclosure include agents with chemical modifications as disclosed, for example, in WO 2013/075035, filed on Nov. 16, 2012, the entire contents of which are incorporated herein by reference. As shown herein and in PCT Publication No. WO 2013/075035, a superior result may be obtained by introducing one or more motifs of three identical modifications on three consecutive nucleotides into a sense strand and/or antisense strand of an RNAi agent, particularly at or near the cleavage site. In some embodiments, the sense strand and antisense strand of the RNAi agent may otherwise be completely modified. The introduction of these motifs interrupts the modification pattern, if present, of the sense and/or antisense strand. The RNAi agent may be optionally conjugated with a C16 ligand, for instance on the sense strand. The RNAi agent may be optionally modified with a (S)-glycol nucleic acid (GNA) modification, for instance on one or more residues of the antisense strand. The resulting RNAi agents present superior gene silencing activity.
[0277] More specifically, it has been surprisingly discovered that when the sense strand and antisense strand of the double-stranded RNAi agent are completely modified to have one or more motifs of three identical modifications on three consecutive nucleotides at or near the cleavage site of at least one strand of an RNAi agent, the gene silencing activity of the RNAi agent was superiorly enhanced.
[0278] Accordingly, the disclosure provides double stranded RNAi agents capable of inhibiting the expression of a target gene (i.e., an APP gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent may range from 12-30 nucleotides in length. For example, each strand may be between 14-30 nucleotides in length, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length.
[0279] The sense strand and antisense strand typically form a duplex double stranded RNA (“dsRNA”), also referred to herein as an “RNAi agent.” The duplex region of an RNAi agent may be 12-30 nucleotide pairs in length. For example, the duplex region can be between 14-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17-23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.
[0280] In one embodiment, the RNAi agent may contain one or more overhang regions and/or capping groups at the 3′-end, 5′-end, or both ends of one or both strands. The overhang can be 1-6 nucleotides in length, for instance 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence. The first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers.
[0281] In one embodiment, the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2′-sugar modified, such as, 2-F, 2′-Omethyl, thymidine (T), and any combinations thereof.
[0282] For example, TT can be an overhang sequence for either end on either strand. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.
[0283] The 5′- or 3′-overhangs at the sense strand, antisense strand or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different. In one embodiment, the overhang is present at the 3′-end of the sense strand, antisense strand, or both strands. In one embodiment, this 3′-overhang is present in the antisense strand. In one embodiment, this 3′-overhang is present in the sense strand.
[0284] The RNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability. For example, the single-stranded overhang may be located at the 3′-terminal end of the sense strand or, alternatively, at the 3′-terminal end of the antisense strand. The RNAi may also have a blunt end, located at the 5′-end of the antisense strand (or the 3′-end of the sense strand) or vice versa. Generally, the antisense strand of the RNAi has a nucleotide overhang at the 3′-end, and the 5′-end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5′-end of the antisense strand and 3′-end overhang of the antisense strand favor the guide strand loading into RISC process.
[0285] In one embodiment, the RNAi agent is a double ended bluntmer of 19 nucleotides in length, wherein the sense strand contains at least one motif of three 2′-F modifications on three consecutive nucleotides at positions 7, 8, 9 from the 5′end. The antisense strand contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5′end.
[0286] In another embodiment, the RNAi agent is a double ended bluntmer of 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2′-F modifications on three consecutive nucleotides at positions 8, 9, 10 from the 5′end. The antisense strand contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5′end.
[0287] In yet another embodiment, the RNAi agent is a double ended bluntmer of 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2′-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5′end. The antisense strand contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5′end.
[0288] In one embodiment, the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2′-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5′end; the antisense strand contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5′end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang. Preferably, the 2 nucleotide overhang is at the 3′-end of the antisense strand. When the 2 nucleotide overhang is at the 3′-end of the antisense strand, there may be two phosphorothioate internucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. In one embodiment, the RNAi agent additionally has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5′-end of the sense strand and at the 5′-end of the antisense strand. In one embodiment, every nucleotide in the sense strand and the antisense strand of the RNAi agent, including the nucleotides that are part of the motifs are modified nucleotides. In one embodiment each residue is independently modified with a 2′-O-methyl or 3′-fluoro, e.g., in an alternating motif. Optionally, the RNAi agent further comprises a ligand (optionally a C16 ligand).
[0289] In one embodiment, the RNAi agent comprises a sense and an antisense strand, wherein the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5′ terminal nucleotide (position 1) positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; the antisense strand is 36-66 nucleotide residues in length and, starting from the 3′ terminal nucleotide, comprises at least 8 ribonucleotides in the positions paired with positions 1-23 of sense strand to form a duplex; wherein at least the 3 ‘ terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3’ terminal nucleotides are unpaired with sense strand, thereby forming a 3′ single stranded overhang of 1-6 nucleotides; wherein the 5′ terminus of antisense strand comprises from 10-30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10-30 nucleotide single stranded 5′ overhang; wherein at least the sense strand 5′ terminal and 3′ terminal nucleotides are base paired with nucleotides of antisense strand when sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplexed region between sense and antisense strands; and antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when the double stranded nucleic acid is introduced into a mammalian cell; and wherein the sense strand contains at least one motif of three 2′-F modifications on three consecutive nucleotides, where at least one of the motifs occurs at or near the cleavage site. The antisense strand contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at or near the cleavage site.
[0290] In one embodiment, the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucleotides and a second strand having a length which is at most 30 nucleotides with at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at position 11, 12, 13 from the 5′ end; wherein the 3′ end of the first strand and the 5′ end of the second strand form a blunt end and the second strand is 1-4 nucleotides longer at its 3′ end than the first strand, wherein the duplex region region which is at least 25 nucleotides in length, and the second strand is sufficiently complemenatary to a target mRNA along at least 19 nucleotide of the second strand length to reduce target gene expression when the RNAi agent is introduced into a mammalian cell, and wherein dicer cleavage of the RNAi agent preferentially results in an siRNA comprising the 3′ end of the second strand, thereby reducing expression of the target gene in the mammal. Optionally, the RNAi agent further comprises a ligand.
[0291] In one embodiment, the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand.
[0292] In one embodiment, the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand.
[0293] For an RNAi agent having a duplex region of 17-23 nucleotide in length, the cleavage site of the antisense strand is typically around the 10, 11 and 12 positions from the 5′-end. Thus the motifs of three identical modifications may occur at the 9, 10, 11 positions; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13, 14 positions; or 13, 14, 15 positions of the antisense strand, the count starting from the 1st nucleotide from the 5′-end of the antisense strand, or, the count starting from the 1st paired nucleotide within the duplex region from the 5′-end of the antisense strand. The cleavage site in the antisense strand may also change according to the length of the duplex region of the RNAi from the 5′-end.
[0294] The sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand. When the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.
[0295] In one embodiment, the sense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides. The first motif may occur at or near the cleavage site of the strand and the other motifs may be a wing modification. The term “wing modification” herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand. The wing modification is either adjacent to the first motif or is separated by at least one or more nucleotides. When the motifs are immediately adjacent to each other then the chemistry of the motifs are distinct from each other and when the motifs are separated by one or more nucleotide than the chemistries can be the same or different. Two or more wing modifications may be present. For instance, when two wing modifications are present, each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif
[0296] Like the sense strand, the antisense strand of the RNAi agent may contain more than one motifs of three identical modifications on three consecutive nucleotides, with at least one of the motifs occurring at or near the cleavage site of the strand. This antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications that may be present on the sense strand.
[0297] In one embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3′-end, 5′-end or both ends of the strand.
[0298] In another embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3′-end, 5′-end or both ends of the strand.
[0299] When the sense strand and the antisense strand of the RNAi agent each contain at least one wing modification, the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two or three nucleotides.
[0300] When the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications, the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex region, having an overlap of one, two or three nucleotides; two modifications each from one strand fall on the other end of the duplex region, having an overlap of one, two or three nucleotides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two or three nucleotides in the duplex region.
[0301] In one embodiment, the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mismatch may occur in the overhang region or the duplex region. The base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.
[0302] In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5′-end of the antisense strand independently selected from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5′-end of the duplex.
[0303] In one embodiment, the nucleotide at the 1 position within the duplex region from the 5′-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5′-end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5′-end of the antisense strand is an AU base pair.
[0304] In another embodiment, the nucleotide at the 3′-end of the sense strand is deoxy-thymine (dT). In another embodiment, the nucleotide at the 3′-end of the antisense strand is deoxy-thymine (dT). In one embodiment, there is a short sequence of deoxy-thymine nucleotides, for example, two dT nucleotides on the 3′-end of the sense and/or antisense strand.
[0305] In one embodiment, the sense strand sequence may be represented by formula (I):
TABLE-US-00011 (I) 5′n.sub.p-N.sub.a-(X X X).sub.i-N.sub.b-Y Y Y -N.sub.b-(Z Z Z).sub.j-N.sub.a-n.sub.q3′
[0306] wherein:
[0307] i and j are each independently 0 or 1;
[0308] p and q are each independently 0-6;
[0309] each N.sub.a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;
[0310] each N.sub.b independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;
[0311] each n.sub.p and n.sub.q independently represent an overhang nucleotide;
[0312] wherein N.sub.b and Y do not have the same modification; and XXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides. Preferably YYY is all 2′-F modified nucleotides.
[0313] In one embodiment, the N.sub.a and/or N.sub.b comprise modifications of alternating pattern.
[0314] In one embodiment, the YYY motif occurs at or near the cleavage site of the sense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotides in length, the YYY motif can occur at or the vicinity of the cleavage site (e.g.: can occur at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11, 12 or 11, 12, 13) of—the sense strand, the count starting from the 1st nucleotide, from the 5′-end; or optionally, the count starting at the Pt paired nucleotide within the duplex region, from the 5′-end.
[0315] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. The sense strand can therefore be represented by the following formulas:
TABLE-US-00012 (Ib) 5′n.sub.p-N.sub.a-YYY-N.sub.b-ZZZ-N.sub.a-n.sub.q3′; (Ic) 5′n.sub.p-N.sub.a-XXX-N.sub.b-YYY-N.sub.a-n.sub.q3′; or (Id) 5′n.sub.p-N.sub.a-XXX-N.sub.b-YYY-N.sub.b-ZZZ-N.sub.a-n.sub.q3′.
[0316] When the sense strand is represented by formula (Ib), N.sub.b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
[0317] Each N.sub.a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0318] When the sense strand is represented as formula (Ic), N.sub.b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0319] When the sense strand is represented as formula (Id), each N.sub.b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Preferably, N.sub.b is 0, 1, 2, 3, 4, 5 or 6. Each N.sub.a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0320] Each of X, Y and Z may be the same or different from each other.
[0321] In other embodiments, i is 0 and j is 0, and the sense strand may be represented by the formula:
TABLE-US-00013 (Ia) 5′n.sub.p-N.sub.a-YYY-N.sub.a-n.sub.q3′.
[0322] When the sense strand is represented by formula (Ia), each N.sub.a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0323] In one embodiment, the antisense strand sequence of the RNAi may be represented by formula (II):
TABLE-US-00014 (II) 5′n.sub.q′-N.sub.a′-(Z′Z′Z′).sub.k-N.sub.b′-Y′Y′Y′-N.sub.b′-(X′X′X′).sub.l- N′.sub.a-n.sub.p′3′
[0324] wherein: [0325] k and l are each independently 0 or 1;
[0326] p′ and q′ are each independently 0-6;
each N.sub.a′ independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;
each N.sub.b′ independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;
each n.sub.p′ and n.sub.q′ independently represent an overhang nucleotide;
wherein N.sub.b′ and Y′ do not have the same modification;
and
X′X′X′, Y′Y′Y′ and Z′Z′Z′ each independently represent one motif of three identical modifications on three consecutive nucleotides.
In one embodiment, the N.sub.a′ and/or N.sub.b′ comprise modifications of alternating pattern.
[0327] The Y′Y′Y′ motif occurs at or near the cleavage site of the antisense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotide in length, the Y′Y′Y′ motif can occur at positions 9, 10, 11, 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, with the count starting from the 1st nucleotide, from the 5′-end; or optionally, the count starting at the 1st paired nucleotide within the duplex region, from the 5′-end. Preferably, the Y′Y′Y′ motif occurs at positions 11, 12, 13.
[0328] In one embodiment, Y′Y′Y′ motif is all 2′-OMe modified nucleotides.
[0329] In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or both k and 1 are 1.
[0330] The antisense strand can therefore be represented by the following formulas:
TABLE-US-00015 (IIb) 5′n.sub.q′-N.sub.a′-Z′Z′Z′-N.sub.b′-Y′Y′Y′-N.sub.a′-n.sub.p′3′; (IIc) 5′n.sub.q′-N.sub.a′-Y′Y′Y′-N.sub.b′-X′X′X′-n.sub.p′3′; or (IId) 5′n.sub.q′-N.sub.a′-Z′Z′Z′-N.sub.b′-Y′Y′Y′-N.sub.b′-X′X′X′-N.sub.a′-n.sub.p′3′.
[0331] When the antisense strand is represented by formula (IIb), N.sub.b′ represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0332] When the antisense strand is represented as formula (IIc), N.sub.b′ represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0333] When the antisense strand is represented as formula (IId), each N.sub.b′ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Preferably, N.sub.b is 0, 1, 2, 3, 4, 5 or 6.
[0334] In other embodiments, k is 0 and l is 0 and the antisense strand may be represented by the formula:
TABLE-US-00016 (Ia) 5′n.sub.p′-N.sub.a′-Y′Y′Y′-N.sub.a′-n.sub.q′3′.
[0335] When the antisense strand is represented as formula (IIa), each N.sub.a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0336] Each of X′, Y′ and Z′ may be the same or different from each other.
[0337] Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, HNA, CeNA, 2′-methoxy ethyl, 2′-O-methyl, 2′-O-allyl, 2′-C-allyl, 2′-hydroxyl, or 2′-fluoro. For example, each nucleotide of the sense strand and antisense strand is independently modified with 2′-O-methyl or 2′-fluoro. Each X, Y, Z, X′, Y′ and Z′, in particular, may represent a 2′-O-methyl modification or a 2′-fluoro modification.
[0338] In one embodiment, the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex region is 21 nt, the count starting from the 1.sup.st nucleotide from the 5′-end, or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5′-end; and Y represents 2′-F modification. The sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2′-OMe modification or 2′-F modification.
[0339] In one embodiment the antisense strand may contain Y′Y′Y′ motif occurring at positions 11, 12, 13 of the strand, the count starting from the Pt nucleotide from the 5′-end, or optionally, the count starting at the 1″ paired nucleotide within the duplex region, from the 5′-end; and Y′ represents 2′-O-methyl modification. The antisense strand may additionally contain X′X′X′ motif or Z′Z′Z′ motifs as wing modifications at the opposite end of the duplex region; and X′X′X′ and Z′Z′Z′ each independently represents a 2′-OMe modification or 2′-F modification.
[0340] The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with a antisense strand being represented by any one of formulas (IIa), (IIb), (IIc), and (IId), respectively.
[0341] Accordingly, the RNAi agents for use in the methods of the disclosure may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, the RNAi duplex represented by formula (III):
TABLE-US-00017 (III) sense: 5′n.sub.p-N.sub.a-(X X X).sub.i-N.sub.b-Y Y Y -N.sub.b-(Z Z Z).sub.j-N.sub.a-n.sub.q3′ antisense: 3′n.sub.p′-N.sub.a′-(X′X′X′).sub.k-N.sub.b′-Y′Y′Y′-N.sub.b′-(Z′Z′Z′).sub.l-N.sub.a′- n.sub.q′5′
[0342] wherein:
[0343] j, k, and 1 are each independently 0 or 1;
[0344] p, p′, q, and q′ are each independently 0-6;
[0345] each N.sub.a and N.sub.a′ independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;
[0346] each N.sub.b and N.sub.b′ independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;
[0347] wherein
[0348] each n.sub.p′, n.sub.p, n.sub.q′, and n.sub.q, each of which may or may not be present, independently represents an overhang nucleotide; and
[0349] XXX, YYY, ZZZ, X′X′X′, Y′Y′Y′, and Z′Z′Z′ each independently represent one motif of three identical modifications on three consecutive nucleotides.
[0350] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k is 1 and 1 is 0; k is 0 and l is 1; or both k and 1 are 0; or both k and 1 are 1.
[0351] Exemplary combinations of the sense strand and antisense strand forming a RNAi duplex include the formulas below:
TABLE-US-00018 (IIIa) 5′n.sub.p-N.sub.a-Y Y Y -N.sub.a-n.sub.q3′ 3′n.sub.p′-N.sub.a′-Y′Y′Y′-N.sub.a′n.sub.q′5′ (IIIb) 5′n.sub.p-N.sub.a-Y Y Y -N.sub.b-Z Z Z-N.sub.a-n.sub.q3′ 3′n.sub.p′-N.sub.a′-Y′Y′Y′-N.sub.b′-Z′Z′Z′-N.sub.a′n.sub.q′5′ (IIIc) 5′n.sub.p-N.sub.a-X X X-N.sub.b-Y Y Y -N.sub.a-n.sub.q3′ 3′n.sub.p′-N.sub.a′-X′X′X′-N.sub.b′-Y′Y′Y′-N.sub.a′-n.sub.q′5′ (IIId) 5′n.sub.p-N.sub.a-X X X-N.sub.b-Y Y Y -N.sub.b-Z Z Z-N.sub.a-n.sub.q3′ 3′n.sub.p′-N.sub.a′-X′X′X′-N.sub.b′-Y′Y′Y′-N.sub.b′-Z′Z′Z′-N.sub.a-n.sub.q′5′
[0352] When the RNAi agent is represented by formula (IIIa), each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0353] When the RNAi agent is represented by formula (IIIb), each N.sub.b independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucleotides. Each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0354] When the RNAi agent is represented as formula (IIIc), each N.sub.b, N.sub.b′ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0355] When the RNAi agent is represented as formula (IIId), each N.sub.b, N.sub.b′ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a, N.sub.a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Each of N.sub.a, N.sub.a′, N.sub.b and N.sub.b′ independently comprises modifications of alternating pattern.
[0356] In one embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications. In another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications and n.sub.p′>0 and at least one n.sub.p′ is linked to a neighboring nucleotide a via phosphorothioate linkage. In yet another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications, n.sub.p′>0 and at least one n.sub.p′ is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense strand is conjugated to one or more C16 (or related) moieties attached through a bivalent or trivalent branched linker (described below). In another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications, n.sub.p′>0 and at least one n.sub.p′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more C16 (or related) moieties, optionally attached through a bivalent or trivalent branched linker.
[0357] In one embodiment, when the RNAi agent is represented by formula (IIIa), the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications, n.sub.p′>0 and at least one n.sub.p′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more C16 (or related) moieties attached through a bivalent or trivalent branched linker.
[0358] In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
[0359] In one embodiment, the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
[0360] In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other at the 5′ end, and one or both of the 3′ ends and are optionally conjugated to a ligand. Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites.
[0361] Various publications describe multimeric RNAi agents that can be used in the methods of the disclosure. Such publications include WO2007/091269, U.S. Pat. No. 7,858,769, WO2010/141511, WO2007/117686, WO2009/014887 and WO2011/031520 the entire contents of each of which are hereby incorporated herein by reference. In certain embodiments, the RNAi agents of the disclosure may include GalNAc ligands, even if such GalNAc ligands are currently projected to be of limited value for the preferred intrathecal/CNS delivery route(s) of the instant disclosure.
[0362] As described in more detail below, the RNAi agent that contains conjugations of one or more carbohydrate moieties to a RNAi agent can optimize one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS). A cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.
[0363] The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one “backbone attachment point,” preferably two “backbone attachment points” and (ii) at least one “tethering attachment point.” A “backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid. A “tethering attachment point” (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected moiety is connected by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring.
[0364] The RNAi agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and and decalin; preferably, the acyclic group is selected from serinol backbone or diethanolamine backbone.
[0365] In certain specific embodiments, the RNAi agent for use in the methods of the disclosure is an agent selected from the group of agents listed in any one of Tables 2A, 2B, 3, 5A, 5B, 6, 9, 10-15, 16A, 16B, and 26. These agents may further comprise a ligand.
IV. APP Knockdown to Treat APP-Associated Diseases
[0366] Certain aspects of the instant disclosure are directed to RNAi agent-mediated knockdown of APP-associated diseases or disorders, which include CAA and AD, including hereditary CAA and EOFAD, as well as sporadic and/or late onset AD.
[0367] Hereditary CAA (hCAA) is a vascular proteinopathy, for which the amyloid therapeutic hypothesis is relatively straightforward and clinically testable. It is a devastating and rare disease, with no existing therapy. Both biochemical and imaging biomarkers exist for clinical validation of anti-APP siRNA-mediated treatment of hCAA.
[0368] One particular type of hCAA contemplated for treatment using the RNAi agents of the instant disclosure is “Dutch type” Aβ hCAA, which has an estimated patient population in the hundreds, primarily located in the Netherlands and Western Australia. Among APP-associated diseases, hCAA is unique in being purely vascular: in CAA, amyloid fibrils deposit in arterioles and capillaries of CNS parenchyma and leptomeninges, leading to cognitive decline due to cerebral ischemia and microhemorrhages in subjects suffering from CAA. CAA is present in greater than 80% of all AD subjects (with 25% of AD subjects having moderate-severe CAA), and the incidence of CAA rises with the age of a subject, at approximately 50% incidence in elderly over 70 years of age.
[0369] The following are exemplary manifestations of hereditary CAA: [0370] Amyloid-beta—Sporadic CAA, HCHWA-Dutch and Italian type EOFAD, LOAD, Trisomy 21 [0371] ABri—Familial British Dementia [0372] ADan—Familial Danish Dementia [0373] Cystatin C—HCHWA-Icelandic type (HCHWA-Hereditary cerebral hemorrhage with amyloidosis) [0374] Gelsolin—Familial Amyloidosis-Finnish type [0375] Prion protein—Prion disease [0376] Transthyretin—Hereditary systemic amyloidosis
[0377] As noted above, Aβ-hCAA (aka APP-hCAA) is a rapidly progressive, dementing disease associated with intracerebral hemorrhage. Known indications of CAA include both APP-hCAA and sporadic CAA. Possible additional CAA indications include: CAA associated with EOFAD (PSEN1; APP; PSEN2); CAA associated with Down syndrome; and CAA associated with late-onset Alzheimer's disease (for which prevalence is common, as noted above).
[0378] For APP-hCAA as an indication, the prevalence of APP-hCAA is not known; however, pure APP-hCAA is less common than EOFAD (Dutch type hCAA (involving an APP E693Q mutation) has been reported in several hundred individuals). Typically, onset of APP-hCAA symptoms occur from age 35-45; and APP-hCAA typically progresses to serious CVA within 2-5 years, resulting in a peak age at death from CVA at age 55.
[0379] Sporadic CAA as an indication exhibits relatively high prevalence: it is the common cause of lobar intracerebral hemorrhage (ICH) in the elderly. It is also a rapidly progressive disease, with 86 (36%) of 316 patients developed recurrent ICH over a mean follow up time of 5 years (Van Etten et al. 2016 Neurology). Cumulative dementia incidence in sporadic CAA was observed in one study to be 14% at 1 year and 73% at 5 years (Xiong et al. 2017 J Cerebr Blood Flow Metab). Sporadic CAA also overlaps extensively with AD, as advanced CAA has been identified as present in approximately 25% of AD brains; however, less than 50% of CAA cases actually meet the pathological criteria for AD.
[0380] To assess the efficacy of APP knockdown in a subject treated with a RNAi agent of the instant disclosure, it is expressly contemplated that soluble forms of APP, particularly including APPα and APPβ can serve as cerebrospinal fluid (CSF) biomarkers for assessing APP knockdown efficiency.
[0381] Amyloid-β production, elimination and deposition in CAA: converging evidence indicates that the major source of Aβ is neuronal. It is generated by sequential cleavage of amyloid precursor protein (APP) by β- and γ-secretases, in proportion to neuronal activity. Aβ is eliminated from the brain by four major pathways: (a) proteolytic degradation by endopeptidases (such as neprilysin and insulin degrading enzyme (IDE)); (b) receptor mediated clearance by cells in the brain parenchyma (microglia, astrocytes and to a lesser extent neurones); (c) active transport into the blood through the blood-brain barrier (BBB); (d) elimination along the perivascular pathways by which interstitial fluid drains from the brain. Specialized carriers (e.g., ApoE) and/or receptor transport mechanisms (eg, the low density lipoprotein receptor (LDLR) and LDLR related protein (LRP1)) are involved in all major cellular clearance pathways. Vascular deposition is facilitated by factors that increase the Aβ40:Aβ42 ratio (while increased Aβ42 leads to oligomerization and amyloid plaques) and impede perivascular passage.
[0382] As the clearance mechanisms fail with age, Aβ3 is increasingly entrapped from the perivascular drainage pathways into the basement membranes of capillaries and arterioles of the brain leading to CAA. ApoE alleles have a differential effect on different molecular and cellular processes of Aβ3 production, elimination and deposition in a way that they either increase or decrease the risk of developing CAA (Charidimou A et al. J Neurol Neurosurg Psychiatry 2012; 83: 124-137).
[0383] Sequential cleavage of APP occurs by two pathways. The APP family of proteins is noted as having large, biologically active, N-terminal ectodomains as well as a shorter C-terminus that contains a crucial Tyrosine-Glutamic Acid-Asparagine-Proline-Threonine-Tyrosine (YENPTY; SEQ ID NO: 1863) protein-sorting domain to which the adaptor proteins X11 and Fe65 bind. The resulting Aβ peptide cleavage product starts within the ectodomain and continues into the transmembrane region. In one pathway, APP is cleaved by α-secretase followed by γ-secretase in performing nonamyloidogenic processing of APP. In a second pathway, amyloidogenic processing of APP involves BACE1 cleavage followed by γ-secretase. Both processes generate soluble ectodomains (sAPPα and sAPPβ) and identical intracellular C-terminal fragments (AICD; SEQ ID NO: 1864; Thinakaran and Koo. J. Biol. Chem. 283: 29615-19; Reinhard et al. The EMBO Journal, 24: 3996-4006; Walsh et al. Biochemical Society Transactions, 35: 416-420; O'Brien and Wong. Annu Rev Neurosci. 34: 185-204).
[0384] CAA histopathology includes morphological changes of vessel walls (as revealed by haematoxylin-eosin staining) and Aβ deposition. In leptomeningeal arterioles, significant structural alterations and double barreling have been observed (Charidimou et al. J Neurol Neurosurg Psychiatry 83: 124-137). In mild and moderate CAA, only minimal structural changes have been detected; however, in advanced CAA, significant structural alterations have been detected, the most extreme of which is double barreling (detachment and delamination of the outer part of the tunica media). A similar pathological range of CAA related changes in leptomeningeal arterioles have also been observed using immunohistochemical detection of Aβ. In mild CAA, patchy deposition of amyloid has been observed in the wall of examined vessels. Moderate CAA has shown more dense amyloid deposition which spans the entire vessel wall, while severe CAA has shown double balled vessels and endothelial involvement. Pathological findings of CAA in cortical arterioles has revealed progressive Aβ deposition in proportion to disease severity. Moderate CAA has shown pan-mural deposition of AP along with Aβ deposition in the surrounding brain parenchyma, while in severe CAA, a double barrel vessel has been observed, although this was less common as compared with leptomeningeal vessels (Charidimou et al.).
[0385] Pathogenesis of CAA has also been examined. Amyloid beta produced by the brain parenchyma is normally cleared via a perivascular route. Excessive production of Aβ expression of specific CAA-prone Aβ variants and delayed drainage of Aβ has been observed to lead to amyloid deposition in the media of small arteries in the CNS. Soluble and insoluble amyloid fibrils have been identified as toxic to vascular smooth muscle and such fibrils replace these cells, disabling vascular reactivity. Further damage to the endothelium has been observed to lead to microhemorrhages, microinfarcts and tissue destruction leading to dementia. Further progression has caused intracerebral hemorrhage, which has often been observed to be lethal. CAA has been observed to occur most frequently in the occipital lobe, less frequently in the hippocampus, cerebellum, basal ganglia, and not normally in the deep central grey matter, subcortical white matter and brain stem (Charidimou et al.).
[0386] Many potential outcome markers have been identified for performance of CAA human studies. In addition to symptomatic intracerebral haemorrhage, microbleeds, white matter hyperintensities (WMH) and amyloid imaging have been associated with disease severity and progression (Greenburg et al., Lancet Neurol 13: 419-28).
[0387] Available assays can also be used to detect soluble APP levels in human CSF samples. In particular, sAPPα and sAPPβ are soluble forms of APP and have been identified as serving as PD (pharmacodynamic) biomarkers. Analytes have also been detected in non-human primate (NHP) CSF samples, and such assays can enable efficacy studies in NHPs. Detection of Aβ40/42/38 peptides and Total tau/P181 Tau has also been described and is being implemented in the current studies.
[0388] Imaging biomarkers are also available for CAA studies, as cerebrovascular function has been identified to reflect pathology in CAA. Imaging has been specifically used to measure blood-oxygen-level-dependent (BOLD) signal after visual stimulation (Van Opstal et al., The lancet Neurology; 16(2); 2017; Peca S et al., Neurology. 2013; 81(19); Switzer A et al., NeuroImage Clinical; 2016). In performing BOLD fMRI in CAA subjects (assessing group blood oxygen level-dependent functional MRI responses for motor and visual tasks), reduced functional MRI activation has been observed for patients with CAA. In particular, BOLD fMRI activity in visual cortex has been observed to be correlated with higher WMH volume and higher microbleed count (Peca et al., Neurology 2013; 81(19); Switzer et al. NeuroImage Clinical 2016).
[0389] Animal models of CAA have also been described, which allow for determination of the effect of APP knockdown on CAA pathology and identification of translatable biomarkers. In particular, multiple rodent models that express mutant human APP and show CAA pathology have been developed, including Tg-SwDI/NOS2−/−. In Tg-SwDI/NOS2−/− model mice, increased Aβ levels have been identified with increased age of model mice. Perivascular hyperphosphorylated tau protein has also been associated with capillary amyloid not only in Tg-SwDI/NOS2−/− mice but also in human CAA-type 1 samples (Hall and Roberson. Brain Res Bull. 2012; 88(1): 3-12; Attems et al., Nephrology and Applied Neurobiology, 2011, 37, 75-93). A CVN mouse model of AD (APPSDI/NOS2 KO) also exhibited phenotypes including amyloid plaques in the hippocampus, thalamus and cortex, increased tissue inflammation and behavioral deficits. A transgenic rat model (harboring hAPP mutations) has also been developed.
[0390] Thus, APP has been identified as a target for hereditary cerebral amyloid angiopathy (CAA). Mutations in APP that have been reported to cause severe forms of CAA include A692G (Flemish), E693Q (Dutch), E693K (Italian), and D694N (Iowa). Meanwhile, mutations in APP that have been described to cause early onset AD include E665D, K670N, M671L (Swedish), T714A (Iranian), T714I (Austrian), V715M (French), V715A (German), I716V (Florida), I716T, V717I (London), V717F, V717G and V717L. In particular, the APP E693Q (Dutch) mutation causes severe CAA with few parenchymal neurofibrillary tangles; E693Q increases amyloid beta aggregation and toxicity; E693K (Italian) is similar but E693G (Arctic), E693A and E693delta mutations cause EOFAD with little or no CAA; and APP D694N (Iowa) causes severe CAA with typical AD pathology. In addition to the preceding point mutations, APP duplications that result in APP overexpression have also been identified to cause Aβ deposition. Meanwhile, no known APP mutations have been described that prevent or delay APP-hCAA. In addition to APP mutants, Aβ CAA has also been observed for PSEN1 (L282V) and PSEN2 (N141I) mutations. Meanwhile, ApoE ≥2 (independent of AD) and ApoE ε4 (dependent on AD) have also been reported as risk factors for CAA (Rensink A et al., Brain Research Reviews, 43 (2) 2003).
[0391] Certain aspects of the instant disclosure are directed towards targeting of APP for knockdown in individuals having APP-hCAA. A need exists for such agents because there are currently no disease-modifying therapies for CAA. In certain embodiments, the RNAi agents of the instant disclosure should provide approximately 60-80% knockdown of both mutant and WT APP levels throughout the CNS.
[0392] Humans with heterozygous APP mutations exist in the general population with pLI score of 0.3; however, no Human APP knockout has been identified thus far.
[0393] Pharmacological attempts to treat human CAA include the following: [0394] Ponezumab, an amyloid beta 40 antibody was studied by Pfizer in 36 individuals with late-onset CAA Three infusions of ponezumab or placebo over the course of 60 days were evaluated for changes in cerebrovascular reactivity as measured by BOLD fMRI, as well as for cerebral edema, infarcts, Aβ, cognitive change and other secondary outcomes. Ponezumab showed drug-placebo differences, but did not meet the primary endpoint. [0395] BAN2401-. Amyloid beta therapeutic antibodies delivered systemically were identified to be safe but also could cause local cerebral edema. In a recent phase II 18-mo trial of BAN2401 in LOAD, the incidence of SAEs was 17.6% for placebo and 15.5% for the highest dose (10 mg/kg biweekly). Amyloid Related Imaging Abnormalities-Edema (ARIA-E) was 14.6% at the highest dose in APOE4 carriers.
[0396] Against animal CAA models, ponezumab was noted as effective in a mouse model of CAA with respect to lowering amyloid beta burden and vascular reactivity (Bales, 2018). Meanwhile, global APP knockout mice have further been noted as viable.
[0397] The following exemplary biomarker and pathological data have also provided further validation for the primary role for amyloid beta protein in pathogenesis of CAA: [0398] Hereditary forms of “pure” CAA (i.e., lacking parenchymal plaque amyloid) have been observed as characterized by predominant Aβ40 deposition in amyloid, as opposed to Aβ42 in parenchymal AD; [0399] CAA has been observed as not a “tauopathy”, with normal levels of T-tau and P-tau in the CSF, in contrast to elevated levels observed in AD; [0400] The inverse correlation of increasing brain amyloid burden, measured by PiB PET, with decreasing CSF Aβ40 levels has been identified as unique to CAA; and [0401] In vitro and in vivo experimental data have provided increasing support to a prion hypothesis in CAA, wherein Aβ40 containing hereditary CAA mutations has a propensity to misfold and induce misfolding in WT protein, so that both are present in amyloid fibrils (akin to transthyretin (TTR)).
[0402] As disclosed in the below Examples, the instant disclosure provides a number of mouse/rat cross reactive APP-targeting duplexes (including, e.g., AD-397177, AD397192, AD-397196, AD-397182, AD397190, AD-397265 and AD-397203), based upon screening results obtained for APP liver mRNA, when duplexes were administered at 2 mg/Kg in a single dose, as assessed at day 21 post-dosing. The instant disclosure also provides a number of human/cynomolgus cross-reactive duplexes (including, e.g., AD-392911, AD-392912, AD-392703, AD-392866, AD-392927, AD-392913, AD-392843, AD-392916, AD-392714, AD-392844, AD-392926, AD-392824, AD-392704 and AD-392790), based upon screening results obtained for treatment of primary cynomolgus hepatocytes and human BE(2)C cells.
[0403] RNAi agent-mediated knockdown of EOFAD is also expressly contemplated. Like hCAA, EOFAD is a devastating and rare disease and—as for hCAA—a causal role of APP is well-established and phenotyping of the disease can be performed with greater accuracy and over a shorter duration of time than, e.g., sporadic and/or late onset AD (optionally late onset AD with severe CAA as a subclass of late onset AD). EOFAD is a progressive, dementing neurodegenerative disease in young adults, possessing an age of onset before age 60 to 65 years and often before 55 years of age.
[0404] The prevalence of EOFAD has been estimated to be 41.2 per 100,000 for the population at risk (i.e., persons aged 40-59 years), with 61% of those affected by EOFAD having a positive family history of EOFAD (among these, 13% had affected individuals in three generations). EOFAD comprises less than 3% of all AD (Bird, Genetics in Medicine, 10: 231-239; Brien and Wang. Annu Rev Neu Sci, 2011, 34: 185-204; NCBI Gene Reviews).
[0405] Providing human genetic validation of the APP target (OMIM 104300), certain APP mutations have been identified that cause EOFAD, including E665D, K670N, M671L (Swedish), T714A (Iranian), T714I (Austrian), V715M (French), V715A (German), I716V (Florida), I716T, V717I (London), V717F, V717G and V717L, as described above. In addition, dominant amyloid beta precursor protein mutations have also been identified that cause EOFAD and CAA.
[0406] Without wishing to be bound by theory, the pathogenesis of AD is believed to begin in the hippocampus, a ridge of grey matter immediately superior to both lateral ventricles. Degeneration of this tissue is believed to cause the memory loss characteristic of early disease. While the mechanism of neurodegeneration at the protein level has been a matter of great debate, duplications of APP associated with EOFAD have indicated that overexpression of APP may be sufficient to cause AD. (Haass and Selkoe. Nature Reviews Molecular Cell Biology, 8: 101-112).
[0407] In contrast to EOFAD and CAA, the pathogenic mechanisms of sporadic AD are not yet understood and the population of clinically defined sporadic AD is probably mechanistically heterogeneous.
[0408] Certain aspects of the instant disclosure are directed towards targeting of APP for knockdown in individuals having EOFAD. A need exists for such agents because only symptom-directed treatments (of limited efficacy) exist for AD more generally and EOFAD in particular. In certain embodiments, the RNAi agents of the instant disclosure should provide approximately 60-80% knockdown of both mutant and WT APP levels throughout the CNS. One further observation from human genetics that speaks to the likely therapeutic efficacy of an APP-targeted therapy capable of knocking down APP levels in CNS cells is that an A673T mutation was identified that protected carriers from AD and dementia in the general population (Jonsson et al. Nature Letter, 488. doi:doi:10.1038/nature11283). The A673T substitution is adjacent to a β-secretase cleavage site, and has been described as resulting in a 40% reduction in amyloid beta in cell assays. Thus, a dominant negative APP point mutant appeared to protect families from AD, further reinforcing that RNAi agent-mediated knockdown of APP could exert a similar protective and/or therapeutic effect in at least certain forms of AD, including EOFAD.
[0409] Aiding initial stages of APP-targeting RNAi agent development, it has been noted that APP knockout mice are viable (OMIM 104300), which is expected to allow for viable use of mouse as a model system during lead compound development. In contrast to mice, while humans possessing heterozygous APP mutations exist in the general population with EXAC score of 0.3, no human APP knockout has been identified to date. Biomarkers available for development of APP-targeting RNAi agents include APP and MAPT peptides in CSF, which should allow for rapid assessment and useful efficacy even in a genetically homogeneous population (Mo et al. (2017) Alzheimers & Dementia: Diagnosis, Assessment & Disease Monitoring, 6: 201-209). As noted above, attempts to treat sporadic forms of AD and EOFAD have to date proven unsuccessful—for example, all trials of BACE1 (β-secretase) inhibitors (BACE1i) for treatment of sporadic AD have thus far failed (Egan et al. The New England Journal of Medicine, 378: 1691-1703; Hung and Fu. Journal of Biomedical Science, 24: 47). In such BACEi testing, there have been no completed studies in genetically-defined populations (only studies initiated). Notably, the most recent BACE1i study showed that verubecestat lowered amyloid beta levels by 60% in a population selected based on age and clinical criteria that suggested a probable diagnosis of AD (Egan et al. The New England Journal of Medicine, 378: 1691-1703; Hung and Fu. Journal of Biomedical Science, 24: 47). Meanwhile, among Aβ-directed immunotherapies, one such immunotherapy demonstrated proof-of-concept in a recent trial in sporadic AD, supporting initiation of an ongoing Phase III trial (Selkoe and Hardy. EMBO Molecular Medicine, 8: 595-608). Given its role in APP cleavage, γ-secretase has also been targeted in certain AD-directed trials. However, to date no γ-secretase inhibitor trials have been completed in a genetically-defined population; and several programs have been discontinued for toxicity (Selkoe and Hardy).
[0410] A need therefore exists for agents that can treat or prevent APP-associated diseases or disorders in an affected individual.
[0411] It is expressly contemplated that all APP-associated diseases or disorders can ultimately be targeted using the RNAi agents of the instant disclosure—specifically, targeting of sporadic CAA and sporadic and/or late onset AD is also contemplated for the RNAi agents of the instant disclosure, even in view of the diagnostic/phenotyping issues presently confronted for these particular APP-associated diseases (it is further contemplated that diagnostics for these diseases will also continue to improve).
V. RNAi Agents Conjugated to Ligands
[0412] Another modification of the RNA of a RNAi agent of the disclosure involves chemically linking to the RNA one or more ligands, moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the RNAi. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., (1989) Proc. Natl. Acid. Sci. USA, 86: 6553-6556), cholic acid (Manoharan et al., (1994) Biorg. Med. Chem. Let., 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., (1992) Ann. N.Y. Acad. Sci., 660:306-309; Manoharan et al., (1993) Biorg. Med. Chem. Let., 3:2765-2770), a thiocholesterol (Oberhauser et al., (1992) Nucl. Acids Res., 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., (1991) EMBO J, 10:1111-1118; Kabanov et al., (1990) FEBS Lett., 259:327-330; Svinarchuk et al., (1993) Biochimie, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654; Shea et al., (1990) Nucl. Acids Res., 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., (1995) Nucleosides & Nucleotides, 14:969-973), or adamantane acetic acid (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654), a palmityl moiety (Mishra et al., (1995) Biochim. Biophys. Acta, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., (1996) J. Pharmacol. Exp. Ther., 277:923-937).
[0413] In one embodiment, a ligand alters the distribution, targeting or lifetime of a RNAi agent into which it is incorporated. In preferred embodiments a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. Preferred ligands will not take part in duplex pairing in a duplexed nucleic acid.
[0414] Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.
[0415] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.
[0416] Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG].sub.2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.
[0417] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a CNS cell. Ligands can also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, or multivalent fucose.
[0418] The ligand can be a substance, e.g., a drug, which can increase the uptake of the RNAi agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.
[0419] In some embodiments, a ligand attached to a RNAi agent as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present disclosure as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.
[0420] Ligand-conjugated oligonucleotides of the disclosure may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.
[0421] The oligonucleotides used in the conjugates of the present disclosure may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.
[0422] In the ligand-conjugated oligonucleotides and ligand-molecule bearing sequence-specific linked nucleosides of the present disclosure, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.
[0423] When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present disclosure are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.
[0424] A. Lipophilic Moieties
[0425] In certain embodiments, the lipophilic moiety is an aliphatic, cyclic such as alicyclic, or polycyclic such as polyalicyclic compound, such as a steroid (e.g., sterol) or a linear or branched aliphatic hydrocarbon. The lipophilic moiety may generally comprises a hydrocarbon chain, which may be cyclic or acyclic. The hydrocarbon chain may comprise various substituents and/or one or more heteroatoms, such as an oxygen or nitrogen atom. Such lipophilic aliphatic moieties include, without limitation, saturated or unsaturated C.sub.4-C.sub.30 hydrocarbon (e.g., C.sub.6-C.sub.18 hydrocarbon), saturated or unsaturated fatty acids, waxes (e.g., monohydric alcohol esters of fatty acids and fatty diamides), terpenes (e.g., C.sub.10 terpenes, C.sub.15 sesquiterpenes, C.sub.20 diterpenes, C.sub.30 triterpenes, and C.sub.40 tetraterpenes), and other polyalicyclic hydrocarbons. For instance, the lipophilic moiety may contain a C.sub.4-C.sub.30 hydrocarbon chain (e.g., C.sub.4-C.sub.30 alkyl or alkenyl). In some embodiment the lipophilic moiety contains a saturated or unsaturated C.sub.6-C.sub.18 hydrocarbon chain (e.g., a linear C.sub.6-C.sub.18 alkyl or alkenyl). In one embodiment, the lipophilic moiety contains a saturated or unsaturated C.sub.16 hydrocarbon chain (e.g., a linear C.sub.16 alkyl or alkenyl).
[0426] The lipophilic moiety may be attached to the RNAi agent by any method known in the art, including via a functional grouping already present in the lipophilic moiety or introduced into the RNAi agent, such as a hydroxy group (e.g., —CO—CH.sub.2—OH). The functional groups already present in the lipophilic moiety or introduced into the RNAi agent include, but are not limited to, hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne.
[0427] Conjugation of the RNAi agent and the lipophilic moiety may occur, for example, through formation of an ether or a carboxylic or carbamoyl ester linkage between the hydroxy and an alkyl group R—, an alkanoyl group RCO— or a substituted carbamoyl group RNHCO—. The alkyl group R may be cyclic (e.g., cyclohexyl) or acyclic (e.g., straight-chained or branched; and saturated or unsaturated). Alkyl group R may be a butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, tetradecyl, pentadecyl, hexadecyl, heptadecyl or octadecyl group, or the like.
[0428] In some embodiments, the lipophilic moiety is conjugated to the double-stranded RNAi agent via a linker a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide linkage, a product of a click reaction (e.g., a triazole from the azide-alkyne cycloaddition), or carbamate.
[0429] In another embodiment, the lipophilic moiety is a steroid, such as sterol. Steroids are polycyclic compounds containing a perhydro-1,2-cyclopentanophenanthrene ring system. Steroids include, without limitation, bile acids (e.g., cholic acid, deoxycholic acid and dehydrocholic acid), cortisone, digoxigenin, testosterone, cholesterol, and cationic steroids, such as cortisone. A “cholesterol derivative” refers to a compound derived from cholesterol, for example by substitution, addition or removal of substituents.
[0430] In another embodiment, the lipophilic moiety is an aromatic moiety. In this context, the term “aromatic” refers broadly to mono- and polyaromatic hydrocarbons. Aromatic groups include, without limitation, C.sub.6-C.sub.14 aryl moieties comprising one to three aromatic rings, which may be optionally substituted; “aralkyl” or “arylalkyl” groups comprising an aryl group covalently linked to an alkyl group, either of which may independently be optionally substituted or unsubstituted; and “heteroaryl” groups. As used herein, the term “heteroaryl” refers to groups having 5 to 14 ring atoms, preferably 5, 6, 9, or 10 ring atoms; having 6, 10, or 14n electrons shared in a cyclic array, and having, in addition to carbon atoms, between one and about three heteroatoms selected from the group consisting of nitrogen (N), oxygen (O), and sulfur (S).
[0431] As employed herein, a “substituted” alkyl, cycloalkyl, aryl, heteroaryl, or heterocyclic group is one having between one and about four, preferably between one and about three, more preferably one or two, non-hydrogen substituents. Suitable substituents include, without limitation, halo, hydroxy, nitro, haloalkyl, alkyl, alkaryl, aryl, aralkyl, alkoxy, aryloxy, amino, acylamino, alkylcarbamoyl, arylcarbamoyl, aminoalkyl, alkoxycarbonyl, carboxy, hydroxyalkyl, alkanesulfonyl, arenesulfonyl, alkanesulfonamido, arenesulfonamido, aralkylsulfonamido, alkylcarbonyl, acyloxy, cyano, and ureido groups.
[0432] In some embodiments, the lipophilic moiety is an aralkyl group, e.g., a 2-arylpropanoyl moiety. The structural features of the aralkyl group are selected so that the lipophilic moiety will bind to at least one protein in vivo. In certain embodiments, the structural features of the aralkyl group are selected so that the lipophilic moiety binds to serum, vascular, or cellular proteins. In certain embodiments, the structural features of the aralkyl group promote binding to albumin, an immunoglobulin, a lipoprotein, α-2-macroglubulin, or α-1-glycoprotein.
[0433] In certain embodiments, the ligand is naproxen or a structural derivative of naproxen. Procedures for the synthesis of naproxen can be found in U.S. Pat. Nos. 3,904,682 and 4,009,197, which are hereby incorporated by reference in their entirety. Naproxen has the chemical name (S)-6-Methoxy-α-methyl-2-naphthaleneacetic acid and the structure is
##STR00003##
[0434] In certain embodiments, the ligand is ibuprofen or a structural derivative of ibuprofen. Procedures for the synthesis of ibuprofen can be found in U.S. Pat. No. 3,228,831, which are hereby incorporated by reference in their entirety. The structure of ibuprofen is
##STR00004##
[0435] Additional exemplary aralkyl groups are illustrated in U.S. Pat. No. 7,626,014, which is incorporated herein by reference in its entirety.
[0436] In another embodiment, suitable lipophilic moieties include lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, ibuprofen, naproxen, dimethoxytrityl, or phenoxazine.
[0437] In certain embodiments, more than one lipophilic moieties can be incorporated into the double-strand RNAi agent, particularly when the lipophilic moiety has a low lipophilicity or hydrophobicity. In one embodiment, two or more lipophilic moieties are incorporated into the same strand of the double-strand RNAi agent. In one embodiment, each strand of the double-strand RNAi agent has one or more lipophilic moieties incorporated. In one embodiment, two or more lipophilic moieties are incorporated into the same position (i.e., the same nucleobase, same sugar moiety, or same internucleosidic linkage) of the double-strand RNAi agent. This can be achieved by, e.g., conjugating the two or more lipophilic moieties via a carrier, and/or conjugating the two or more lipophilic moieties via a branched linker, and/or conjugating the two or more lipophilic moieties via one or more linkers, with one or more linkers linking the lipophilic moieties consecutively.
[0438] The lipophilic moiety may be conjugated to the RNAi agent via a direct attachment to the ribosugar of the RNAi agent. Alternatively, the lipophilic moiety may be conjugated to the double-strand RNAi agent via a linker or a carrier.
[0439] In certain embodiments, the lipophilic moiety may be conjugated to the RNAi agent via one or more linkers (tethers).
[0440] In one embodiment, the lipophilic moiety is conjugated to the double-stranded RNAi agent via a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide linkage, a product of a click reaction (e.g., a triazole from the azide-alkyne cycloaddition), or carbamate.
[0441] Exemplary linkers, tethers, carriers, nucleic acid modifications, conjugates, ligands and other moieties useful for achieving central nervous system-directed delivery of the APP-targeting RNAi agents of the instant disclosure are described in additional detail, e.g., in U.S. Application Nos. 62/668,072, 62/738,747 and/or 62/773,082, the entire contents of which are incorporated herein by this reference.
[0442] B. Lipid Conjugates
[0443] In one embodiment, the ligand or conjugate is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule preferably binds a serum protein, e.g., human serum albumin (HSA). An HSA binding ligand allows for vascular distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. In certain embodiments, the target tissue can be the CNS, including glial cells of the brain. Other molecules that can bind HSA can also be used as ligands. For example, neproxin or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g., HSA.
[0444] A lipid based ligand can be used to inhibit, e.g., control the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.
[0445] Optionally, the lipid based ligand binds HSA. Preferably, it binds HSA with a sufficient affinity such that the conjugate will be preferably distributed to a non-kidney tissue. However, it is preferred that the affinity not be so strong that the HSA-ligand binding cannot be reversed.
[0446] In another preferred embodiment, the lipid based ligand binds HSA weakly or not at all, such that the conjugate will be preferably distributed to the kidney. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid based ligand.
[0447] In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by target cells such as brain cells. Also included are HSA and low density lipoprotein (LDL).
[0448] C. Cell Permeation Agents
[0449] In another aspect, the ligand is a cell-permeation agent, preferably a helical cell-permeation agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is preferably an alpha-helical agent, which preferably has a lipophilic and a lipophobic phase.
[0450] The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to RNAi agents can affect pharmacokinetic distribution of the RNAi agent, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
[0451] A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 29). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO: 30) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a “delivery” peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 31) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 32) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Examples of a peptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit for cell targeting purposes is an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.
[0452] An RGD peptide for use in the compositions and methods of the disclosure may be linear or cyclic, and may be modified, e.g., glyciosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Preferred conjugates of this ligand target PECAM-1 or VEGF.
[0453] A “cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an α-helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g., α-defensin, β-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).
[0454] D. Carbohydrate Conjugates and Ligands
[0455] In some embodiments of the compositions and methods of the disclosure, an RNAi agent oligonucleotide further comprises a carbohydrate. The carbohydrate conjugated RNAi agents are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).
[0456] In one embodiment, a carbohydrate conjugate for use in the compositions and methods of the disclosure is a monosaccharide.
[0457] In certain embodiments, the compositions and methods of the disclosure include a C16 ligand. In exemplary embodiments, the C16 ligand of the disclosure has the following structure (exemplified here below for a uracil base, yet attachment of the C16 ligand is contemplated for a nucleotide presenting any base (C, G, A, etc.) and/or possessing any other modification as presented herein, provided that 2′ ribo attachment is preserved) and is attached at the 2′ position of the ribo within a residue that is so modified:
##STR00005##
[0458] As shown above, a C16 ligand-modified residue presents a straight chain alkyl at the 2′-ribo position of an exemplary residue (here, a Uracil) that is so modified.
[0459] In some embodiments, a carbohydrate conjugate of a RNAi agent of the instant disclosure further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and/or a cell permeation peptide.
[0460] Additional carbohydrate conjugates (and linkers) suitable for use in the present disclosure include those described in PCT Publication Nos. WO 2014/179620 and WO 2014/179627, the entire contents of each of which are incorporated herein by reference.
[0461] In certain embodiments, the compositions and methods of the disclosure include a vinyl phosponate (VP) modification of an RNAi agent as described herein. In exemplary embodiments, a vinyl phosphonate of the disclosure has the following structure:
##STR00006##
A vinyl phosponate of the instant disclosure may be attached to either the antisense or the sense strand of a dsRNA of the disclosure. In certain preferred embodiments, a vinyl phosphonate of the instant disclosure is attached to the antisense strand of a dsRNA, optionally at the 5′ end of the antisense strand of the dsRNA.
[0462] Vinyl phosphate modifications are also contemplated for the compositions and methods of the instant disclosure. An exemplary vinyl phosphate structure is:
##STR00007##
[0463] E. Thermally Destabilizing Modifications
[0464] In certain embodiments, a dsRNA molecule can be optimized for RNA interference by incorporating thermally destabilizing modifications in the seed region of the antisense strand (i.e., at positions 2-9 of the 5′-end of the antisense strand) to reduce or inhibit off-target gene silencing. It has been discovered that dsRNAs with an antisense strand comprising at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5′ end, of the antisense strand have reduced off-target gene silencing activity. Accordingly, in some embodiments, the antisense strand comprises at least one (e.g., one, two, three, four, five or more) thermally destabilizing modification of the duplex within the first 9 nucleotide positions of the 5′ region of the antisense strand. In some embodiments, one or more thermally destabilizing modification(s) of the duplex is/are located in positions 2-9, or preferably positions 4-8, from the 5′-end of the antisense strand. In some further embodiments, the thermally destabilizing modification(s) of the duplex is/are located at position 6, 7 or 8 from the 5′-end of the antisense strand. In still some further embodiments, the thermally destabilizing modification of the duplex is located at position 7 from the 5′-end of the antisense strand. The term “thermally destabilizing modification(s)” includes modification(s) that would result with a dsRNA with a lower overall melting temperature (Tm) (preferably a Tm with one, two, three or four degrees lower than the Tm of the dsRNA without having such modification(s). In some embodiments, the thermally destabilizing modification of the duplex is located at position 2, 3, 4, 5 or 9 from the 5′-end of the antisense strand.
[0465] The thermally destabilizing modifications can include, but are not limited to, abasic modification; mismatch with the opposing nucleotide in the opposing strand; and sugar modification such as 2′-deoxy modification or acyclic nucleotide, e.g., unlocked nucleic acids (UNA) or glycol nucleic acid (GNA).
[0466] Exemplified abasic modifications include, but are not limited to the following:
##STR00008##
[0467] Wherein R=H, Me, Et or OMe; R′=H, Me, Et or OMe; R″=H, Me, Et or OMe
##STR00009##
wherein B is a modified or unmodified nucleobase.
[0468] Exemplified sugar modifications include, but are not limited to the following:
##STR00010##
wherein B is a modified or unmodified nucleobase.
[0469] In some embodiments the thermally destabilizing modification of the duplex is selected from the group consisting of:
##STR00011##
wherein B is a modified or unmodified nucleobase and the asterisk on each structure represents either R, S or racemic.
[0470] The term “acyclic nucleotide” refers to any nucleotide having an acyclic ribose sugar, for example, where any of bonds between the ribose carbons (e.g., C1′-C2′, C2′-C3′, C3′-C4′, C4′-O4′, or C1′-O4′) is absent and/or at least one of ribose carbons or oxygen (e.g., C1′, C2′, C3′, C4′ or O4′) are independently or in combination absent from the nucleotide. In some embodiments, acyclic nucleotide is
##STR00012##
wherein B is a modified or unmodified nucleobase, R.sup.1 and R.sup.2 independently are H, halogen, OR.sub.3, or alkyl; and R.sub.3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar). The term “UNA” refers to unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked “sugar” residue. In one example, UNA also encompasses monomers with bonds between C1′-C4′ being removed (i.e. the covalent carbon-oxygen-carbon bond between the C1′ and C4′ carbons). In another example, the C2′-C3′ bond (i.e. the covalent carbon-carbon bond between the C2′ and C3′ carbons) of the sugar is removed (see Mikhailov et. al., Tetrahedron Letters, 26 (17): 2059 (1985); and Fluiter et al., Mol. Biosyst., 10: 1039 (2009), which are hereby incorporated by reference in their entirety). The acyclic derivative provides greater backbone flexibility without affecting the Watson-Crick pairings. The acyclic nucleotide can be linked via 2′-5′ or 3′-5′ linkage.
[0471] The term ‘GNA’ refers to glycol nucleic acid which is a polymer similar to DNA or RNA but differing in the composition of its “backbone” in that is composed of repeating glycerol units linked by phosphodiester bonds:
##STR00013##
[0472] The thermally destabilizing modification of the duplex can be mismatches (i.e., noncomplementary base pairs) between the thermally destabilizing nucleotide and the opposing nucleotide in the opposite strand within the dsRNA duplex. Exemplary mismatch base pairs include G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, U:T, or a combination thereof. Other mismatch base pairings known in the art are also amenable to the present invention. A mismatch can occur between nucleotides that are either naturally occurring nucleotides or modified nucleotides, i.e., the mismatch base pairing can occur between the nucleobases from respective nucleotides independent of the modifications on the ribose sugars of the nucleotides. In certain embodiments, the dsRNA molecule contains at least one nucleobase in the mismatch pairing that is a 2′-deoxy nucleobase; e.g., the 2′-deoxy nucleobase is in the sense strand.
[0473] In some embodiments, the thermally destabilizing modification of the duplex in the seed region of the antisense strand includes nucleotides with impaired W—C H-bonding to complementary base on the target mRNA, such as:
##STR00014##
[0474] More examples of abasic nucleotide, acyclic nucleotide modifications (including UNA and GNA), and mismatch modifications have been described in detail in WO 2011/133876, which is herein incorporated by reference in its entirety.
[0475] The thermally destabilizing modifications may also include universal base with reduced or abolished capability to form hydrogen bonds with the opposing bases, and phosphate modifications.
[0476] In some embodiments, the thermally destabilizing modification of the duplex includes nucleotides with non-canonical bases such as, but not limited to, nucleobase modifications with impaired or completely abolished capability to form hydrogen bonds with bases in the opposite strand. These nucleobase modifications have been evaluated for destabilization of the central region of the dsRNA duplex as described in WO 2010/0011895, which is herein incorporated by reference in its entirety. Exemplary nucleobase modifications are:
##STR00015##
[0477] In some embodiments, the thermally destabilizing modification of the duplex in the seed region of the antisense strand includes one or more α-nucleotide complementary to the base on the target mRNA, such as:
##STR00016##
wherein R is H, OH, OCH.sub.3, F, NH.sub.2, NHMe, NMe.sub.2 or O-alkyl.
[0478] Exemplary phosphate modifications known to decrease the thermal stability of dsRNA duplexes compared to natural phosphodiester linkages are:
##STR00017##
[0479] The alkyl for the R group can be a C.sub.1-C.sub.6alkyl. Specific alkyls for the R group include, but are not limited to methyl, ethyl, propyl, isopropyl, butyl, pentyl and hexyl. As the skilled artisan will recognize, in view of the functional role of nucleobases is defining specificity of a RNAi agent of the disclosure, while nucleobase modifications can be performed in the various manners as described herein, e.g., to introduce destabilizing modifications into a RNAi agent of the disclosure, e.g., for purpose of enhancing on-target effect relative to off-target effect, the range of modifications available and, in general, present upon RNAi agents of the disclosure tends to be much greater for non-nucleobase modifications, e.g., modifications to sugar groups and/or phosphate backbones of polyribonucleotides. Such modifications are described in greater detail in other sections of the instant disclosure and are expressly contemplated for RNAi agents of the disclosure, either possessing native nucleobases or modified nucleobases as described above and/or elsewhere herein.
[0480] In addition to the antisense strand comprising a thermally destabilizing modification, the dsRNA can also comprise one or more stabilizing modifications. For example, the dsRNA can comprise at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications. Without limitations, the stabilizing modifications all can be present in one strand. In some embodiments, both the sense and the antisense strands comprise at least two stabilizing modifications. The stabilizing modification can occur on any nucleotide of the sense strand or antisense strand. For instance, the stabilizing modification can occur on every nucleotide on the sense strand and/or antisense strand; each stabilizing modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both stabilizing modification in an alternating pattern. The alternating pattern of the stabilizing modifications on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the stabilizing modifications on the sense strand can have a shift relative to the alternating pattern of the stabilizing modifications on the antisense strand.
[0481] In some embodiments, the antisense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications. Without limitations, a stabilizing modification in the antisense strand can be present at any positions. In some embodiments, the antisense comprises stabilizing modifications at positions 2, 6, 8, 9, 14 and 16 from the 5′-end. In some other embodiments, the antisense comprises stabilizing modifications at positions 2, 6, 14 and 16 from the 5′-end. In still some other embodiments, the antisense comprises stabilizing modifications at positions 2, 14 and 16 from the 5′-end.
[0482] In some embodiments, the antisense strand comprises at least one stabilizing modification adjacent to the destabilizing modification. For example, the stabilizing modification can be the nucleotide at the 5′-end or the 3′-end of the destabilizing modification, i.e., at position −1 or +1 from the position of the destabilizing modification. In some embodiments, the antisense strand comprises a stabilizing modification at each of the 5′-end and the 3′-end of the destabilizing modification, i.e., positions −1 and +1 from the position of the destabilizing modification. In some embodiments, the antisense strand comprises at least two stabilizing modifications at the 3′-end of the destabilizing modification, i.e., at positions +1 and +2 from the position of the destabilizing modification.
[0483] In some embodiments, the sense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications. Without limitations, a stabilizing modification in the sense strand can be present at any positions. In some embodiments, the sense strand comprises stabilizing modifications at positions 7, 10 and 11 from the 5′-end. In some other embodiments, the sense strand comprises stabilizing modifications at positions 7, 9, 10 and 11 from the 5′-end. In some embodiments, the sense strand comprises stabilizing modifications at positions opposite or complimentary to positions 11, 12 and 15 of the antisense strand, counting from the 5′-end of the antisense strand. In some other embodiments, the sense strand comprises stabilizing modifications at positions opposite or complimentary to positions 11, 12, 13 and 15 of the antisense strand, counting from the 5′-end of the antisense strand. In some embodiments, the sense strand comprises a block of two, three or four stabilizing modifications.
[0484] In some embodiments, the sense strand does not comprise a stabilizing modification in position opposite or complimentary to the thermally destabilizing modification of the duplex in the antisense strand.
[0485] Exemplary thermally stabilizing modifications include, but are not limited to 2′-fluoro modifications. Other thermally stabilizing modifications include, but are not limited to LNA.
[0486] In some embodiments, the dsRNA of the disclosure comprises at least four (e.g., four, five, six, seven, eight, nine, ten or more) 2′-fluoro nucleotides. Without limitations, the 2′-fluoro nucleotides all can be present in one strand. In some embodiments, both the sense and the antisense strands comprise at least two 2′-fluoro nucleotides. The 2′-fluoro modification can occur on any nucleotide of the sense strand or antisense strand. For instance, the 2′-fluoro modification can occur on every nucleotide on the sense strand and/or antisense strand; each 2′-fluoro modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both 2′-fluoro modifications in an alternating pattern. The alternating pattern of the 2′-fluoro modifications on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the 2′-fluoro modifications on the sense strand can have a shift relative to the alternating pattern of the 2′-fluoro modifications on the antisense strand.
[0487] In some embodiments, the antisense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) 2′-fluoro nucleotides. Without limitations, a 2′-fluoro modification in the antisense strand can be present at any positions. In some embodiments, the antisense comprises 2′-fluoro nucleotides at positions 2, 6, 8, 9, 14 and 16 from the 5′-end. In some other embodiments, the antisense comprises 2′-fluoro nucleotides at positions 2, 6, 14 and 16 from the 5′-end. In still some other embodiments, the antisense comprises 2′-fluoro nucleotides at positions 2, 14 and 16 from the 5′-end.
[0488] In some embodiments, the antisense strand comprises at least one 2′-fluoro nucleotide adjacent to the destabilizing modification. For example, the 2′-fluoro nucleotide can be the nucleotide at the 5′-end or the 3′-end of the destabilizing modification, i.e., at position −1 or +1 from the position of the destabilizing modification. In some embodiments, the antisense strand comprises a 2′-fluoro nucleotide at each of the 5′-end and the 3′-end of the destabilizing modification, i.e., positions −1 and +1 from the position of the destabilizing modification.
[0489] In some embodiments, the antisense strand comprises at least two 2′-fluoro nucleotides at the 3′-end of the destabilizing modification, i.e., at positions +1 and +2 from the position of the destabilizing modification.
[0490] In some embodiments, the sense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) 2′-fluoro nucleotides. Without limitations, a 2′-fluoro modification in the sense strand can be present at any positions. In some embodiments, the antisense comprises 2′-fluoro nucleotides at positions 7, 10 and 11 from the 5′-end. In some other embodiments, the sense strand comprises 2′-fluoro nucleotides at positions 7, 9, 10 and 11 from the 5′-end. In some embodiments, the sense strand comprises 2′-fluoro nucleotides at positions opposite or complimentary to positions 11, 12 and 15 of the antisense strand, counting from the 5′-end of the antisense strand. In some other embodiments, the sense strand comprises 2′-fluoro nucleotides at positions opposite or complimentary to positions 11, 12, 13 and 15 of the antisense strand, counting from the 5′-end of the antisense strand. In some embodiments, the sense strand comprises a block of two, three or four 2′-fluoro nucleotides.
[0491] In some embodiments, the sense strand does not comprise a 2′-fluoro nucleotide in position opposite or complimentary to the thermally destabilizing modification of the duplex in the antisense strand.
[0492] In some embodiments, the dsRNA molecule of the disclosure comprises a 21 nucleotides (nt) sense strand and a 23 nucleotides (nt) antisense, wherein the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide occurs in the seed region of the antisense strand (i.e., at position 2-9 of the 5′-end of the antisense strand), wherein one end of the dsRNA is blunt, while the other end is comprises a 2 nt overhang, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2′-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4 or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2′-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4 or 5 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2′-fluoro modifications; and (vii) the dsRNA comprises a blunt end at 5′-end of the antisense strand. Preferably, the 2 nt overhang is at the 3′-end of the antisense.
[0493] In some embodiments, the dsRNA molecule of the disclosure comprising a sense and antisense strands, wherein: the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5′ terminal nucleotide (position 1), positions 1 to 23 of said sense strand comprise at least 8 ribonucleotides; antisense strand is 36-66 nucleotide residues in length and, starting from the 3′ terminal nucleotide, at least 8 ribonucleotides in the positions paired with positions 1-23 of sense strand to form a duplex; wherein at least the 3 ‘ terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3’ terminal nucleotides are unpaired with sense strand, thereby forming a 3′ single stranded overhang of 1-6 nucleotides; wherein the 5′ terminus of antisense strand comprises from 10-30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10-30 nucleotide single stranded 5′ overhang; wherein at least the sense strand 5′ terminal and 3′ terminal nucleotides are base paired with nucleotides of antisense strand when sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplexed region between sense and antisense strands; and antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when said double stranded nucleic acid is introduced into a mammalian cell; and wherein the antisense strand contains at least one thermally destabilizing nucleotide, where at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. at position 2-9 of the 5′-end of the antisense strand). For example, the thermally destabilizing nucleotide occurs between positions opposite or complimentary to positions 14-17 of the 5′-end of the sense strand, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2′-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4 or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2′-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4 or 5 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2′-fluoro modifications; and (vii) the dsRNA comprises a duplex region of 12-30 nucleotide pairs in length.
[0494] In some embodiments, the dsRNA molecule of the disclosure comprises a sense and antisense strands, wherein said dsRNA molecule comprises a sense strand having a length which is at least 25 and at most 29 nucleotides and an antisense strand having a length which is at most 30 nucleotides with the sense strand comprises a modified nucleotide that is susceptible to enzymatic degradation at position 11 from the 5′end, wherein the 3′ end of said sense strand and the 5′ end of said antisense strand form a blunt end and said antisense strand is 1˜4 nucleotides longer at its 3′ end than the sense strand, wherein the duplex region which is at least 25 nucleotides in length, and said antisense strand is sufficiently complementary to a target mRNA along at least 19 nt of said antisense strand length to reduce target gene expression when said dsRNA molecule is introduced into a mammalian cell, and wherein dicer cleavage of said dsRNA preferentially results in an siRNA comprising said 3′ end of said antisense strand, thereby reducing expression of the target gene in the mammal, wherein the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e. at position 2-9 of the 5′-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2′-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4 or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2′-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4 or 5 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2′-fluoro modifications; and (vii) the dsRNA has a duplex region of 12-29 nucleotide pairs in length.
[0495] In some embodiments, every nucleotide in the sense strand and antisense strand of the dsRNA molecule may be modified. Each nucleotide may be modified with the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2′ hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone.
[0496] As nucleic acids are polymers of subunits, many of the modifications occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate moiety, or a non-linking O of a phosphate moiety. In some cases the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not. By way of example, a modification may only occur at a 3′ or 5′ terminal position, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand. A modification may occur in a double strand region, a single strand region, or in both. A modification may occur only in the double strand region of a RNA or may only occur in a single strand region of a RNA. E.g., a phosphorothioate modification at a non-linking O position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini. The 5′ end or ends can be phosphorylated.
[0497] It may be possible, e.g., to enhance stability, to include particular bases in overhangs, or to include modified nucleotides or nucleotide surrogates, in single strand overhangs, e.g., in a 5′ or 3′ overhang, or in both. E.g., it can be desirable to include purine nucleotides in overhangs. In some embodiments all or some of the bases in a 3′ or 5′ overhang may be modified, e.g., with a modification described herein. Modifications can include, e.g., the use of modifications at the 2′ position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, 2′-deoxy-2′-fluoro (2′-F) or 2′-O-methyl modified instead of the ribosugar of the nucleobase, and modifications in the phosphate group, e.g., phosphorothioate modifications. Overhangs need not be homologous with the target sequence.
[0498] In some embodiments, each residue of the sense strand and antisense strand is independently modified with LNA, HNA, CeNA, 2′-methoxyethyl, 2′-O-methyl, 2′40-allyl, 2′-C-allyl, 2′-deoxy, or 2′-fluoro. The strands can contain more than one modification. In some embodiments, each residue of the sense strand and antisense strand is independently modified with 2′-O-methyl or 2′-fluoro. It is to be understood that these modifications are in addition to the at least one thermally destabilizing modification of the duplex present in the antisense strand.
[0499] At least two different modifications are typically present on the sense strand and antisense strand. Those two modifications may be the 2′-deoxy, 2′-O-methyl or 2′-fluoro modifications, acyclic nucleotides or others. In some embodiments, the sense strand and antisense strand each comprises two differently modified nucleotides selected from 2′-O-methyl or 2′-deoxy. In some embodiments, each residue of the sense strand and antisense strand is independently modified with 2′-O-methyl nucleotide, 2′-deoxy nucleotide, 2′-deoxy-2′-fluoro nucleotide, 2′-O—N-methylacetamido (2′-O-NMA) nucleotide, a 2′-O-dimethylaminoethoxyethyl (2′-O-DMAEOE) nucleotide, 2′-O-aminopropyl (2′-O-AP) nucleotide, or 2′-ara-F nucleotide. Again, it is to be understood that these modifications are in addition to the at least one thermally destabilizing modification of the duplex present in the antisense strand.
[0500] In some embodiments, the dsRNA molecule of the disclosure comprises modifications of an alternating pattern, particular in the B1, B2, B3, B1′, B2′, B3′, B4′ regions. The term “alternating motif” or “alternative pattern” as used herein refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of one strand. The alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern. For example, if A, B and C each represent one type of modification to the nucleotide, the alternating motif can be “ABABABABABAB . . . ,” “AABBAABBAABB . . . ,” “AABAABAABAAB . . . ,” “AAABAAABAAAB . . . ,” “AAABBBAAABBB . . . ,” or “ABCABCABCABC . . . ,” etc. The type of modifications contained in the alternating motif may be the same or different. For example, if A, B, C, D each represent one type of modification on the nucleotide, the alternating pattern, i.e., modifications on every other nucleotide, may be the same, but each of the sense strand or antisense strand can be selected from several possibilities of modifications within the alternating motif such as “ABABAB . . . ”, “ACACAC . . . ” “BDBDBD . . . ” or “CDCDCD . . . ,” etc.
[0501] In some embodiments, the dsRNA molecule of the disclosure comprises the modification pattern for the alternating motif on the sense strand relative to the modification pattern for the alternating motif on the antisense strand is shifted. The shift may be such that the modified group of nucleotides of the sense strand corresponds to a differently modified group of nucleotides of the antisense strand and vice versa. For example, the sense strand when paired with the antisense strand in the dsRNA duplex, the alternating motif in the sense strand may start with “ABABAB” from 5′-3′ of the strand and the alternating motif in the antisense strand may start with “BABABA” from 3′-5′ of the strand within the duplex region. As another example, the alternating motif in the sense strand may start with “AABBAABB” from 5′-3′ of the strand and the alternating motif in the antisense strand may start with “BBAABBAA” from 3′-5′ of the strand within the duplex region, so that there is a complete or partial shift of the modification patterns between the sense strand and the antisense strand.
[0502] The dsRNA molecule of the disclosure may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. The phosphorothioate or methylphosphonate internucleotide linkage modification may occur on any nucleotide of the sense strand or antisense strand or both in any position of the strand. For instance, the internucleotide linkage modification may occur on every nucleotide on the sense strand and/or antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both internucleotide linkage modifications in an alternating pattern. The alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the internucleotide linkage modification on the antisense strand.
[0503] In some embodiments, the dsRNA molecule comprises the phosphorothioate or methylphosphonate internucleotide linkage modification in the overhang region. For example, the overhang region comprises two nucleotides having a phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides. Internucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within duplex region. For example, at least 2, 3, 4, or all the overhang nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate internucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide. For instance, there may be at least two phosphorothioate internucleotide linkages between the terminal three nucleotides, in which two of the three nucleotides are overhang nucleotides, and the third is a paired nucleotide next to the overhang nucleotide. Preferably, these terminal three nucleotides may be at the 3′-end of the antisense strand.
[0504] In some embodiments, the sense strand of the dsRNA molecule comprises 1-10 blocks of two to ten phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said sense strand is paired with an antisense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
[0505] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of two phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
[0506] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of three phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
[0507] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of four phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
[0508] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of five phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
[0509] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of six phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
[0510] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of seven phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7 or 8 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
[0511] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of eight phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5 or 6 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
[0512] In some embodiments, the antisense strand of the dsRNA molecule comprises two blocks of nine phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3 or 4 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
[0513] In some embodiments, the dsRNA molecule of the disclosure further comprises one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1-10 of the termini position(s) of the sense and/or antisense strand. For example, at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage at one end or both ends of the sense and/or antisense strand.
[0514] In some embodiments, the dsRNA molecule of the disclosure further comprises one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1-10 of the internal region of the duplex of each of the sense and/or antisense strand. For example, at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides may be linked through phosphorothioate methylphosphonate internucleotide linkage at position 8-16 of the duplex region counting from the 5′-end of the sense strand; the dsRNA molecule can optionally further comprise one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1-10 of the termini position(s).
[0515] In some embodiments, the dsRNA molecule of the disclosure further comprises one to five phosphorothioate or methylphosphonate internucleotide linkage modification(s) within position 1-5 and one to five phosphorothioate or methylphosphonate internucleotide linkage modification(s) within position 18-23 of the sense strand (counting from the 5′-end), and one to five phosphorothioate or methylphosphonate internucleotide linkage modification at positions 1 and 2 and one to five within positions 18-23 of the antisense strand (counting from the 5′-end).
[0516] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 and one phosphorothioate or methylphosphonate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5′-end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate or methylphosphonate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end).
[0517] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5′-end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end).
[0518] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and two phosphorothioate internucleotide linkage modifications within position 18-23 of the sense strand (counting from the 5′-end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end).
[0519] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and two phosphorothioate internucleotide linkage modifications within position 18-23 of the sense strand (counting from the 5′-end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5′-end).
[0520] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end).
[0521] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 and one within position 18-23 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modification at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5′-end).
[0522] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 (counting from the 5′-end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5′-end).
[0523] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 (counting from the 5′-end) of the sense strand, and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end).
[0524] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one within position 18-23 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5′-end).
[0525] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end).
[0526] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5′-end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5′-end).
[0527] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 20 and 21 of the sense strand (counting from the 5′-end), and one phosphorothioate internucleotide linkage modification at positions 1 and one at position 21 of the antisense strand (counting from the 5′-end).
[0528] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification at position 1, and one phosphorothioate internucleotide linkage modification at position 21 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 20 and 21 the antisense strand (counting from the 5′-end).
[0529] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 21 and 22 of the sense strand (counting from the 5′-end), and one phosphorothioate internucleotide linkage modification at positions 1 and one phosphorothioate internucleotide linkage modification at position 21 of the antisense strand (counting from the 5′-end).
[0530] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification at position 1, and one phosphorothioate internucleotide linkage modification at position 21 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 21 and 22 the antisense strand (counting from the 5′-end).
[0531] In some embodiments, the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 22 and 23 of the sense strand (counting from the 5′-end), and one phosphorothioate internucleotide linkage modification at positions 1 and one phosphorothioate internucleotide linkage modification at position 21 of the antisense strand (counting from the 5′-end).
[0532] In some embodiments, the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification at position 1, and one phosphorothioate internucleotide linkage modification at position 21 of the sense strand (counting from the 5′-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 23 and 23 the antisense strand (counting from the 5′-end).
[0533] In some embodiments, compound of the disclosure comprises a pattern of backbone chiral centers. In some embodiments, a common pattern of backbone chiral centers comprises at least 5 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 6 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 7 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 8 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 9 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 10 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 11 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 12 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 13 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 14 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 15 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 16 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 17 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 18 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 19 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 8 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 7 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 6 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 5 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 4 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 3 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 2 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 1 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 8 internucleotidic linkages which are not chiral (as a non-limiting example, a phosphodiester). In some embodiments, a common pattern of backbone chiral centers comprises no more than 7 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 6 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 5 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 4 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 3 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 2 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 1 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 10 internucleotidic linkages in the Sp configuration, and no more than 8 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 11 internucleotidic linkages in the Sp configuration, and no more than 7 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 12 internucleotidic linkages in the Sp configuration, and no more than 6 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 13 internucleotidic linkages in the Sp configuration, and no more than 6 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 14 internucleotidic linkages in the Sp configuration, and no more than 5 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 15 internucleotidic linkages in the Sp configuration, and no more than 4 internucleotidic linkages which are not chiral. In some embodiments, the internucleotidic linkages in the Sp configuration are optionally contiguous or not contiguous. In some embodiments, the internucleotidic linkages in the Rp configuration are optionally contiguous or not contiguous. In some embodiments, the internucleotidic linkages which are not chiral are optionally contiguous or not contiguous.
[0534] In some embodiments, compound of the disclosure comprises a block is a stereochemistry block. In some embodiments, a block is an Rp block in that each internucleotidic linkage of the block is Rp. In some embodiments, a 5′-block is an Rp block. In some embodiments, a 3′-block is an Rp block. In some embodiments, a block is an Sp block in that each internucleotidic linkage of the block is Sp. In some embodiments, a 5′-block is an Sp block. In some embodiments, a 3′-block is an Sp block. In some embodiments, provided oligonucleotides comprise both Rp and Sp blocks. In some embodiments, provided oligonucleotides comprise one or more Rp but no Sp blocks. In some embodiments, provided oligonucleotides comprise one or more Sp but no Rp blocks. In some embodiments, provided oligonucleotides comprise one or more PO blocks wherein each internucleotidic linkage in a natural phosphate linkage.
[0535] In some embodiments, compound of the disclosure comprises a 5′-block is an Sp block wherein each sugar moiety comprises a 2′-F modification. In some embodiments, a 5′-block is an Sp block wherein each of internucleotidic linkage is a modified internucleotidic linkage and each sugar moiety comprises a 2′-F modification. In some embodiments, a 5′-block is an Sp block wherein each of internucleotidic linkage is a phosphorothioate linkage and each sugar moiety comprises a 2′-F modification. In some embodiments, a 5′-block comprises 4 or more nucleoside units. In some embodiments, a 5′-block comprises 5 or more nucleoside units. In some embodiments, a 5′-block comprises 6 or more nucleoside units. In some embodiments, a 5′-block comprises 7 or more nucleoside units. In some embodiments, a 3′-block is an Sp block wherein each sugar moiety comprises a 2′-F modification. In some embodiments, a 3′-block is an Sp block wherein each of internucleotidic linkage is a modified internucleotidic linkage and each sugar moiety comprises a 2′-F modification. In some embodiments, a 3′-block is an Sp block wherein each of internucleotidic linkage is a phosphorothioate linkage and each sugar moiety comprises a 2′-F modification. In some embodiments, a 3′-block comprises 4 or more nucleoside units. In some embodiments, a 3′-block comprises 5 or more nucleoside units. In some embodiments, a 3′-block comprises 6 or more nucleoside units. In some embodiments, a 3′-block comprises 7 or more nucleoside units.
[0536] In some embodiments, compound of the disclosure comprises a type of nucleoside in a region or an oligonucleotide is followed by a specific type of internucleotidic linkage, e.g., natural phosphate linkage, modified internucleotidic linkage, Rp chiral internucleotidic linkage, Sp chiral internucleotidic linkage, etc. In some embodiments, A is followed by Sp. In some embodiments, A is followed by Rp. In some embodiments, A is followed by natural phosphate linkage (PO). In some embodiments, U is followed by Sp. In some embodiments, U is followed by Rp. In some embodiments, U is followed by natural phosphate linkage (PO). In some embodiments, C is followed by Sp. In some embodiments, C is followed by Rp. In some embodiments, C is followed by natural phosphate linkage (PO). In some embodiments, G is followed by Sp. In some embodiments, G is followed by Rp. In some embodiments, G is followed by natural phosphate linkage (PO). In some embodiments, C and U are followed by Sp. In some embodiments, C and U are followed by Rp. In some embodiments, C and U are followed by natural phosphate linkage (PO). In some embodiments, A and G are followed by Sp. In some embodiments, A and G are followed by Rp.
[0537] In some embodiments, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-9 of the 5′-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2′-fluoro modifications; (ii) the antisense comprises 3, 4 or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2′-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4 or 5 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2′-fluoro modifications; (vii) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5′-end of the antisense strand. In some embodiments, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-9 of the 5′-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2′-fluoro modifications; (ii) the sense strand is conjugated with a ligand; (iii) the sense strand comprises 2, 3, 4 or 5 2′-fluoro modifications; (iv) the sense strand comprises 1, 2, 3, 4 or 5 phosphorothioate internucleotide linkages; (v) the dsRNA comprises at least four 2′-fluoro modifications; (vi) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; (vii) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5′-end of the antisense strand.
[0538] In some embodiments, the sense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-9 of the 5′-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2′-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4 or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2′-fluoro modifications; (v) the sense strand comprises 3, 4 or 5 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2′-fluoro modifications; (vii) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5′-end of the antisense strand.
[0539] In some embodiments, the sense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-9 of the 5′-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2′-fluoro modifications; (ii) the sense strand is conjugated with a ligand; (iii) the sense strand comprises 2, 3, 4 or 5 2′-fluoro modifications; (iv) the sense strand comprises 3, 4 or 5 phosphorothioate internucleotide linkages; (v) the dsRNA comprises at least four 2′-fluoro modifications; (vi) the dsRNA comprises a duplex region of 12-40 nucleotide pairs in length; and (vii) the dsRNA has a blunt end at 5′-end of the antisense strand.
[0540] In some embodiments, the dsRNA molecule of the disclosure comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mismatch can occur in the overhang region or the duplex region. The base pair can be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.
[0541] In some embodiments, the dsRNA molecule of the disclosure comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5′-end of the antisense strand can be chosen independently from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5′-end of the duplex.
[0542] In some embodiments, the nucleotide at the 1 position within the duplex region from the 5′-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5′-end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5′-end of the antisense strand is an AU base pair.
[0543] It was found that introducing 4′-modified and/or 5′-modified nucleotide to the 3′-end of a phosphodiester (PO), phosphorothioate (PS), and/or phosphorodithioate (PS2) linkage of a dinucleotide at any position of single stranded or double stranded oligonucleotide can exert steric effect to the internucleotide linkage and, hence, protecting or stabilizing it against nucleases.
[0544] In some embodiments, 5′-modified nucleoside is introduced at the 3′-end of a dinucleotide at any position of single stranded or double stranded siRNA. For instance, a 5′-alkylated nucleoside may be introduced at the 3′-end of a dinucleotide at any position of single stranded or double stranded siRNA. The alkyl group at the 5′ position of the ribose sugar can be racemic or chirally pure R or S isomer. An exemplary 5′-alkylated nucleoside is 5′-methyl nucleoside. The 5′-methyl can be either racemic or chirally pure R or S isomer.
[0545] In some embodiments, 4′-modified nucleoside is introduced at the 3′-end of a dinucleotide at any position of single stranded or double stranded siRNA. For instance, a 4′-alkylated nucleoside may be introduced at the 3′-end of a dinucleotide at any position of single stranded or double stranded siRNA. The alkyl group at the 4′ position of the ribose sugar can be racemic or chirally pure R or S isomer. An exemplary 4′-alkylated nucleoside is 4′-methyl nucleoside. The 4′-methyl can be either racemic or chirally pure R or S isomer. Alternatively, a 4′-O-alkylated nucleoside may be introduced at the 3′-end of a dinucleotide at any position of single stranded or double stranded siRNA. The 4′-O-alkyl of the ribose sugar can be racemic or chirally pure R or S isomer. An exemplary 4′-O-alkylated nucleoside is 4′-O-methyl nucleoside. The 4′-O-methyl can be either racemic or chirally pure R or S isomer.
[0546] In some embodiments, 5′-alkylated nucleoside is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA. The 5′-alkyl can be either racemic or chirally pure R or S isomer. An exemplary 5′-alkylated nucleoside is 5′-methyl nucleoside. The 5′-methyl can be either racemic or chirally pure R or S isomer.
[0547] In some embodiments, 4′-alkylated nucleoside is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA. The 4′-alkyl can be either racemic or chirally pure R or S isomer. An exemplary 4′-alkylated nucleoside is 4′-methyl nucleoside. The 4′-methyl can be either racemic or chirally pure R or S isomer.
[0548] In some embodiments, 4′-O-alkylated nucleoside is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA. The 5′-alkyl can be either racemic or chirally pure R or S isomer. An exemplary 4′-O-alkylated nucleoside is 4′-O-methyl nucleoside. The 4′49-methyl can be either racemic or chirally pure R or S isomer.
[0549] In some embodiments, the dsRNA molecule of the disclosure can comprise 2′-5′ linkages (with 2′-H, 2′-OH and 2′-OMe and with P═O or P═S). For example, the 2′-5′ linkages modifications can be used to promote nuclease resistance or to inhibit binding of the sense to the antisense strand, or can be used at the 5′ end of the sense strand to avoid sense strand activation by RISC.
[0550] In another embodiment, the dsRNA molecule of the disclosure can comprise L sugars (e.g., L ribose, L-arabinose with 2′-H, 2′-OH and 2′-OMe). For example, these L sugars modifications can be used to promote nuclease resistance or to inhibit binding of the sense to the antisense strand, or can be used at the 5′ end of the sense strand to avoid sense strand activation by RISC.
[0551] Various publications describe multimeric siRNA which can all be used with the dsRNA of the disclosure. Such publications include WO2007/091269, U.S. Pat. No. 7,858,769, WO2010/141511, WO2007/117686, WO2009/014887 and WO2011/031520 which are hereby incorporated by their entirely.
[0552] The dsRNA molecule that contains conjugations of one or more carbohydrate moieties to a dsRNA molecule can optimize one or more properties of the dsRNA molecule. In many cases, the carbohydrate moiety will be attached to a modified subunit of the dsRNA molecule. E.g., the ribose sugar of one or more ribonucleotide subunits of a dsRNA molecule can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS). A cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.
[0553] The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one “backbone attachment point,” preferably two “backbone attachment points” and (ii) at least one “tethering attachment point.” A “backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid. A “tethering attachment point” (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected moiety is connected by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring.
[0554] In one embodiment the dsRNA molecule of the disclosure is conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and decalin; preferably, the acyclic group is selected from serinol backbone or diethanolamine backbone.
[0555] The double-stranded RNA (dsRNA) agent of the disclosure may optionally be conjugated to one or more ligands. The ligand can be attached to the sense strand, antisense strand or both strands, at the 3′-end, 5′-end or both ends. For instance, the ligand may be conjugated to the sense strand, in particular, the 3′-end of the sense strand.
[0556] In some embodiments dsRNA molecules of the disclosure are 5′ phosphorylated or include a phosphoryl analog at the 5′ prime terminus. 5′-phosphate modifications include those which are compatible with RISC mediated gene silencing. Suitable modifications include: 5′-monophosphate ((HO).sub.2(O)P—O-5′); 5′-diphosphate ((HO).sub.2(O)P—O—P(HO)(O)—O-5′); 5′-triphosphate ((HO).sub.2(O)P—O—(HO)(O)P—O—P(HO)(O)—O-5′); 5′-guanosine cap (7-methylated or non-methylated) (7m-G-O-5′-(HO)(O)P—O—(HO)(O)P—O—P(HO)(O)—O-5′); 5′-adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (N—O-5′-(HO)(O)P—O—(HO)(O)P—O—P(HO)(O)—O-5′); 5′-monothiophosphate (phosphorothioate; (HO).sub.2(S)P—O-5′); 5′-monodithiophosphate (phosphorodithioate; (HO)(HS)(S)P—O-5′), 5′-phosphorothiolate ((HO)2(O)P—S-5′); any additional combination of oxygen/sulfur replaced monophosphate, diphosphate and triphosphates (e.g. 5′-alpha-thiotriphosphate, 5′-gamma-thiotriphosphate, etc.), 5′-phosphoramidates ((HO).sub.2(O)P—NH-5′, (HO)(NH.sub.2)(O)P—O-5′), 5′-alkylphosphonates (R=alkyl=methyl, ethyl, isopropyl, propyl, etc., e.g. RP(OH)(O)—O-5′-, 5′-alkenylphosphonates (i.e. vinyl, substituted vinyl), (OH).sub.2(O)P-5′-CH2-), 5′-alkyletherphosphonates (R=alkylether=methoxymethyl (MeOCH2-), ethoxymethyl, etc., e.g. RP(OH)(O)—O-5′-). In one example, the modification can in placed in the antisense strand of a dsRNA molecule.
[0557] F. Linkers
[0558] In some embodiments, the conjugate or ligand described herein can be attached to a RNAi agent oligonucleotide with various linkers that can be cleavable or non cleavable.
[0559] The term “linker” or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR.sub.8, C(O), C(O)NH, SO, SO.sub.2, SO.sub.2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO.sub.2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-17, or 8-16 atoms.
[0560] A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In a preferred embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).
[0561] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.
[0562] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.
[0563] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted.
[0564] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).
[0565] i. Redox Cleavable Linking Groups
[0566] In one embodiment, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (—S—S—). To determine if a candidate cleavable linking group is a suitable “reductively cleavable linking group,” or for example is suitable for use with a particular iRNA moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.
[0567] ii. Phosphate-Based Cleavable Linking Groups
[0568] In another embodiment, a cleavable linker comprises a phosphate-based cleavable linking group. A phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are —O—P(O)(ORk)-O—, —O—P(S)(ORk)-O—, —O—P(S)(SRk)-O—, —S—P(O)(ORk)-O—, —O—P(O)(ORk)-S—, —S—P(O)(ORk)-S—, —O—P(S)(ORk)-S—, —S—P(S)(ORk)-O—, —O—P(O)(Rk)-O—, —O—P(S)(Rk)-O—, —S—P(O)(Rk)-O—, —S—P(S)(Rk)-O—, —S—P(O)(Rk)-S—, —O—P(S)(Rk)-S—. Preferred embodiments are —O—P(O)(OH)—O—, —O—P(S)(OH)—O—, —O—P(S)(SH)—O—, —S—P(O)(OH)—O—, —O—P(O)(OH)—S—, —S—P(O)(OH)—S—, —O—P(S)(OH)—S—, —S—P(S)(OH)—O—, —O—P(O)(H)—O—, —O—P(S)(H)—O—, —S—P(O)(H)—O—, —S—P(S)(H)—O—, —S—P(O)(H)—S—, —O—P(S)(H)—S—. A preferred embodiment is —O—P(O)(OH)—O—. These candidates can be evaluated using methods analogous to those described above.
[0569] iii. Acid Cleavable Linking Groups
[0570] In another embodiment, a cleavable linker comprises an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In preferred embodiments acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula —C═NN—, C(O)O, or —OC(O). A preferred embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.
[0571] iv. Ester-based linking groups
[0572] In another embodiment, a cleavable linker comprises an ester-based cleavable linking group. An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula —C(O)O—, or —OC(O)—. These candidates can be evaluated using methods analogous to those described above.
[0573] v. Peptide-Based Cleaving Groups
[0574] In yet another embodiment, a cleavable linker comprises a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (—C(O)NH—). The amide group can be formed between any alkylene, alkenylene or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula —NHCHRAC(O)NHCHRBC(O)—, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.
[0575] Representative U.S. patents that teach the preparation of RNA conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; 8,106,022, the entire contents of each of which are hereby incorporated herein by reference.
[0576] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated in a single compound or even at a single nucleoside within a RNAi agent. The present disclosure also includes RNAi agents that are chimeric compounds.
[0577] “Chimeric” RNAi agents or “chimeras,” in the context of this disclosure, are RNAi agents, preferably dsRNAs, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound. These RNAi agents typically contain at least one region wherein the RNA is modified so as to confer upon the RNAi agent increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the RNAi agent can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of RNAi agent-mediated inhibition of gene expression. Consequently, comparable results can often be obtained with shorter RNAi agents when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
[0578] In certain instances, the RNA of a RNAi agent can be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to RNAi agents in order to enhance the activity, cellular distribution or cellular uptake of the RNAi agent, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of an RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.
VI. Delivery of a RNAi Agent of the Disclosure
[0579] The delivery of a RNAi agent of the disclosure to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having an APP-associated disorder, e.g., CAA and/or AD, e.g., EOFAD) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with a RNAi agent of the disclosure either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising a RNAi agent, e.g., a dsRNA, to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the RNAi agent. These alternatives are discussed further below.
[0580] In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with a RNAi agent of the disclosure (see e.g., Akhtar S. and Julian R L., (1992) Trends Cell. Biol. 2(5):139-144 and WO94/02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver a RNAi agent include, for example, biological stability of the delivered agent, prevention of non-specific effects, and accumulation of the delivered agent in the target tissue. The non-specific effects of a RNAi agent can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the RNAi agent to be administered. Several studies have shown successful knockdown of gene products when a RNAi agent is administered locally. For example, intraocular delivery of a VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino, M J. et al., (2004) Retina 24:132-138) and subretinal injections in mice (Reich, S J. et al. (2003) Mol. Vis. 9:210-216) were both shown to prevent neovascularization in an experimental model of age-related macular degeneration. In addition, direct intratumoral injection of a dsRNA in mice reduces tumor volume (Pille, J. et al. (2005) Mol. Ther. 11:267-274) and can prolong survival of tumor-bearing mice (Kim, W J. et al., (2006) Mol. Ther. 14:343-350; Li, S. et al., (2007) Mol. Ther. 15:515-523). RNA interference has also shown success with local delivery to the CNS by direct injection (Dorn, G. et al., (2004) Nucleic Acids 32:e49; Tan, P H. et al. (2005) Gene Ther. 12:59-66; Makimura, H. et al. (2002) BMC Neurosci. 3:18; Shishkina, G T., et al. (2004) Neuroscience 129:521-528; Thakker, E R., et al. (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275; Akaneya, Y., et al. (2005) J. Neurophysiol. 93:594-602) and to the lungs by intranasal administration (Howard, K A. et al., (2006) Mol. Ther. 14:476-484; Zhang, X. et al., (2004) J. Biol. Chem. 279:10677-10684; Bitko, V. et al., (2005) Nat. Med. 11:50-55). For administering a RNAi agent systemically for the treatment of a disease, the RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the dsRNA by endo- and exo-nucleases in vivo. Modification of the RNA or the pharmaceutical carrier can also permit targeting of the RNAi agent to the target tissue and avoid undesirable off-target effects (e.g., without wishing to be bound by theory, use of GNAs as described herein has been identified to destabilize the seed region of a dsRNA, resulting in enhanced preference of such dsRNAs for on-target effectiveness, relative to off-target effects, as such off-target effects are significantly weakened by such seed region destabilization). RNAi agents can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, a RNAi agent directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J. et al., (2004) Nature 432:173-178). Conjugation of a RNAi agent to an aptamer has been shown to inhibit tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, J O. et al., (2006) Nat. Biotechnol. 24:1005-1015). In an alternative embodiment, the RNAi agent can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of molecule RNAi agent (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of a RNAi agent by the cell. Cationic lipids, dendrimers, or polymers can either be bound to a RNAi agent, or induced to form a vesicle or micelle (see e.g., Kim S H. et al., (2008) Journal of Controlled Release 129(2):107-116) that encases a RNAi agent. The formation of vesicles or micelles further prevents degradation of the RNAi agent when administered systemically. Methods for making and administering cationic-RNAi agent complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., et al. (2003) J. Mol. Biol 327:761-766; Verma, U N. et al., (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A S et al. (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of RNAi agents include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N. et al., (2003), supra), Oligofectamine, “solid nucleic acid lipid particles” (Zimmermann, T S. et al., (2006) Nature 441:111-114), cardiolipin (Chien, P Y. et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E. et al., (2008) Pharm. Res. August 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A. et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. et al., (1999) Pharm. Res. 16:1799-1804). In some embodiments, a RNAi agent forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of RNAi agents and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is herein incorporated by reference in its entirety.
[0581] Certain aspects of the instant disclosure relate to a method of reducing the expression of an APP target gene in a cell, comprising contacting said cell with the double-stranded RNAi agent of the disclosure. In one embodiment, the cell is an extraheptic cell, optionally a CNS cell.
[0582] Another aspect of the disclosure relates to a method of reducing the expression of an APP target gene in a subject, comprising administering to the subject the double-stranded RNAi agent of the disclosure.
[0583] Another aspect of the disclosure relates to a method of treating a subject having a CNS disorder, comprising administering to the subject a therapeutically effective amount of the double-stranded APP-targeting RNAi agent of the disclosure, thereby treating the subject. Exemplary CNS disorders that can be treated by the method of the disclosure include alzheimer, amyotrophic lateral schlerosis (ALS), frontotemporal dementia, huntington, Parkinson, spinocerebellar, prion, and lafora.
[0584] In one embodiment, the double-stranded RNAi agent is administered intrathecally. By intrathecal administration of the double-stranded RNAi agent, the method can reduce the expression of an APP target gene in a brain or spine tissue, for instance, cortex, cerebellum, striatum, cervical spine, lumbar spine, and thoracic spine.
[0585] For ease of exposition the formulations, compositions and methods in this section are discussed largely with regard to modified siRNA compounds. It may be understood, however, that these formulations, compositions and methods can be practiced with other siRNA compounds, e.g., unmodified siRNA compounds, and such practice is within the disclosure. A composition that includes a RNAi agent can be delivered to a subject by a variety of routes. Exemplary routes include: intrathecal, intravenous, topical, rectal, anal, vaginal, nasal, pulmonary, ocular.
[0586] The RNAi agents of the disclosure can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically include one or more species of RNAi agent and a pharmaceutically acceptable carrier. As used herein the language “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
[0587] The pharmaceutical compositions of the present disclosure may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, intranasal, transdermal), oral or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, or intrathecal or intraventricular administration.
[0588] The route and site of administration may be chosen to enhance targeting. For example, to target muscle cells, intramuscular injection into the muscles of interest would be a logical choice. Lung cells might be targeted by administering the RNAi agent in aerosol form. The vascular endothelial cells could be targeted by coating a balloon catheter with the RNAi agent and mechanically introducing the DNA.
[0589] Formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.
[0590] Compositions for oral administration include powders or granules, suspensions or solutions in water, syrups, elixirs or non-aqueous media, tablets, capsules, lozenges, or troches. In the case of tablets, carriers that can be used include lactose, sodium citrate and salts of phosphoric acid. Various disintegrants such as starch, and lubricating agents such as magnesium stearate, sodium lauryl sulfate and talc, are commonly used in tablets. For oral administration in capsule form, useful diluents are lactose and high molecular weight polyethylene glycols. When aqueous suspensions are required for oral use, the nucleic acid compositions can be combined with emulsifying and suspending agents. If desired, certain sweetening and/or flavoring agents can be added.
[0591] Compositions for intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives.
[0592] Formulations for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives. Intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir. For intravenous use, the total concentration of solutes may be controlled to render the preparation isotonic.
[0593] In one embodiment, the administration of the siRNA compound, e.g., a double-stranded siRNA compound, or ssiRNA compound, composition is parenteral, e.g., intravenous (e.g., as a bolus or as a diffusible infusion), intradermal, intraperitoneal, intramuscular, intrathecal, intraventricular, intracranial, subcutaneous, transmucosal, buccal, sublingual, endoscopic, rectal, oral, vaginal, topical, pulmonary, intranasal, urethral or ocular. Administration can be provided by the subject or by another person, e.g., a health care provider. The medication can be provided in measured doses or in a dispenser which delivers a metered dose. Selected modes of delivery are discussed in more detail below.
[0594] Intrathecal Administration. In one embodiment, the double-stranded RNAi agent is delivered by intrathecal injection (i.e. injection into the spinal fluid which bathes the brain and spinal chord tissue). Intrathecal injection of RNAi agents into the spinal fluid can be performed as a bolus injection or via minipumps which can be implanted beneath the skin, providing a regular and constant delivery of siRNA into the spinal fluid. The circulation of the spinal fluid from the choroid plexus, where it is produced, down around the spinal chord and dorsal root ganglia and subsequently up past the cerebellum and over the cortex to the arachnoid granulations, where the fluid can exit the CNS, that, depending upon size, stability, and solubility of the compounds injected, molecules delivered intrathecally could hit targets throughout the entire CNS.
[0595] In some embodiments, the intrathecal administration is via a pump. The pump may be a surgically implanted osmotic pump. In one embodiment, the osmotic pump is implanted into the subarachnoid space of the spinal canal to facilitate intrathecal administration.
[0596] In some embodiments, the intrathecal administration is via an intrathecal delivery system for a pharmaceutical including a reservoir containing a volume of the pharmaceutical agent, and a pump configured to deliver a portion of the pharmaceutical agent contained in the reservoir. More details about this intrathecal delivery system may be found in PCT/US2015/013253, filed on Jan. 28, 2015, which is incorporated by reference in its entirety.
[0597] The amount of intrathecally injected RNAi agents may vary from one target gene to another target gene and the appropriate amount that has to be applied may have to be determined individually for each target gene. Typically, this amount ranges between 10 μg to 2 mg, preferably 50 μg to 1500 μg, more preferably 100 μg to 1000 μg.
[0598] A. Vector encoded RNAi agents of the Disclosure
[0599] RNAi agents targeting the APP gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A., et al., International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114, and Conrad, U.S. Pat. No. 6,054,299). Expression can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the specific construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., (1995) Proc. Natl. Acad. Sci. USA 92:1292).
[0600] The individual strand or strands of a RNAi agent can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced (e.g., by transfection or infection) into a target cell. Alternatively each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid. In one embodiment, a dsRNA is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.
[0601] RNAi agent expression vectors are generally DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can be used to produce recombinant constructs for the expression of a RNAi agent as described herein. Eukaryotic cell expression vectors are well known in the art and are available from a number of commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of RNAi agent expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.
[0602] Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Replication-defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells' genome. The constructs can include viral sequences for transfection, if desired. Alternatively, the construct can be incorporated into vectors capable of episomal replication, e.g. EPV and EBV vectors. Constructs for the recombinant expression of a RNAi agent will generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure the expression of the RNAi agent in target cells. Other aspects to consider for vectors and constructs are known in the art.
VII. Pharmaceutical Compositions of the Disclosure
[0603] The present disclosure also includes pharmaceutical compositions and formulations which include the RNAi agents of the disclosure. In one embodiment, provided herein are pharmaceutical compositions containing a RNAi agent, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical compositions containing the RNAi agent are useful for treating a disease or disorder associated with the expression or activity of an APP gene, e.g., an APP-associated disease, e.g., CAA or AD, e.g., EOFAD.
[0604] Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by intravenous (IV), intramuscular (IM), or for subcutaneous (subQ) delivery. Another example is compositions that are formulated for direct delivery into the CNS, e.g., by intrathecal or intravitreal routes of injection, optionally by infusion into the brain, such as by continuous pump infusion.
[0605] The pharmaceutical compositions of the disclosure may be administered in dosages sufficient to inhibit expression of an APP gene. In general, a suitable dose of a RNAi agent of the disclosure will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day. Typically, a suitable dose of a RNAi agent of the disclosure will be in the range of about 0.1 mg/kg to about 5.0 mg/kg, preferably about 0.3 mg/kg and about 3.0 mg/kg.
[0606] A repeat-dose regimen may include administration of a therapeutic amount of a RNAi agent on a regular basis, such as bi-monthly or monthly to once a year. In certain embodiments, the RNAi agent is administered about once per month to about once per quarter (i.e., about once every three months).
[0607] After an initial treatment regimen, the treatments can be administered on a less frequent basis.
[0608] The dosage unit can be compounded for delivery over an extended period, e.g., using a conventional sustained release formulation which provides sustained release of the RNAi agent over an extended period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as could be used with the agents of the present disclosure. In this embodiment, the dosage unit contains a corresponding multiple of, e.g., a monthly dose.
[0609] In other embodiments, a single dose of the pharmaceutical compositions can be long lasting, such that subsequent doses are administered at not more than 1, 2, 3, or 4 or more week intervals. In some embodiments of the disclosure, a single dose of the pharmaceutical compositions of the disclosure is administered once per week. In other embodiments of the disclosure, a single dose of the pharmaceutical compositions of the disclosure is administered bi-monthly.
[0610] The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the individual RNAi agents encompassed by the disclosure can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein.
[0611] Advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as APP-associated disorders that would benefit from reduction in the expression of APP. Such models can be used for in vivo testing of RNAi agents, as well as for determining a therapeutically effective dose. Suitable mouse models are known in the art and include, for example, the AD and/or CAA models described elsewhere herein.
[0612] The pharmaceutical compositions of the present disclosure can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.
[0613] The RNAi agents can be delivered in a manner to target a particular tissue, such as the CNS (e.g., neuronal, glial and/or vascular tissue of the brain).
[0614] Pharmaceutical compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like can be necessary or desirable. Coated condoms, gloves and the like can also be useful. Suitable topical formulations include those in which the RNAi agents featured in the disclosure are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). RNAi agents featured in the disclosure can be encapsulated within liposomes or can form complexes thereto, in particular to cationic liposomes. Alternatively, RNAi agents can be complexed to lipids, in particular to cationic lipids. Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C1-20 alkyl ester (e.g., isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof. Topical formulations are described in detail in U.S. Pat. No. 6,747,014, which is incorporated herein by reference.
[0615] A. RNAi Agent Formulations Comprising Membranous Molecular Assemblies
[0616] A RNAi agent for use in the compositions and methods of the disclosure can be formulated for delivery in a membranous molecular assembly, e.g., a liposome or a micelle. As used herein, the term “liposome” refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the RNAi agent composition. The lipophilic material isolates the aqueous interior from an aqueous exterior, which typically does not include the RNAi agent composition, although in some examples, it may. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the RNAi agent are delivered into the cell where the RNAi agent can specifically bind to a target RNA and can mediate RNAi. In some cases the liposomes are also specifically targeted, e.g., to direct the RNAi agent to particular cell types.
[0617] A liposome containing a RNAi agent can be prepared by a variety of methods. In one example, the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or lipid conjugate. The detergent can have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. The RNAi agent preparation is then added to the micelles that include the lipid component. The cationic groups on the lipid interact with the RNAi agent and condense around the RNAi agent to form a liposome. After condensation, the detergent is removed, e.g., by dialysis, to yield a liposomal preparation of RNAi agent.
[0618] If necessary a carrier compound that assists in condensation can be added during the condensation reaction, e.g., by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or spermidine). pH can also adjusted to favor condensation.
[0619] Methods for producing stable polynucleotide delivery vehicles, which incorporate a polynucleotide/cationic lipid complex as structural components of the delivery vehicle, are further described in, e.g., WO 96/37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of exemplary methods described in Felgner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417; U.S. Pat. Nos. 4,897,355; 5,171,678; Bangham et al., (1965) M. Mol. Biol. 23:238; Olson et al., (1979) Biochim. Biophys. Acta 557:9; Szoka et al., (1978) Proc. Natl. Acad. Sci. 75: 4194; Mayhew et al., (1984) Biochim. Biophys. Acta 775:169; Kim et al., (1983) Biochim. Biophys. Acta 728:339; and Fukunaga et al., (1984) Endocrinol. 115:757. Commonly used techniques for preparing lipid aggregates of appropriate size for use as delivery vehicles include sonication and freeze-thaw plus extrusion (see, e.g., Mayer et al., (1986) Biochim. Biophys. Acta 858:161. Microfluidization can be used when consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew et al., (1984) Biochim. Biophys. Acta 775:169. These methods are readily adapted to packaging RNAi agent preparations into liposomes.
[0620] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic acid/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al. (1987) Biochem. Biophys. Res. Commun., 147:980-985).
[0621] Liposomes, which are pH-sensitive or negatively charged, entrap nucleic acids rather than complex with them. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some nucleic acid is entrapped within the aqueous interior of these liposomes. pH sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al. (1992) Journal of Controlled Release, 19:269-274).
[0622] One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
[0623] Examples of other methods to introduce liposomes into cells in vitro and in vivo include U.S. Pat. Nos. 5,283,185; 5,171,678; WO 94/00569; WO 93/24640; WO 91/16024; Felgner, (1994) J. Biol. Chem. 269:2550; Nabel, (1993) Proc. Natl. Acad. Sci. 90:11307; Nabel, (1992) Human Gene Ther. 3:649; Gershon, (1993) Biochem. 32:7143; and Strauss, (1992) EMBO J. 11:417.
[0624] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome™ (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome™ II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al., (1994) ST.P. Pharma. Sci., 4(6):466).
[0625] Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G.sub.M1, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., (1987) FEBS Letters, 223:42; Wu et al., (1993) Cancer Research, 53:3765).
[0626] Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., (1987), 507:64) reported the ability of monosialoganglioside G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., (1988), 85,:6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al).
[0627] In one embodiment, cationic liposomes are used. Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non-cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver RNAi agents to macrophages.
[0628] Further advantages of liposomes include: liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated RNAi agents in their internal compartments from metabolism and degradation (Rosoff, in “Pharmaceutical Dosage Forms,” Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.
[0629] A positively charged synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid-nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of RNAi agent (see, e.g., Felgner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417, and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).
[0630] A DOTMA analogue, 1,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA-complexing vesicles. Lipofectin™ Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that comprise positively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive. Positively charged complexes prepared in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane (“DOTAP”) (Boehringer Mannheim, Indianapolis, Ind.) differs from DOTMA in that the oleoyl moieties are linked by ester, rather than ether linkages.
[0631] Other reported cationic lipid compounds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5-carboxyspermylglycine dioctaoleoylamide (“DOGS”) (Transfectam™, Promega, Madison, Wis.) and dipalmitoylphosphatidylethanolamine 5-carboxyspermylamide (“DPPES”) (see, e.g., U.S. Pat. No. 5,171,678).
[0632] Another cationic lipid conjugate includes derivatization of the lipid with cholesterol (“DC-Chol”) which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L., (1991) Biochim. Biophys. Res. Commun. 179:280). Lipopolylysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., (1991) Biochim. Biophys. Acta 1065:8). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, Calif.) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Md.). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.
[0633] Liposomal formulations are particularly suited for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer RNAi agent into the skin. In some implementations, liposomes are used for delivering RNAi agent to epidermal cells and also to enhance the penetration of RNAi agent into dermal tissues, e.g., into skin. For example, the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e.g., Weiner et al., (1992) Journal of Drug Targeting, vol. 2, 405-410 and du Plessis et al., (1992) Antiviral Research, 18:259-265; Mannino, R. J. and Fould-Fogerite, S., (1998) Biotechniques 6:682-690; Itani, T. et al., (1987) Gene 56:267-276; Nicolau, C. et al. (1987) Meth. Enzymol. 149:157-176; Straubinger, R. M. and Papahadjopoulos, D. (1983) Meth. Enzymol. 101:512-527; Wang, C. Y. and Huang, L., (1987) Proc. Natl. Acad. Sci. USA 84:7851-7855).
[0634] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver a drug into the dermis of mouse skin. Such formulations with RNAi agent are useful for treating a dermatological disorder.
[0635] Liposomes that include RNAi agents can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome. For example, transfersomes are a type of deformable liposomes. Transferosomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include RNAi agent can be delivered, for example, subcutaneously by infection in order to deliver RNAi agent to keratinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. In addition, due to the lipid properties, these transferosomes can be self-optimizing (adaptive to the shape of pores, e.g., in the skin), self-repairing, and can frequently reach their targets without fragmenting, and often self-loading.
[0636] Other formulations amenable to the present disclosure are described in U.S. provisional application Ser. No. 61/018,616, filed Jan. 2, 2008; 61/018,611, filed Jan. 2, 2008; 61/039,748, filed Mar. 26, 2008; 61/047,087, filed Apr. 22, 2008 and 61/051,528, filed May 8, 2008. PCT application no PCT/US2007/080331, filed Oct. 3, 2007 also describes formulations that are amenable to the present disclosure.
[0637] Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g., they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
[0638] Surfactants find wide application in formulations such as those described herein, particularlay in emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the “head”) provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
[0639] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
[0640] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
[0641] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.
[0642] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.
The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
[0643] The RNAi agent for use in the methods of the disclosure can also be provided as micellar formulations. “Micelles” are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.
[0644] A mixed micellar formulation suitable for delivery through transdermal membranes may be prepared by mixing an aqueous solution of the siRNA composition, an alkali metal C.sub.8 to C.sub.22 alkyl sulphate, and a micelle forming compounds. Exemplary micelle forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil, evening of primrose oil, menthol, trihydroxy oxo cholanyl glycine and pharmaceutically acceptable salts thereof, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ethers and analogues thereof, polidocanol alkyl ethers and analogues thereof, chenodeoxycholate, deoxycholate, and mixtures thereof The micelle forming compounds may be added at the same time or after addition of the alkali metal alkyl sulphate. Mixed micelles will form with substantially any kind of mixing of the ingredients but vigorous mixing in order to provide smaller size micelles.
[0645] In one method a first micellar composition is prepared which contains the siRNA composition and at least the alkali metal alkyl sulphate. The first micellar composition is then mixed with at least three micelle forming compounds to form a mixed micellar composition. In another method, the micellar composition is prepared by mixing the siRNA composition, the alkali metal alkyl sulphate and at least one of the micelle forming compounds, followed by addition of the remaining micelle forming compounds, with vigorous mixing.
[0646] Phenol and/or m-cresol may be added to the mixed micellar composition to stabilize the formulation and protect against bacterial growth. Alternatively, phenol and/or m-cresol may be added with the micelle forming ingredients. An isotonic agent such as glycerin may also be added after formation of the mixed micellar composition.
[0647] For delivery of the micellar formulation as a spray, the formulation can be put into an aerosol dispenser and the dispenser is charged with a propellant. The propellant, which is under pressure, is in liquid form in the dispenser. The ratios of the ingredients are adjusted so that the aqueous and propellant phases become one, i.e., there is one phase. If there are two phases, it is necessary to shake the dispenser prior to dispensing a portion of the contents, e.g., through a metered valve. The dispensed dose of pharmaceutical agent is propelled from the metered valve in a fine spray.
[0648] Propellants may include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2 tetrafluoroethane) may be used.
[0649] The specific concentrations of the essential ingredients can be determined by relatively straightforward experimentation. For absorption through the oral cavities, it is often desirable to increase, e.g., at least double or triple, the dosage for through injection or administration through the gastrointestinal tract.
Lipid Particles
[0650] RNAi agents, e.g., dsRNAs of in the disclosure may be fully encapsulated in a lipid formulation, e.g., a LNP, or other nucleic acid-lipid particle.
[0651] As used herein, the term “LNP” refers to a stable nucleic acid-lipid particle. LNPs typically contain a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate). LNPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). LNPs include “pSPLP,” which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00/03683. The particles of the present disclosure typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid-lipid particles of the present disclosure are resistant in aqueous solution to degradation with a nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Publication No. 2010/0324120 and PCT Publication No. WO 96/40964.
[0652] In one embodiment, the lipid to drug ratio (mass/mass ratio) (e.g., lipid to dsRNA ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above recited ranges are also contemplated to be part of the disclosure.
[0653] Certain specific LNP formulations for delivery of RNAi agents have been described in the art, including, e.g., “LNP01” formulations as described, e.g., in International Application Publication No. WO 2008/042973, which is hereby incorporated by reference.
[0654] Additional exemplary lipid-dsRNA formulations are identified in the table below.
TABLE-US-00019 cationic lipid/non-cationic lipid/cholesterol/PEG-lipid conjugate Ionizable/Cationic Lipid Lipid:siRNA ratio SNALP-1 1,2-Dilinolenyloxy-N,N- DLinDMA/DPPC/Cholesterol/PEG- dimethylaminopropane (DLinDMA) cDMA (57.1/7.1/34.4/1.4) lipid:siRNA ~ 7:1 2-XTC 2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DPPC/Cholesterol/PEG- [1,3]-dioxolane (XTC) cDMA 57.1/7.1/34.4/1.4 lipid:siRNA ~ 7:1 LNP05 2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DSPC/Cholesterol/PEG-DMG [1,3]-dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:siRNA ~ 6:1 LNP06 2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DSPC/Cholesterol/PEG-DMG [1,3]-dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:siRNA ~ 11:1 LNP07 2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DSPC/Cholesterol/PEG-DMG [1,3]-dioxolane (XTC) 60/7.5/31/1.5, lipid:siRNA ~ 6:1 LNP08 2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DSPC/Cholesterol/PEG-DMG [1,3]-dioxolane (XTC) 60/7.5/31/1.5, lipid:siRNA ~ 11:1 LNP09 2,2-Dilinoleyl-4-dimethylaminoethyl- XTC/DSPC/Cholesterol/PEG-DMG [1,3]-dioxolane (XTC) 50/10/38.5/1.5 Lipid:siRNA 10:1 LNP10 (3aR,5s,6aS)-N,N-dimethyl-2,2- ALN100/DSPC/Cholesterol/PEG- di((9Z,12Z)-octadeca-9,12- DMG dienyl)tetrahydro-3aH- 50/10/38.5/1.5 cyclopenta[d][1,3]dioxo1-5-amine Lipid:siRNA 10:1 (ALN100) LNP11 (6Z,9Z,28Z,31Z)-heptatriaconta- MC-3/DSPC/Cholesterol/PEG- 6,9,28,31-tetraen-19-yl 4- DMG (dimethylamino)butanoate (MC3) 50/10/38.5/1.5 Lipid:siRNA 10:1 LNP12 1,1′-(2-(4-(2-((2-(bis(2- Tech G1/DSPC/Cholesterol/PEG- hydroxydodecyl)amino)ethyl)(2- DMG hydroxydodecyl)amino)ethyl)piperazin- 50/10/38.5/1.5 1-yl)ethylazanediyl)didodecan-2-ol Lipid:siRNA 10:1 (Tech G1) LNP13 XTC XTC/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 33:1 LNP14 MC3 MC3/DSPC/Chol/PEG-DMG 40/15/40/5 Lipid:siRNA: 11:1 LNP15 MC3 MC3/DSPC/Chol/PEG- DSG/Ga1NAc-PEG-DSG 50/10/35/4.5/0.5 Lipid:siRNA: 11:1 LNP16 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 7:1 LNP17 MC3 MC3/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA: 10:1 LNP18 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 12:1 LNP19 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/35/5 Lipid:siRNA: 8:1 LNP20 MC3 MC3/DSPC/Chol/PEG-DPG 50/10/38.5/1.5 Lipid:siRNA: 10:1 LNP21 C12-200 C12-200/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA: 7:1 LNP22 XTC XTC/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA: 10:1
DSPC: distearoylphosphatidylcholine
DPPC: dipalmitoylphosphatidylcholine
PEG-DMG: PEG-didimyristoyl glycerol (C14-PEG, or PEG-C14) (PEG with avg mol wt of 2000)
PEG-DSG: PEG-distyryl glycerol (C18-PEG, or PEG-C18) (PEG with avg mol wt of 2000)
PEG-cDMA: PEG-carbamoyl-1,2-dimyristyloxypropylamine (PEG with avg mol wt of 2000)
[0655] SNALP (1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)) comprising formulations are described in International Publication No. WO2009/127060, filed Apr. 15, 2009, which is hereby incorporated by reference.
[0656] XTC comprising formulations are described in PCT Publication No. WO 2010/088537, the entire contents of which are hereby incorporated herein by reference. MC3 comprising formulations are described, e.g., in U.S. Publication No. 2010/0324120, filed Jun. 10, 2010, the entire contents of which are hereby incorporated by reference.
[0657] ALNY-100 comprising formulations are described in PCT Publication No. WO 2010/054406, the entire contents of which are hereby incorporated herein by reference.
[0658] C12-200 comprising formulations are described in PCT Publication No. WO 2010/129709, the entire contents of which are hereby incorporated herein by reference.
[0659] Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable. In some embodiments, oral formulations are those in which dsRNAs featured in the disclosure are administered in conjunction with one or more penetration enhancer surfactants and chelators. Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g., sodium). In some embodiments, combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. DsRNAs featured in the disclosure can be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. DsRNA complexing agents include polyamino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses and starches. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for dsRNAs and their preparation are described in detail in U.S. Pat. No. 6,887,906, US Publn. No. 20030027780, and U.S. Pat. No. 6,747,014, each of which is incorporated herein by reference.
[0660] Compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
[0661] Pharmaceutical compositions of the present disclosure include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. Particularly preferred are formulations that target the brain when treating APP-associated diseases or disorders.
[0662] The pharmaceutical formulations of the present disclosure, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
[0663] The compositions of the present disclosure can be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present disclosure can also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension can also contain stabilizers.
[0664] Additional Formulations
[0665] i. Emulsions
[0666] The compositions of the present disclosure can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μm in diameter (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions can be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions can contain additional components in addition to the dispersed phases, and the active drug which can be present as a solution in either aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants can also be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.
[0667] Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion can be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that can be incorporated into either phase of the emulsion. Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0668] Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y. Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).
[0669] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
[0670] A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0671] Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.
[0672] Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that can readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used can be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
[0673] The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of ease of formulation, as well as efficacy from an absorption and bioavailability standpoint (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.
[0674] ii. Microemulsions
[0675] In one embodiment of the present disclosure, the compositions of RNAi agents and nucleic acids are formulated as microemulsions. A microemulsion can be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).
[0676] The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.
[0677] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions can, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase can typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase can include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
[0678] Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions can form spontaneously when their components are brought together at ambient temperature. This can be particularly advantageous when formulating thermolabile drugs, peptides or RNAi agents. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present disclosure will facilitate the increased systemic absorption of RNAi agents and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of RNAi agents and nucleic acids.
[0679] Microemulsions of the present disclosure can also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the RNAi agents and nucleic acids of the present disclosure. Penetration enhancers used in the microemulsions of the present disclosure can be classified as belonging to one of five broad categories—surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.
[0680] iii. Microparticles
[0681] An RNAi agent of the disclosure may be incorporated into a particle, e.g., a microparticle. Microparticles can be produced by spray-drying, but may also be produced by other methods including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques.
[0682] iv. Penetration Enhancers
[0683] In one embodiment, the present disclosure employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly RNAi agents, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.
[0684] Penetration enhancers can be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.
[0685] Surfactants (or “surface-active agents”) are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of RNAi agents through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).
[0686] Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C.sub.1-20 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see e.g., Touitou, E., et al. Enhancement in Drug Delivery, CRC Press, Danvers, Mass., 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).
[0687] The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term “bile salts” includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (see e.g., Malmsten, M.
[0688] Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).
[0689] Chelating agents, as used in connection with the present disclosure, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of RNAi agents through the mucosa is enhanced. With regards to their use as penetration enhancers in the present disclosure, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(see e.g., Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, Mass., 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).
[0690] As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of RNAi agents through the alimentary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).
[0691] Agents that enhance uptake of RNAi agents at the cellular level can also be added to the pharmaceutical and other compositions of the present disclosure. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of dsRNAs. Examples of commercially available transfection reagents include, for example Lipofectamine™ (Invitrogen; Carlsbad, Calif.), Lipofectamine 2000™ (Invitrogen; Carlsbad, Calif.), 293Fectin™ (Invitrogen; Carlsbad, Calif.), Cellfectin™ (Invitrogen; Carlsbad, Calif.), DMRIE-C™ (Invitrogen; Carlsbad, Calif.), FreeStyle™ MAX (Invitrogen; Carlsbad, Calif.), Lipofectamine™ 2000 CD (Invitrogen; Carlsbad, Calif.), Lipofectamine™ (Invitrogen; Carlsbad, Calif.), RNAiMAX (Invitrogen; Carlsbad, Calif.), Oligofectamine™ (Invitrogen; Carlsbad, Calif.), Optifect™ (Invitrogen; Carlsbad, Calif.), X-tremeGENE Q2 Transfection Reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse, Switzerland), Transfectam® Reagent (Promega; Madison, Wis.), TransFast™ Transfection Reagent (Promega; Madison, Wis.), Tfx™-20 Reagent (Promega; Madison, Wis.), Tfx™-50 Reagent (Promega; Madison, Wis.), DreamFect™ (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPass.sup.a D1 Transfection Reagent (New England Biolabs; Ipswich, Mass., USA), LyoVec™/LipoGen™ (Invitrogen; San Diego, Calif., USA), PerFectin Transfection Reagent (Genlantis; San Diego, Calif., USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), GenePORTER Transfection reagent (Genlantis; San Diego, Calif., USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego, Calif., USA), Cytofectin Transfection Reagent (Genlantis; San Diego, Calif., USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), TroganPORTER™ transfection Reagent (Genlantis; San Diego, Calif., USA), RiboFect (Bioline; Taunton, Mass., USA), PlasFect (Bioline; Taunton, Mass., USA), UniFECTOR (B-Bridge International; Mountain View, Calif., USA), SureFECTOR (B-Bridge International; Mountain View, Calif., USA), or HiFect™ (B-Bridge International, Mountain View, Calif., USA), among others.
[0692] Other agents can be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.
[0693] v. Carriers
[0694] Certain compositions of the present disclosure also incorporate carrier compounds in the formulation. As used herein, “carrier compound” or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate dsRNA in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4′isothiocyano-stilbene-2,2′-disulfonic acid (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183.
[0695] vi. Excipients
[0696] In contrast to a carrier compound, a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc).
[0697] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present disclosure. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
[0698] Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions can also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.
[0699] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
[0700] vii. Other Components
[0701] The compositions of the present disclosure can additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions can contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or can contain additional materials useful in physically formulating various dosage forms of the compositions of the present disclosure, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present disclosure. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
[0702] Aqueous suspensions can contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension can also contain stabilizers.
[0703] In some embodiments, pharmaceutical compositions featured in the disclosure include (a) one or more RNAi agents and (b) one or more agents which function by a non-RNAi mechanism and which are useful in treating an APP-associated disorder. Examples of such agents include, but are not limited to an anti-inflammatory agent, anti-steatosis agent, anti-viral, and/or anti-fibrosis agent, or other agent included to treat AD (including EOFAD) and/or CAA in a subject.
[0704] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD.sub.50 (the dose lethal to 50% of the population) and the ED.sub.50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD.sub.50/ED.sub.50. Compounds that exhibit high therapeutic indices are preferred.
[0705] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured herein in the disclosure lies generally within a range of circulating concentrations that include the ED.sub.50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the disclosure, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC.sub.50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.
[0706] In addition to their administration, as discussed above, the RNAi agents featured in the disclosure can be administered in combination with other known agents effective in treatment of pathological processes mediated by APP expression. In any event, the administering physician can adjust the amount and timing of RNAi agent administration on the basis of results observed using standard measures of efficacy known in the art or described herein.
VIII. Kits
[0707] In certain aspects, the instant disclosure provides kits that include a suitable container containing a pharmaceutical formulation of a siRNA compound, e.g., a double-stranded siRNA compound, or ssiRNA compound, (e.g., a precursor, e.g., a larger siRNA compound which can be processed into a ssiRNA compound, or a DNA which encodes an siRNA compound, e.g., a double-stranded siRNA compound, or ssiRNA compound, or precursor thereof). In certain embodiments the individual components of the pharmaceutical formulation may be provided in one container. Alternatively, it may be desirable to provide the components of the pharmaceutical formulation separately in two or more containers, e.g., one container for a siRNA compound preparation, and at least another for a carrier compound. The kit may be packaged in a number of different configurations such as one or more containers in a single box. The different components can be combined, e.g., according to instructions provided with the kit. The components can be combined according to a method described herein, e.g., to prepare and administer a pharmaceutical composition. The kit can also include a delivery device.
IX. Methods for Inhibiting APP Expression
[0708] The present disclosure also provides methods of inhibiting expression of an APP gene in a cell. The methods include contacting a cell with an RNAi agent, e.g., double stranded RNAi agent, in an amount effective to inhibit expression of APP in the cell, thereby inhibiting expression of APP in the cell. In certain embodiments of the disclosure, APP is inhibited preferentially in CNS (e.g., brain) cells.
[0709] Contacting of a cell with a RNAi agent, e.g., a double stranded RNAi agent, may be done in vitro or in vivo. Contacting a cell in vivo with the RNAi agent includes contacting a cell or group of cells within a subject, e.g., a human subject, with the RNAi agent. Combinations of in vitro and in vivo methods of contacting a cell are also possible.
[0710] Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is a carbohydrate moiety, e.g., a C16 ligand, or any other ligand that directs the RNAi agent to a site of interest.
[0711] The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating,” “suppressing” and other similar terms, and includes any level of inhibition. In certain embodiments, a level of inhibition, e.g., for a RNAi agent of the instant disclosure, can be assessed in cell culture conditions, e.g., wherein cells in cell culture are transfected via Lipofectamine™-mediated transfection at a concentration in the vicinity of a cell of 10 nM or less, 1 nM or less, etc. Knockdown of a given RNAi agent can be determined via comparison of pre-treated levels in cell culture versus post-treated levels in cell culture, optionally also comparing against cells treated in parallel with a scrambled or other form of control RNAi agent. Knockdown in cell culture of, e.g., at least 10% or more, at least 20% or more, etc. can thereby be identified as indicative of “inhibiting” and/or “reducing”, “downregulating” or “suppressing”, etc. having occurred. It is expressly contemplated that assessment of targeted mRNA and/or encoded protein levels (and therefore an extent of “inhibiting”, etc. caused by a RNAi agent of the disclosure) can also be assessed in in vivo systems for the RNAi agents of the instant disclosure, under properly controlled conditions as described in the art.
[0712] The phrase “inhibiting expression of an APP,” as used herein, includes inhibition of expression of any APP gene (such as, e.g., a mouse APP gene, a rat APP gene, a monkey APP gene, or a human APP gene) as well as variants or mutants of an APP gene that encode an APP protein. Thus, the APP gene may be a wild-type APP gene, a mutant APP gene, or a transgenic APP gene in the context of a genetically manipulated cell, group of cells, or organism.
[0713] “Inhibiting expression of an APP gene” includes any level of inhibition of an APP gene, e.g., at least partial suppression of the expression of an APP gene, such as an inhibition by at least about 20%. In certain embodiments, inhibition is by at least about 25%, at least about 30%, at least about 35%,at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
[0714] The expression of an APP gene may be assessed based on the level of any variable associated with APP gene expression, e.g., APP mRNA level or APP protein level (including APP cleavage products). The expression of an APP may also be assessed indirectly based on the levels of APP-associated biomarkers as described herein.
[0715] Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).
[0716] In certain embodiments, surrogate markers can be used to detect inhibition of APP. For example, effective prevention or treatment of an APP-associated disorder, e.g., a CNS disorder such as EOFAD, CAA or other disorder, as demonstrated by acceptable diagnostic and monitoring criteria with an agent to reduce APP expression can be understood to demonstrate a clinically relevant reduction in APP.
[0717] In some embodiments of the methods of the disclosure, expression of an APP gene is inhibited by at least 20%, a 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to below the level of detection of the assay. In certain embodiments, the methods include a clinically relevant inhibition of expression of APP, e.g. as demonstrated by a clinically relevant outcome after treatment of a subject with an agent to reduce the expression of APP.
[0718] Inhibition of the expression of an APP gene may be manifested by a reduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which an APP gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with a RNAi agent of the disclosure, or by administering a RNAi agent of the disclosure to a subject in which the cells are or were present) such that the expression of an APP gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s) not treated with a RNAi agent or not treated with a RNAi agent targeted to the gene of interest). The degree of inhibition may be expressed in terms of:
[0719] In other embodiments, inhibition of the expression of an APP gene may be assessed in terms of a reduction of a parameter that is functionally linked to APP gene expression, e.g., APP protein expression, formation and/or levels of APP cleavage products, or APP signaling pathways. APP gene silencing may be determined in any cell expressing APP, either endogenous or heterologous from an expression construct, and by any assay known in the art.
[0720] Inhibition of the expression of an APP protein may be manifested by a reduction in the level of the APP protein that is expressed by a cell or group of cells (e.g., the level of protein expressed in a sample derived from a subject). As explained above, for the assessment of mRNA suppression, the inhibition of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells.
[0721] A control cell or group of cells that may be used to assess the inhibition of the expression of an APP gene includes a cell or group of cells that has not yet been contacted with a RNAi agent of the disclosure. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an RNAi agent.
[0722] The level of APP mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of APP in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the APP gene. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA preparation kits (Qiagen®) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis. Circulating APP mRNA may be detected using methods the described in PCT Publication WO2012/177906, the entire contents of which are hereby incorporated herein by reference.
[0723] In some embodiments, the level of expression of APP is determined using a nucleic acid probe. The term “probe”, as used herein, refers to any molecule that is capable of selectively binding to a specific APP. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.
[0724] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to APP mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of APP mRNA.
[0725] An alternative method for determining the level of expression of APP in a sample involves the process of nucleic acid amplification and/or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), rolling circle replication (Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects of the disclosure, the level of expression of APP is determined by quantitative fluorogenic RT-PCR (i.e., the TaqMan™ System), by a Dual-Glo® Luciferase assay, or by other art-recognized method for measurement of APP expression and/or mRNA level.
[0726] The expression levels of APP mRNA may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Pat. Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, which are incorporated herein by reference. The determination of APP expression level may also comprise using nucleic acid probes in solution.
[0727] In some embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The use of this PCR method is described and exemplified in the Examples presented herein. Such methods can also be used for the detection of APP nucleic acids, SREBP nucleic acids or PNPLA3 nucleic acids.
[0728] The level of APP protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like. Such assays can also be used for the detection of proteins indicative of the presence or replication of APP proteins, APP cleavage products, or other proteins associated with APP, e.g., PSEN1, PSEN2, etc.
[0729] In some embodiments, the efficacy of the methods of the disclosure in the treatment of an APP-related disease is assessed by a decrease in APP mRNA level (e.g, by assessment of a CSF sample for Aβ levels, by brain biopsy, or otherwise).
[0730] In some embodiments of the methods of the disclosure, the RNAi agent is administered to a subject such that the RNAi agent is delivered to a specific site within the subject. The inhibition of expression of APP may be assessed using measurements of the level or change in the level of APP mRNA or APP protein in a sample derived from a specific site within the subject, e.g., CNS cells. In certain embodiments, the methods include a clinically relevant inhibition of expression of APP, e.g. as demonstrated by a clinically relevant outcome after treatment of a subject with an agent to reduce the expression of APP.
[0731] As used herein, the terms detecting or determining a level of an analyte are understood to mean performing the steps to determine if a material, e.g., protein, RNA, is present. As used herein, methods of detecting or determining include detection or determination of an analyte level that is below the level of detection for the method used.
X. Methods of Treating or Preventing APP-Associated Diseases
[0732] The present disclosure also provides methods of using a RNAi agent of the disclosure and/or a composition containing a RNAi agent of the disclosure to reduce and/or inhibit APP expression in a cell. The methods include contacting the cell with a dsRNA of the disclosure and maintaining the cell for a time sufficient to obtain degradation of the mRNA transcript of an APP gene, thereby inhibiting expression of the APP gene in the cell. Reduction in gene expression can be assessed by any methods known in the art. For example, a reduction in the expression of APP may be determined by determining the mRNA expression level of APP using methods routine to one of ordinary skill in the art, e.g., Northern blotting, qRT-PCR; by determining the protein level of APP using methods routine to one of ordinary skill in the art, such as Western blotting, immunological techniques. A reduction in the expression of APP may also be assessed indirectly by measuring a decrease in the levels of a soluble cleavage product of APP, e.g., a decrease in the level of soluble APPα, APPβ and/or a soluble Aβ peptide, optionally in a CSF sample of a subject.
[0733] In the methods of the disclosure the cell may be contacted in vitro or in vivo, i.e., the cell may be within a subject.
[0734] A cell suitable for treatment using the methods of the disclosure may be any cell that expresses an APP gene. A cell suitable for use in the methods of the disclosure may be a mammalian cell, e.g., a primate cell (such as a human cell or a non-human primate cell, e.g., a monkey cell or a chimpanzee cell), a non-primate cell (such as a cow cell, a pig cell, a camel cell, a llama cell, a horse cell, a goat cell, a rabbit cell, a sheep cell, a hamster, a guinea pig cell, a cat cell, a dog cell, a rat cell, a mouse cell, a lion cell, a tiger cell, a bear cell, or a buffalo cell), a bird cell (e.g., a duck cell or a goose cell), or a whale cell. In one embodiment, the cell is a human cell, e.g., a human CNS cell.
[0735] APP expression is inhibited in the cell by at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or about 100%. In preferred embodiments, APP expression is inhibited by at least 20%.
[0736] The in vivo methods of the disclosure may include administering to a subject a composition containing a RNAi agent, where the RNAi agent includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the APP gene of the mammal to be treated. When the organism to be treated is a mammal such as a human, the composition can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intravenous, intramuscular, intravitreal, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection.
[0737] In some embodiments, the administration is via a depot injection. A depot injection may release the RNAi agent in a consistent way over a prolonged time period. Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of APP, or a therapeutic or prophylactic effect. A depot injection may also provide more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the depot injection is a subcutaneous injection.
[0738] In some embodiments, the administration is via a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. An infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the RNAi agent to the CNS.
[0739] The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting.
[0740] In one aspect, the present disclosure also provides methods for inhibiting the expression of an APP gene in a mammal. The methods include administering to the mammal a composition comprising a dsRNA that targets an APP gene in a cell of the mammal and maintaining the mammal for a time sufficient to obtain degradation of the mRNA transcript of the APP gene, thereby inhibiting expression of the APP gene in the cell. Reduction in gene expression can be assessed by any methods known it the art and by methods, e.g. qRT-PCR, described herein. Reduction in protein production can be assessed by any methods known it the art and by methods, e.g. ELISA, described herein. In one embodiment, a CNS biopsy sample or a cerebrospinal fluid (CSF) sample serves as the tissue material for monitoring the reduction in APP gene and/or protein expression (or of a proxy therefore, as described herein or as known in the art).
[0741] The present disclosure further provides methods of treatment of a subject in need thereof. The treatment methods of the disclosure include administering a RNAi agent of the disclosure to a subject, e.g., a subject that would benefit from a reduction and/or inhibition of APP expression, in a therapeutically effective amount of a RNAi agent targeting an APP gene or a pharmaceutical composition comprising a RNAi agent targeting an APP gene.
[0742] The present disclosure also provides methods of decreasing Aβ40 and/or Aβ42 levels in a subject. The methods include administering a RNAi agent of the disclosure to a subject, e.g., a subject that would benefit from a reduction and/or inhibition of APP expression, in a therapeutically effective amount of a RNAi agent targeting an APP gene or a pharmaceutical composition comprising a RNAi agent targeting an APP gene.
[0743] In addition, the present disclosure provides methods of preventing, treating and/or inhibiting the progression of an APP-associated disease or disorder (e.g., CAA and/or AD, optionally EOFAD) in a subject, such as the progression of an APP-associated disease or disorder to neurodegeneration, increased amyloid plaque formation and/or cognitive decline in a subject having an APP-associated disease or disorder or a subject at risk of developing an APP-associated disease or disorder. The methods include administering to the subject a therapeutically effective amount of any of the dsRNAs or the pharmaceutical composition provided herein, thereby preventing, treating and/or inhibiting the progression of an APP-associated disease or disorder in the subject.
[0744] A RNAi agent of the disclosure may be administered as a “free RNAi agent.” A free RNAi agent is administered in the absence of a pharmaceutical composition. The naked RNAi agent may be in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the RNAi agent can be adjusted such that it is suitable for administering to a subject.
[0745] Alternatively, a RNAi agent of the disclosure may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation.
[0746] Subjects that would benefit from a reduction and/or inhibition of APP gene expression are those having an APP-associated disorder. The term “APP-associated disease” includes a disease, disorder or condition that would benefit from a decrease in APP gene expression, replication, or protein activity. Non-limiting examples of APP-associated diseases include, for example, CAA (including hCAA and sporadic CAA) and AD (including EOFAD, sporadic and/or late onset AD, optionally with CAA).
[0747] The disclosure further provides methods for the use of a RNAi agent or a pharmaceutical composition thereof, e.g., for treating a subject that would benefit from reduction and/or inhibition of APP expression, e.g., a subject having an APP-associated disorder, in combination with other pharmaceuticals and/or other therapeutic methods, e.g., with known pharmaceuticals and/or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders. For example, in certain embodiments, a RNAi agent targeting APP is administered in combination with, e.g., an agent useful in treating an APP-associated disorder as described elsewhere herein or as otherwise known in the art. For example, additional agents suitable for treating a subject that would benefit from reducton in APP expression, e.g., a subject having an APP-associated disorder, may include agents currently used to treat symptoms of AD. Non-limiting examples of such agents may include cholinesterase inhibitors (such as donepezil, rivastigmate, and galantamine), memantine, BACE1i, immunotherapies, and secretase inhibitors. The RNAi agent and additional therapeutic agents may be administered at the same time and/or in the same combination, e.g., intrathecally, or the additional therapeutic agent can be administered as part of a separate composition or at separate times and/or by another method known in the art or described herein.
[0748] In one embodiment, the method includes administering a composition featured herein such that expression of the target APP gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours, 28, 32, or about 36 hours. In one embodiment, expression of the target APP gene is decreased for an extended duration, e.g., at least about two, three, four days or more, e.g., about one week, two weeks, three weeks, or four weeks or longer.
[0749] Preferably, the RNAi agents useful for the methods and compositions featured herein specifically target RNAs (primary or processed) of the target APP gene. Compositions and methods for inhibiting the expression of these genes using RNAi agents can be prepared and performed as described herein.
[0750] Administration of the dsRNA according to the methods of the disclosure may result in a reduction of the severity, signs, symptoms, and/or markers of such diseases or disorders in a patient with an APP-associated disorder. By “reduction” in this context is meant a statistically significant decrease in such level. The reduction can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%.
[0751] Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. For example, efficacy of treatment of an APP-associated disorder may be assessed, for example, by periodic monitoring of a subject's cognition, CSF Aβ levels, etc. Comparisons of the later readings with the initial readings provide a physician an indication of whether the treatment is effective. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. In connection with the administration of a RNAi agent targeting APP or pharmaceutical composition thereof, “effective against” an APP-associated disorder indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as an improvement of symptoms, a cure, a reduction in disease, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating APP-associated disorders and the related causes.
[0752] A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment. Efficacy for a given RNAi agent drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant reduction in a marker or symptom is observed.
[0753] Alternatively, the efficacy can be measured by a reduction in the severity of disease as determined by one skilled in the art of diagnosis based on a clinically accepted disease severity grading scale, as but one example mental ability tests for dementia. Any positive change resulting in e.g., lessening of severity of disease measured using the appropriate scale, represents adequate treatment using a RNAi agent or RNAi agent formulation as described herein.
[0754] Subjects can be administered a therapeutic amount of dsRNA, such as about 0.01 mg/kg to about 200 mg/kg.
[0755] The RNAi agent can be administered intrathecally, via intravitreal injection and/or by intravenous infusion over a period of time, on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. Administration of the RNAi agent can reduce APP levels, e.g., in a cell, tissue, blood, CSF sample or other compartment of the patient by at least about 5%, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 39, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or at least about 99% or more. In a preferred embodiment, administration of the RNAi agent can reduce APP levels, e.g., in a cell, tissue, blood, CSF sample or other compartment of the patient by at least 20%.
[0756] Before administration of a full dose of the RNAi agent, patients can be administered a smaller dose, such as a 5% infusion reaction, and monitored for adverse effects, such as an allergic reaction. In another example, the patient can be monitored for unwanted immunostimulatory effects, such as increased cytokine (e.g., TNF-alpha or INF-alpha) levels.
[0757] Alternatively, the RNAi agent can be administered subcutaneously, i.e., by subcutaneous injection. One or more injections may be used to deliver the desired, e.g., monthly dose of RNAi agent to a subject. The injections may be repeated over a period of time. The administration may be repeated on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. A repeat-dose regimine may include administration of a therapeutic amount of RNAi agent on a regular basis, such as monthly or extending to once a year or once every 2, 3, 4 and/or 5 years. In certain embodiments, the RNAi agent is administered about once per month to about once per quarter (i.e., about once every three months).
[0758] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the RNAi agents and methods featured in the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
EXAMPLES
Example 1. RNAi Agent Design, Synthesis, Selection, and In Vitro Evaluation
[0759] This Example describes methods for the design, synthesis, selection, and in vitro evaluation of APP RNAi agents.
Source of Reagents
[0760] Where the source of a reagent is not specifically given herein, such reagent can be obtained from any supplier of reagents for molecular biology at a quality/purity standard for application in molecular biology.
Bioinformatics
[0761] A set of siRNA agents targeting the human amyloid beta precursor protein gene (APP; human NCBI refseq NM_201414; NCBI GeneID: 351; SEQ ID NO: 1), as well as the toxicology-species APP ortholog from Macaca fascicularis (cynomolgus monkey: XM_005548883.2; SEQ ID NO: 12) was designed using custom R and Python scripts. All the siRNA designs have a perfect match to the human APP transcript and a subset either perfect or near-perfect matches to the cynomolgus ortholog. The human NM_201414 REFSEQ mRNA, version 2, has a length of 3423 bases. The rationale and method for the set of siRNA designs is as follows: the predicted efficacy for every potential 23mer siRNA from position 10 through the end was determined with a random forest model derived from the direct measure of mRNA knockdown from several thousand distinct siRNA designs targeting a diverse set of vertebrate genes. For each strand of the siRNA, a custom Python script was used in a brute force search to measure the number and positions of mismatches between the siRNA and all potential alignments in the human transcriptome. Extra weight was given to mismatches in the seed region, defined here as positions 2-9 of the antisense oligonucleotide, as well the cleavage site of the siRNA, defined here as positions 10-11 of the antisense oligonucleotide. The relative weight of the mismatches was 2.8, 1.2, 1 for seed mismatches, cleavage site, and other positions up through antisense position 19. Mismatches in the first position were ignored. A specificity score was calculated for each strand by summing the value of each weighted mismatch. Preference was given to siRNAs whose antisense score in human and monkey was ≥3 with a predicted efficacy of ≥50% knockdown (161 sequences), or with an antisense score ≥2 and ≥60% predicted knockdown (118 sequences).
[0762] A second set of siRNAs targeting the toxicology-species Mus musculus (mouse) amyloid beta precursor protein (App, an ortholog of the human APP; mouse NCBI refseq NM_001198823; NCBI GeneID: 11820; SEQ ID NO: 13) as well as the Rattus norvegicus (rat) App ortholog: NM_019288.2 (SEQ ID NO: 14) was designed using custom R and Python scripts. All the siRNA designs possessed a perfect match to the mouse App transcript and a subset possessed either perfect or near-perfect matches to the rat ortholog. The mouse NM_001198823 REFSEQ mRNA, version 1, has a length of 3377 bases. The same selection process was used as stated above for human sequences, but with the following selection criteria applied: Preference was given to siRNAs whose antisense score in mouse and rat was ≥2.8 with a predicted efficacy of ≥50% knockdown (85 sequences), or with an antisense score ≥2 and ≥61% predicted knockdown (8 sequences).
Synthesis of APP Sequences
Synthesis of APP Single Strands and Duplexes
[0763] All oligonucleotides were prepared on a MerMade 192 synthesizer on a 1 μmole scale using universal or custom supports. All phosphoramidites were used at a concentration 100 mM in 100% Acetonitrile or 9:1 Acetonitrile:DMF with a standard protocol for 2-cyanoethyl phosphoramidites, except that the coupling time was extended to 400 seconds. Oxidation of the newly formed linkages was achieved using a solution of 50 mM 12 in 9:1 Acetonitrile:Water to create phosphate linkages and 100 mM DDTT in 9:1 Pyridine:Acetonitrile to create phosphorothioate linkages. After the trityl-off synthesis, columns were incubated with 150 μL of 40% aqueous Methylamine for 45 minutes and the solution drained via vacuum into a 96-well plate. After repeating the incubation and draining with a fresh portion of aqueous Methylamine, the plate containing crude oligonucleotide solution was sealed and shaken at room temperature for an additional 60 minutes to completely remove all protecting groups. Precipitation of the crude oligonucleotides was accomplished via the addition of 1.2 mL of 9:1 Acetonitrile:EtOH to each well followed by incubation at −20° C. overnight. The plate was then centrifuged at 3000 RPM for 45 minutes, the supernatant removed from each well, and the pellets resuspended in 950 μL of 20 mM aqueous NaOAc. Each crude solution was finally desalted over a GE Hi-Trap Desalting Column (Sephadex G25 Superfine) using water to elute the final oligonucleotide products. All identities and purities were confirmed using ESI-MS and IEX HPLC, respectively.
[0764] Annealing of APP single strands was performed on a Tecan liquid handling robot. Sense and antisense single strands were combined in an equimolar ratio in 96 well plates and buffered with 10×PBS to provide a final duplex concentration of 10 μM in 1×PBS. After combining the complementary single strands, the 96 well plate was sealed tightly and heated in an oven at 100° C. for 40 minutes and allowed to come slowly to room temperature over a period of 2-3 hours and subsequently used directly for in vitro screening assays at the appropriate concentrations.
[0765] A detailed list of the modified APP sense and antisense strand sequences is shown in Tables 2A, 2B, 3, 5A, 5B, 6, 9, 10-15, 16A, 16B, and 26 and a detailed list of the unmodified APP sense and antisense strand sequences is shown in Tables 3, 6, 11, 13, 15, and 26.
In Vitro Primary Mouse, Primary Cynomolgus Hepatocytes, be(2)C and Neuron2A Screening:
Cell Culture and Transfections:
[0766] Human Be(2)C (ATCC), mouse Neuro2A (ATCC), Primary Mouse Hepatocytes (BioreclamationIVT) and Primary cyno hepatocytes (BioreclamationIVT) were transfected by adding 4.9 μl of Opti-MEM plus 0.1 μl of RNAiMAX per well (Invitrogen, Carlsbad Calif. cat #13778-150) to 5 μl of siRNA duplexes per well, with 4 replicates of each siRNA duplex, into a 384-well plate, and incubated at room temperature for 15 minutes. 40 μl of media containing ˜5×10.sup.3 cells were then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification. Multi-dose experiments were performed at 10 nM and 0.1 nM. Total RNA isolation using DYNABEADS mRNA Isolation Kit (Invitrogen, part #: 610-12):
[0767] RNA was isolated using an automated protocol on a BioTek-EL406 platform using DYNABEADs (Invitrogen, cat #61012). Briefly, 70 μl of Lysis/Binding Buffer and 10 μl of lysis buffer containing 3 μl of magnetic beads were added to the plate with cells. Plates were incubated on an electromagnetic shaker for 10 minutes at room temperature and then magnetic beads were captured and the supernatant was removed. Bead-bound RNA was then washed 2 times with 150 μl Wash Buffer A and once with Wash Buffer B. Beads were then washed with 150 μl Elution Buffer, re-captured and supernatant removed.
cDNA synthesis using ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, Calif., Cat #4368813):
[0768] 10 μl of a master mix containing 1 μl 10× Buffer, 0.4 μl 25× dNTPs, 1 μl 10× Random primers, 0.5 μl Reverse Transcriptase, 0.5 μl RNase inhibitor and 6.6 μl of H.sub.2O per reaction was added to RNA isolated above. Plates were sealed, mixed, and incubated on an electromagnetic shaker for 10 minutes at room temperature, followed by 2 h 37° C.
Real Time PCR:
[0769] Two μl of cDNA were added to a master mix containing 0.5 μl of human GAPDH TaqMan Probe (4326317E), and 0.5 μl APP human probe (Hs00169098 ml) and 5 μl Lightcycler 480 probe master mix (Roche Cat #04887301001) per well in a 384 well plates (Roche cat #04887301001). Or 2 μl of cDNA were added to a master mix containing 0.5 μl of mouse GAPDH TaqMan Probe (4352339E), and 0.5 μl APP mouse probe (Mm01344172 ml) and 5 μl Lightcycler 480 probe master mix (Roche Cat #04887301001) per well in a 384 well plates (Roche cat #04887301001). Or 2 μl of cDNA were added to a master mix containing 0.5 μl of Cyno GAPDH TaqMan Probe (forward primer: 5′-GCATCCTGGGCTACACTGA-3′, reverse primer: 5′-TGGGTGTCGCTGTTGAAGTC-3′, probe: 5′HEX-CCAGGTGGTCTCCTCC-3′BHQ-1) and 0.5 μl APP cynomolgus probe (Mf01552291_m1) and 5 μl Lightcycler 480 probe master mix (Roche Cat #04887301001) per well in a 384 well plates (Roche cat #04887301001). Real time PCR was done in a LightCycler480 Real Time PCR system (Roche). Each duplex was tested at least two times and data were normalized to cells transfected with a non-targeting control siRNA.
[0770] To calculate relative fold change, real time data were analyzed using the ΔΔCt method and normalized to assays performed with cells transfected with a non-targeting control siRNA. The results from the assays are shown in Tables 4 and 7.
TABLE-US-00020 TABLE 1 Abbreviations of nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5′-3′-phosphodiester bonds. Abbreviation Nucleotide(s) A Adenosine-3′-phosphate Agn (S)-glycol-adenosine Ahd 2′-O-hexadecyl adenosine-3′-phosphate Af 2′-fluoroadenosine-3′-phosphate Afs 2′-fluoroadenosine-3′-phosphorothioate As adenosine-3′-phosphorothioate C cytidine-3′-phosphate Cgn (S)-glycol-cytidine Chd 2′-O-hexadecyl cytidine-3′-phosphate Cf 2′-fluorocytidine-3′-phosphate Cfs 2′-fluorocytidine-3′-phosphorothioate Cs cytidine-3′-phosphorothioate G guanosine-3′-phosphate Ggn (S)-glycol-guanosine Ghd 2′-O-hexadecyl guanosine-3′-phosphate Gf 2′-fluoroguanosine-3′-phosphate Gfs 2′-fluoroguanosine-3′-phosphorothioate Gs guanosine-3′-phosphorothioate T 5′-methyluridine-3′-phosphate Tgn (S)-glycol-5′-methylundine Tf 2′-fluoro-5-methyluridine-3′-phosphate Tfs 2′-fluoro-5-methyluridine-3′-phosphorothioate Ts 5-methyluridine-3′-phosphorothioate U Uridine-3′-phosphate Uhd 2′-O-hexadecyl uridine-3′-phosphate Uf 2′-fluorouridine-3′-phosphate Ufs 2′-fluorouridine -3′-phosphorothioate Us uridine -3′-phosphorothioate N any nucleotide (G, A, C, T or U) a 2′-O-methyladenosine-3′-phosphate as 2′-O-methyladenosine-3′- phosphorothioate c 2′-O-methylcytidine-3′-phosphate cs 2′-O-methylcytidine-3′- phosphorothioate g 2′-O-methylguanosine-3′-phosphate gs 2′-O-methylguanosine-3′- phosphorothioate t 2′-O-methyl-5-methyluridine-3′-phosphate ts 2′-O-methyl-5-methyluridine-3′-phosphorothioate u 2′-O-methyluridine-3′-phosphate us 2′-O-methyluridine-3′-phosphorothioate s phosphorothioate linkage L96 N-[tris(GaINAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol Hyp-(GaINAc- alkyl)3 dT 2′-deoxythymidine-3′-phosphate dC 2′-deoxycytidine-3′-phosphate P Phosphate VP Vinyl-phosphonate
TABLE-US-00021 TABLE 2A Human APP Modified Sequences Duplex Name Sense Sequence (5′ to 3′) SEQ ID NO Antisense Sequence (5′ to 3′) SEQ ID NO mRNA target sequence SEQ ID NO AD-392699 gsasccc(Ahd)AfuUfAfAfguccuacuuuL96 33 asAfsagua(Ggn)gacuuaAfuUfgggucsasc 34 GUGACCCAAUUAAGUCCUACUUU 35 AD-392700 uscsucc(Uhd)GfaUfUfAfuuuaucacauL96 36 asUfsguga(Tgn)aaauaaUfcAfggagasgsa 37 UCUCUCCUGAUUAUUUAUCACAU 38 AD-392703 cscsuga(Ahd)CfuUfGfAfauuaauccauL96 39 asUfsggau(Tgn)aanucaAfgUfucaggscsa 40 UGCCUGAACUUGAAUUAAUCCAC 41 AD-392704 gsgsuuc(Ahd)AfaCfAfAfaggugcaauuL96 42 asAfsuugc(Agn)ccuuugUfuUfgaaccscsa 43 UGGGUUCAAACAAAGGUGCAAUC 44 AD-392705 ususuac(Uhd)CfaUfUfAfucgccuuuugL96 45 csAfsaaag(Ggn)cgauaaUfgAfguaaasusc 46 GAUUUACUCAUUAUCGCCUUUUG 47 AD-392707 asusuna(Ghd)CfuGfUfAfucaaacuaguL96 48 asCfsuagu(Tgn)ugauacAfgCfuaaaususc 49 GAAUUUAGCUGUAUCAAACUAGU 50 AD-392708 asgsuau(Uhd)CfcUfUfUfccugaucacuL96 51 asGfsugau(Cgn)aggaaaGfgAfauacususa 52 UAAGUAUUCCUUUCCUGAUCACU 53 AD-392709 gscsuua(Uhd)GfaCfAfUfgaucgcuuucL96 54 gsAfsaagc(Ggn)aucaugUfcAfuaagcsasa 55 UUGCUUAUGACAUGAUCGCUUUC 56 AD-392710 asasgau(Ghd)UfgUfCfUfucaauuuguaL96 57 usAfscaaa(Tgn)ugaagaCfaCfaucuusasa 58 UUAAGAUGUGUCUUCAAUUUGUA 59 AD-392711 gscsaaa(Ahd)CfcAfUfUfgcuucacuauL96 60 asufsagug(Agn)agcaauGfgUfuuugcsusg 61 CAGCAAAACCAUUGCUUCACUAC 62 AD-392712 asusuua(Chd)UfcAfUfUfaucgccuuuuL96 63 asAfsaagg(Cgn)gauaauGfaGfuaaauscsa 64 UGAUUUACUCAUUAUCGCCUUUU 65 AD-392713 usascuc(Ahd)UfuAfUfCfgccuuuugauL96 66 asUfscaaa(Agn)ggcgauAfaUfgaguasasa 67 uuuACuCAUUAUCGCCUUUUGAC 68 AD-392714 usgsccu(Ghd)AfaCfUfUfgaauuaaucuL96 69 asGfsauua(Agn)uucaagUfuCfaggcasusc 70 GAUGCCUGAACUUGAAUUAAUCC 71 AD-392715 csusgaa(Chd)UfuGfAfAfuuaauccacaL96 72 usGfsugga(Tgn)uaauucAfaGfuucagsgsc 73 GCCUGAACUUGAAUUAAUCCACA 74 AD-392716 ususuag(Chd)UfgUfAfUfcaaacuaguuL96 75 asAfscuag(Tgn)ungauaCfaGfcuaaasusu 76 AAUUUAGCUGUAUCAAACUACUG 77 AD-392717 gsasaua(Ghd)AfuUfCfUfcuccugauuaL96 78 usAfsauca(Ggn)gagagaAfuCfuauucsasu 79 AUGAAUAGAUUCUCUCCUGAUUA 80 AD-392718 uscscug(Ahd)UfnAfUfUfuaucacauauL96 81 asUfsaugu(Ggn)auaaauAfaUfcaggasgsa 82 UCUCCUGAUUAUUUAUCACAUAG 83 AD-392719 cscscaa(Uhd)UfaAfGfUfccuacuuuauL96 84 asufsaaag(Tgn)aggacuUfaAfuugggsusc 85 GACCCAAUUAAGUCCUACUUUAC 86 AD-392720 csasuau(Ghd)CfuUfUfAfagaaucgauuL96 87 asAfsucga(Tgn)ucuuaaAfgCfauaugsusa 88 UACAUAUGCUUUAAGAAUCGAUG 89 AD-392721 csusucu(Chd)UfuGfCfCfuaaguauucuL96 90 asGfsaana(Cgn)unaggcAfaGfagaagscsa 91 UGCUUCUCUUGCCUAAGUAUUCC 92 AD-392722 csasuug(Chd)UfuAfUfGfacaugaucguL96 93 asCfsgauc(Agn)ugucauAfaGfcaaugsasu 94 AUCAUUGCUUAUGACAUGAUCGC 95 AD-392723 csusuau(Ghd)AfcAfUfGfaucgcuuucuL96 96 asGfsaaag(Cgn)gaucauGfuCfauaagscsa 97 UGCUUAUGACAUGAUCGCUUUCU 98 AD-392724 usasuga(Chd)AfuGfAfUfcgcuuucuauL96 99 asufsagaa(Agn)gcgaucAfuGfucauasasg 100 CUUAUGACAUGAUCGCUUUCUAC 101 AD-392725 usgsaca(Uhd)GfaUfCfGfcuuucuacauL96 102 asUfsguag(Agn)aagcgaUfcAfugucasusa 103 UAUGACAUGAUCGCUUUCUACAC 104 AD-392726 gsasucg(Chd)UfuUfCfUfacacuguauuL96 105 asAfsuaca(Ggn)uguagaAfaGfcgaucsasu 106 AUGAUCGCUUUCUACACUGUAUU 107 AD-392727 asasaac(Uhd)AfuUfCfAfgaugacgucuL96 108 asGfsacgu(Cgn)aucugaAfuAfguuuusgsc 109 GCAAAACUAUUCAGAUGACGUCU 110 AD-392728 asasacu(Ahd)UfuCfAfGfaugacgucuuL96 111 asAfsgacg(Tgn)caucugAfaUfaguuususg 112 CAAAACUAUUCAGAUGACGUCUU 113 AD-392729 ascsgaa(Ahd)AfuCfCfAfaccuacaaguL96 114 asCfsuugu(Agn)gguuggAfuUfuucgusasg 115 CUACGAAAAUCCAACCUACAAGU 116 AD-392730 usgscuu(Chd)UfcUfUfGfccuaaguauuL96 117 asAfsuacu(Tgn)aggcaaGfaGfaagcasgsc 118 GCUGCUUCUCUUGCCUAAGUAUU 119 AD-392731 usgscuu(Ahd)UfgAfCfAfugaucgcuuuL96 120 asAfsagcg(Agn)ucauguCfaUfaagcasasu 121 AUUGCUUAUGACAUGAUCGCUUU 122 AD-392732 usgsauc(Ghd)CfuUTUfCfuacacuguauL96 123 asUfsacag(Tgn)guagaaAfgCfgaucasusg 124 CAUGAUCGCUUUCUACACUGUAU 125 AD-392733 asuscgc(Uhd)UfuCfUfAfcacuguauuaL96 126 usAfsauac(Agn)guguagAfaAfgcgauscsa 127 UGAUCGCUUUCUACACUGUAUUA 128 AD-392734 uscsuuu(Ghd)AfcCfGfAfaacgaaaacuL96 129 asGfsuuuu(Cgn)guuucgGfuCfaaagasusg 130 CAUCUUUGACCGAAACGAAAACC 131 AD-392735 gsusucu(Ghd)GfgUfUfGfacaaauaucaL96 132 usGfsauau(Tgn)ugucaaCfcCfagaacscsu 133 AGGUUCUGGGUUGACAAAUAUCA 134 AD-392736 usgsggu(Uhd)GfaCfAfAfauaucaagauL96 135 asUfscuug(Agn)uauuugUfcAfacccasgsa 136 UCUGGGUUGACAAAUAUCAAGAC 137 AD-392737 gsasuuu(Ahd)CfuCfAfUfuaucgccuuuL96 138 asAfsaggc(Ggn)auaaugAfgUfaaaucsasu 139 AUGAUUUACUCAUUAUCGCCUUU 140 AD-392738 uscscuu(Uhd)CfcUfGfAfucacuaugcaL96 141 usGfscaua(Ggn)ugaucaGfgAfaaggasasu 142 AUUCCUUUCCUGAUCACUAUGCA 143 AD-392739 csusunc(Chd)UfgAfUfCfacuaugcauuL96 144 asAfsugca(Tgn)agugauCfaGfgaaagsgsa 145 UCCUUUCCUGAUCACUAUGCAUU 146 AD-392740 asusugc(Uhd)UfaUfGfAfcaugaucgcuL96 147 asGfscgau(Cgn)augucaUfaAfgcaausgsa 148 UCAUUGCUUAUGACAUGAUCGCU 149 AD-392741 uscsuuu(Ahd)AfcCfAfGfucugaaguuuL96 150 asAfsacuu(Cgn)agacugGfuUfaaagasasa 151 UUUCUUUAACCAGUCUGAAGUUU 152 AD-392742 gsgsauc(Ahd)GfuUfAfCfggaaacgauuL96 153 asAfsucgu(Tgn)uccguaAfcUfgauccsusu 154 AAGGAUCAGUUACGGAAACGAUG 155 AD-392743 csusggg(Uhd)UfgAfCfAfaauaucaagaL96 156 usCfsuuga(Tgn)auuuguCfaAfcccagsasa 157 UUCUGGGUUGACAAAUAUCAAGA 158 AD-392744 asusgau(Uhd)UfaCfUfCfauuaucgccuL96 159 asGfsgcga(Tgn)aaugagUfaAfaucausasa 160 UUAUGAUUUACUCAUUAUCGCCU 161 AD-392745 csusugu(Ghd)GfuUfUfGfugacccaauuL96 162 asAfsuugg(Ggn)ucacaaAfcCfacaagsasa 163 UUCUUGUGGUUUGUGACCCAAUU 164 AD-392746 asusaug(Chd)UfuUfAfAfgaaucgauguL96 165 asCfsaucg(Agn)uucuuaAfaGfcauausgsu 166 ACAUAUGCUUUAAGAAUCGAuGG 167 AD-392747 ususugu(Chd)CfaCfGfUfaucuuuggguL96 168 asCfsccaa(Agn)ganacgUfgGfacaaasasa 169 UUUUUGUCCACGUAUCUUUGGGU 170 AD-392748 uscsauu(Ghd)UfaAfGfCfacuuuuacguL96 171 asCfsguaa(Agn)agugcuUfaCfaaugasasc 172 GUUCAUUGUAAGCACUUUUACGG 173 AD-392749 gsgscca(Ahd)CfaUfGfAfuuagugaacuL96 174 asGfsunca(Cgn)uaaucaUfgUfuggccsasa 175 UUGGCCAACAUGAUUAGUGAACC 176 AD-392750 gsasuca(Ghd)UfnAfCfGfgaaacgauguL96 177 asCfsaucg(Tgn)uuccguAfaCfugaucscsu 178 AGGAUCAGUUACGGAAACGAUGC 179 AD-392751 usascgg(Ahd)AfaCfGfAfugcucucauuL96 180 asAfsugag(Agn)gcaucgUfuUfccguasasc 181 GUUACGGAAACGAUGCUCUCAUG 182 AD-392752 usgsauu(Uhd)AfcUfCfAfuuaucgccuuL96 183 asAfsggcg(Agn)uaaugaGfuAfaaucasusa 184 UAUGAUUUACUCAUUAUCGCCUU 185 AD-392753 gsusaga(Uhd)GfcCfUfGfaacuugaauuL96 186 asAfsuuca(Agn)guucagGfcAfucuacsusu 187 AAGUAGAUGCCUGAACUUGAAUU 188 AD-392754 ususgua(Uhd)AfuUfAfUfucuugugguuL96 189 asAfsccac(Agn)agaauaAfuAfuucaascsu 190 AGUUGUAUAUUAUUCUUGUGGUU 191 AD-392755 asusugc(Uhd)GfcUfUfCfugcuauauuuL96 192 asAfsauau(Agn)gcagaaGfcAfgcaauscsu 193 AGAUUGCUGCUUCUGCUAUAUUU 194 AD-392756 usgscua(Uhd)AfuUfUfGfugauauaggaL96 195 usCfscuau(Agn)ucacaaAfuAfuagcasgsa 196 UCUGCUAUAUUUGUGAUAUAGGA 197 AD-392757 ascsaca(Uhd)UfaGfGfCfauugagacuuL96 198 asAfsgucu(Cgn)aaugccUfaAfugugusgsc 199 GCACACAUUAGGCAUUGAGACUU 200 AD-392758 asasgaa(Uhd)CfcCfUfGfuucauuguaaL96 201 usUfsacaa(Tgn)gaacagGfgAfuucuususu 202 AAAAGAAUCCCUGUUCAUUGUAA 203 AD-392759 csasuug(Uhd)AfaGfCfAfcuuuuacgguL96 204 asCfscgua(Agn)aagugcUfuAfcaaugsasa 205 UUCAUUGUAAGCACUUUUACGGG 206 AD-392760 ususgcu(Uhd)AfuGfAfCfaugaucgcuuL96 207 asAfsgcga(Tgn)caugucAfuAfagcaasusg 208 CAUUGCUUAUGACAUGAUCGCUU 209 AD-392761 csasagg(Ahd)UfcAfGfUfuacggaaacuL96 210 asGfsuuuc(Cgn)guaacuGfaUfccuugsgsu 211 ACCAAGGAUCAGUUACGGAAACG 212 AD-392762 asgsguu(Chd)UfgGfGfUfugacaaauauL96 213 asUfsauuu(Ggn)ucaaccCfaGfaaccusgsg 214 CCAGGUUCUGGGUUGACAAAUAU 215 AD-392763 asasgau(Ghd)UfgGfGfUfucaaacaaauL96 216 asUfsuugu(Tgn)ugaaccCfaCfaucuuscsu 217 AGAAGAUGUGGGUUCAAACAAAG 218 AD-392764 csusgaa(Ghd)AfaGfAfAfacaguacacaL96 219 usGfsugua(Cgn)uguuucUfuCfuucagscsa 220 UGCUGAAGAAGAAACAGUACACA 221 AD-392765 asasguu(Ghd)GfaCfAfGfcaaaaccauuL96 222 asAfsuggu(Tgn)uugcugUfcCfaacuuscsa 223 UGAAGUUGGACAGCAAAACCAUU 224 AD-392766 asuscgg(Uhd)GfuCfCfAfuuuauagaauL96 225 asUfsucua(Tgn)aaauggAfcAfccgausgsg 226 CCAUCGGUGUCCAUUUAUAGAAU 227 AD-392767 uscsggu(Ghd)UfcCfAfUfuuauagaauaL96 228 usAfsuucu(Agn)uaaaugGfaCfaccgasusg 229 CAUCGGUGUCCAUUUAUAGAAUA 230 AD-392768 gscsugu(Ahd)AfcAfCfAfaguagaugcuL96 231 asGfscauc(Tgn)acuuguGfuUfacagcsasc 232 GUGCUGUAACACAAGUAGAUGCC 233 AD-392769 asasgua(Ghd)AfuGfCfCfugaacuugaaL96 234 usUfscaag(Tgn)ucaggcAfuCfnacuusgsu 235 ACAAGUAGAUGCCUGAACUUGAA 236 AD-392770 ususgug(Ghd)UfuUfGfUfgacccaauuaL96 237 usAfsauug(Ggn)gucacaAfaCfcacaasgsa 238 UCUUGUGGUUUGUGACCCAAUUA 239 AD-392771 gsusuug(Uhd)GfaCfCfCfaauuaagucuL96 240 asGfsacuu(Agn)auugggUfcAfcaaacscsa 241 UGGUUUGUGACCCAAUUAAGUCC 242 AD-392772 gsusgac(Chd)CfaAfUfUfaaguccuacuL96 243 asGfsuagg(Agn)cuuaauUfgGfgucacsasa 244 UUGUGACCCAAUUAAGUCCUACU 245 AD-392773 usasugc(Uhd)UfuAfAfGfaaucgaugguL96 246 asCfscauc(Ggn)auucuuAfaAfgcauasusg 247 CAUAUGCUUUAAGAAUCGAUGGG 248 AD-392774 ususugu(Ghd)AfuAfUfAfggaauuaagaL96 249 usCfsuuaa(Tgn)uccuauAfuCfacaaasusa 250 UAUUUGUGAUAUAGGAAUUAAGA 251 AD-392775 asasaga(Ahd)UfcCfCfUfguucauuguaL96 252 usAfscaau(Ggn)aacaggGfaUfucuuususc 253 GAAAAGAAUCCCUGUUCAUUGUA 254 AD-392776 usgsauu(Ghd)UfaCfAfGfaaucauugcuL96 255 asGfscaau(Ggn)auucugUfaCfaaucasusc 256 GAUGAUUGUACAGAAUCAUUGCU 257 AD-392777 usgsccu(Ghd)GfaCfAfAfacccuucuuuL96 258 asAfsagaa(Ggn)gguuugUfcCfaggcasusg 259 CAUGCCUGGACAAACCCUUCUUU 260 AD-392778 gsasgca(Ahd)AfaCfUfAfuucagaugauL96 261 asUfscauc(Tgn)gaauagUfuUfugcucsusu 202 AAGAGCAAAACUAUUCAGAUGAC 263 AD-392779 asgsuga(Ahd)CfcAfAfGfgaucaguuauL96 264 asUfsaacu(Ggn)auccunGfgUfucacusasa 265 UUAGUGAACCAAGGAUCAGUUAC 266 AD-392780 usgsaac(Chd)AfaGfGfAfucaguuacguL96 267 asCfsguaa(Cgn)ugauccUfuGfguucascsu 208 AGUGAACCAAGGAUCAGUUACGG 269 AD-392781 csasguu(Ahd)CfgGfAfAfacgaugcucuL96 270 asGfsagca(Tgn)cguuucCfgUfaacugsasu 271 AUCAGUUACGGAAACGAUGCUCU 272 AD-392782 asgsaag(Ahd)UfgUfGfGfguucaaacaaL96 273 usUfsguuu(Ggn)aacccaCfaUfcuucusgsc 274 GCAGAAGAUGUGGGUUCAAACAA 275 AD-392783 cscsucu(Ghd)AfaGfUfUfggacagcaaaL96 276 usUfsugcu(Ggn)uccaacUfuCfagaggscsu 277 AGCCUCUGAAGUUGGACAGCAAA 278 AD-392784 ususaug(Ahd)UfuUfAfCfucauuaucguL96 279 ascfsgaua(Agn)ugaguaAfaUfcauaasasa 280 UUUUAUGAUUUACUCAUUAUCGC 281 AD-392785 ascsagc(Uhd)GfuGfCfUfguaacacaauL96 282 asUfsugug(Tgn)uacagcAfcAfgcuguscsa 283 UGACAGCUGUGCUGUAACACAAG 284 AD-392786 usgsuga(Chd)CfcAfAfUfuaaguccuauL96 285 asUfsagga(Cgn)uuaauuGfgGfucacasasa 286 UUUGUGACCCAAUUAAGUCCUAC 287 AD-392787 usascau(Ahd)UfgCfUfUfuaagaaucgaL96 288 usCfsgauu(Cgn)uuaaagCfaUfauguasasa 289 UUUACAUAUGCUUUAAGAAUCGA 290 AD-392788 gsusaaa(Uhd)AfaAfUfAfcauucuuggaL96 291 usCfscaag(Agn)auguauUfuAfuuuacsasu 292 AUGUAAAUAAAUACAUUCUUGGA 293 AD-392789 uscsagu(Uhd)AfcGfGfAfaacgaugcuuL96 294 asAfsgcau(Cgn)guuuccGfuAfacugasusc 295 GAUCAGUUACGGAAACGAUGCUC 296 AD-392790 csusucc(Chd)GfuGfAfAfuggagaguuuL96 297 asAfsacuc(Tgn)ccauucAfcGfggaagsgsa 298 UCCUUCCCGUGAAUGGAGAGUUC 299 AD-392791 asgsuug(Ghd)AfcAfGfCfaaaaccauuuL96 300 asAfsaugg(Tgn)uuugcuGfuCfcaacususc 301 GAAGUUGGACAGCAAAACCAUUG 302 AD-392792 cscscau(Chd)GfgUfGfUfccauuuauauL96 303 asUfsauaa(Agn)uggacaCfcGfaugggsusa 304 UACCCAUCGGUGUCCAUUUAUAG 305 AD-392793 usgscac(Ahd)CfaUfUfAfggcauugagaL96 306 usCfsucaa(Tgn)gccuaaUfgUfgugcascsa 307 UGUGCACACAUUAGGCAUUGAGA 308 AD-392794 cscsaac(Ahd)UfgAfUfUfagugaaccaaL96 309 usUfsgguu(Cgn)acuaauCfaUfguuggscsc 310 GGCCAACAUGAUUAGUGAACCAA 311 AD-392795 asusgau(Uhd)AfgUfGfAfaccaaggauuL96 312 asAfsuccu(Tgn)gguucaCfuAfaucausgsu 313 ACAUGAUUAGUGAACCAAGGAUC 314 AD-392796 ususagu(Ghd)AfaCfCfAfaggaucaguuL96 315 asAfscuga(Tgn)ccuuggUfuCfacuaasusc 316 GAUUAGUGAACCAAGGAUCAGUU 317 AD-392797 asascca(Ahd)GfgAfUfCfaguuacggaaL96 318 usUfsccgu(Agn)acugauCfcUfugguuscsa 319 uGAACCAAGGAUCAGUUACGGAA 320 AD-392798 gsusuac(Ghd)GfaAfAfCfgaugcucucaL96 321 usGfsagag(Cgn)aucguuUfcCfguaacsusg 322 CAGUUACGGAAACGAUGCUCUCA 323 AD-392799 gsasugc(Ahd)GfaAfUfUfccgacaugauL96 324 asUfscaug(Tgn)cggaauUfcUfgcaucscsa 325 UGGAUGCAGAAUUCCGACAUGAC 326 AD-392800 ususgga(Chd)AfgCfAfAfaaccauugcuL96 327 asGfscaau(Ggn)guuuugCfuGfuccaascsu 328 AGUUGGACAGCAAAACCAUUGCU 329 AD-392801 asasacc(Ahd)UfuGfCfUfucacuacccaL96 330 usGfsggua(Ggn)ugaagcAfaUfgguuususg 331 CAAAACCAUUGCUUCACUACCCA 332 AD-392802 cscsauc(Ghd)GfuGfUfCfcauuuauagaL96 333 usCfsuaua(Agn)auggacAfcCfganggsgsu 334 ACCCAUCGGUGUCCAUUUAUAGA 335 AD-392803 ususauc(Ghd)CfcUfUfUfugacagcuguL96 336 asCfsagcu(Ggn)ucaaaaGfgCfganaasusg 337 CAUUAUCGCCUUUUGACAGCUGU 338 AD-392804 asuscgc(Chd)UfuUfUfGfacagcuguguL96 339 asCfsacag(Cgn)ugucaaAfaGfgcgausasa 340 UUAUCGCCUUUUGACAGCUGUGC 341 AD-392805 ascsaca(Ahd)GfuAfGfAfugccugaacuL96 342 asGfsuuca(Ggn)gcaucuAfcUfugugususa 343 UAACACAAGUAGAUGCCUGAACU 344 AD-392806 usgsugg(Uhd)UfuGfUfGfacccaauuaaL96 345 usUfsaauu(Ggn)ggucacAfaAfccacasasg 346 CUUGUGGUUUGUGACCCAAUUAA 347 AD-392807 gsgsgau(Ghd)CfuUfCfAfugugaacguuL96 348 asAfscgun(Cgn)acauguAfgCfaucccscsc 349 GGGGGAUGCUUCAUGUGAACGUG 350 AD-392808 usgsugc(Ahd)CfaCfAfUfnaggcauugaL96 351 usCfsaaug(Cgn)cuaaugUfgUfgcacasusa 352 UAUGUGCACACAUUAGGCAUUGA 353 AD-392809 asasaug(Ghd)AfaGfUfGfgcaauauaauL96 354 asUfsuaua(Tgn)ugccacUfuCfcauuususc 355 GAAAAUGGAAGUGGCAAUAUAAG 356 AD-392810 asusgga(Ahd)GfuGfGfCfaauauaagguL96 357 asCfscuua(Tgn)aungccAfcUfuccaususu 358 AAAUGGAAGUGGCAAUAUAAGGG 359 AD-392811 usgsccc(Ghd)AfgAfUfCfcuguuaaacuL96 360 asGfsuuua(Agn)caggauCfuCfgggcasasg 361 CUUGCCCGAGAUCCUGUUAAACU 362 AD-392812 asusuag(Uhd)GfaAfCfCfaaggancaguL96 363 asCfsugau(Cgn)cuugguUfcAfcuaanscsa 364 UGAUUAGUGAACCAAGGAUCAGU 365 AD-392813 gsasacc(Ahd)AfgGfAfUfcagunacggaL96 366 usCfscgua(Agn)cugaucCfuUfgguucsasc 307 GUGAACCAAGGAUCAGUUACGGA 368 AD-392814 asasgga(Uhd)CfaGfUfUfacggaaacgaL96 369 usCfsguuu(Cgn)cguaacUfgAfuccuusgsg 370 CCAAGGAUCAGUUACGGAAACGA 371 AD-392815 csasaca(Chd)AfgAfAfAfacgaaguugaL96 372 usCfsaacu(Tgn)cguuuuCfuGfugungsgsc 373 GCCAACACAGAAAACGAAGUUGA 374 AD-392816 usgsggu(Uhd)CfaAfAfCfaaaggugcaaL96 375 usUfsgcac(Cgn)uuuguuUfgAfacccascsa 376 UGUGGGUUCAAACAAAGGUGCAA 377 AD-392817 csasgug(Ahd)UfcGfUfCfaucaccuuguL96 378 asCfsaagg(Tgn)gaugacGfaUfcacugsusc 379 GACAGUGAUCGUCAUCACCUUGG 380 AD-392818 ascscca(Uhd)CfgGfUfGfuccauuuauaL96 381 usAfsuaaa(Tgn)ggacacCfgAfugggusasg 382 CUACCCAUCGGUGUCCAUUUAUA 383 AD-392819 uscsuug(Uhd)GfgUfUfUfgugacccaauL96 384 asUfsuggg(Tgn)cacaaaCfcAfcaagasasu 385 AUUCUUGUGGUUUGUGACCCAAU 386 AD-392820 ususugu(Ghd)AfcCfCfAfauuaaguccuL96 387 asGfsgacu(Tgn)aauuggGfuCfacaaascsc 388 GGUUUGUGACCCAAUUAAGUCCU 389 AD-392821 ususgug(Ahd)CfcCfAfAfuuaaguccuaL96 390 usAfsggac(Tgn)uaauugGfgUfcacaasasc 391 GUUUGUGACCCAAUUAAGUCCUA 392 AD-392822 ususcag(Ahd)UfgAfCfGfucuuggccaaL96 393 usUfsggcc(Agn)agacguCfaUfcugaasusa 394 UAUUCAGAUGACGUCUUGGCCAA 395 AD-392823 asuscag(Uhd)UfaCfGfGfaaacgaugcuL96 396 asGfscauc(Ggn)uuuccgUfaAfcugauscsc 397 GGAUCAGUUACGGAAACGAUGCU 398 AD-392824 usgsgau(Ghd)CfaGfAfAfuuccgacauuL96 399 asAfsuguc(Ggn)gaauucUfgCfauccasusc 400 GAUGGAUGCAGAAUUCCGACAUG 401 AD-392825 gsuscca(Ahd)GfaUfGfCfagcagaacguL96 402 asCfsguuc(Tgn)gcugcaUfcUfuggacsasg 403 CUGUCCAAGAUGCAGCAGAACGG 404 AD-392826 usasccc(Ahd)UfcGfGfUfguccauuuauL96 405 asUfsaaau(Ggn)gacaccGfaUfggguasgsu 406 ACUACCCAUCGGUGUCCAUUUAU 407 AD-392827 ususuug(Ahd)CfaGfCfUfgugcuguaauL96 408 asUfsuaca(Ggn)cacagcUfgUfcaaaasgsg 409 CCUUUUGACAGCUGUGCUGUAAC 410 AD-392828 ususgac(Ahd)GfcUfGfUfgcuguaacauL96 411 asUfsguua(Cgn)agcacaGfcUfgucaasasa 412 UUUUGACAGCUGUGCUGUAACAC 413 AD-392829 asgscug(Uhd)GfcUfGfUfaacacaaguaL96 414 usAfscuug(Tgn)guuacaGfcAfcagcusgsu 415 ACAGCUGUGCUGUAACACAAGUA 416 AD-392830 gsusuuu(Ahd)UfgUfGfCfacacauuaguL96 417 asCfsuaau(Ggn)ugugcaCfaUfaaaacsasg 418 CUGUUUUAUGUGCACACAUUAGG 419 AD-392831 ususcaa(Uhd)UfaCfCfAfagaanucucuL96 420 asGfsagaa(Tgn)ucuuggUfaAfuugaasgsa 421 UCUUCAAUUACCAAGAAUUCUCC 422 AD-392832 csascac(Ahd)UfcAfGfUfaauguauucuL96 423 asGfsaaua(Cgn)auuacuGfaUfgugugsgsa 424 UCCACACAUCAGUAAUGUAUUCU 425 AD-392833 usgsguc(Uhd)CfuAfUfAfcuacauuauuL96 426 asAfsuaau(Ggn)uaguauAfgAfgaccasasa 427 UUUGGUCUCUAUACUACAUUAUU 428 AD-392834 ascsccg(Uhd)UfuUfAfUfgauuuacucaL96 429 usGfsagua(Agn)aucauaAfaAfcgggususu 430 AAACCCGUUUUAUGAUUUACUCA 431 AD-392835 usascga(Ahd)AfaUfCfCfaaccuacaauL96 432 asUfsugua(Ggn)guuggaUfuUfucguasgsc 433 GCUACGAAAAUCCAACCUACAAG 434 AD-392836 uscscac(Ahd)CfaUfCfAfguaauguauuL96 435 asAfsuaca(Tgn)uacugaUfgUfguggasusu 436 AAUCCACACAUCAGUAAUGUAUU 437 AD-392837 csusggu(Chd)UfuCfAfAfuuaccaagaaL96 438 usUfscung(Ggn)uaauugAfaGfaccagscsa 439 UGCUGGUCUUCAAUUACCAAGAA 440 AD-392838 gscscau(Chd)UfuUfGfAfccgaaacgaaL96 441 usUfscguu(Tgn)cggucaAfaGfauggcsasu 442 AUGCCAUCUUUGACCGAAACGAA 443 AD-392839 cscsauc(Uhd)UfuGfAfCfcgaaacgaaaL96 444 usUfsucgu(Tgn)ucggucAfaAfgauggscsa 445 UGCCAUCUUUGACCGAAACGAAA 446 AD-392840 csusacg(Ahd)AfaAfUfCfcaaccuacaaL96 447 usUfsguag(Ggn)uuggauUfuUfcguagscsc 448 GGCUACGAAAAUCCAACCUACAA 449 AD-392841 asuscca(Chd)AfcAfUfCfaguaauguauL96 450 asUfsacau(Tgn)acugauGfuGfuggaususa 451 UAAUCCACACAUCAGUAAUGUAU 452 AD-392842 csasugc(Chd)AfuCfUfUfugaccgaaauL96 453 asUfsuucg(Ggn)ucaaagAfuGfgcaugsasg 454 CUCAUGCCAUCUUUGACCGAAAC 455 AD-392843 gsgscua(Chd)GfaAfAfAfuccaaccuauL96 456 asUfsaggu(Tgn)ggauuuUfcGfuagccsgsu 457 ACGGCUACGAAAAUCCAACCUAC 458 AD-392844 uscsaug(Chd)CfaUfCfUfuugaccgaaaL96 459 usUfsucgg(Tgn)caaagaUfgGfcaugasgsa 460 UCUCAUGCCAUCUUUGACCGAAA 461 AD-392845 csasgua(Chd)AfcAfUfCfcauucaucauL96 462 asUfsgaug(Agn)auggauGfuGfuacugsusu 463 AACAGUACACAUCCAUUCAucAu 464 AD-392846 asascgg(Chd)UfaCfGfAfaaauccaacuL96 465 asGfsuugg(Agn)uuuucgUfaGfccguuscsu 466 AGAACGGCUACGAAAAUCCAACC 467 AD-392847 gsasagu(Uhd)UfcAfUfUfnaugauacaaL96 468 usUfsguau(Cgn)auaaauGfaAfacuucsasg 469 CUGAAGUUUCAUUUAUGAUACAA 470 AD-392848 asusgcc(Ahd)UfcUfUfUfgaccgaaacuL96 471 asGfsuuuc(Ggn)gucaaaGfaUfggcausgsa 472 UCAUGCCAUCUUUGACCGAAACG 473 AD-392849 gsasacg(Ghd)CfuAfCfGfaaaauccaauL96 474 asUfsugga(Tgn)uuucguAfgCfcguucsusg 475 CAGAACGGCUACGAAAAUCCAAC 476 AD-392850 uscsuuc(Ghd)UfgCfCfUfguuuuauguuL96 477 asAfscaua(Agn)aacaggCfaCfgaagasasa 478 UUUCUUCGUGCCUGUUUUAUGUG 479 AD-392851 ususgcc(Chd)GfaGfAfUfccuguuaaauL96 480 asUfsuuaa(Cgn)aggaucUfcGfggcaasgsa 481 UCUUGCCCGAGAUCCUGUUAAAC 482 AD-392852 csusucg(Uhd)GfcCfUfGfuuuuauguguL96 483 asCfsacau(Agn)aaacagGfcAfcgaagsasa 484 UUCUUCGUGCCUGUUUUAUGUGC 485 AD-392853 gscsgcc(Ahd)UfgUfCfCfcaaaguuuauL96 486 asUfsaaac(Tgn)uugggaCfaUfggcgcsusg 487 CAGCGCCAUGUCCCAAAGUUUAC 488 AD-392854 gsuscau(Ahd)GfcGfAfCfagugaucguuL96 489 asAfscgau(Cgn)acugucGfcUfaugacsasa 490 UUGUCAUAGCGACAGUGAUCGUC 491 AD-392855 gscsuac(Ghd)AfaAfAfUfccaaccuacaL96 492 usGfsuagg(Tgn)uggauuUfuCfguagcscsg 493 CGGCUACGAAAAUCCAACCUACA 494 AD-392856 asusagc(Ghd)AfcAfGfUfgaucgucauuL96 495 asAfsugac(Ggn)aucacuGfuCfgcuausgsa 496 UCAUAGCGACAGUGAUCGUCAUC 497 AD-392857 csusugc(Chd)CfgAfGfAfuccuguuaaaL96 498 usUfsuaac(Agn)ggaucuCfgGfgcaagsasg 499 CUCUUGCCCGAGAUCCUGUUAAA 500 AD-392858 csuscau(Ghd)CfcAfUfCfuuugaccgaaL96 501 usUfscggu(Cgn)aaagauGfgCfaugagsasg 502 CUCUCAUGCCAUCUUUGACCGAA 503 AD-392859 ascsggc(Uhd)AfcGfAfAfaauccaaccuL96 504 asGfsguug(Ggn)auuuucGfuAfgccgususc 505 GAACGGCUACGAAAAUCCAACCu 506 AD-392860 csasuca(Ahd)AfaAfUfUfgguguucuuuL96 507 asAfsagaa(Cgn)accaauUfuUfugaugsasu 508 AUCAUCAAAAAUUGGUGUUCUUU 509 AD-392861 asuscca(Ahd)CfcUfAfCfaaguucuuugL96 510 csAfsaaga(Agn)cuuguaGfgUfuggaususu 511 AAAUCCAACCUACAAGUUCUUUG 512 AD-392862 csgscuu(Uhd)CfuAfCfAfcuguauuacaL96 513 usGfsuaau(Agn)caguguAfgAfaagcgsasu 514 AUCGCUUUCUACACUGUAUUACA 515 AD-392863 uscscaa(Chd)CfuAfCfAfaguucuuugaL96 516 usCfsaaag(Agn)acuuguAfgGfuuggasusu 517 AAUCCAACCUACAAGUUCUUUGA 518 AD-392864 uscsucu(Chd)UfuUfAfCfauuuuggucuL96 519 asGfsacca(Agn)aauguaAfaGfagagasusa 520 UAUCUCUCUUUACAUUUUGGUCU 521 AD-392865 csuscuc(Uhd)UfuAfCfAfuuuuggucuuL96 522 asAfsgacc(Agn)aaauguAfaAfgagagsasu 523 AUCUCUCUUUACAUUUUGGUCUC 524 AD-392866 ususugu(Ghd)UfaCfUfGfuaaagaauuuL96 525 asAfsauuc(Tgn)uuacagUfaCfacaaasasc 526 GUUUUGUGUACUGUAAAGAAUUU 527 AD-392867 gsusgua(Chd)UfgUfAfAfagaauuuaguL96 528 asCfsuaaa(Tgn)ucuuuaCfaGfuacacsasa 529 UUGUGUACUGUAAAGAAUUUAGC 530 AD-392868 ascscca(Ahd)UfuAfAfGfuccuacuuuaL96 531 usAfsaagu(Agn)ggacuuAfaUfuggguscsa 532 UGACCCAAUUAAGUCCUACUUUA 533 AD-392869 uscscua(Chd)UfuUfAfCfauaugcuuuaL96 534 usAfsaagc(Agn)uauguaAfaGfuaggascsu 535 AGUCCUACUUUACAUAUGCUUUA 536 AD-392870 cscsuac(Uhd)UfuAfCfAfuaugcuuuaaL96 537 usUfsaaag(Cgn)auauguAfaAfguaggsasc 538 GUCCUACUUUACAUAUGCUUUAA 539 AD-392871 ususcua(Chd)AfcUfGfUfauuacauaaaL96 540 usUfsuaug(Tgn)aauacaGfuGfuagaasasg 541 CUUUCUACACUGUAUUACAUAAA 542 AD-392872 uscsuac(Ahd)CfuGfUfAfuuacauaaauL96 543 asUfsuuau(Ggn)uaauacAfgUfguagasasa 544 UUUCUACACUGUAUUACAUAAAU 545 AD-392873 csusuuu(Ahd)AfgAfUfGfugucuucaauL96 546 asUfsugaa(Ggn)acacauCfuUfaaaagsasa 547 UUCUUUUAAGAUGUGUCUUCAAU 548 AD-392874 asusgug(Uhd)CfnUfCfAfauuuguauaDL96 549 usUfsauac(Agn)aauugaAfgAfcacauscsu 550 AGAUGUGUCUUCAAUUUGUAUAA 551 AD-392875 asuscaa(Ahd)AfaUfUfGfguguucuungL96 552 csAfsaaga(Agn)caccaaUfuUfuugausgsa 553 UCAUCAAAAAUUGGUGUUCUUUG 554 AD-392876 asasauc(Chd)AfaCfCfUfacaaguucuuL96 555 asAfsgaac(Tgn)uguaggUfuGfgauuususc 556 GAAAAUCCAACCUACAAGUUCUU 557 AD-392877 gsusacu(Ghd)UfaAfAfGfaauuuagcuuL96 558 asAfsgcua(Agn)auucuuUfaCfaguacsasc 559 GUGUACUGUAAAGAAUUUAGCUG 560 AD-392878 csusccu(Ghd)AfuUfAfUfuuaucacauaL96 561 usAfsugug(Agn)uauauuAfuCfaggagsasg 562 CUCUCCUGAUUAUUUAUCACAUA 563 AD-392879 gscscag(Uhd)UfgUfAfUfauuauucuuuL96 564 asAfsagaa(Tgn)aauauaCfuAfeuggcsusa 565 UAGCCAGUUGUAUAUUAUUCUUG 566 AD-392880 asasuua(Ahd)GfuCfCfUfacuuuacauaL96 567 usAfsugua(Agn)aguaggAfcUfnaanusgsg 568 CCAAUUAAGUCCUACUUUACAUA 569 AD-392881 csusugc(Chd)UfaAfGfUfauuccuuucuL96 570 asGfsaaag(Ggn)aanacuUfaGfgcaagsasg 571 CUCUUGCCUAAGUAUUCCUUUCC 572 AD-392882 asusucc(Uhd)UfuCfCfUfgaucacuauuL96 573 asAfsuagu(Ggn)aucaggAfaAfggaausasc 574 GUAUUCCUUUCCUGAUCACUAUG 575 AD-392883 ascsuau(Ghd)CfaUfUfUfunaaguuaaaL96 576 usUfsuaac(Tgn)uuaaaaUfgCfauagusgsa 577 UCACUAUGCAUUUUAAAGUUAAA 578 AD-392884 usgsuuc(Ahd)UfuGfUfAfagcacuuuuaL96 579 usAfsaaag(Tgn)gcnnacAfaUfgaacasgsg 580 CCUGUUCAUUGUAAGCACUUUUA 581 AD-392885 asasuua(Chd)CfaAfGfAfauucuccaaaL96 582 usUfsugga(Ggn)aauucuUfgGfuuauusgsa 583 UCAAUUACCAAGAAUUCUCCAAA 584 AD-392886 ususacc(Ahd)AfgAfAfUfucuccaaaauL96 585 asUfsnung(Ggn)agaauuCfnUfgguaasusu 586 AAUUACCAAGAAUUCUCCAAAAC 587 AD-392887 uscsauu(Ghd)CfuUfAfUfgacaugaucuL96 588 asGfsauca(Tgn)gucauaAfgCfaaugasusu 589 AAUCAUUGCUUAUGACAUGAUCG 590 AD-392889 ususuua(Ahd)GfaUfGfUfgucuucaauuL96 591 asAfsuuga(Agn)gacacaUfcUfuaaaasgsa 592 UCUUUUAAGAUGUGUCUUCAAUU 593 AD-392890 asusccu(Ghd)UfuAfAfAfcuuccuacaaT96 594 usUfsguag(Ggn)aaguuuAfaCfaggauscsu 595 AGAUCCUGUUAAACUUCCUACAA 596 AD-392891 ascsuau(Uhd)CfaGfAfUfgacgucuuguL96 597 asCfsaaga(Cgn)gucaucUfgAfauagususu 598 AAACUAUUCAGAUGACGUCUUGG 599 AD-392892 gsusuca(Uhd)CfaUfCfAfaaaauugguuL96 600 asAfsccaa(Tgn)uuuugaUfgAfugaacsusu 601 AAGUUCAUCAUCAAAAAUUGGUG 602 AD-392893 usasucu(Chd)UfcUfUfUfacauuuugguL96 603 asCfscaaa(Agn)uguaaaGfaGfagauasgsa 604 UCUAUCUCUCUUUACAUUUUGGU 605 AD-392894 asuscuc(Uhd)CfuUfUfAfcauuuugguuL96 606 asAfsccaa(Agn)auguanAfgAfgagausasg 607 CUAUCUCUCUUUACAUUUUGGUC 608 AD-392895 usgsugu(Ahd)CfuGfUfAfaagaauuuauL96 609 asUfsaaau(Tgn)cuuuacAfgUfacacasasa 610 UUUGUGUACUGUAAAGAAUUUAG 611 AD-392896 csusacu(Uhd)UfaCfAfUfaugcuuuaauL96 612 asUfsuaaa(Ggn)cauaugUfaAfaguagsgsa 613 UCCUACUUUACAUAUGCUUUAAG 614 AD-392897 usgsccu(Ahd)AfgUfAfUfuccuuuccuuL96 615 asAfsggaa(Agn)ggaauaCfnUfaggcasasg 616 CUUGCCUAAGUAUUCCUUUCCUG 617 AD-392898 asasgua(Uhd)UfcCfUfUfuccugaucauL96 618 asUfsgauc(Agn)ggaaagGfaAfuacuusasg 619 CUAAGUAUUCCUUUCCUGAUCAC 620 AD-392899 gsusauu(Chd)CfuUfUfCfcugaucacuaL96 621 usAfsguga(Tgn)caggaaAfgGfaauacsusu 622 AAGUAUUCCUUUCCUGAUCACUA 623 AD-392900 ususccu(Ghd)AfuCfAfCfuaugcauuuuL96 624 asAfsaang(Cgn)auagugAfuCfaggaasasg 625 CUUUCCUGAUCACUAUGCAUUUU 626 AD-392901 csusgau(Chd)AfcUfAfUfgcauuuuaaaL96 627 usUfsuaaa(Agn)ugcauaGfuGfaucagsgsa 628 UCCUGAUCACUAUGCAUUUUAAA 629 AD-392902 csascgu(Ahd)UfcUfUfUfgggucuuugaL96 630 usCfsaaag(Agn)cccaaaGfaUfacgugsgsa 631 UCCACGUAUCUUUGGGUCUUUGA 632 AD-392903 usgsggu(Chd)UfnUfGfAfuaaagaaaauL96 633 asUfsuuuc(Tgn)uuaucaAfaGfacccasasa 634 UUUGGGUCUUUGAUAAAGAAAAG 635 AD-392904 uscsaau(Uhd)AfcCfAfAfgaauucuccaL96 636 usGfsgaga(Agn)uucuugGfuAfauugasasg 637 CUUCAAUUACCAAGAAUUCUCCA 638 AD-392906 uscsgcu(Uhd)UfcUfAfCfacuguaunauL96 639 asUfsaaua(Cgn)aguguaGfaAfagcgasusc 640 GAUCGCUUUCUACACUGUAUUAC 641 AD-392907 asusuuu(Chd)UfaUfAfAfccagucugaaL96 642 usUfscaga(Cgn)ugguuaAfaGfaaaaususg 643 CAAUUUUCUUUAACCAGUCUGAA 644 AD-392908 csusuua(Ahd)CfcAfGfUfcugaaguuucL96 645 gsAfsaacu(Tgn)cagacuGfgUfuaaagsasa 646 UUCUUUAACCAGUCUGAAGUUUC 647 AD-392909 usasaga(Uhd)GfuGfUfCfuucaauuuguL96 648 asCfsaaau(Tgn)gaagacAfcAfucuuasasa 649 UUUAAGAUGUGUCUUCAAUUUGU 650 AD-392910 gsasucc(Uhd)GfuUfAfAfacuuccuacaL96 651 usGfsuagg(Agn)aguuuaAfcAfggaucsusc 652 GAGAUCCUGUUAAACUUCCUACA 653 AD-392911 csusgcu(Uhd)CfaGfAfAfagagcaaaauL96 654 asUfsuung(Cgn)ucuuucUfgAfagcagscsu 655 AGCUGCUUCAGAAAGAGCAAAAC 656 AD-392912 csasgaa(Ahd)GfaGfCfAfaaacuauucaL96 657 usGfsaaua(Ggn)uuuugcUfcUfuucugsasa 658 UUCAGAAAGAGCAAAACUAUUCA 659 AD-392913 usasuga(Ahd)GfuUfCfAfucaucaaaaaL96 660 usUfsuuug(Agn)ugaugaAfcUfucauasusc 661 GAUAUGAAGUUCAUCAUCAAAAA 662 AD-392914 csasuca(Uhd)CfaAfAfAfauugguguuuL96 663 asAfsacac(Cgn)aauuuuUfgAfugaugsasa 664 UUCAUCAUCAAAAAUUGGUGUUC 665 AD-392915 uscsaaa(Ahd)AfuUfGfGfuguucuuuguL96 666 asCfsaaag(Agn)acaccaAfuUfuuugasusg 667 CAUCAAAAAUUGGUGUUCUUUGC 668 AD-392916 asasaau(Chd)CfaAfCfCfuacaaguucuL96 669 asGfsaacu(Tgn)guagguUfgGfauuuuscsg 670 CGAAAAUCCAACCUACAAGUUCU 671 AD-392917 cscsaac(Chd)UfaCfAfAfguucuuugauL96 672 asUfscaaa(Ggn)aacuugUfaGfguuggsasu 673 AUCCAACCUACAAGUUCUUUGAG 674 AD-392918 ascsuca(Uhd)UfaUfCfGfccuuuugacaL96 675 usGfsucaa(Agn)aggcgaUfaAfugagusasa 676 UUACUCAUUAUCGCCUUUUGACA 677 AD-392919 csuscau(Uhd)AfuCfGfCfcuuuugacauL96 678 asUfsguca(Agn)aaggcgAfuAfaugagsusa 679 UACUCAUUAUCGCCUUUUGACAG 680 AD-392920 usgsugc(Uhd)GfuAfAfCfacaaguagauL96 681 asUfscuac(Tgn)uguguuAfcAfgcacasgsc 682 GCUGUGCUGUAACACAAGUAGAU 683 AD-392921 gsusgcu(Ghd)UfaAfCfAfcaaguagauuL96 684 asAfsucua(Cgn)uuguguUfaCfagcacsasg 685 CUGUGCUGUAACACAAGUAGAUG 686 AD-392922 uscsuuu(Ahd)CfaUfUfUfuggucucuauL96 687 asUfsagag(Agn)ccaaaaUfgUfaaagasgsa 688 UCUCUUUACAUUUUGGUCUCUAU 689 AD-392923 asusggg(Uhd)UfaUfGfUfguacuguaaaL96 690 usUfsuaca(Ggn)uacacaAfaAfcccaususa 691 UAAUGGGUUUUGUGUACUGUAAA 692 AD-392924 ususgug(Uhd)AfcUfGfUfaaagaauunaL96 693 usAfsaauu(Cgn)uuuacaGfuAfcacaasasa 694 UUUUGUGUACUGUAAAGAAUUUA 695 AD-392925 gscsugu(Ahd)UfcAfAfAfcuagugcauuL96 696 asAfsugca(Cgn)uaguuuGfaUfacagcsusa 697 UAGCUGUAUCAAACUAGUGCAUG 698 AD-392926 csusagu(Ghd)CfaUfGfAfauagauucuuL96 699 asAfsgaau(Cgn)uauucaUfgCfacuagsusu 700 AACUAGUGCAUGAAUAGAUUCUC 701 AD-392927 usasgug(Chd)AfuGfAfAfuagauucucuL96 702 asGfsagaa(Tgn)cuauucAfuGfcacuasgsu 703 ACUAGUGCAUGAAUAGAUUCUCU 704 AD-392928 csuscuc(Chd)UfgAfUfUfauunaucacaL96 705 usGfsugau(Agn)aauaauCfaGfgagagsasa 706 UUCUCUCCUGAUUAUUUAUCACA 707 AD-392929 cscsuga(Uhd)UfaUfUfUfaucacauaguL96 708 asCfsuaug(Tgn)gauaaaUfaAfucaggsasg 709 CUCCUGAUUAUUUAUCACAUAGC 710 AD-392930 usasagu(Chd)CfuAfCfUfunacauauguL96 711 asCfsauau(Ggn)uaaaguAfgGfacuuasasu 712 AUUAAGUCCUACUUUACAUAUGC 713 AD-392931 asgsucc(Uhd)AfcUfUfUfacauaugcuuL96 714 asAfsgcau(Agn)uguaaaGfuAfggacususa 715 UAAGUCCUACUUUACAUAUGCUU 716 AD-392932 gsusccu(Ahd)CfnUfVfAfcauaugcuuuL96 717 asAfsagca(Tgn)auguaaAfgUfaggacsusu 718 AAGUCCUACUUUACAUAUGCUUU 719 AD-392933 ususcuc(Uhd)UfgCfCfUfaaguauuccuL96 720 asGfsgaau(Agn)cuuaggCfaAfgagaasgsc 721 GCUUCUCUUGCCUAAGUAUUCCU 722 AD-392934 csuscuu(Ghd)CfcUfAfAfguauuccuuuL96 723 asAfsagga(Agn)uacuuaGfgCfaagagsasa 724 UUCUCUUGCCUAAGUAUUCCUUU 725 AD-392935 usasuuc(Chd)UfuUfCfCfugaucacuauL96 726 asUfsagug(Agn)ucaggaAfaGfgaauascsu 727 AGUAUUCCUUUCCUGAUCACUAU 728 AD-392936 ususucc(Uhd)GfaUfCfAfcuaugcauuuL96 729 asAfsaugc(Agn)uagugaUfcAfggaaasgsg 730 CCUUUCCUGAUCACUAUGCAUUU 731 AD-392937 csascua(Uhd)GfcAfUfUfnuaaagunaat96 732 usUfsaacu(Tgn)uaaaauGfcAfuagugsasu 733 AUCACUAUGCAUUUUAAAGUUAA 734 AD-392938 csusgca(Uhd)UfnUfAfCfuguacagauuL96 735 asAfsucug(Tgn)acaguaAfaAfugcagsusc 736 GACUGCAUUUUACUGUACAGAUU 737 AD-392939 ususcug(Chd)UfaUfAfUfungugauauaL96 738 usAfsuauc(Agn)caaauaUfaGfcagaasgsc 739 GCUUCUGCUAUAUUUGUGAUAUA 740 AD-392940 uscsugc(Uhd)AfuAfUfUfugugauauauL96 741 asUfsauau(Cgn)acaaauAfuAfgcagasasg 742 CUUCUGCUAUAUUUGUGAUAUAG 743 AD-392941 ascsgua(Uhd)CfuUfUfGfggucuuugauL96 744 asUfscaaa(Ggn)acccaaAfgAfuacgusgsg 745 CCACGUAUCUUUGGGUCUUUGAU 746 AD-392942 uscsuuu(Ghd)GfgUfCfUfungauaaagaL96 747 usCfsuuna(Tgn)caaagaCfcCfaaagasusa 748 UAUCUUUGGGUCUUUGAUAAAGA 749 AD-392943 csusuug(Ghd)GfuCfUfUfugauaaagaaL96 750 usUfscuuu(Agn)ucaaagAfcCfcaaagsasu 751 AUCUUUGGGUCUUUGAUAAAGAA 752 AD-392944 ususggg(Uhd)CfnUfUfGfauaaagaaaaT96 753 usUfsuucu(Tgn)uaucaaAfgAfcccaasasg 754 CUUUGGGUCUUUGAUAAAGAAAA 755 AD-392945 asgsaau(Chd)CfcUfGfUfucauuguaauL96 756 asUfsuaca(Agn)ugaacaGfgGfauucususu 757 AAAGAAUCCCUGUUCAUUGUAAG 758 AD-392946 gsasauc(Chd)CfuGfUfUfcauuguaaguL96 759 asCfsuuac(Agn)augaacAfgGfgauucsusu 760 AAGAAUCCCUGUUCAUUGUAAGC 761 AD-392947 gsusuca(Uhd)UfgUfAfAfgcacuuuuauL96 762 asUfsaaaa(Ggn)ugcuuaCfaAfugaacsasg 763 CUGUUCAUUGUAAGCACUUUUAC 764 AD-392948 ususaug(Ahd)CfaUfGfAfucgcuuucuaL96 765 usAfsgaaa(Ggn)cgaucaUfgUfcauaasgsc 766 GCUUAUGACAUGAUCGCUUUCUA 767 AD-392949 asusgac(Ahd)UfgAfUfCfgcuuucuacaL96 768 usGfsuaga(Agn)agcgauCfaUfgucausasa 769 UUAUGACAUGAUCGCUUUCUACA 770 AD-392950 csasuga(Uhd)CfgCfUfUfucuacacuguL96 771 asCfsagug(Tgn)agaaagCfgAfucaugsusc 772 GACAUGAUCGCUUUCUACACUGU 773 AD-392951 csusuuc(Uhd)AfcAfCfUfguanuacauaL96 774 usAfsugua(Agn)uacaguGfuAfgaaagscsg 775 CGCUUUCUACACUGUAUUACAUA 776 AD-392952 gsasuuc(Ahd)AfuUTUfUfcuuuaaccauL96 777 asUfsgguu(Agn)aagaaaAfuUfgaaucsusg 778 CAGAUUCAAUUUUCUUUAACCAG 779 AD-392953 ususucu(Uhd)UfaAfCfCfagucugaaguL96 780 asCfsuuca(Ggn)acugguUfaAfagaaasasu 781 AUUUUCUUUAACCAGUCUGAAGU 782 AD-392954 ususuaa(Ghd)AfuGfUfGfucuucaauuuL96 783 asAfsauug(Agn)agacacAfuCfuuaaasasg 784 CUUUUAAGAUGUGUCUUCAAUUu 785 AD-392955 ususaag(Ahd)UfgUfGfUfcuucaauuugL96 786 csAfsaauu(Ggn)aagacaCfaUfcuuaasasa 787 UUUUAAGAUGUGUCUUCAAUUUG 788 AD-392956 asgsaug(Uhd)GfuCfUfUfcaauuuguauL96 789 asUfsacaa(Agn)ungaagAfcAfcaucususa 790 UAAGAUGUGUCUUCAAUUUGUAU 791 AD-392957 usgsucu(Uhd)CfaAfUfUfuguauaaaauL96 792 asUfsuuua(Tgn)acaaauUfgAfagacascsa 793 UGUGUCUUCAAUUUGUAUAAAAU 794 AD-392958 csusuca(Ahd)UfuUfGfUfauaaaaugguL96 795 asCfscauu(Tgn)uauacaAfaUfugaagsasc 796 GUCUUCAAUUUGUAUAAAAUGGU 797 AD-392959 asusggu(Ghd)UfuUTUfCfauguaaauaaL96 798 usUfsauuu(Agn)caugaaAfaCfaccaususu 799 AAAUGGUGUUUUCAUGUAAAUAA 800 AD-392960 ususcuu(Uhd)UfaAfGfAfugugucuucaL96 801 usGfsaaga(Cgn)acaucuUfaAfaagaasgsg 802 CCUUCUUUUAAGAUGUGUCUUCA 803 AD-392961 usgsuau(Uhd)CfuAfUfCfucucuuuacaL96 804 usGfsuaaa(Ggn)agagaUAfgAfauacasusu 805 AAUGUAUUCUAUCUCUCUUUACA 806 AD-392962 gsuscuc(Uhd)AfuAfCfUfacauuauuaaL96 807 usUfsaaua(Agn)uguaguAfuAfgagacscsa 808 UGGUCUCUAUACUACAUUAUUAA 809 AD-392963 uscsucu(Ahd)UfaCfUfAfcauuauuaauL96 810 asUfsuaau(Agn)auguagUfaUfagagascsc 811 GGUCUCUAUACUACAUUAUUAAU 812 AD-392964 csuscua(Uhd)AfcUfAfCfauuauuaauuL96 813 asAfsunaa(Tgn)aauguaGfuAfuagagsasc 814 GUCUCUAUACUACAUUAUUAAUG 815 AD-392965 csusuca(Ahd)UfnAfCfCfaagaauucuuL96 816 asAfsgaau(Tgn)cuugguAfaUfugaagsasc 817 GUCUUCAAUUACCAAGAAUUCUC 818 AD-392966 cscsaca(Chd)AfuCfAfGfuaauguauuuL96 819 asAfsauac(Agn)uuacugAfuGfuguggsasu 820 AUCCACACAUCAGUAAUGUAUUC 821 AD-392967 csusauc(Uhd)CfuCfUfUfuacauuuuguL96 822 asCfsaaaa(Tgn)guaaagAfgAfgauagsasa 823 UUCUAUCUCUCUUUACAUUUUGG 824 AD-392968 gsgsucu(Chd)UfaUfAfCfuacauuanuaL96 825 usAfsauaa(Tgn)guaguaUfaGfagaccsasa 826 UUGGUCUCUAUACUACAUUAUUA 827 AD-392969 uscsuau(Ahd)CfuAfCfAfuuauuaauguL96 828 asCfsauua(Agn)uaauguAfgUfauagasgsa 829 UCUCUAUACUACAUUAuuAAuGG 830 AD-392970 gsgsucu(Uhd)CfaAfUfUfaccaagaauuL96 831 asAfsuucu(Tgn)gguaauUfgAfagaccsasg 832 CUGGUCUUCAAUUACCAAGAAUU 833 AD-392971 csasgga(Uhd)AfuGfAfAfguucaucauuL96 834 asAfsugau(Ggn)aacuucAfuAfuccugsasg 835 CUCAGGAUAUGAAGUUCAUCAUC 836 AD-392972 ascsaca(Uhd)CfaGfUfAfauguauucuaL96 837 usAfsgaau(Agn)cauuacUfgAfugugusgsg 838 CCACACAUCAGUAAUGUAUUCUA 839 AD-392973 csusaua(Chd)UfaCfAfUfuauuaaugguL96 840 asCfscauu(Agn)auaaugUfaGfuauagsasg 841 CUCUAUACUACAUUAUUAAUGGG 842 AD-392974 cscscgu(Uhd)UfuAfUfGfauuuacucauL96 843 asUfsgagu(Agn)aaucauAfaAfacgggsusu 844 AACCCGUUUUAUGAUUUACUCAU 845 AD-392975 ususcca(Uhd)GfaCfUfGfcauuuuacuuL96 846 asAfsguaa(Agn)augcagUfcAfuggaasasa 847 UUUUCCAUGACUGCAUUUUACUG 848 AD-392976 uscsuuc(Ahd)AfnUfAfCfcaagaanucuL96 849 asGfsaauu(Cgn)uugguaAfuUfgaagascsc 850 GGUCUUCAAUUACCAAGAAUUCU 851 AD-392977 csusgaa(Ghd)UfuUfCfAfuuuaugauauL96 852 asUfsauca(Tgn)aaaugaAfaCfuucagsasc 853 GUCUGAAGUUUCAUUUAUGAUAC 854
TABLE-US-00022 TABLE 2B Human APP Modified Sequences, No “L96” Linker Duplex Name Sense Sequence (5′ to 3′) SEQ ID NO Antisense Sequence (5′ to 3′) SEQ ID NO mRNA target sequence SEQ ID NO AD-392699 gsasccc(Ahd)AfuUfAfAfguccuacuuu 33 asAfsagua(Ggn)gacuuaAfuUfgggucsasc 34 GUGACCCAAUUAAGUCCUACUUU 35 AD-392700 uscsucc(Uhd)GfaUfUfAfuuuaucacau 36 asUfsguga(Tgn)aaauaaUfcAfggagasgsa 37 UCUCUCCUGAUUAUUUAUCACAU 38 AD-392703 cscsuga(Ahd)CfuUfGfAfauuaauccau 39 asUfsggau(Tgn)aauucaAfgUfucaggscsa 40 UGCCUGAACUUGAAUUAAUCCAC 41 AD-392704 gsgsuuc(Ahd)AfaCfAfAfaggugcaauu 42 asAfsuugc(Agn)ccuuugUfuUfgaaccscsa 43 UGGGUUCAAACAAAGGUGCAAUC 44 AD-392705 ususuac(Uhd)CfaUfUfAfucgccuuuug 45 csAfsaaag(Ggn)cgauaaUfgAfguaaasusc 46 GAUUUACUCAUUAUCGCCUUUUG 47 AD-392707 asusuua(Ghd)CfuGfUfAfucaaacuagu 48 asCfsuagu(Tgn)ugauacAfgCfuaaaususc 49 GAAUUUAGCUGUAUCAAACUAGU 50 AD-392708 asgsuau(Uhd)CfcUfUfUfccugaucacu 51 asGfsugau(Cgn)aggaaaGfgAfauacususa 52 UAAGUAUUCCUUUCCUGAUCACU 53 AD-392709 gscsuua(Uhd)GfaCfAfUfgaucgcuuuc 54 gsAfsaagc(Ggn)aucaugUfcAfuaagcsasa 55 UUGCUUAUGACAUGAUCGCUUUC 56 AD-392710 asasgau(Ghd)UfgUfCfUfucaauuugua 57 usAfscaaa(Tgn)ugaagaCfaCfaucuusasa 58 UUAAGAUGUGUCUUCAAUUUGUA 59 AD-392711 gscsaaa(Ahd)CfcAfUfUfgcuucacuau 60 asufsagug(Agn)agcaauGfgUfuuugcsusg 61 CAGCAAAACCAUUGCUUCACUAC 62 AD-392712 asusuna(Chd)UfcAfUfUfaucgccuuuu 63 asAfsaagg(Cgn)gauaauGfaGfuaaauscsa 64 UGAUUUACUCAUUAUCGCCUUUU 65 AD-392713 usascuc(Ahd)UfuAfUfCfgccuuuugau 66 asUfscaaa(Agn)ggcgauAfaUfgaguasasa 67 UUUACUCAUUAUCGCCUUUUGAC 68 AD-392714 usgsccu(Ghd)AfaCfUfUfgaauuaaucu 69 asGfsauua(Agn)uucaagUfuCfaggcasusc 70 GAUGCCUGAACUUGAAUUAAUCC 71 AD-392715 csusgaa(Chd)UfuGfAfAfuuaauccaca 72 usGfsugga(Tgn)uaauucAfaGfuucagsgsc 73 GCCUGAACUUGAAUUAAUCCACA 74 AD-392716 ususuag(Chd)UfgUfAfUfcaaacuaguu 75 asAfscuag(Tgn)uugauaCfaGfcuaaasusu 76 AAUUUAGCUGUAUCAAACUAGUG 77 AD-392717 gsasaua(Ghd)AfuUfCfUfcuccugauua 78 usAfsauca(Ggn)gagagaAfuCfuauucsasu 79 AUGAAUAGAUUCUCUCCUGAUUA 80 AD-392718 uscscug(Ahd)UfuAfUfUfuaucacauau 81 asUfsaugu(Ggn)auaaauAfaUfcaggasgsa 82 UCUCCUGAUUAUUUAUCACAUAG 83 AD-392719 cscscaa(Uhd)UfaAfGfUfccuacuuuau 84 asufsaaag(Tgn)aggacuUfaAfuugggsusc 85 GACCCAAUUAAGUCCUACUUUAC 86 AD-392720 csasuau(Ghd)CfuUfUfAfagaaucgauu 87 asAfsucga(Tgn)ucuuaaAfgCfauaugsusa 88 UACAUAUGCUUUAAGAAUCGAUG 89 AD-392721 csusucu(Chd)UfuGfCfCfuaaguauucu 90 asGfsaana(Cgn)uuaggcAfaGfagaagscsa 91 UGCUUCUCUUGCCUAAGUAUUCC 92 AD-392722 csasuug(Chd)UfuAfUfGfacaugaucgu 93 asCfsgauc(Agn)ugucauAfaGfcaaugsasu 94 AUCAUUGCUUAUGACAUGAUCGC 95 AD-392723 csusuau(Ghd)AfcAfUfGfaucgcuuncu 96 asGfsaaag(Cgn)gaucauGfuCfauaagscsa 97 UGCUUAUGACAUGAUCGCUUUCU 98 AD-392724 usasuga(Chd)AfuGfAfUfcgcuuncuau 99 asufsagaa(Agn)gcgaucAfuGfucauasasg 100 CUUAUGACAUGAUCGCUUUCUAC 101 AD-392725 usgsaca(Uhd)GfaUfCfGfcuuucuacau 102 asUfsguag(Agn)aagcgaUfcAfugucasusa 103 UAUGACAUGAUCGCUUUCUACAC 104 AD-392726 gsasucg(Chd)UfuUfCfUfacacuguauu 105 asAfsuaca(Ggn)uguagaAfaGfcgaucsasu 106 AUGAUCGCUUUCUACACUGUAUU 107 AD-392727 asasaac(Uhd)AfuUfCfAfgaugacgucu 108 asGfsacgu(Cgn)aucugaAfuAfguuuusgsc 109 GCAAAACUAUUCAGAUGACGUCU 110 AD-392728 asasacu(Ahd)UfuCfAfGfaugacgucuu 111 asAfsgacg(Tgn)caucugAfaUfaguuususg 112 CAAAACUAUUCAGAUGACGUCUU 113 AD-392729 ascsgaa(Ahd)AfuCfCfAfaccuacaagu 114 asCfsuugu(Agn)gguuggAfuUfuucgusasg 115 CUACGAAAAUCCAACCUACAAGU 116 AD-392730 usgscuu(Chd)UfcUfUfGfccuaaguauu 117 asAfsuacu(Tgn)aggcaaGfaGfaagcasgsc 118 GCUGCUUCUCUUGCCUAAGUAUU 119 AD-392731 usgscuu(Ahd)UfgAfCfAfugaucgcuuu 120 asAfsagcg(Agn)ucauguCfaUfaagcasasu 121 AUUGCUUAUGACAUGAUCGCUUU 122 AD-392732 usgsauc(Ghd)CfuUTUfCfuacacuguau 123 asufsacag(Tgn)guagaaAfgCfgaucasusg 124 CAUGAUCGCUUUCUACACUGUAU 125 AD-392733 asuscgc(Uhd)UfuCfUfAfcacuguauua 126 usAfsauac(Agn)guguagAfaAfgcgauscsa 127 UGAUCGCUUUCUACACUGUAUUA 128 AD-392734 uscsuuu(Ghd)AfcCfGfAfaacgaaaacu 129 asGfsuuuu(Cgn)guuucgGfuCfaaagasusg 130 CAUCUUUGACCGAAACGAAAACC 131 AD-392735 gsusucu(Ghd)GfgUfUfGfacaaanauca 132 usGfsauau(Tgn)ugucaaCfcCfagaacscsu 133 AGGUUCUGGGUUGACAAAUAUCA 134 AD-392736 usgsggu(Uhd)GfaCfAfAfauaucaagau 135 asUfscuug(Agn)uauuugUfcAfacccasgsa 136 UCUGGGUUGACAAAUAUCAAGAC 137 AD-392737 gsasuuu(Ahd)CfuCfAfUfuaucgccuuu 138 asAfsaggc(Ggn)auaaugAfgUfaaaucsasu 139 AUGAUUUACUCAUUAUCGCCUUU 140 AD-392738 uscscuu(Uhd)CfcUfGfAfucacuaugca 141 usGfscaua(Ggn)ugaucaGfgAfaaggasasu 142 AUUCCUUUCCUGAUCACUAUGCA 143 AD-392739 csusuuc(Chd)UfgAfUfCfacuaugcauu 144 asAfsugca(Tgn)agugauCfaGfgaaagsgsa 145 UCCUUUCCUGAUCACUAUGCAUU 146 AD-392740 asusugc(Uhd)UfaUfGfAfcaugaucgcu 147 asGfscgau(Cgn)augucaUfaAfgcaausgsa 148 UCAUUGCUUAUGACAUGAUCGCU 149 AD-392741 uscsuuu(Ahd)AfcCfAfGfucugaaguuu 150 asAfsacuu(Cgn)agacugGfuUfaaagasasa 151 UUUCUUUAACCAGUCUGAAGUUU 152 AD-392742 gsgsauc(Ahd)GfuUfAfCfggaaacgauu 153 asAfsucgu(Tgn)uccguaAfcUfgauccsusu 154 AAGGAUCAGUUACGGAAACGAUG 155 AD-392743 csusggg(Uhd)UfgAfCfAfaanaucaaga 156 usCfsuuga(Tgn)auuuguCfaAfcccagsasa 157 UUCUGGGUUGACAAAUAUCAAGA 158 AD-392744 asusgau(Uhd)UfaCfUfCfauuaucgccu 159 asGfsgcga(Tgn)aaugagUfaAfaucausasa 160 UUAUGAUUUACUCAUUAUCGCCU 161 AD-392745 csusugu(Ghd)GfuUfUfGfugacccaauu 162 asAfsuugg(Ggn)ucacaaAfcCfacaagsasa 163 UUCUUGUGGUUUGUGACCCAAUU 164 AD-392746 asusaug(Chd)UfnUfAfAfgaaucgaugu 165 asCfsaucg(Agn)uucuuaAfaGfcauausgsu 166 ACAUAUGCUUUAAGAAUCGAUGG 167 AD-392747 ususugu(Chd)CfaCfGfUfaucuuugggu 168 asCfsccaa(Agn)gauacgUfgGfacaaasasa 169 UUUUUGUCCACGUAUCUUUGGGU 170 AD-392748 uscsauu(Ghd)UfaAfGfCfacuuuuacgu 171 ascfsguaa(Agn)agugcuUfaCfaaugasasc 172 GUUCAUUGUAAGCACUUUUACGG 173 AD-392749 gsgscca(Ahd)CfaUfGfAfuuagugaacu 174 asGfsuuca(Cgn)uaaucaUfgUfuggccsasa 175 UUGGCCAACAUGAUUAGUGAACC 176 AD-392750 gsasuca(Ghd)UfuAfCfGfgaaacgaugu 177 asCfsaucg(Tgn)uuccguAfaCfugaucscsu 178 AGGAUCAGUUACGGAAACGAUGC 179 AD-392751 usascgg(Ahd)AfaCfGfAfugcucucauu 180 asAfsugag(Agn)gcaucgUfnUfccguasasc 181 GUUACGGAAACGAUGCUCUCAUG 182 AD-392752 usgsauu(Uhd)AfcUfCfAfuuaucgccuu 183 asAfsggcg(Agn)uaaugaGfuAfaaucasusa 184 UAUGAUUUACUCAUUAUCGCCUU 185 AD-392753 gsusaga(Uhd)GfcCfUfGfaacuugaauu 186 asAfsuuca(Agn)guucagGfcAfucuacsusu 187 AAGUAGAUGCCUGAACUUGAAUU 188 AD-392754 ususgua(Uhd)AfuUfAfUfucuugugguu 189 asAfsccac(Agn)agaauaAfuAfuacaascsu 190 AGUUGUAUAUUAUUCUUGUGGUU 191 AD-392755 asusugc(Uhd)GfcUfUfCfugcuauauuu 192 asAfsauau(Agn)gcagaaGfcAfgcaauscsu 193 AGAUUGCUGCUUCUGCUAUAUUU 194 AD-392756 usgscua(Uhd)AfuUfUfGfugauauagga 195 uscfscuau(Agn)ucacaaAfuAfuagcasgsa 196 UCUGCUAUAUUUGUGAUAUAGGA 197 AD-392757 ascsaca(Uhd)UfaGfGfCfauugagacuu 198 asAfsgucu(Cgn)aaugccUfaAfugugusgsc 199 GCACACAUUAGGCAUUGAGACUU 200 AD-392758 asasgaa(Uhd)CfcCfUfGfuucauuguaa 201 usUfsacaa(Tgn)gaacagGfgAfuucuususu 202 AAAAGAAUCCCUGUUCAUUGUAA 203 AD-392759 csasuug(Uhd)AfaGfCfAfcuuuuacggu 204 asCfscgua(Agn)aagugcUfuAfcaaugsasa 205 UUCAUUGUAAGCACUUUUACGGG 206 AD-392760 ususgcu(Uhd)AfuGfAfCfaugaucgcuu 207 asAfsgcga(Tgn)caugucAfuAfagcaasusg 208 CAUUGCUUAUGACAUGAUCGCUU 209 AD-392761 csasagg(Ahd)UfcAfGfUfuacggaaacu 210 asGfsuuuc(Cgn)guaacuGfaUfccuugsgsu 211 ACCAAGGAUCAGUUACGGAAACG 212 AD-392762 asgsguu(Chd)UfgGfGfUfugacaaauau 213 asUfsauuu(Ggn)ucaaccCfaGfaaccusgsg 214 CCAGGUUCUGGGUUGACAAAUAU 215 AD-392763 asasgau(Ghd)UfgGfGfUfucaaacaaau 216 asUfsuugu(Tgn)ugaaccCfaCfaucuuscsu 217 AGAAGAUGUGGGUUCAAACAAAG 218 AD-392764 csusgaa(Ghd)AfaGfAfAfacaguacaca 219 usGfsugua(Cgn)uguuucUfuCfuucagscsa 220 UGCUGAAGAAGAAACAGUACACA 221 AD-392765 asasguu(Ghd)GfaCfAfGfcaaaaccauu 222 asAfsuggu(Tgn)uugcugUfcCfaacuuscsa 223 UGAAGUUGGACAGCAAAACCAUU 224 AD-392766 asuscgg(Uhd)GfuCfCfAfuuuauagaau 225 asUfsucua(Tgn)aaauggAfcAfccgausgsg 226 CCAUCGGUGUCCAUUUAUAGAAU 227 AD-392767 uscsggu(Ghd)UfcCfAfUfuuauagaaua 228 usAfsuucu(Agn)uaaaugGfaCfaccgasusg 229 CAUCGGUGUCCAUUUAUAGAAUA 230 AD-392768 gscsugu(Ahd)AfcAfCfAfaguagaugcu 231 asGfscauc(Tgn)acuuguGfuUfacagcsasc 232 GUGCUGUAACACAAGUAGAUGCC 233 AD-392769 asasgua(Ghd)AfuGfCfCfugaacuugaa 234 usufscaag(Tgn)ucaggcAfuCfuacuusgsu 235 ACAAGUAGAUGCCUGAACUUGAA 236 AD-392770 ususgug(Ghd)UfuUfGfUfgacccaauua 237 usAfsauug(Ggn)gucacaAfaCfcacaasgsa 238 UCUUGUGGUUUGUGACCCAAUUA 239 AD-392771 gsusuug(Uhd)GfaCfCfCfaauuaagucu 240 asGfsacuu(Agn)auugggUfcAfcaaacscsa 241 UGGUUUGUGACCCAAUUAAGUCC 242 AD-392772 gsusgac(Chd)CfaAfUfUfaaguccuacu 243 asGfsuagg(Agn)cuuaauUfgGfgucacsasa 244 UUGUGACCCAAUUAAGUCCUACU 245 AD-392773 usasugc(Uhd)UfuAfAfGfaaucgauggu 246 asCfscauc(Ggn)auucuuAfaAfgcauasusg 247 CAUAUGCUUUAAGAAUCGAUGGG 248 AD-392774 ususugu(Ghd)AfuAfUfAfggaauuaaga 249 usCfsunaa(Tgn)uccuauAfuCfacaaasusa 250 UAUUUGUGAUAUAGGAAUUAAGA 251 AD-392775 asasaga(Ahd)UfcCfCfUfguucauugua 252 usAfscaau(Ggn)aacaggGfaUfucuuususc 253 GAAAAGAAUCCCUGUUCAUUGUA 254 AD-392776 usgsauu(Ghd)UfaCfAfGfaaucaungcu 255 asGfscaau(Ggn)auucugUfaCfaaucasusc 256 GAUGAUUGUACAGAAUCAUUGCU 257 AD-392777 usgsccu(Ghd)GfaCfAfAfacccuucuuu 258 asAfsagaa(Ggn)gguuugUfcCfaggcasusg 259 CAUGCCUGGACAAACCCUUCUUU 260 AD-392778 gsasgca(Ahd)AfaCfUfAfuncagaugau 261 asUfscauc(Tgn)gaauagUfuUfugcucsusu 262 AAGAGCAAAACUAUUCAGAUGAC 263 AD-392779 asgsuga(Ahd)CfcAfAfGfgaucaguuau 264 asUfsaacu(Ggn)auccuuGfgUfucacusasa 265 UUAGUGAACCAAGGAUCAGUUAC 266 AD-392780 usgsaac(Chd)AfaGfGfAfucaguuacgu 267 asCfsguaa(Cgn)ugauccUfuGfguucascsu 268 AGUGAACCAAGGAUCAGUUACGG 269 AD-392781 csasguu(Ahd)CfgGfAfAfacgaugcucu 270 asGfsagca(Tgn)cguuucCfgUfaacugsasu 271 AUCAGUUACGGAAACGAUGCUCU 272 AD-392782 asgsaag(Ahd)UfgUfGfGfguucaaacaa 273 usufsguuu(Ggn)aacccaCfaUfcuucusgsc 274 GCAGAAGAUGUGGGUUCAAACAA 275 AD-392783 cscsucu(Ghd)AfaGfUfUfggacagcaaa 276 usUfsugcu(Ggn)uccaacUfuCfagaggscsu 277 AGCCUCUGAAGUUGGACAGCAAA 278 AD-392784 ususaug(Ahd)UfuUfAfCfucauuaucgu 279 ascfsgaua(Agn)ugaguaAfaUfcauaasasa 280 UUUUAUGAUUUACUCAUUAUCGC 281 AD-392785 ascsagc(Uhd)GfuGfCfUfguaacacaau 282 asUfsugug(Tgn)uacagcAfcAfgcuguscsa 283 UGACAGCUGUGCUGUAACACAAG 284 AD-392786 usgsuga(Chd)CfcAfAfUfuaaguccuau 285 asUfsagga(Cgn)uuaauuGfgGfucacasasa 286 UUUGUGACCCAAUUAAGUCCUAC 287 AD-392787 usascau(Ahd)UfgCfUfUfuaagaaucga 288 usCfsgauu(Cgn)uuaaagCfaUfauguasasa 289 UUUACAUAUGCUUUAAGAAUCGA 290 AD-392788 gsusaaa(Uhd)AfaAfUfAfcauucuugga 291 usCfscaag(Agn)auguauUfuAfuuuacsasu 292 AUGUAAAUAAAUACAUUCUUGGA 293 AD-392789 uscsagu(Uhd)AfcGfGfAfaacgaugcuu 294 asAfsgcau(Cgn)guuuccGfuAfacugasusc 295 GAUCAGUUACGGAAACGAUGCUC 296 AD-392790 csusucc(Chd)GfuGfAfAfuggagaguuu 297 asAfsacuc(Tgn)ccauucAfcGfggaagsgsa 298 UCCUUCCCGUGAAUGGAGAGUUC 299 AD-392791 asgsuug(Ghd)AfcAfGfCfaaaaccauuu 300 asAfsaugg(Tgn)uuugcuGfuCfcaacususc 301 GAAGUUGGACAGCAAAACCAUUG 302 AD-392792 cscscau(Chd)GfgUfGfUfccauuuauau 303 asUfsauaa(Agn)uggacaCfcGfaugggsusa 304 UACCCAUCGGUGUCCAUUUAUAG 305 AD-392793 usgscac(Ahd)CfaUfUfAfggcauugaga 306 usCfsucaa(Tgn)gccuaaUfgUfgugcascsa 307 UGUGCACACAUUAGGCAUUGAGA 308 AD-392794 cscsaac(Ahd)UfgAfUfUfagugaaccaa 309 usufsgguu(Cgn)acuaauCfaUfguuggscsc 310 GGCCAACAUGAUUAGUGAACCAA 311 AD-392795 asusgau(Uhd)AfgUfGfAfaccaaggauu 312 asAfsuccu(Tgn)gguucaCfuAfaucausgsu 313 ACAUGAUUAGUGAACCAAGGAUC 314 AD-392796 ususagu(Ghd)AfaCfCfAfaggaucaguu 315 asAfscuga(Tgn)ccuuggUfuCfacuaasusc 316 GAUUAGUGAACCAAGGAUCAGUU 317 AD-392797 asascca(Ahd)GfgAfUfCfaguuacggaa 318 usUfsccgu(Agn)acugauCfcUfugguuscsa 319 UGAACCAAGGAUCAGUUACGGAA 320 AD-392798 gsusuac(Ghd)GfaAfAfCfgaugcucuca 321 usGfsagag(Cgn)aucguuUfcCfguaacsusg 322 CAGUUACGGAAACGAUGCUCUCA 323 AD-392799 gsasugc(Ahd)GfaAfUfUfccgacaugau 324 asUfscaug(Tgn)cggaauUfcUfgcaucscsa 325 UGGAUGCAGAAUUCCGACAUGAC 326 AD-392800 ususgga(Chd)AfgCfAfAfaaccauugcu 327 asGfscaau(Ggn)guuuuuCfuGfuccaascsu 328 AGUUGGACAGCAAAACCAUUGCU 329 AD-392801 asasacc(Ahd)UfuGfCfUfucacuaccca 330 usGfsggua(Ggn)ugaagcAfaUfgguuususg 331 CAAAACCAUUGCUUCACUACCCA 332 AD-392802 cscsauc(Ghd)GfuGfUfCfcauuuauaga 333 uscfsuaua(Agn)auggacAfcCfgauggsgsu 334 ACCCAUCGGUGUCCAUUUAUAGA 335 AD-392803 ususauc(Ghd)CfcUfUfUfugacagcugu 336 asCfsagcu(Ggn)ucaaaaGfgCfgauaasusg 337 CAUUAUCGCCUUUUGACAGCUGU 338 AD-392804 asuscgc(Chd)UfuUTUfGfacagcugugu 339 asCfsacag(Cgn)ugucaaAfaGfgcgausasa 340 UUAUCGCCUUUUGACAGCUGUGC 341 AD-392805 ascsaca(Ahd)GfuAfGfAfugccugaacu 342 asGfsuuca(Ggn)gcaucuAfcUfugugususa 343 UAACACAAGUAGAUGCCUGAACU 344 AD-392806 usgsugg(Uhd)UfuGfUfGfacccaauuaa 345 usUfsaauu(Ggn)ggucacAfaAfccacasasg 346 CUUGUGGUUUGUGACCCAAUUAA 347 AD-392807 gsgsgau(Ghd)CfnUfCfAfugugaacguu 348 asAfscguu(Cgn)acaugaAfgCfaucccscsc 349 GGGGGAUGCUUCAUGUGAACGUG 350 AD-392808 usgsugc(Ahd)CfaCfAfUfuaggcauuga 351 usCfsaaug(Cgn)cuaaugUfgUfgcacasusa 352 UAUGUGCACACAUUAGGCAUUGA 353 AD-392809 asasaug(Ghd)AfaGfUfGfgcaauauaau 354 asUfsuaua(Tgn)ugccacUfuCfcauuususc 355 GAAAAUGGAAGUGGCAAUAUAAG 356 AD-392810 asusgga(Ahd)GfuGfGfCfaauauaaggu 357 asCfscuua(Tgn)auugccAfcUfuccaususu 358 AAAUGGAAGUGGCAAUAUAAGGG 359 AD-392811 usgsccc(Ghd)AfgAfUfCfcuguuaaacu 360 asGfsuuua(Agn)caggauCfuCfgggcasasg 361 CUUGCCCGAGAUCCUGUUAAACU 362 AD-392812 asusuag(Uhd)GfaAfCfCfaaggaucagu 363 asCfsugau(Cgn)cuugguUfcAfcuaauscsa 364 UGAUUAGUGAACCAAGGAUCAGU 365 AD-392813 gsasacc(Ahd)AfgGfAfUfcagunacgga 366 usCfscgua(Agn)cugaucCfnUfgguucsasc 367 GUGAACCAAGGAUCAGUUACGGA 368 AD-392814 asasgga(Uhd)CfaGfUfUfacggaaacga 369 usCfsguuu(Cgn)cguaacUfgAfuccuusgsg 370 CCAAGGAUCAGUUACGGAAACGA 371 AD-392815 csasaca(Chd)AfgAfAfAfacgaaguuga 372 usCfsaacu(Tgn)cguuuuCfuGfuguugsgsc 373 GCCAACACAGAAAACGAAGUUGA 374 AD-392816 usgsggu(Uhd)CfaAfAfCfaaaggugcaa 375 usUfsgcac(Cgn)uuuguuUfgAfacccascsa 376 UGUGGGUUCAAACAAAGGUGCAA 377 AD-392817 csasgug(Ahd)UfcGfUfCfaucaccuugu 378 ascfsaagg(Tgn)gaugacGfaUfcacugsusc 379 GACAGUGAUCGUCAUCACCUUGG 380 AD-392818 ascscca(Uhd)CfgGfUfGfuccauunaua 381 usAfsuaaa(Tgn)ggacacCfgAfugggusasg 382 CUACCCAUCGGUGUCCAUUUAUA 383 AD-392819 uscsuug(Uhd)GfgUfUfUfgugacccaau 384 asufsuggg(Tga)cacaaaCfcAfcaagasasu 385 AUUCUUGUGGUUUGUGACCCAAU 386 AD-392820 ususugu(Ghd)AfcCfCfAfauuaaguccu 387 asGfsgacu(Tgn)aauuggGfuCfacaaascsc 388 GGUUUGUGACCCAAUUAAGUCCU 389 AD-392821 ususgug(Ahd)CfcCfAfAfuuaaguccua 390 usAfsggac(Tgh)uaauugGfgUfcacaasasc 391 GUUUGUGACCCAAUUAAGUCCUA 392 AD-392822 ususcag(Ahd)UfgAfCfGfucuuggccaa 393 usUfsggcc(Agn)agacguCfaUfcugaasusa 394 UAUUCAGAUGACGUCUUGGCCAA 395 AD-392823 asuscag(Uhd)UfaCfGfGfaaacgangcn 396 asGfscanc(Ggn)uuuccgUfaAfcugauscsc 397 GGAUCAGUUACGGAAACGAUGCU 398 AD-392824 usgsgan(Ghd)CfaGfAfAfnuccgacann 399 asAfsuguc(Ggn)gaauucUfgCfauccasusc 400 GAUGGAUGCAGAAUUCCGACAUG 401 AD-392825 gsuscca(Ahd)GfaUfGfCfagcagaacgu 402 asCfsgunc(Tgn)gcugcaUfcUfuggacsasg 403 CUGUCCAAGAUGCAGCAGAACGG 404 AD-392826 usasccc(Ahd)UfcGfGfUfguccauuuau 405 asUfsaaan(Ggn)gacaccGfaUfggguasgsu 406 ACUACCCAUCGGUGUCCAUUUAU 407 AD-392827 ususuug(Ahd)CfaGfCfUfgugcuguaau 408 asUfsuaca(Ggn)cacagcUfgUfcaaaasgsg 409 CCUUUUGACAGCUGUGCUGUAAC 410 AD-392828 ususgac(Ahd)GfcUfGfUfgcuguaacau 411 asufsguna(Cgn)agcacaGfcUfgucaasasa 412 UUUUGACAGCUGUGCUGUAACAC 413 AD-392829 asgscug(Uhd)GfcUfGfUfaacacaagua 414 usAfscung(Tgn)gunacaGfcAfcagcusgsu 415 ACAGCUGUGCUGUAACACAAGUA 416 AD-392830 gsusunn(Ahd)UfgUfGfCfacacannagu 417 asCfsuaan(Ggn)ugugcaCfaUfaaaacsasg 418 CUGUUUUAUGUGCACACAUUAGG 419 AD-392831 ususcaa(Uhd)UfaCfCfAfagaanucucu 420 asGfsagaa(Tgn)ucuuggUfaAfungaasgsa 421 UCUUCAAUUACCAAGAAUUCUCC 422 AD-392832 csascac(Ahd)UfcAfGfUfaauguauucu 423 asGfsaana(Cgn)auuacuGfaUfgugugsgsa 424 UCCACACAUCAGUAAUGUAUUCU 425 AD-392833 usgsguc(Uhd)CfnAfUfAfcuacauuauu 426 asAfsuaan(Ggn)uaguanAfgAfgaccasasa 427 UUUGGUCUCUAUACUACAUUAUU 428 AD-392834 ascsccg(Uhd)UfnUfAfUfgauuuacuca 429 usGfsagua(Agn)aucauaAfaAfcgggususu 430 AAACCCGUUUUAUGAUUUACUCA 431 AD-392835 usascga(Ahd)AfaUfCfCfaaccuacaau 432 asUfsugua(Ggn)guuggaUfnUfncguasgsc 433 GCUACGAAAAUCCAACCUACAAG 434 AD-392836 uscscac(Ahd)CfaUfCfAfguaauguauu 435 asAfsuaca(Tgn)uacugaUfgUfguggasusu 436 AAUCCACACAUCAGUAAUGUAUU 437 AD-392837 csusggu(Chd)Ufnq1AfAfuuaccaagaa 438 usUfscung(Ggn)uaauugAfaGfaccagscsa 439 UGCUGGUCUUCAAUUACCAAGAA 440 AD-392838 gscscan(Chd)UfnUfGfAfccgaaacgaa 441 usUfscgun(Tgn)cggucaAfaGfauggcsasu 442 AUGCCAUCUUUGACCGAAACGAA 443 AD-392839 cscsanc(Uhd)UfuGfAfCfcgaaacgaaa 444 usUfsucgu(Tgn)ucggucAfaAfgauggscsa 445 UGCCAUCUUUGACCGAAACGAAA 446 AD-392840 csusacg(Ahd)AfaAfUfCfcaaccuacaa 447 usUfsguag(Ggn)uuggauUfuUfcguagscsc 448 GGCUACGAAAAUCCAACCUACAA 449 AD-392841 asuscca(Chd)AfcAfUfCfaguaanguau 450 asUfsacau(Tgn)acugauGfuGfuggaususa 451 UAAUCCACACAUCAGUAAUGUAU 452 AD-392842 csasugc(Chd)AfuCfUfUfugaccgaaau 453 asUfsuncg(Ggn)ucaaagAfuGfgcaugsasg 454 CUCAUGCCAUCUUUGACCGAAAC 455 AD-392843 gsgscua(Chd)GfaAfAfAfuccaaccuau 456 asUfsaggu(Tgn)ggauuuUfcGfuagccsgsu 457 ACGGCUACGAAAAUCCAACCUAC 458 AD-392844 uscsaug(Chd)CfaUfCfUfungaccgaaa 459 usufsucgg(Tgn)caaagaUfgGfcaugasgsa 460 UCUCAUGCCAUCUUUGACCGAAA 461 AD-392845 csasgua(Chd)AfcAfUfCfcauucaucau 462 asUfsgaug(Agn)auggauGfuGfuacugsusu 463 AACAGUACACAUCCAUUCAUCAU 464 AD-392846 asascgg(Chd)UfaCfGfAfaaauccaacu 465 asGfsuugg(Agn)uuuucgUfaGfccguuscsu 466 AGAACGGCUACGAAAAUCCAACC 467 AD-392847 gsasagu(Uhd)UfcAfUfUfuaugauacaa 468 usUfsguau(Cgn)auaaauGfaAfacuucsasg 469 CUGAAGUUUCAUUUAUGAUACAA 470 AD-392848 asusgcc(Ahd)UfcUfUfUfgaccgaaacu 471 asGfsuuuc(Ggn)gucaaaGfaUfggcausgsa 472 UCAUGCCAUCUUUGACCGAAACC 473 AD-392849 gsasacg(Ghd)CfnAfCfGfaaaauccaau 474 asUfsugga(Tgn)uuucguAfgCfcguucsusg 475 CAGAACGGCUACGAAAAUCCAAC 476 AD-392850 uscsuuc(Ghd)UfgCfCfUfguuuuauguu 477 asAfscaua(Agn)aacaggCfaCfgaagasasa 478 UUUCUUCGUGCCUGUUUUAUGUG 479 AD-392851 ususgcc(Chd)GfaGfAfUfccuguuaaau 480 asUfsunaa(Cgn)aggaucUfcGfggcaasgsa 481 UCUUGCCCGAGAUCCUGUUAAAC 482 AD-392852 csusucg(Uhd)GfcCfUfGfuuuuaugugu 483 asCfsacau(Agn)aaacagGfcAfcgaagsasa 484 UUCUUCGUGCCUGUUUUAUGUGC 485 AD-392853 gscsgcc(Ahd)UfgUfCfCfcaaaguuuau 486 asUfsaaac(Tgn)uugggaCfaUfggcgcsusg 487 CAGCGCCAUGUCCCAAAGUUUAC 488 AD-392854 gsuscau(Ahd)GfcGfAfCfagugaucguu 489 asAfscgau(Cgn)acugucGfcUfaugacsasa 490 UUGUCAUAGCGACAGUGAUCGUC 491 AD-392855 gscsuac(Ghd)AfaAfAfUfccaaccuaca 492 usGfsuagg(Tgn)uggauuUfuCfguagcscsg 493 CGGCUACGAAAAUCCAACCUACA 494 AD-392856 asusagc(Ghd)AfcAfGfUfgaucgucauu 495 asAfsugac(Ggn)aucacuGfuCfgcuausgsa 496 UCAUAGCGACAGUGAUCGUCAUC 497 AD-392857 csusugc(Chd)CfgAfGfAfuccuguuaaa 498 usufsuaac(Agn)ggaucuCfgGfgcaagsasg 499 CUCUUGCCCGAGAUCCUGUUAAA 500 AD-392858 csuscau(Ghd)CfcAfUfCfuuugaccgaa 501 usUfscggu(Cgn)aaagauGfgCfaugagsasg 502 CUCUCAUGCCAUCUUUGACCGAA 503 AD-392859 ascsggc(Uhd)AfcGfAfAfaauccaaccu 504 asGfsguug(Ggn)auuuucGfuAfgccgususc 505 GAACGGCUACGAAAAUCCAACCU 506 AD-392860 csasuca(Ahd)AfaAfUfUfgguguucuuu 507 asAfsagaa(Cgn)accaauUfuUfugaugsasu 508 AUCAUCAAAAAUUGGUGUUCUUU 509 AD-392861 asuscca(Ahd)CfcUfAfCfaaguucuuug 510 csAfsaaga(Agn)cuuguaGfgUfuggaususu 511 AAAUCCAACCUACAAGUUCUUUG 512 AD-392862 csgscuu(Uhd)CfuAfCfAfcuguauuaca 513 usGfsuaau(Agn)caguguAfgAfaagcgsasu 514 AUCGCUUUCUACACUGUAUUACA 515 AD-392863 uscscaa(Chd)CfuAfCfAfaguucuuuga 516 usCfsaaag(Agn)acuuguAfgGfuuggasusu 517 AAUCCAACCUACAAGUUCUUUGA 518 AD-392864 uscsucu(Chd)UfuUfAfCfauuuuggucu 519 asGfsacca(Agn)aauguaAfaGfagagasusa 520 UAUCUCUCUUUACAUUUUGGUCU 521 AD-392865 csuscuc(Uhd)UfuAfCfAfuuuuggucuu 522 asAfsgacc(Agn)aaauguAfaAfgagagsasu 523 AUCUCUCUUUACAUUUUGGUCUC 524 AD-392866 ususugu(Ghd)UfaCfUfGfuaaagaauuu 525 asAfsauuc(Tgn)uuacagUfaCfacaaasasc 526 GUUUUGUGUACUGUAAAGAAUUU 527 AD-392867 gsusgua(Chd)UfgUfAfAfagaauuuagu 528 asCfsuaaa(Tgn)ucuuuaCfaGfuacacsasa 529 UUGUGUACUGUAAAGAAUUUAGC 530 AD-392868 ascscca(Ahd)UfuAfAfGfuccuacuuua 531 usAfsaagu(Agn)ggacuuAfaUfuggguscsa 532 UGACCCAAUUAAGUCCUACUUUA 533 AD-392869 uscscua(Chd)UfuUfAfCfauaugcuuua 534 usAfsaagc(Agn)nauguaAfaGfuaggascsu 535 AGUCCUACUUUACAUAUGCUUUA 536 AD-392870 cscsuac(Uhd)UfuAfCfAfuaugcuuuaa 537 usUfsaaag(Cgn)auauguAfaAfguaggsasc 538 GUCCUACUUUACAUAUGCUUUAA 539 AD-392871 ususcua(Chd)AfcUfGfUfauuacauaaa 540 usUfsuaug(Tgn)aanacaGfuGfuagaasasg 541 CUUUCUACACUGUAUUACAUAAA 542 AD-392872 uscsuac(Ahd)CfuGfUfAfuuacauaaau 543 asUfsuuau(Ggn)uaauacAfgUfguagasasa 544 UUUCUACACUGUAUUACAUAAAU 545 AD-392873 csusuuu(Ahd)AfgAfUfGfugucuucaau 546 asufsugaa(Ggn)acacauCfuUfaaaagsasa 547 UUCUUUUAAGAUGUGUCUUCAAU 548 AD-392874 asusgug(Uhd)CfuUfCfAfauuuguauaa 549 usUfsauac(Agn)aauugaAfgAfcacauscsu 550 AGAUGUGUCUUCAAUUUGUAUAA 551 AD-392875 asuscaa(Ahd)AfaUfUfGfguguucuuug 552 csAfsaaga(Agn)caccaaUfuUfuugausgsa 553 UCAUCAAAAAUUGGUGUUCUUUG 554 AD-392876 asasauc(Chd)AfaCfCfUfacaaguucuu 555 asAfsgaac(Tgn)uguaggUfuGfgauuususc 556 GAAAAUCCAACCUACAAGUUCUU 557 AD-392877 gsusacu(Ghd)UfaAfAfGfaauuuagcuu 558 asAfsgcua(Agn)auucuuUfaCfaguacsasc 559 GUGUACUGUAAAGAAUUUAGCUG 560 AD-392878 csusccu(Ghd)AfuUfAfUfuuaucacaua 561 usAfsugug(Agn)uaaauaAfuCfaggagsasg 562 CUCUCCUGAUUAUUUAUCACAUA 563 AD-392879 gscscag(Uhd)UfgUfAfUfauuauucuuu 564 asAfsagaa(Tgn)aauauaCfaAfcuggcsusa 565 UAGCCAGUUGUAUAUUAUUCUUG 566 AD-392880 asasuua(Ahd)GfuCfCfUfacuuuacaua 567 usAfsugua(Agn)aguaggAfcUfuaauusgsg 568 CCAAUUAAGUCCUACUUUACAUA 569 AD-392881 csusugc(Chd)UfaAfGfUfauuccuuncu 570 asGfsaaag(Ggn)aauacuUfaGfgcaagsasg 571 CUCUUGCCUAAGUAUUCCUUUCC 572 AD-392882 asusucc(Uhd)UfuCfCfUfgaucacuauu 573 asAfsuagu(Ggn)aucaggAfaAfggaausasc 574 GUAUUCCUUUCCUGAUCACUAUG 575 AD-392883 ascsuau(Ghd)CfaUfUfUfuaaaguuaaa 576 usUfsuaac(Tgn)uuaaaaUfgCfauagusgsa 577 UCACUAUGCAUUUUAAAGUUAAA 578 AD-392884 usgsuuc(Ahd)UfuGfUfAfagcacuuuua 579 usAfsaaag(Tgn)gcunacAfaUfgaacasgsg 580 CCUGUUCAUUGUAAGCACUUUUA 581 AD-392885 asasuua(Chd)CfaAfGfAfauucuccaaa 582 usUfsugga(Ggn)aanucuUfgGfuaauusgsa 583 UCAAUUACCAAGAAUUCUCCAAA 584 AD-392886 ususacc(Ahd)AfgAfAfUfucuccaaaau 585 asUfsuuug(Ggn)agaauuCfuUfgguaasusu 586 AAUUACCAAGAAUUCUCCAAAAC 587 AD-392887 uscsauu(Ghd)CfuUfAfUfgacaugaucu 588 asGfsauca(Tgn)gucauaAfgCfaaugasusu 589 AAUCAUUGCUUAUGACAUGAUCG 590 AD-392889 ususuua(Ahd)GfaUfGfUfgucuucaauu 591 asAfsuuga(Agn)gacacaUfcUfuaaaasgsa 592 UCUUUUAAGAUGUGUCUUCAAUU 593 AD-392890 asusccu(Ghd)UfnAfAfAfcuuccuacaa 594 usufsguag(Ggn)aaguuuAfaCfaggauscsu 595 AGAUCCUGUUAAACUUCCUACAA 596 AD-392891 ascsuau(Uhd)CfaGfAfUfgacgucuugu 597 asCfsaaga(Cgn)gucaucUfgAfauagususu 598 AAACUAUUCAGAUGACGUCUUGG 599 AD-392892 gsusuca(Uhd)CfaUfCfAfaaaauugguu 600 asAfsccaa(Tgn)uuuugaUfgAfugaacsusu 601 AAGUUCAUCAUCAAAAAUUGGUG 602 AD-392893 usasucu(Chd)UfcUfUfUfacauuuuggu 603 asCfscaaa(Agn)uguaaaGfaGfagauasgsa 604 UCUAUCUCUCUUUACAUUUUGGU 605 AD-392894 asuscuc(Uhd)CfuUfUfAfcauuuugguu 606 asAfsccaa(Agn)auguaaAfgAfgagausasg 607 CUAUCUCUCUUUACAUUUUGGUC 608 AD-392895 usgsugu(Ahd)CfuGfUfAfaagaauuuau 609 asufsaaau(Tgn)cuuuacAfgUfacacasasa 610 UUUGUGUACUGUAAAGAAUUUAG 611 AD-392896 csusacu(Uhd)UfaCfAfUfaugcuuuaau 612 asUfsuaaa(Ggn)cauaugUfaAfaguagsgsa 613 UCCUACUUUACAUAUGCUUUAAG 614 AD-392897 usgsccu(Ahd)AfgUfAfUfuccuuuccuu 615 asAfsggaa(Agn)ggaauaCfuUfaggcasasg 616 CUUGCCUAAGUAUUCCUUUCCUG 617 AD-392898 asasgua(Uhd)UfcCfUfUfuccugaucau 618 asUfsganc(Agn)ggaaagGfaAfuacuusasg 619 CUAAGUAUUCCUUUCCUGAUCAC 620 AD-392899 gsusauu(Chd)CfuUfUfCfcugaucacua 621 usAfsguga(Tgn)caggaaAfgGfaauacsusu 622 AAGUAUUCCUUUCCUGAUCACUA 623 AD-392900 ususccu(Ghd)AfuCfAfCfuaugcauuuu 624 asAfsaaug(Cgn)auagugAfuCfaggaasasg 625 CUUUCCUGAUCACUAUGCAUUUU 626 AD-392901 csusgau(Chd)AfcUfAfUfgcauuuuaaa 627 usUfsuaaa(Agn)ugcauaGfuGfaucagsgsa 628 UCCUGAUCACUAUGCAUUUUAAA 629 AD-392902 csascgu(Ahd)UfcUfUfUfgggucuuuga 630 usCfsaaag(Agn)cccaaaGfaUfacgugsgsa 631 UCCACGUAUCUUUGGGUCUUUGA 632 AD-392903 usgsggu(Chd)UfuUfGfAfuaaagaaaau 633 asUfsuuuc(Tgn)uuaucaAfaGfacccasasa 634 UUUGGGUCUUUGAUAAAGAAAAG 635 AD-392904 uscsaau(Uhd)AfcCfAfAfgaauucucca 636 usGfsgaga(Agn)uucuugGfuAfauugasasg 637 CUUCAAUUACCAAGAAUUCUCCA 638 AD-392906 uscsgcu(Uhd)UfcUfAfCfacuguauuau 639 asUfsaaua(Cgn)aguguaGfaAfagcgasusc 640 GAUCGCUUUCUACACUGUAUUAC 641 AD-392907 asusuuu(Chd)UfuUfAfAfccagucugaa 642 usUfscaga(Cgn)ugguuaAfaGfaaaaususg 643 CAAUUUUCUUUAACCAGUCUGAA 644 AD-392908 csusuua(Ahd)CfcAfGfUfcugaaguuuc 645 gsAfsaacu(Tgn)cagacuGfgUfuaaagsasa 646 UUCUUUAACCAGUCUGAAGUUUC 647 AD-392909 usasaga(Uhd)GfuGfUfCfuucaauuugu 648 asCfsaaau(Tgn)gaagacAfcAfucuuasasa 649 UUUAAGAUGUGUCUUCAAUUUGU 650 AD-392910 gsasucc(Uhd)GfuUfAfAfacuuccuaca 651 usGfsuagg(Agn)aguuuaAfcAfggaucsusc 652 GAGAUCCUGUUAAACUUCCUACA 653 AD-392911 csusgcu(Uhd)CfaGfAfAfagagcaaaau 654 asUfsuuug(Cgn)ucuuucUfgAfagcagscsu 655 AGCUGCUUCAGAAAGAGCAAAAC 656 AD-392912 csasgaa(Ahd)GfaGfCfAfaaacuanuca 657 usGfsaaua(Ggn)uuuugcUfcUfuucugsasa 658 UUCAGAAAGAGCAAAACUAUUCA 659 AD-392913 usasuga(Ahd)GfuUfCfAfucaucaaaaa 660 usUfsuuug(Agn)ugaugaAfcUfucauasusc 661 GAUAUGAAGUUCAUCAUCAAAAA 662 AD-392914 csasuca(Uhd)CfaAfAfAfauugguguuu 663 asAfsacac(Cgn)aauuuuUfgAfugaugsasa 664 UUCAUCAUCAAAAAUUGGUGUUC 665 AD-392915 uscsaaa(Ahd)AfuUfGfGfuguucuuugu 666 asCfsaaag(Agn)acaccaAfuUfuuugasusg 667 CAUCAAAAAUUGGUGUUCUUUGC 668 AD-392916 asasaau(Chd)CfaAfCfCfuacaaguucu 669 asGfsaacu(Tgn)guagguUfgGfauuuuscsg 670 CGAAAAUCCAACCUACAAGUUCU 671 AD-392917 cscsaac(Chd)UfaCfAfAfguucuuugau 672 asUfscaaa(Ggn)aacuugUfaGfguuggsasu 673 AUCCAACCUACAAGUUCUUUGAG 674 AD-392918 ascsuca(Uhd)UfaUfCfGfccuuuugaca 675 usGfsucaa(Agn)aggcgaUfaAfugagusasa 676 UUACUCAUUAUCGCCUUUUGACA 677 AD-392919 csuscau(Uhd)AfuCfGfCfcuuuugacau 678 asUfsguca(Agn)aaggcgAfuAfaugagsusa 679 UACUCAUUAUCGCCUUUUGACAG 680 AD-392920 usgsugc(Uhd)GfuAfAfCfacaaguagau 681 asUfscuac(Tgn)uguguuAfcAfgcacasgsc 682 GCUGUGCUGUAACACAAGUAGAU 683 AD-392921 gsusgcu(Ghd)UfaAfCfAfcaaguagauu 684 asAfsucua(Cgn)uuguguUfaCfagcacsasg 685 CUGUGCUGUAACACAAGUAGAUG 686 AD-392922 uscsuuu(Ahd)CfaUfUfUfuggucucuau 687 asUfsagag(Agn)ccaaaaUfgUfaaagasgsa 688 UCUCUUUACAUUUUGGUCUCUAU 689 AD-392923 asusggg(Uhd)UfuUfGfUfguacuguaaa 690 usUfsuaca(Ggn)uacacaAfaAfcccaususa 691 UAAUGGGUUUUGUGUACUGUAAA 692 AD-392924 ususgug(Uhd)AfcUfGfUfaaagaauuua 693 usAfsaauu(Cgn)uuuacaGfnAfcacaasasa 694 UUUUGUGUACUGUAAAGAAUUUA 695 AD-392925 gscsugu(Ahd)UfcAfAfAfcuagugcauu 696 asAfsugca(Cgn)uaguuuGfaUfacagcsusa 697 UAGCUGUAUCAAACUAGUGCAUC 698 AD-392926 csusagu(Ghd)CfaUfGfAfauagauucuu 699 asAfsgaau(Cgn)uauucaUfgCfacnagsusu 700 AACUAGUGCAUGAAUAGAUUCUC 701 AD-392927 usasgug(Chd)AfuGfAfAfuagauucucu 702 asGfsagaa(Tgn)cuauucAfuGfcacuasgsu 703 ACUAGUGCAUGAAUAGAUUCUCU 704 AD-392928 csuscuc(Chd)UfgAfUfUfauuuaucaca 705 usGfsugau(Agn)aauaauCfaGfgagagsasa 706 UUCUCUCCUGAUUAUUUAUCACA 707 AD-392929 cscsuga(Uhd)UfaUfUfUfaucacauagu 708 asCfsuaug(Tgn)gauaaaUfaAfucaggsasg 709 CUCCUGAUUAUUUAUCACAUAGC 710 AD-392930 usasagu(Chd)CfuAfCfUfuuacauaugu 711 asCfsauau(Ggn)uaaaguAfgGfacuuasasu 712 AUUAAGUCCUACUUUACAUAUGC 713 AD-392931 asgsucc(Uhd)AfcUfUfUfacauaugcuu 714 asAfsgcau(Agn)uguaaaGfnAfggacususa 715 UAAGUCCUACUUUACAUAUGCUU 716 AD-392932 gsusccu(Ahd)CfuUfUfAfcauaugcuuu 717 asAfsagca(Tgn)auguaaAfgUfaggacsusu 718 AAGUCCUACUUUACAUAUGCUUU 719 AD-392933 ususcuc(Uhd)UfgCfCfUfaaguauuccu 720 asGfsgaau(Agn)cuuaggCfaAfgagaasgsc 721 GCUUCUCUUGCCUAAGUAUUCCU 722 AD-392934 csuscuu(Ghd)CfcUfAfAfguauuccuuu 723 asAfsagga(Agn)uacuuaGfgCfaagagsasa 724 UUCUCUUGCCUAAGUAUUCCUUU 725 AD-392935 usasuuc(Chd)UfuUfCfCfugaucacuau 726 asUfsagug(Agn)ucaggaAfaGfgaauascsu 727 AGUAUUCCUUUCCUGAUCACUAU 728 AD-392936 ususucc(Uhd)GfaUfCfAfcuaugcauuu 729 asAfsaugc(Agn)uagugaUfcAfggaaasgsg 730 CCUUUCCUGAUCACUAUGCAUUU 731 AD-392937 csascua(Uhd)GfcAfUfUfuuaaaguuaa 732 usUfsaacu(Tgn)uaaaauGfcAfuagugsasu 733 AUCACUAUGCAUUUUAAAGUUAA 734 AD-392938 csusgca(Uhd)UfuUfAfCfuguacagauu 735 asAfsucug(Tgn)acaguaAfaAfugcagsusc 736 GACUGCAUUUUACUGUACAGAUU 737 AD-392939 ususcug(Chd)UfaUfAfUfuugugauaua 738 usAfsuauc(Agn)caaauaUfaGfcagaasgsc 739 GCUUCUGCUAUAUUUGUGAUAUA 740 AD-392940 uscsugc(Uhd)AfuAfUfUfugugauauau 741 asUfsauau(Cgn)acaaauAfuAfgcagasasg 742 CUUCUGCUAUAUUUGUGAUAUAG 743 AD-392941 ascsgua(Uhd)CfuUfUfGfggucuuugau 744 asUfscaaa(Ggn)acccaaAfgAfuacgusgsg 745 CCACGUAUCUUUGGGUCUUUGAU 746 AD-392942 uscsuuu(Ghd)GfgUfCfUfuugauaaaga 747 uscfsuUUa(Tgn)cauagaCfcCfaaagasusa 748 UAUCUUUGGGUCUUUGAUAAAGA 749 AD-392943 csusuug(Ghd)GfuCfUfUfugauaaagaa 750 usufscuuu(Agn)ucaaagAfcCfcaaagsasu 751 AUCUUUGGGUCUUUGAUAAAGAA 752 AD-392944 ususggg(Uhd)CfnUfUfGfauaaagaaaa 753 usUfsuucu(Tgn)uaucaaAfgAfcccaasasg 754 CUUUGGGUCUUUGAUAAAGAAAA 755 AD-392945 asgsaau(Chd)CfcUfGfUfucauuguaau 756 asUfsuaca(Agn)ugaacaGfgGfauucususu 757 AAAGAAUCCCUGUUCAUUGUAAG 758 AD-392946 gsasauc(Chd)CfuGfUfUfcauuguaagu 759 asCfsunac(Agn)augaacAfgGfgauucsusu 760 AAGAAUCCCUGUUCAUUGUAAGC 761 AD-392947 gsusuca(Uhd)UfgUfAfAfgcacuunuau 762 asUfsaaaa(Ggn)ugcuuaCfaAfugaacsasg 703 CUGUUCAUUGUAAGCACUUUUAC 764 AD-392948 ususaug(Ahd)CfaUfGfAfucgcuuucua 765 usAfsgaaa(Ggn)cgaucaUfgUfcauaasgsc 766 GCUUAUGACAUGAUCGCUUUCUA 767 AD-392949 asusgac(Ahd)UfgAfUfCfgcuuucuaca 768 usGfsuaga(Agn)agcgauCfaUfgucausasa 709 UUAUGACAUGAUCGCUUUCUACA 770 AD-392950 csasuga(Uhd)CfgCfUfUfucuacacugu 771 ascfsagug(Tgu)agaaagCfgAfucaugsusc 772 GACAUGAUCGCUUUCUACACUGU 773 AD-392951 csusuuc(Uhd)AfcAfCfUfguanuacaua 774 usAfsugua(Agn)uacaguGfuAfgaaagscsg 775 CGCUUUCUACACUGUAUUACAUA 776 AD-392952 gsasuuc(Ahd)AfuUfUfUfcuunaaccau 777 asUfsgguu(Agn)aagaaaAfuUfgaaucsusg 778 CAGAUUCAAUUUUCUUUAACCAG 779 AD-392953 ususucu(Uhd)UfaAfCfCfagucugaagu 780 asCfsuuca(Ggn)acugguUfaAfagaaasasu 781 AUUUUCUUUAACCAGUCUGAAGU 782 AD-392954 ususuaa(Ghd)AfuGfUfGfucuucaauuu 783 asAfsauug(Agn)agacacAfuCfnuaaasasg 784 CUUUUAAGAUGUGUCUUCAAUUU 785 AD-392955 ususaag(Ahd)UfgUfGfUfcuucaauuug 786 csAfsaauu(Ggn)aagacaCfaUfcuuaasasa 787 UUUUAAGAUGUGUCUUCAAUUUG 788 AD-392956 asgsaug(Uhd)GfuCfUfUfcaauuuguau 789 asUfsacaa(Agn)uugaagAfcAfcaucususa 790 UAAGAUGUGUCUUCAAUUUGUAU 791 AD-392957 usgsucu(Uhd)CfaAfUfUfuguauaaaau 792 asufsuuua(Tgn)acaaauUfgAfagacascsa 793 UGUGUCUUCAAUUUGUAUAAAAU 794 AD-392958 csusuca(Ahd)UfnUfGfUfauaaaauggu 795 asCfscauu(Tgn)uauacaAfaUfugaagsasc 796 GUCUUCAAUUUGUAUAAAAUGGU 797 AD-392959 asusggu(Ghd)UfnUfUfCfauguaaauaa 798 usufsauuu(Agn)caugaaAfaCfaccaususu 799 AAAUGGUGUUUUCAUGUAAAUAA 800 AD-392960 ususcuu(Uhd)UfaAfGfAfugugucuuca 801 usGfsaaga(Cgn)acaucuUfaAfaagaasgsg 802 CCUUCUUUUAAGAUGUGUCUUCA 803 AD-392961 usgsuau(Uhd)CfuAfUfCfucucuuuaca 804 usGfsuaaa(Ggn)agagauAfgAfauacasusu 805 AAUGUAUUCUAUCUCUCUUUACA 806 AD-392962 gsuscuc(Uhd)AfuAfCfUfacauuauuaa 807 usUfsaaua(Agn)uguaguAfuAfgagacscsa 808 UGGUCUCUAUACUACAUUAUUAA 809 AD-392963 uscsucu(Ahd)UfaCfUfAfcauuauuaau 810 asUfsuaau(Agn)auguagUfaUfagagascsc 811 GGUCUCUAUACUACAUUAUUAAU 812 AD-392964 csuscua(Uhd)AfcUfAfCfauuauuaauu 813 asAfsuuaa(Tgn)aauguaGfuAfuagagsasc 814 GUCUCUAUACUACAUUAUUAAUG 815 AD-392965 csusuca(Ahd)UfuAfCfCfaagaauucuu 816 asAfsgaau(Tgn)cuugguAfaUfugaagsasc 817 GUCUUCAAUUACCAAGAAUUCUC 818 AD-392966 cscsaca(Chd)AfuCfAfGfuaauguauuu 819 asAfsauac(Agn)uuacugAfuGfuguggsasu 820 AUCCACACAUCAGUAAUGUAUUC 821 AD-392967 csusauc(Uhd)CfuCfUfUfuacauuuugu 822 asCfsaaaa(Tgn)guaaagAfgAfgauagsasa 823 UUCUAUCUCUCUUUACAUUUUGG 824 AD-392968 gsgsucu(Chd)UfaUfAfCfuacauuauua 825 usAfsauaa(Tgn)guaguaUfaGfagaccsasa 826 UUGGUCUCUAUACUACAUUAUUA 827 AD-392969 uscsuau(Ahd)CfuAfCfAfuuauuaaugu 828 asCfsauua(Agn)uaauguAfgUfauagasgsa 829 UCUCUAUACUACAUUAUUAAUGG 830 AD-392970 gsgsucu(Uhd)CfaAfUfUfaccaagaauu 831 asAfsuucu(Tgn)gguaauUfgAfagaccsasg 832 CUGGUCUUCAAUUACCAAGAAUU 833 AD-392971 csasgga(Uhd)AfuGfAfAfguucaucauu 834 asAfsugau(Ggn)aacuucAfuAfuccugsasg 835 CUCAGGAUAUGAAGUUCAUCAUC 836 AD-392972 ascsaca(Uhd)CfaGfUfAfauguauucua 837 usAfsgaau(Agn)cauuacUfgAfugugusgsg 838 CCACACAUCAGUAAUGUAUUCUA 839 AD-392973 csusaua(Chd)UfaCfAfUfuauuaauggu 840 asCfscauu(Agn)auaaugUfaGfuauagsasg 841 CUCUAUACUACAUUAUUAAUGGG 842 AD-392974 cscscgu(Uhd)UfuAfUfGfauuuacucau 843 asUfsgagu(Agn)aaucauAfaAfacgggsusu 844 AACCCGUUUUAUGAUUUACUCAU 845 AD-392975 ususcca(Uhd)GfaCfUfGfcauuuuacuu 846 asAfsguaa(Agn)augcagUfcAfuggaasasa 847 UUUUCCAUGACUGCAUUUUACUG 848 AD-392976 uscsuuc(Ahd)AfuUfAfCfcaagaauucu 849 asGfsaauu(Cgn)uugguaAfuUfgaagascsc 850 GGUCUUCAAUUACCAAGAAUUCU 851 AD-392977 csusgaa(Ghd)UfuUfCfAfuuuaugauau 852 asUfsauca(Tgn)aaaugaAfaGfuncagsasc 853 GUCUGAAGUUUCAUUUAUGAUAC 854
TABLE-US-00023 TABLE 3 APP Unmodified Sequences, Human NM_000484 Targeting Anti- Sense sense Se- Position Se- Position quence SEQ in quence SEQ in Duplex (5′ to ID NM_ (5′ to ID NM_ Name 3′) NO 000484 3′) NO 000484 AD- GCG 855 1228- AUA 856 1226- 392853 CCA 1248 AAC 1248 UGU TUU CCC GGG AAA ACA GUU UGG UAU CGC UG AD- CUU 857 1269- UUU 858 1267- 392857 GCC 1289 AAC 1289 CGA AGG GAU AUC CCU UCG GUU GGC AAA AAG AG AD- UUG 859 1270- AUU 860 1268- 392851 CCC 1290 UAA 1290 GAG CAG AUC GAU CUG CUC UUA GGG AAU CAA GA AD- UGC 861 1271- AGU 862 1269- 392811 CCG 1291 UUA 1291 AGA ACA UCC GGA UGU UCU UAA CGG ACU GCA AG AD- GAU 863 1278- UGU 864 1276- 392910 CCU 1298 AGG 1298 GUU AAG AAA UUU CUU AAC CCU AGG ACA AUC UC AD- AUC 865 1279- UUG 866 1277- 392890 CUG 1299 UAG 1299 UUA GAA AAC GUU UUC UAA CUA CAG CAA GAU CU AD- CUG 867 1893- AUU 868 1891- 392911 CUU 1913 UUG 1913 CAG CUC AAA UUU GAG CUG CAA AAG AAU CAG CU AD- CAG 869 1899- UGA 870 1897- 392912 AAA 1919 AUA 1919 GAG GUU CAA UUG AAC CUC UAU UUU UCA CUG AA AD- GAG 871 1905- AUC 872 1903- 392778 CAA 1925 AUC 1925 AAC TGA UAU AUA UCA GUU GAU UUG GAU CUC UU AD- AAA 873 1909- AGA 874 1907- 392727 ACU 1929 CGU 1929 AUU CAU CAG CUG AUG AAU ACG AGU UCU UUU GC AD- AAA 875 1910- AAG 876 1908- 392728 CUA 1930 ACG 1930 UUC TCA AGA UCU UGA GAA CGU UAG CUU UUU UG AD- ACU 877 1912- ACA 878 1910- 392891 AUU 1932 AGA 1932 CAG CGU AUG CAU ACG CUG UCU AAU UGU AGU UU AD- UUC 879 1916- UUG 880 1914- 392822 AGA 1936 GCC 1936 UGA AAG CGU ACG CUU UCA GGC UCU CAA GAA UA AD- GGC 881 1931- AGU 882 1929- 392749 CAA 1951 UCA 1951 CAU CUA GAU AUC UAG AUG UGA UUG ACU GCC AA AD- CCA 883 1933- UUG 884 1931- 392794 ACA 1953 GUU 1953 UGA CAC UUA UAA GUG UCA AAC UGU CAA UGG CC AD- AUG 885 1938- AAU 886 1936- 392795 AUU 1958 CCU 1958 AGU TGG GAA UUC CCA ACU AGG AAU AUU CAU GU AD- AUU 887 1941- ACU 888 1939- 392812 AGU 1961 GAU 1961 GAA CCU CCA UGG AGG UUC AUC ACU AGU AAU CA AD- UUA 889 1942- AAC 890 1940- 392796 GUG 1962 UGA 1962 AAC TCC CAA UUG GGA GUU UCA CAC GUU UAA UC AD- AGU 891 1944- AUA 892 1942- 392779 GAA 1964 ACU 1964 CCA GAU AGG CCU AUC UGG AGU UUC UAU ACU AA AD- UGA 893 1946- ACG 894 1944- 392780 ACC 1966 UAA 1966 AAG CUG GAU AUC CAG CUU UUA GGU CGU UCA CU AD- GAA 895 1947- UCC 896 1945- 392813 CCA 1967 GUA 1967 AGG ACU AUC GAU AGU CCU UAC UGG GGA UUC AC AD- AAC 897 1948- UUC 898 1946- 392797 CAA 1968 CGU 1968 GGA AAC UCA UGA GUU UCC ACG UUG GAA GUU CA AD- CAA 899 1951- AGU 900 1949- 392761 GGA 1971 UUC 1971 UCA CGU GUU AAC ACG UGA GAA UCC ACU UUG GU AD- AAG 901 1952- UCG 902 1950- 392814 GAU 1972 UUU 1972 CAG CCG UUA UAA CGG CUG AAA AUC CGA CUU GG AD- GGA 903 1954- AAU 904 1952- 392742 UCA 1974 CGU 1974 GUU TUC ACG CGU GAA AAC ACG UGA AUU UCC UU AD- GAU 905 1955- ACA 906 1953- 392750 CAG 1975 UCG 1975 UUA TUU CGG CCG AAA UAA CGA CUG UGU AUC CU AD- AUC 907 1956- AGC 908 1954- 392823 AGU 1976 AUC 1976 UAC GUU GGA UCC AAC GUA GAU ACU GCU GAU CC AD- UCA 909 1957- AAG 910 1955- 392789 GUU 1977 CAU 1977 ACG CGU GAA UUC ACG CGU AUG AAC CUU UGA UC AD- CAG 911 1958- AGA 912 1956- 392781 UUA 1978 GCA 1978 CGG TCG AAA UUU CGA CCG UGC UAA UCU CUG AU AD- GUU 913 1960- UGA 914 1958- 392798 ACG 1980 GAG 1980 GAA CAU ACG CGU AUG UUC CUC CGU UCA AAC UG AD- UAC 915 1962- AAU 916 1960- 392751 GGA 1982 GAG 1982 AAC AGC GAU AUC GCU GUU CUC UCC AUU GUA AC AD- CUC 917 1977- UUC 918 1975- 392858 AUG 1997 GGU 1997 CCA CAA UCU AGA UUG UGG ACC CAU GAA GAG AG AD- UCA 919 1978- UUU 920 1976- 392844 UGC 1998 CGG 1998 CAU TCA CUU AAG UGA AUG CCG GCA AAA UGA GA AD- CAU 921 1979- AUU 922 1977- 392842 GCC 1999 UCG 1999 AUC GUC UUU AAA GAC GAU CGA GGC AAU AUG AG AD- AUG 923 1980- AGU 924 1978- 392848 CCA 2000 UUC 2000 UCU GGU UUG CAA ACC AGA GAA UGG ACU CAU GA AD- GCC 925 1982- UUC 926 1980- 392838 AUC 2002 GUU 2002 UUU TCG GAC GUC CGA AAA AAC GAU GAA GGC AU AD- CCA 927 1983- UUU 928 1981- 392839 UCU 2003 CGU 2003 UUG TUC ACC GGU GAA CAA ACG AGA AAA UGG CA AD- UCU 929 1986- AGU 930 1984- 392734 UUG 2006 UUU 2006 ACC CGU GAA UUC ACG GGU AAA CAA ACU AGA UG AD- CUU 931 2019- AAA 932 2017- 392790 CCC 2039 CUC 2039 GUG TCC AAU AUU GGA CAC GAG GGG UUU AAG GA AD- CAA 933 2093- UCA 934 2091- 392815 CAC 2113 ACU 2113 AGA TCG AAA UUU CGA UCU AGU GUG UGA UUG GC AD- AGG 935 2162- AUA 936 2160- 392762 UUC 2182 UUU 2182 UGG GUC GUU AAC GAC CCA AAA GAA UAU CCU GG AD- GUU 937 2164- UGA 938 2162- 392735 CUG 2184 UAU 2184 GGU TUG UGA UCA CAA ACC AUA CAG UCA AAC CU AD- CUG 939 2167- UCU 940 2165- 392743 GGU 2187 UGA 2187 UGA TAU CAA UUG AUA UCA UCA ACC AGA CAG AA AD- UGG 941 2168- AUC 942 2166- 392736 GUU 2188 UUG 2188 GAC AUA AAA UUU UAU GUC CAA AAC GAU CCA GA AD- UGG 943 2212- AAU 944 2210- 392824 AUG 2232 GUC 2232 CAG GGA AAU AUU UCC CUG GAC CAU AUU CCA UC AD- GAU 945 2214- AUC 946 2212- 392799 GCA 2234 AUG 2234 GAA TCG UUC GAA CGA UUC CAU UGC GAU AUC CA AD- CAG 947 2236- AAU 948 2234- 392971 GAU 2256 GAU 2256 AUG GAA AAG CUU UUC CAU AUC AUC AUU CUG AG AD- UAU 949 2241- UUU 950 2239- 392913 GAA 2261 UUG 2261 GUU AUG CAU AUG CAU AAC CAA UUC AAA AUA UC AD- GUU 951 2247- AAC 952 2245- 392892 CAU 2267 CAA 2267 CAU TUU CAA UUG AAA AUG UUG AUG GUU AAC UU AD- CAU 953 2250- AAA 954 2248- 392914 CAU 2270 CAC 2270 CAA CAA AAA UUU UUG UUG GUG AUG UUU AUG AA AD- CAU 955 2253- AAA 956 2251- 392860 CAA 2273 GAA 2273 AAA CAC UUG CAA GUG UUU UUC UUG UUU AUG AU AD- AUC 957 2254- CAA 958 2252- 392875 AAA 2274 AGA 2274 AAU ACA UGG CCA UGU AUU UCU UUU UUG GAU GA AD- UCA 959 2255- ACA 960 2253- 392915 AAA 2275 AAG 2275 AUU AAC GGU ACC GUU AAU CUU UUU UGU UGA UG AD- AGA 961 2276- UUG 962 2274- 392782 AGA 2296 UUU 2296 UGU GAA GGG CCC UUC ACA AAA UCU CAA UCU GC AD- AAG 963 2278- AUU 964 2276- 392763 AUG 2298 UGU 2298 UGG TUG GUU AAC CAA CCA ACA CAU AAU CUU CU AD- UGG 965 2284- UUG 966 2282- 392816 GUU 2304 CAC 2304 CAA CUU ACA UGU AAG UUG GUG AAC CAA CCA CA AD- GGU 967 2286- AAU 968 2284- 392704 UCA 2306 UGC 2306 AAC ACC AAA UUU GGU GUU GCA UGA AUU ACC CA AD- GUC 969 2331- AAC 970 2329- 392854 AUA 2351 GAU 2351 GCG CAC ACA UGU GUG CGC AUC UAU GUU GAC AA AD- AUA 971 2334- AAU 972 2332- 392856 GCG 2354 GAC 2354 ACA GAU GUG CAC AUC UGU GUC CGC AUU UAU GA AD- CAG 973 2341- ACA 974 2339- 392817 UGA 2361 AGG 2361 UCG TGA UCA UGA UCA CGA CCU UCA UGU CUG UC AD- CUG 975 2367- UGU 976 2365- 392764 AAG 2387 GUA 2387 AAG CUG AAA UUU CAG CUU UAC CUU ACA CAG CA AD- CAG 977 2379- AUG 978 2377- 392845 UAC 2399 AUG 2399 ACA AAU UCC GGA AUU UGU CAU GUA CAU CUG UU AD- GUC 979 2447- ACG 980 2445- 392825 CAA 2467 UUC 2467 GAU TGC GCA UGC GCA AUC GAA UUG CGU GAC AG AD- GAA 981 2462- AUU 982 2460- 392849 CGG 2482 GGA 2482 CUA TUU CGA UCG AAA UAG UCC CCG AAU UUC UG AD- AAC 983 2463- AGU 984 2461- 392846 GGC 2483 UGG 2483 UAC AUU GAA UUC AAU GUA CCA GCC ACU GUU CU AD- ACG 985 2464- AGG 986 2462- 392859 GCU 2484 UUG 2484 ACG GAU AAA UUU AUC CGU CAA AGC CCU CGU UC AD- GGC 987 2466- AUA 988 2464- 392843 UAC 2486 GGU 2486 GAA TGG AAU AUU CCA UUC ACC GUA UAU GCC GU AD- GCU 989 2467- UGU 990 2465- 392855 ACG 2487 AGG 2487 AAA TUG AUC GAU CAA UUU CCU CGU ACA AGC CG AD- CUA 991 2468- UUG 992 2466- 392840 CGA 2488 UAG 2488 AAA GUU UCC GGA AAC UUU CUA UCG CAA UAG CC AD- UAC 993 2469- AUU 994 2467- 392835 GAA 2489 GUA 2489 AAU GGU CCA UGG ACC AUU UAC UUC AAU GUA GC AD- ACG 995 2470- ACU 996 2468- 392729 AAA 2490 UGU 2490 AUC AGG CAA UUG CCU GAU ACA UUU AGU CGU AG AD- AAA 997 2473- AGA 998 2471- 392916 AUC 2493 ACU 2493 CAA TGU CCU AGG ACA UUG AGU GAU UCU UUU CG AD- AAA 999 2474- AAG 1000 2472- 392876 UCC 2494 AAC 2494 AAC TUG CUA UAG CAA GUU GUU GGA CUU UUU UC AD- AUC 1001 2476- CAA 1002 2474- 392861 CAA 2496 AGA 2496 CCU ACU ACA UGU AGU AGG UCU UUG UUG GAU UU AD- UCC 1003 2477- UCA 1004 2475- 392863 AAC 2497 AAG 2497 CUA AAC CAA UUG GUU UAG CUU GUU UGA GGA UU AD- CCA 1005 2478- AUC 1006 2476- 392917 ACC 2498 AAA 2498 UAC GAA AAG CUU UUC GUA UUU GGU GAU UGG AU AD- CCU 1007 2530- UUU 1008 2528- 392783 CUG 2550 GCU 2550 AAG GUC UUG CAA GAC CUU AGC CAG AAA AGG CU AD- AAG 1009 2536- AAU 1010 2534- 392765 UUG 2556 GGU 2556 GAC TUU AGC GCU AAA GUC ACC CAA AUU CUU CA AD- AGU 1011 2537- AAA 1012 2535- 392791 UGG 2557 UGG 2557 ACA TUU GCA UGC AAA UGU CCA CCA UUU ACU UC AD- UUG 1013 2539- AGC 1014 2537- 392800 GAC 2559 AAU 2559 AGC GGU AAA UUU ACC GCU AUU GUC GCU CAA CU AD- GCA 1015 2546- AUA 1016 2544- 392711 AAA 2566 GUG 2566 CCA AAG UUG CAA CUU UGG CAC UUU UAU UGC UG AD- AAA 1017 2549- UGG 1018 2547- 392801 CCA 2569 GUA 2569 UUG GUG CUU AAG CAC CAA UAC UGG CCA UUU UG AD- UAC 1019 2564- AUA 1020 2562- 392826 CCA 2584 AAU 2584 UCG GGA GUG CAC UCC CGA AUU UGG UAU GUA GU AD- ACC 1021 2565- UAU 1022 2563- 392818 CAU 2585 AAA 2585 CGG TGG UGU ACA CCA CCG UUU AUG AUA GGU AG AD- CCC 1023 2566- AUA 1024 2564- 392792 AUC 2586 UAA 2586 GGU AUG GUC GAC CAU ACC UUA GAU UAU GGG UA AD- CCA 1025 2567- UCU 1026 2565- 392802 UCG 2587 AUA 2587 GUG AAU UCC GGA AUU CAC UAU CGA AGA UGG GU AD- AUC 1027 2569- AUU 1028 2567- 392766 GGU 2589 CUA 2589 GUC TAA CAU AUG UUA GAC UAG ACC AAU GAU GG AD- UCG 1029 2570- UAU 1030 2568- 392767 GUG 2590 UCU 2590 UCC AUA AUU AAU UAU GGA AGA CAC AUA CGA UG AD- ACC 1031 2607- UGA 1032 2605- 392834 CGU 2627 GUA 2627 UUU AAU AUG CAU AUU AAA UAC ACG UCA GGU UU AD- CCC 1033 2608- AUG 1034 2606- 392974 GUU 2628 AGU 2628 UUA AAA UGA UCA UUU UAA ACU AAC CAU GGG UU AD- UUA 1035 2614- ACG 1036 2612- 392784 UGA 2634 AUA 2634 UUU AUG ACU AGU CAU AAA UAU UCA CGU UAA AA AD- AUG 1037 2616- AGG 1038 2614- 392744 AUU 2636 CGA 2636 UAC TAA UCA UGA UUA GUA UCG AAU CCU CAU AA AD- UGA 1039 2617- AAG 1040 2615- 392752 UUU 2637 GCG 2637 ACU AUA CAU AUG UAU AGU CGC AAA CUU UCA UA AD- GAU 1041 2618- AAA 1042 2616- 392737 UUA 2638 GGC 2638 CUC GAU AUU AAU AUC GAG GCC UAA UUU AUC AU AD- AUU 1043 2619- AAA 1044 2617- 392712 UAC 2639 AGG 2639 UCA CGA UUA UAA UCG UGA CCU GUA UUU AAU CA AD- UUU 1045 2620- CAA 1046 2618- 392705 ACU 2640 AAG 2640 CAU GCG UAU AUA CGC AUG CUU AGU UUG AAA UC AD- UAC 1047 2622- AUC 1048 2620- 392713 UCA 2642 AAA 2642 UUA AGG UCG CGA CCU UAA UUU UGA GAU GUA AA AD- ACU 1049 2623- UGU 1050 2621- 392918 CAU 2643 CAA 2643 UAU AAG CGC GCG CUU AUA UUG AUG ACA AGU AA AD- CUC 1051 2624- AUG 1052 2622- 392919 AUU 2644 UCA 2644 AUC AAA GCC GGC UUU GAU UGA AAU CAU GAG UA AD- UUA 1053 2628- ACA 1054 2626- 392803 UCG 2648 GCU 2648 CCU GUC UUU AAA GAC AGG AGC CGA UGU UAA UG AD- AUC 1055 2630- ACA 1056 2628- 392804 GCC 2650 CAG 2650 UUU CUG UGA UCA CAG AAA CUG GGC UGU GAU AA AD- UUU 1057 2636- AUU 1058 2634- 392827 UGA 2656 ACA 2656 CAG GCA CUG CAG UGC CUG UGU UCA AAU AAA GG AD- UUG 1059 2638- AUG 1060 2636- 392828 ACA 2658 UUA 2658 GCU CAG GUG CAC CUG AGC UAA UGU CAU CAA AA AD- ACA 1061 2641- AUU 1062 2639- 392785 GCU 2661 GUG 2661 GUG TUA CUG CAG UAA CAC CAC AGC AAU UGU CA AD- AGC 1063 2643- UAC 1064 2641- 392829 UGU 2663 UUG 2663 GCU TGU GUA UAC ACA AGC CAA ACA GUA GCU GU AD- UGU 1065 2646- AUC 1066 2644- 392920 GCU 2666 UAC 2666 GUA TUG ACA UGU CAA UAC GUA AGC GAU ACA GC AD- GUG 1067 2647- AAU 1068 2645- 392921 CUG 2667 CUA 2667 UAA CUU CAC GUG AAG UUA UAG CAG AUU CAC AG AD- GCU 1069 2649- AGC 1070 2647- 392768 GUA 2669 AUC 2669 ACA TAC CAA UUG GUA UGU GAU UAC GCU AGC AC AD- ACA 1071 2655- AGU 1072 2653- 392805 CAA 2675 UCA 2675 GUA GGC GAU AUC GCC UAC UGA UUG ACU UGU UA AD- AAG 1073 2659- UUC 1074 2657- 392769 UAG 2679 AAG 2679 AUG TUC CCU AGG GAA CAU CUU CUA GAA CUU GU AD- GUA 1075 2661- AAU 1076 2659- 392753 GAU 2681 UCA 2681 GCC AGU UGA UCA ACU GGC UGA AUC AUU UAC UU AD- UGC 1077 2666- AGA 1078 2664- 392714 CUG 2686 UUA 2686 AAC AUU UUG CAA AAU GUU UAA CAG UCU GCA UC AD- CCU 1079 2668- AUG 1080 2666- 392703 GAA 2688 GAU 2688 CUU TAA GAA UUC UUA AAG AUC UUC CAU AGG CA AD- CUG 1081 2669- UGU 1082 2667- 392715 AAC 2689 GGA 2689 UUG TUA AAU AUU UAA CAA UCC GUU ACA CAG GC AD- AUC 1083 2683- AUA 1084 2681- 392841 CAC 2703 CAU 2703 ACA TAC UCA UGA GUA UGU AUG GUG UAU GAU UA AD- UCC 1085 2684- AAU 1086 2682- 392836 ACA 2704 ACA 2704 CAU TUA CAG CUG UAA AUG UGU UGU AUU GGA UU AD- CCA 1087 2685- AAA 1088 2683- 392966 CAC 2705 UAC 2705 AUC AUU AGU ACU AAU GAU GUA GUG UUU UGG AU AD- CAC 1089 2686- AGA 1090 2684- 392832 ACA 2706 AUA 2706 UCA CAU GUA UAC AUG UGA UAU UGU UCU GUG GA AD- ACA 1091 2687- UAG 1092 2685- 392972 CAU 2707 AAU 2707 CAG ACA UAA UUA UGU CUG AUU AUG CUA UGU GG AD- UGU 1093 2699- UGU 1094 2697- 392961 AUU 2719 AAA 2719 CUA GAG UCU AGA CUC UAG UUU AAU ACA ACA UU AD- CUA 1095 2705- ACA 1096 2703- 392967 UCU 2725 AAA 2725 CUC TGU UUU AAA ACA GAG UUU AGA UGU UAG AA AD- UAU 1097 2706- ACC 1098 2704- 392893 CUC 2726 AAA 2726 UCU AUG UUA UAA CAU AGA UUU GAG GGU AUA GA AD- AUC 1099 2707- AAC 1100 2705- 392894 UCU 2727 CAA 2727 CUU AAU UAC GUA AUU AAG UUG AGA GUU GAU AG AD- UCU 1101 2708- AGA 1102 2706- 392864 CUC 2728 CCA 2728 UUU AAA ACA UGU UUU AAA UGG GAG UCU AGA UA AD- CUC 1103 2709- AAG 1104 2707- 392865 UCU 2729 ACC 2729 UUA AAA CAU AUG UUU UAA GGU AGA CUU GAG AU AD- UCU 1105 2712- AUA 1106 2710- 392922 UUA 2732 GAG 2732 CAU ACC UUU AAA GGU AUG CUC UAA UAU AGA GA AD- UGG 1107 2723- AAU 1108 2721- 392833 UCU 2743 AAU 2743 CUA GUA UAC GUA UAC UAG AUU AGA AUU CCA AA AD- GGU 1109 2724- UAA 1110 2722- 392968 CUC 2744 UAA 2744 UAU TGU ACU AGU ACA AUA UUA GAG UUA ACC AA AD- GUC 1111 2725- UUA 1112 2723- 392962 UCU 2745 AUA 2745 AUA AUG CUA UAG CAU UAU UAU AGA UAA GAC CA AD- UCU 1113 2726- AUU 1114 2724- 392963 CUA 2746 AAU 2746 UAC AAU UAC GUA AUU GUA AUU UAG AAU AGA CC AD- CUC 1115 2727- AAU 1116 2725- 392964 UAU 2747 UAA 2747 ACU TAA ACA UGU UUA AGU UUA AUA AUU GAG AC AD- UCU 1117 2728- ACA 1118 2726- 392969 AUA 2748 UUA 2748 CUA AUA CAU AUG UAU UAG UAA UAU UGU AGA GA AD- CUA 1119 2729- ACC 1120 2727- 392973 UAC 2749 AUU 2749 UAC AAU AUU AAU AUU GUA AAU GUA GGU UAG AG AD- AUG 1121 2745- UUU 1122 2743- 392923 GGU 2765 ACA 2765 UUU GUA GUG CAC UAC AAA UGU ACC AAA CAU UA AD- UUU 1123 2751- AAA 1124 2749- 392866 GUG 2771 UUC 2771 UAC TUU UGU ACA AAA GUA GAA CAC UUU AAA AC AD- UUG 1125 2752- UAA 1126 2750- 392924 UGU 2772 AUU 2772 ACU CUU GUA UAC AAG AGU AAU ACA UUA CAA AA AD- UGU 1127 2753- AUA 1128 2751- 392895 GUA 2773 AAU 2773 CUG TCU UAA UUA AGA CAG AUU UAC UAU ACA AA AD- GUG 1129 2754- ACU 1130 2752- 392867 UAC 2774 AAA 2774 UGU TUC AAA UUU GAA ACA UUU GUA AGU CAC AA AD- GUA 1131 2756- AAG 1132 2754- 392877 CUG 2776 CUA 2776 UAA AAU AGA UCU AUU UUA UAG CAG CUU UAC AC AD- AUU 1133 2768- ACU 1134 2766- 392707 UAG 2788 AGU 2788 CUG TUG UAU AUA CAA CAG ACU CUA AGU AAU UC AD- UUU 1135 2769- AAC 1136 2767- 392716 AGC 2789 UAG 2789 UGU TUU AUC GAU AAA ACA CUA GCU GUU AAA UU AD- GCU 1137 2773- AAU 1138 2771- 392925 GUA 2793 GCA 2793 UCA CUA AAC GUU UAG UGA UGC UAC AUU AGC UA AD- CUA 1139 2784- AAG 1140 2782- 392926 GUG 2804 AAU 2804 CAU CUA GAA UUC UAG AUG AUU CAC CUU UAG UU AD- UAG 1141 2785- AGA 1142 2783- 392927 UGC 2805 GAA 2805 AUG TCU AAU AUU AGA CAU UUC GCA UCU CUA GU AD- GAA 1143 2793- UAA 1144 2791- 392717 UAG 2813 UCA 2813 AUU GGA CUC GAG UCC AAU UGA CUA UUA UUC AU AD- CUC 1145 2802- UGU 1146 2800- 392928 UCC 2822 GAU 2822 UGA AAA UUA UAA UUU UCA AUC GGA ACA GAG AA AD- UCU 1147 2803- AUG 1148 2801- 392700 CCU 2823 UGA 2823 GAU TAA UAU AUA UUA AUC UCA AGG CAU AGA GA AD- CUC 1149 2804- UAU 1150 2802- 392878 CUG 2824 GUG 2824 AUU AUA AUU AAU UAU AAU CAC CAG AUA GAG AG AD- UCC 1151 2805- AUA 1152 2803- 392718 UGA 2825 UGU 2825 UUA GAU UUU AAA AUC UAA ACA UCA UAU GGA GA AD- CCU 1153 2806- ACU 1154 2804- 392929 GAU 2826 AUG 2826 UAU TGA UUA UAA UCA AUA CAU AUC AGU AGG AG AD- GCC 1155 2833- AAA 1156 2831- 392879 AGU 2853 GAA 2853 UGU TAA AUA UAU UUA ACA UUC ACU UUU GGC UA AD- UUG 1157 2838- AAC 1158 2836- 392754 UAU 2858 CAC 2858 AUU AAG AUU AAU CUU AAU GUG AUA GUU CAA CU AD- UCU 1159 2849- AUU 1160 2847- 392819 UGU 2869 GGG 2869 GGU TCA UUG CAA UGA ACC CCC ACA AAU AGA AU AD- CUU 1161 2850- AAU 1162 2848- 392745 GUG 2870 UGG 2870 GUU GUC UGU ACA GAC AAC CCA CAC AUU AAG AA AD- UUG 1163 2851- UAA 1164 2849- 392770 UGG 2871 UUG 2871 UUU GGU GUG CAC ACC AAA CAA CCA UUA CAA GA AD- UGU 1165 2852- UUA 1166 2850- 392806 GGU 2872 AUU 2872 UUG GGG UGA UCA CCC CAA AAU ACC UAA ACA AG AD- GUU 1167 2856- AGA 1168 2854- 392771 UGU 2876 CUU 2876 GAC AAU CCA UGG AUU GUC AAG ACA UCU AAC CA AD- UUU 1169 2857- AGG 1170 2855- 392820 GUG 2877 ACU 2877 ACC TAA CAA UUG UUA GGU AGU CAC CCU AAA CC AD- UUG 1171 2858- UAG 1172 2856- 392821 UGA 2878 GAC 2878 CCC TUA AAU AUU UAA GGG GUC UCA CUA CAA AC AD- UGU 1173 2859- AUA 1174 2857- 392786 GAC 2879 GGA 2879 CCA CUU AUU AAU AAG UGG UCC GUC UAU ACA AA AD- GUG 1175 2860- AGU 1176 2858- 392772 ACC 2880 AGG 2880 CAA ACU UUA UAA AGU UUG CCU GGU ACU CAC AA AD- GAC 1177 2862- AAA 1178 2860- 392699 CCA 2882 GUA 2882 AUU GGA AAG CUU UCC AAU UAC UGG UUU GUC AC AD- ACC 1179 2863- UAA 1180 2861- 392868 CAA 2883 AGU 2883 UUA AGG AGU ACU CCU UAA ACU UUG UUA GGU CA AD- CCC 1181 2864- AUA 1182 2862- 392719 AAU 2884 AAG 2884 UAA TAG GUC GAC CUA UUA CUU AUU UAU GGG UC AD- AAU 1183 2867- UAU 1184 2865- 392880 UAA 2887 GUA 2887 GUC AAG CUA UAG CUU GAC UAC UUA AUA AUU GG AD- UAA 1185 2870- ACA 1186 2868- 392930 GUC 2890 UAU 2890 CUA GUA CUU AAG UAC UAG AUA GAC UGU UUA AU AD- AGU 1187 2872- AAG 1188 2870- 392931 CCU 2892 CAU 2892 ACU AUG UUA UAA CAU AGU AUG AGG CUU ACU UA AD- GUC 1189 2873- AAA 1190 2871- 392932 CUA 2893 GCA 2893 CUU TAU UAC GUA AUA AAG UGC UAG UUU GAC UU AD- UCC 1191 2874- UAA 1192 2872- 392869 UAC 2894 AGC 2894 UUU AUA ACA UGU UAU AAA GCU GUA UUA GGA CU AD- CCU 1193 2875- UUA 1194 2873- 392870 ACU 2895 AAG 2895 UUA CAU CAU AUG AUG UAA CUU AGU UAA AGG AC AD- CUA 1195 2876- AUU 1196 2874- 392896 CUU 2896 AAA 2896 UAC GCA AUA UAU UGC GUA UUU AAG AAU UAG GA AD- UAC 1197 2882- UCG 1198 2880- 392787 AUA 2902 AUU 2902 UGC CUU UUU AAA AAG GCA AAU UAU CGA GUA AA AD- CAU 1199 2884- AAU 1200 2882- 392720 AUG 2904 CGA 2904 CUU TUC UAA UUA GAA AAG UCG CAU AUU AUG UA AD- AUA 1201 2885- ACA 1202 2883- 392746 UGC 2905 UCG 2905 UUU AUU AAG CUU AAU AAA CGA GCA UGU UAU GU AD- UAU 1203 2886- ACC 1204 2884- 392773 GCU 2906 AUC 2906 UUA GAU AGA UCU AUC UAA GAU AGC GGU AUA UG AD- GGG 1205 2906- AAC 1206 2904- 392807 AUG 2926 GUU 2926 CUU CAC CAU AUG GUG AAG AAC CAU GUU CCC CC AD- UGC 1207 2937- AAU 1208 2935- 392730 UUC 2957 ACU 2957 UCU TAG UGC GCA CUA AGA AGU GAA AUU GCA GC AD- CUU 1209 2939- AGA 1210 2937- 392721 CUC 2959 AUA 2959 UUG CUU CCU AGG AAG CAA UAU GAG UCU AAG CA AD- UUC 1211 2940- AGG 1212 2938- 392933 UCU 2960 AAU 2960 UGC ACU CUA UAG AGU GCA AUU AGA CCU GAA GC AD- CUC 1213 2942- AAA 1214 2940- 392934 UUG 2962 GGA 2962 CCU AUA AAG CUU UAU AGG UCC CAA UUU GAG AA AD- CUU 1215 2944- AGA 1216 2942- 392881 GCC 2964 AAG 2964 UAA GAA GUA UAC UUC UUA CUU GGC UCU AAG AG AD- UGC 1217 2946- AAG 1218 2944- 392897 CUA 2966 GAA 2966 AGU AGG AUU AAU CCU ACU UUC UAG CUU GCA AG AD- AAG 1219 2951- AUG 1220 2949- 392898 UAU 2971 AUC 2971 UCC AGG UUU AAA CCU GGA GAU AUA CAU CUU AG AD- AGU 1221 2952- AGU 1222 2950- 392708 AUU 2972 GAU 2972 CCU CAG UUC GAA CUG AGG AUC AAU ACU ACU UA AD- GUA 1223 2953- UAG 1224 2951- 392899 UUC 2973 UGA 2973 CUU TCA UCC GGA UGA AAG UCA GAA CUA UAC UU AD- UAU 1225 2954- AUA 1226 2952- 392935 UCC 2974 GUG 2974 UUU AUC CCU AGG GAU AAA CAC GGA UAU AUA CU AD- AUU 1227 2955- AAU 1228 2953- 392882 CCU 2975 AGU 2975 UUC GAU CUG CAG AUC GAA ACU AGG AUU AAU AC AD- UCC 1229 2957- UGC 1230 2955- 392738 UUU 2977 AUA 2977 CCU GUG GAU AUC CAC AGG UAU AAA GCA GGA AU AD- CUU 1231 2959- AAU 1232 2957- 392739 UCC 2979 GCA 2979 UGA TAG UCA UGA CUA UCA UGC GGA AUU AAG GA AD- UUU 1233 2960- AAA 1234 2958- 392936 CCU 2980 UGC 2980 GAU AUA CAC GUG UAU AUC GCA AGG UUU AAA GG AD- UUC 1235 2961- AAA 1236 2959- 392900 CUG 2981 AUG 2981 AUC CAU ACU AGU AUG GAU CAU CAG UUU GAA AG AD- CUG 1237 2964- UUU 1238 2962- 392901 AUC 2984 AAA 2984 ACU AUG AUG CAU CAU AGU UUU GAU AAA CAG GA AD- CAC 1239 2969- UUA 1240 2967- 392937 UAU 2989 ACU 2989 GCA TUA UUU AAA UAA UGC AGU AUA UAA GUG AU AD- ACU 1241 2970- UUU 1242 2968- 392883 AUG 2990 AAC 2990 CAU TUU UUU AAA AAA AUG GUU CAU AAA AGU GA AD- UUC 1243 3029- AAG 1244 3027- 392975 CAU 3049 UAA 3049 GAC AAU UGC GCA AUU GUC UUA AUG CUU GAA AA AD- CUG 1245 3037- AAU 1246 3035- 392938 CAU 3057 CUG 3057 UUU TAC ACU AGU GUA AAA CAG AUG AUU CAG UC AD- AUU 1247 3055- AAA 1248 3053- 392755 GCU 3075 UAU 3075 GCU AGC UCU AGA GCU AGC AUA AGC UUU AAU CU AD- UUC 1249 3063- UAU 1250 3061- 392939 UGC 3083 AUC 3083 UAU ACA AUU AAU UGU AUA GAU GCA AUA GAA GC AD- UCU 1251 3064- AUA 1252 3062- 392940 GCU 3084 UAU 3084 AUA CAC UUU AAA GUG UAU AUA AGC UAU AGA AG AD- UGC 1253 3066- UCC 1254 3064- 392756 UAU 3086 UAU 3086 AUU AUC UGU ACA GAU AAU AUA AUA GGA GCA GA AD- UUU 1255 3073- UCU 1256 3071- 392774 GUG 3093 UAA 3093 AUA TUC UAG CUA GAA UAU UUA CAC AGA AAA UA AD- UCU 1257 3111- AAC 1258 3109- 392850 UCG 3131 AUA 3131 UGC AAA CUG CAG UUU GCA UAU CGA GUU AGA AA AD- CUU 1259 3112- ACA 1260 3110- 392852 CGU 3132 CAU 3132 GCC AAA UGU ACA UUU GGC AUG ACG UGU AAG AA AD- GUU 1261 3122- ACU 1262 3120- 392830 UUA 3142 AAU 3142 UGU GUG GCA UGC CAC ACA AUU UAA AGU AAC AG AD- UGU 1263 3128- UCA 1264 3126- 392808 GCA 3148 AUG 3148 CAC CCU AUU AAU AGG GUG CAU UGC UGA ACA UA AD- UGC 1265 3130- UCU 1266 3128- 392793 ACA 3150 CAA 3150 CAU TGC UAG CUA GCA AUG UUG UGU AGA GCA CA AD- ACA 1267 3133- AAG 1268 3131- 392757 CAU 3153 UCU 3153 UAG CAA GCA UGC UUG CUA AGA AUG CUU UGU GC AD- UUU 1269 3168- ACC 1270 3166- 392747 GUC 3188 CAA 3188 CAC AGA GUA UAC UCU GUG UUG GAC GGU AAA AA AD- CAC 1271 3174- UCA 1272 3172- 392902 GUA 3194 AAG 3194 UCU ACC UUG CAA GGU AGA CUU UAC UGA GUG GA AD- ACG 1273 3175- AUC 1274 3173- 392941 UAU 3195 AAA 3195 CUU GAC UGG CCA GUC AAG UUU AUA GAU CGU GG AD- UCU 1275 3180- UCU 1276 3178- 392942 UUG 3200 UUA 3200 GGU TCA CUU AAG UGA ACC UAA CAA AGA AGA UA AD- CUU 1277 3181- UUC 1278 3179- 392943 UGG 3201 UUU 3201 GUC AUC UUU AAA GAU GAC AAA CCA GAA AAG AU AD- UUG 1279 3183- UUU 1280 3181- 392944 GGU 3203 UCU 3203 CUU TUA UGA UCA UAA AAG AGA ACC AAA CAA AG AD- UGG 1281 3184- AUU 1282 3182- 392903 GUC 3204 UUC 3204 UUU TUU GAU AUC AAA AAA GAA GAC AAU CCA AA AD- AAA 1283 3201- UAC 1284 3199- 392775 GAA 3221 AAU 3221 UCC GAA CUG CAG UUC GGA AUU UUC GUA UUU UC AD- AAG 1285 3202- UUA 1286 3200- 392758 AAU 3222 CAA 3222 CCC TGA UGU ACA UCA GGG UUG AUU UAA CUU UU AD- AGA 1287 3203- AUU 1288 3201- 392945 AUC 3223 ACA 3223 CCU AUG GUU AAC CAU AGG UGU GAU AAU UCU UU AD- GAA 1289 3204- ACU 1290 3202- 392946 UCC 3224 UAC 3224 CUG AAU UUC GAA AUU CAG GUA GGA AGU UUC UU AD- UGU 1291 3211- UAA 1292 3209- 392884 UCA 3231 AAG 3231 UUG TGC UAA UUA GCA CAA CUU UGA UUA ACA GG AD- GUU 1293 3212- AUA 1294 3210- 392947 CAU 3232 AAA 3232 UGU GUG AAG CUU CAC ACA UUU AUG UAU AAC AG AD- UCA 1295 3214- ACG 1296 3212- 392748 UUG 3234 UAA 3234 UAA AAG GCA UGC CUU UUA UUA CAA CGU UGA AC AD- CAU 1297 3215- ACC 1298 3213- 392759 UGU 3235 GUA 3235 AAG AAA CAC GUG UUU CUU UAC ACA GGU AUG AA AD- CUG 1299 3258- UUC 1300 3256- 392837 GUC 3278 UUG 3278 UUC GUA AAU AUU UAC GAA CAA GAC GAA CAG CA AD- GGU 1301 3260- AAU 1302 3258- 392970 CUU 3280 UCU 3280 CAA TGG UUA UAA CCA UUG AGA AAG AUU ACC AG AD- UCU 1303 3262- AGA 1304 3260- 392976 UCA 3282 AUU 3282 AUU CUU ACC GGU AAG AAU AAU UGA UCU AGA CC AD- CUU 1305 3263- AAG 1306 3261- 392965 CAA 3283 AAU 3283 UUA TCU CCA UGG AGA UAA AUU UUG CUU AAG AC AD- UUC 1307 3264- AGA 1308 3262- 392831 AAU 3284 GAA 3284 UAC TUC CAA UUG GAA GUA UUC AUU UCU GAA GA AD- UCA 1309 3265- UGG 1310 3263- 392904 AUU 3285 AGA 3285 ACC AUU AAG CUU AAU GGU UCU AAU CCA UGA AG AD- AAU 1311 3267- UUU 1312 3265- 392885 UAC 3287 GGA 3287 CAA GAA GAA UUC UUC UUG UCC GUA AAA AUU GA AD- UUA 1313 3269- AUU 1314 3267- 392886 CCA 3289 UUG 3289 AGA GAG AUU AAU CUC UCU CAA UGG AAU UAA UU AD- UGA 1315 3304- AGC 1316 3302- 392776 UUG 3324 AAU 3324 UAC GAU AGA UCU AUC GUA AUU CAA GCU UCA UC AD- UCA 1317 3317- AGA 1318 3315- 392887 UUG 3337 UCA 3337 CUU TGU AUG CAU ACA AAG UGA CAA UCU UGA UU AD- CAU 1319 3318- ACG 1320 3316- 392722 UGC 3338 AUC 3338 UUA AUG UGA UCA CAU UAA GAU GCA CGU AUG AU AD- AUU 1321 3319- AGC 1322 3317- 392740 GCU 3339 GAU 3339 UAU CAU GAC GUC AUG AUA AUC AGC GCU AAU GA AD- UUG 1323 3320- AAG 1324 3318- 392760 CUU 3340 CGA 3340 AUG TCA ACA UGU UGA CAU UCG AAG CUU CAA UG AD- UGC 1325 3321- AAA 1326 3319- 392731 UUA 3341 GCG 3341 UGA AUC CAU AUG GAU UCA CGC UAA UUU GCA AU AD- GCU 1327 3322- GAA 1328 3320- 392709 UAU 3342 AGC 3342 GAC GAU AUG CAU AUC GUC GCU AUA UUC AGC AA AD- CUU 1329 3323- AGA 1330 3321- 392723 AUG 3343 AAG 3343 ACA CGA UGA UCA UCG UGU CUU CAU UCU AAG CA AD- UUA 1331 3324- UAG 1332 3322- 392948 UGA 3344 AAA 3344 CAU GCG GAU AUC CGC AUG UUU UCA CUA UAA GC AD- UAU 1333 3325- AUA 1334 3323- 392724 GAC 3345 GAA 3345 AUG AGC AUC GAU GCU CAU UUC GUC UAU AUA AG AD- AUG 1335 3326- UGU 1336 3324- 392949 ACA 3346 AGA 3346 UGA AAG UCG CGA CUU UCA UCU UGU ACA CAU AA AD- UGA 1337 3327- AUG 1338 3325- 392725 CAU 3347 UAG 3347 GAU AAA CGC GCG UUU AUC CUA AUG CAU UCA UA AD- CAU 1339 3330- ACA 1340 3328- 392950 GAU 3350 GUG 3350 CGC TAG UUU AAA CUA GCG CAC AUC UGU AUG UC AD- UGA 1341 3332- AUA 1342 3330- 392732 UCG 3352 CAG 3352 CUU TGU UCU AGA ACA AAG CUG CGA UAU UCA UG AD- GAU 1343 3333- AAU 1344 3331- 392726 CGC 3353 ACA 3353 UUU GUG CUA UAG CAC AAA UGU GCG AUU AUC AU AD- AUC 1345 3334- UAA 1346 3332- 392733 GCU 3354 UAC 3354 UUC AGU UAC GUA ACU GAA GUA AGC UUA GAU CA AD- UCG 1347 3335- AUA 1348 3333- 392906 CUU 3355 AUA 3355 UCU CAG ACA UGU CUG AGA UAU AAG UAU CGA UC AD- CGC 1349 3336- UGU 1350 3334- 392862 UUU 3356 AAU 3356 CUA ACA CAC GUG UGU UAG AUU AAA ACA GCG AU AD- CUU 1351 3338- UAU 1352 3336- 392951 UCU 3358 GUA 3358 ACA AUA CUG CAG UAU UGU UAC AGA AUA AAG CG AD- UUC 1353 3340- UUU 1354 3338- 392871 UAC 3360 AUG 3360 ACU TAA GUA UAC UUA AGU CAU GUA AAA GAA AG AD- UCU 1355 3341- AUU 1356 3339- 392872 ACA 3361 UAU 3361 CUG GUA UAU AUA UAC CAG AUA UGU AAU AGA AA AD- GAU 1357 3456- AUG 1358 3454- 392952 UCA 3476 GUU 3476 AUU AAA UUC GAA UUU AAU AAC UGA CAU AUC UG AD- AUU 1359 3462- UUC 1360 3460- 392907 UUC 3482 AGA 3482 UUU CUG AAC GUU CAG AAA UCU GAA GAA AAU UG AD- UUU 1361 3464- ACU 1362 3462- 392953 CUU 3484 UCA 3484 UAA GAC CCA UGG GUC UUA UGA AAG AGU AAA AU AD- UCU 1363 3466- AAA 1364 3464- 392741 UUA 3486 CUU 3486 ACC CAG AGU ACU CUG GGU AAG UAA UUU AGA AA AD- CUU 1365 3467- GAA 1366 3465- 392908 UAA 3487 ACU 3487 CCA TCA GUC GAC UGA UGG AGU UUA UUC AAG AA AD- CUG 1367 3478- AUA 1368 3476- 392977 AAG 3498 UCA 3498 UUU TAA CAU AUG UUA AAA UGA CUU UAU CAG AC AD- GAA 1369 3480- UUG 1370 3478- 392847 GUU 3500 UAU 3500 UCA CAU UUU AAA AUG UGA AUA AAC CAA UUC AG AD- AAA 1371 3511- AUU 1372 3509- 392809 UGG 3531 AUA 3531 AAG TUG UGG CCA CAA CUU UAU CCA AAU UUU UC AD- AUG 1373 3513- ACC 1374 3511- 392810 GAA 3533 UUA 3533 GUG TAU GCA UGC AUA CAC UAA UUC GGU CAU UU AD- UGC 1375 3547- AAA 1376 3545- 392777 CUG 3567 GAA 3567 GAC GGG AAA UUU CCC GUC UUC CAG UUU GCA UG AD- UUC 1377 3562- UGA 1378 3560- 392960 UUU 3582 AGA 3582 UAA CAC GAU AUC GUG UUA UCU AAA UCA GAA GG AD- CUU 1379 3564- AUU 1380 3562- 392873 UUA 3584 GAA 3584 AGA GAC UGU ACA GUC UCU UUC UAA AAU AAG AA AD- UUU 1381 3565- AAU 1382 3563- 392889 UAA 3585 UGA 3585 GAU AGA GUG CAC UCU AUC UCA UUA AUU AAA GA AD- UUU 1383 3566- AAA 1384 3564- 392954 AAG 3586 UUG 3586 AUG AAG UGU ACA CUU CAU CAA CUU UUU AAA AG AD- UUA 1385 3567- CAA 1386 3565- 392955 AGA 3587 AUU 3587 UGU GAA GUC GAC UUC ACA AAU UCU UUG UAA AA AD- UAA 1387 3568- ACA 1388 3566- 392909 GAU 3588 AAU 3588 GUG TGA UCU AGA UCA CAC AUU AUC UGU UUA AA AD- AAG 1389 3569- UAC 1390 3567- 392710 AUG 3589 AAA 3589 UGU TUG CUU AAG CAA ACA UUU CAU GUA CUU AA AD- AGA 1391 3570- AUA 1392 3568- 392956 UGU 3590 CAA 3590 GUC AUU UUC GAA AAU GAC UUG ACA UAU UCU UA AD- AUG 1393 3572- UUA 1394 3570- 392874 UGU 3592 UAC 3592 CUU AAA CAA UUG UUU AAG GUA ACA UAA CAU CU AD- UGU 1395 3575- AUU 1396 3573- 392957 CUU 3595 UUA 3595 CAA TAC UUU AAA GUA UUG UAA AAG AAU ACA CA AD- CUU 1397 3578- ACC 1398 3576- 392958 CAA 3598 AUU 3598 UUU TUA GUA UAC UAA AAA AAU UUG GGU AAG AC AD- AUG 1399 3594- UUA 1400 3592- 392959 GUG 3614 UUU 3614 UUU ACA UCA UGA UGU AAA AAA CAC UAA CAU UU AD- GUA 1401 3607- UCC 1402 3605- 392788 AAU 3627 AAG 3627 AAA AAU UAC GUA AUU UUU CUU AUU GGA UAC AU
TABLE-US-00024 TABLE 4 APP Single Dose Screen in Primary Cynomolgus Hepatocytes and Be(2)C Cell Line Data are expressed as percent message remaining relative to AD-1955 non- targeting control. Primary Cynomolgus Hepatocytes Be(2)C Cell Line Duplex 10 nM 10 nM 0.1 nM 0.1 nM 10 nM 10 nM 0.1 nM 0.1 nM Name Avg SD Avg SD Avg SD Avg SD AD-392853 92 5 89.9 1.5 97 2.5 99.3 8.8 AD-392857 86.7 3.3 98.9 6.1 85.1 4.4 103.8 5.9 AD-392851 90.5 1.5 97.9 10.1 100.1 4 103.9 7.8 AD-392811 90.5 10.5 87.8 2.5 89.1 6.8 98 5.1 AD-392910 52.3 3 99.2 32.4 66.1 6.1 101.3 9.7 AD-392890 57.4 4.8 108.5 23.1 63.9 1.5 100.3 10.6 AD-392911 16.4 3.4 85.7 4 10.6 3.5 71.2 10.3 AD-392912 16.7 2.7 84.8 4.5 9.7 1.7 57.7 4.1 AD-392778 46.1 19.2 96 23.4 7.9 0.9 82.4 7.4 AD-392727 52.9 5.8 98.9 11.4 48.3 4.5 94 5.7 AD-392728 43.8 20.3 91.5 10.2 17.6 2.2 86.2 6.5 AD-392891 52 7 142.2 35.1 34.8 1.7 93.5 5.8 AD-392822 53.9 3.8 75.2 2.9 30.1 3.2 83.7 5.8 AD-392749 46.3 11.7 97.6 2.6 14.9 1.7 95.7 5.3 AD-392794 108.8 17.9 86.9 2.7 92.9 7.9 87.4 6.7 AD-392795 39.5 13.2 78.1 11.8 15.5 1.8 79.9 7.9 AD-392812 87.2 4.3 90.4 2.5 79.8 3.3 78.5 13.8 AD-392796 48 17.6 82.6 2.8 17.1 2.5 80.2 3.5 AD-392779 100 30.9 95.9 4.8 99.6 4 98.6 3.3 AD-392780 80.7 29.5 93.2 4.5 47.4 4.4 101.6 5.2 AD-392813 91.6 2.9 85.1 4 84.8 4.7 88.9 7 AD-392797 98 6.6 88.7 11.1 79 3.3 84 12 AD-392761 73.9 18.4 94.2 4.3 77.9 4.4 101 6.4 AD-392814 56.9 2.9 84.4 5.4 47.5 2.6 83.8 6.6 AD-392742 89 21.9 99.4 8.2 48.1 5.8 96.6 3.7 AD-392750 110.7 44.7 99.9 13.2 25.4 1.2 95 4.7 AD-392823 65.5 3 73.7 2.9 38.8 4.1 84.9 3.8 AD-392789 103.7 4 105 3.8 88.1 7 79.5 4 AD-392781 81 39.1 94.9 5.8 21.2 3.1 95 8.9 AD-392798 119.2 16.3 85.3 10.9 73.1 6.3 83.2 7.4 AD-392751 48.5 12.9 93.9 7.9 15.6 3 87.2 2.5 AD-392858 90 1.5 95 2.6 90.7 4.7 103 7.7 AD-392844 21.8 0.4 93 3.6 6.2 0.6 51.8 5.3 AD-392842 88.9 0.5 98.2 1.6 67.7 4.1 102 2.7 AD-392848 91.7 9.1 90.1 2.6 70.9 7.5 96.5 16.7 AD-392838 68 3.6 90.2 3.3 20.2 2 84.3 6.2 AD-392839 69 2.6 84.8 3.9 62.7 3.1 85.8 7.6 AD-392734 103 32.4 112.8 23.5 86.6 6.6 98.6 3.1 AD-392790 34 4.8 99.2 1.2 10.9 1.4 72.6 2.5 AD-392815 37.4 1.7 82.5 2.9 21.5 1.9 79.8 0.9 AD-392762 72.2 21.3 95 12.3 91.2 4.6 102.6 7.7 AD-392735 47 9.7 101.5 9.2 29.6 4.4 94 7.4 AD-392743 73.6 23.4 105.5 16.6 58.5 2.6 100.1 11.3 AD-392736 50.5 9 97.3 8.2 19.6 2.4 91.7 7 AD-392824 22.6 6.7 65.8 4.9 6.4 1.6 54.9 5 AD-392799 90.1 23.6 75.8 4.5 35.7 5.4 78.2 7.5 AD-392971 89.2 13.4 92.1 0.3 57.1 3.6 91.8 5.8 AD-392913 18.4 2.7 78.1 8 7.4 0.2 45.7 2.1 AD-392892 61 12.4 113.2 8.6 57.4 5.4 89.7 13.2 AD-392914 80.3 6.3 103.2 5.9 86.5 3.4 111.4 19.7 AD-392860 91.8 4.8 89.4 6.1 106.1 6.2 98.6 5.6 AD-392875 96.2 4.8 107.9 2.5 66.1 2.9 83.5 8.4 AD-392915 48.1 1.8 101.9 4.8 38.3 3.4 103 5.4 AD-392782 109.4 4.8 95.4 5.3 72.2 4.3 101.6 2.7 AD-392763 60 17.6 93 6.3 26.7 2.2 91.6 3.8 AD-392816 40.2 1.5 74.6 2.2 15.6 1.2 78.9 2.4 AD-392704 28.7 12.1 94.1 6.8 15.8 1.5 65.7 9.7 AD-392854 89 3.5 84.9 2.9 99 7 97.9 5.8 AD-392856 93.7 2.5 88.4 2.8 101 7.8 94.2 3.5 AD-392817 101.6 3 85 5.2 77.5 11.4 98.6 11.6 AD-392764 69.5 12.1 87.2 5.9 10.6 1.4 79.4 5.7 AD-392845 89.5 2 99 8.2 50.4 5 90.5 2.9 AD-392825 38.1 2.5 98 8.4 14.7 4.7 91.4 4 AD-392849 89.4 4.1 92.3 11.4 30.3 2.3 103.4 7.4 AD-392846 83.1 1.9 99.7 6.3 17.6 3.2 77.7 4.2 AD-392859 82 2.5 91.4 5.5 69.7 1.5 98.6 2.1 AD-392843 18.8 2.1 88.9 5.4 7.4 2.5 37.2 2.2 AD-392855 64 5.2 85.9 12.4 23.4 2.6 85.6 9.1 AD-392840 74.3 2.3 91.2 6.4 27.7 2.5 94.3 15.6 AD-392835 18.2 2.3 84.3 5.4 12.7 3.1 53.5 4.5 AD-392729 46.9 13.7 100.9 20.5 13.3 2.3 82.4 4.2 AD-392916 20 1.6 63.7 3.6 7.5 2 44.4 2.1 AD-392876 45.8 4.6 100.8 2.6 16.4 3.6 67.4 7.2 AD-392861 91.9 3.9 89.3 2.6 89.9 10.9 91.5 4.3 AD-392863 22.8 0.6 90.1 9.3 9.9 1.9 72.2 8 AD-392917 30.6 1.8 99.7 2.1 21.7 3.5 82.5 7.5 AD-392783 22.8 1.7 90.4 11.1 13.1 1.4 69.8 5.7 AD-392765 79 22 83.3 6.4 22.4 2.8 68.1 5.7 AD-392791 31.9 7.6 84.1 4.8 11.2 1.2 52.3 2.4 AD-392800 38.2 3.6 72.3 7.6 8 1.5 65.4 7.2 AD-392711 38.1 24.1 115.1 21 18.8 0.6 67.2 2.2 AD-392801 18.7 0.6 87 6.3 11.7 3 66.3 17.5 AD-392826 69 4.6 95.1 10 31.9 3.3 88.4 8 AD-392818 31.5 2.2 77.8 6.6 18.6 3 80.7 6.2 AD-392792 35.8 6.7 87.7 4.1 10.7 1.1 58.3 4.7 AD-392802 43.8 4.1 81.8 7.5 26.5 3.7 90.3 2.6 AD-392766 32.8 11.5 75.2 4.1 8.4 2 38.1 3.5 AD-392767 64 23.5 87.5 5.2 10.7 1.5 66.1 5.8 AD-392834 84.6 2.8 85.1 6.9 7.8 0.8 68.1 4.7 AD-392974 118.3 5.4 105.4 6.3 9.3 0.9 53.1 4.5 AD-392784 63.6 14.9 92.8 0.8 28.1 3.4 96.7 6.5 AD-392744 59.6 17.2 96.6 7.4 18.3 1 92.7 7.7 AD-392752 38.2 11.6 92.8 4.9 7.7 1.2 57.6 2.3 AD-392737 44.8 38.6 103.9 27.2 9.7 0.7 57.3 3.4 AD-392712 73 38.4 102.8 6.1 37.2 1.9 67.4 16 AD-392705 25.2 9.4 88.7 4.3 6.6 0.9 47.7 6.3 AD-392713 81.8 33.4 101.1 7.3 61.7 5.8 92.7 9.8 AD-392918 25.1 1.8 93.5 5.3 18.5 1 95 11.2 AD-392919 24.3 3.3 95 8.6 13.8 4 78 9.1 AD-392803 51.5 3.1 89.5 9.4 19.8 2 72 3 AD-392804 72 3.3 97.2 11.3 22.9 1.2 83.1 3.2 AD-392827 24.1 1.5 87 9.2 11.7 1.7 72.7 5.9 AD-392828 67.5 3.7 102.4 13.8 33.7 3.2 81.9 3.9 AD-392785 39.5 14.4 70.2 15 5.6 1.2 37.4 3.9 AD-392829 26.5 2.8 87.5 7.5 16.1 1.6 73 7.4 AD-392920 35.8 3.5 108.1 4.7 19.9 4.3 94.4 6.7 AD-392921 30 3.8 100.7 9.1 11.9 2.8 75 7.6 AD-392768 66.5 21.9 94.1 6.6 13.1 2.7 84.9 5.8 AD-392805 20.5 0.9 88.7 13.4 7.9 2.2 43.5 3.9 AD-392769 41.9 21.5 74.6 4.6 4.9 2.1 32.5 3.9 AD-392753 40.4 7.6 113.9 21.9 12.5 0.9 72.5 7.6 AD-392714 21.7 8.1 99.5 7.2 6.9 0.8 40.8 3.2 AD-392703 17.6 1.5 90.5 6.9 6.2 1.4 37.7 3.9 AD-392715 25.5 10.3 78.8 4.8 6.4 1.7 38.9 2.7 AD-392841 89.6 3.9 93.6 9 36.8 4.1 96.6 6.9 AD-392836 88.5 1.6 97.7 8.6 7.6 2 51.5 2 AD-392966 71.5 4.6 92.4 3.4 6.4 1 47.6 4.2 AD-392832 94.7 7.9 85.4 14.4 23.8 3.2 76.2 2.6 AD-392972 84.1 10.8 89.8 7.1 8.3 2 57.1 3.5 AD-392961 82.6 7.5 111.3 9.9 8 0.4 51.7 5.1 AD-392967 81.6 7.1 93.2 6.8 20.2 1.6 89.4 4.9 AD-392893 64.8 11.7 118.8 19.7 59.9 2.6 80.7 5.1 AD-392894 68.4 10.3 111.4 10.8 21.9 1.5 88.4 15.6 AD-392864 62.7 15.4 88.4 6.2 8.2 0.8 55.9 4.5 AD-392865 45.8 2.4 103.8 12.6 13.6 3.1 35.8 5.4 AD-392922 43.3 5 106.5 2.2 11.1 5.2 53.1 4.9 AD-392833 95.1 5.1 93.9 4.1 21.2 0.7 86.2 0.8 AD-392968 54.3 3.1 94.8 9.3 8.2 0.7 51.9 2.5 AD-392962 82.3 10.9 103 10 8.5 0.5 55 3.8 AD-392963 63.9 8.9 99.6 10.3 19.5 0.5 71.2 1.1 AD-392964 94.4 8.6 97.5 9.2 52.4 3.7 87.1 2.8 AD-392969 73.3 6.6 99 6.2 11.7 1.1 69.4 2.5 AD-392973 69 12.8 87.7 8 7.6 0.7 67.3 1.7 AD-392923 28.6 3.3 106 8.2 13.2 3.5 69.6 12.7 AD-392866 18 4.3 86.5 14.1 9.1 0.8 29.1 8.6 AD-392924 79.7 3.1 108.3 5.2 89 3.1 94.8 7.7 AD-392895 63.4 13.8 109 4.4 31.6 2.9 86.7 8.9 AD-392867 95.2 11.6 99.8 15.8 45.3 1.7 77.1 6.6 AD-392877 74.8 23.6 102.2 7.6 14.3 2 54.1 1.7 AD-392707 27.1 7.6 87.9 5.5 6 1.4 68.8 1.9 AD-392716 107.6 19.9 100.9 7.9 45.4 4 94.6 3.6 AD-392925 47 5.6 106.8 5.1 23.1 2.4 80.7 9.3 AD-392926 22.1 2.5 93.7 8.7 7.7 0.7 67 9.8 AD-392927 18.2 5.4 80.1 8.7 9.7 2 44.2 6.4 AD-392717 57.4 16 84.6 9.4 8.7 0.9 52.2 3.7 AD-392928 71.3 4 95.4 4.1 35.3 2.7 103 8.5 AD-392700 23 7.6 88.4 4.8 6.3 0.6 45.3 10.7 AD-392878 29.9 18.4 89 4.4 8.4 1.6 34.5 4 AD-392718 40.3 14.5 105.4 25.7 10.8 0.6 68.5 2.3 AD-392929 42.4 3.7 99.5 1.2 15 4.9 88.8 14.1 AD-392879 102.2 14.5 97.7 3.5 59.6 3 67.3 8.1 AD-392754 97.1 14.7 102.1 17.6 27.3 2.5 108.6 5.7 AD-392819 22.3 2.2 79.6 4.9 11 2.5 58.4 4.9 AD-392745 13.8 2.2 74 13.1 7.1 1.9 28.2 4 AD-392770 36.9 18 80.3 8.1 6.7 1 34.1 4.1 AD-392806 44.9 3.3 84.2 3.9 17.7 2.6 54.3 1.9 AD-392771 49.4 18.6 89.4 1.6 9.5 0.4 60.1 2.9 AD-392820 54.4 3.3 88.1 3.9 19.6 1.1 78.1 6.4 AD-392821 61.1 2.2 79.8 3.1 15.5 1.6 80.1 5.3 AD-392786 72.2 9.8 109.4 4 19.8 1.9 65.3 2.2 AD-392772 58.9 11.7 88.9 2.6 11 0.6 62.2 3.1 AD-392699 37.9 9.1 102.9 8.7 8.1 3.4 55.6 4.4 AD-392868 52.9 1.4 95.8 11.1 18 1.8 61.5 4.3 AD-392719 37.4 20.3 94.7 12.4 7.3 1 38.9 2.4 AD-392880 21.9 2 83.2 3 10.9 1.5 32.7 3.3 AD-392930 31.4 2.5 95.8 2 9.9 2.4 42.2 6 AD-392931 75.2 7.7 98.4 4.5 44.3 4.1 108.6 12.5 AD-392932 34.7 5.5 99.6 4.9 12.2 0.8 54.5 5.1 AD-392869 21.4 1.8 92.5 12.4 6.9 1.6 29 2 AD-392870 22.1 3.8 86 13.5 9 1.2 20.7 1.6 AD-392896 50.7 6.7 112.8 8.3 21.9 3 75.9 9.4 AD-392787 100.4 6.1 114.6 11.3 54.7 3.4 61.6 28.7 AD-392720 61.7 30 87.6 4.6 6.6 0.2 34.6 4 AD-392746 54.4 23.1 102.1 22.9 5.7 0.7 59 6.3 AD-392773 101.8 22 97.6 6.3 30.3 1.5 97.4 6 AD-392807 56 3.3 76 4.9 11.2 1.4 64.2 4.3 AD-392730 53.3 8.2 102.8 22.2 28.4 1.9 91.9 5.4 AD-392721 43.9 21.8 93.3 6.7 7.4 0.1 58.1 1.5 AD-392933 51.7 6.2 88.8 3.3 22 4.4 86.3 7.8 AD-392934 71.4 7.1 100.9 5.6 53.7 3.7 100.1 14 AD-392881 34.6 2 104.5 1.5 11 3.9 55 11 AD-392897 47.9 5 103.3 2.7 19.2 1.9 91.7 7.3 AD-392898 24.7 4.3 98.9 6.7 11.6 2.4 76.1 11.5 AD-392708 79.7 6.2 99.5 3.8 57.8 2.5 95.7 6.3 AD-392899 20.7 3.4 75 4.2 12.6 3 57.9 5.9 AD-392935 25.8 2.6 85.8 2.4 9.5 1.6 44 8 AD-392882 47.9 2 101.9 4.4 15.9 2.3 77.6 9.3 AD-392738 43.3 10.3 98.8 7.3 9.7 1.4 88 4 AD-392739 42.8 13.3 124.4 28 16.6 0.8 82.1 4.9 AD-392936 26.9 3.9 91.3 2.5 11.7 0.6 45.7 11.4 AD-392900 36.6 1.9 96.1 5.9 11.7 1.5 64.5 4.1 AD-392901 49 0.9 106.8 6.4 46.2 4.3 81.8 7.1 AD-392937 36.7 2.7 89.6 3 12.4 1.4 53 7.9 AD-392883 30.8 2.2 96.6 4.4 8.5 1.2 55.2 3.5 AD-392975 112.8 2.1 106.9 2.2 27.9 1.3 95.3 5.5 AD-392938 33 7.9 88.1 3.2 13.2 2.9 61.6 6.9 AD-392755 100.8 38 105.8 17.6 38.6 2.2 93.2 5.9 AD-392939 36.8 8 96.2 4.8 9.8 3 59.1 9.1 AD-392940 81.3 12.4 97 3.1 84.6 8.1 93.8 7.5 AD-392756 101.7 14.9 94.9 5.7 43.2 4.2 98.9 11.3 AD-392774 99.6 34.8 97.3 2.2 87.9 3.8 98.6 7.7 AD-392850 89.3 3.3 95.3 4.2 37.4 3.2 102.2 11.6 AD-392852 91.8 4.8 88.2 5.9 59.9 5.6 103.8 8.7 AD-392830 89.2 1.9 83.6 9.6 68.2 2.5 89.6 3.7 AD-392808 44.2 17.6 76.1 6.5 9.1 1.1 67.3 3.3 AD-392793 72 2.1 84.9 2 33 3.4 68 19.8 AD-392757 71.3 28.8 98.5 1.7 24.4 1 87.5 5.9 AD-392747 86.8 27.4 99.9 7.2 33.1 0.9 97.6 4.3 AD-392902 29.3 3.3 134.2 36.1 17.9 1.7 87 6.6 AD-392941 36.9 13.1 82.5 5.4 13.3 1.4 70.6 13.1 AD-392942 22 3.6 89.2 5.2 6.5 0.8 56.2 4.4 AD-392943 28 4.2 95.1 4.5 11.3 1.5 57 6.2 AD-392944 27.9 3.5 85.8 4.4 12.9 0.6 53.4 4.1 AD-392903 16.4 1 76.8 2.7 7.9 1.1 29 9.1 AD-392775 61.4 30.1 91.8 4.8 15 0.7 85.1 5.4 AD-392758 53.8 35.1 83.4 8 11.1 0.9 51.6 6.6 AD-392945 33.3 4.7 101.9 4.9 10.6 1 76.2 3.7 AD-392946 71 6.7 99.6 3.1 39.7 2 90.3 4.5 AD-392884 30.2 1.9 90.5 8 10.8 2.3 53.3 2.9 AD-392947 51.8 6 95.8 1.8 12.4 0.7 68.4 3 AD-392748 84.5 29.8 114 35.3 27.9 1.8 92.7 18.9 AD-392759 87.4 36.2 96.7 8.4 22.7 2.7 97 7.7 AD-392837 37.8 0.6 91.9 4.6 7.9 2.4 36.9 1.6 AD-392970 84.2 7.5 93.4 4.1 7.5 1 41.3 4.2 AD-392976 112.8 16.8 112.7 5.3 19.8 1.4 84.1 1.7 AD-392965 82.2 14.1 96.1 5.9 8.2 1 54.3 1.8 AD-392831 87.9 4.2 82 12.3 12.6 2.8 55.5 5.9 AD-392904 74.2 2.8 105.9 7.1 26 3 102.4 14.2 AD-392885 30.3 3.2 82.9 6 5.5 1.6 29.9 3.8 AD-392886 26.6 3.3 87.3 2.6 9.7 2.2 40.1 4.5 AD-392776 60.2 17 95.7 8.6 9.4 1.5 69.4 6.5 AD-392887 20.8 3.3 102.3 11.9 8.1 2 34.5 4.7 AD-392722 68.7 26.2 95.3 4.1 12.3 2.1 73.8 2.3 AD-392740 93.3 22.3 94.2 5.3 50.7 2.6 100.4 8.3 AD-392760 68.1 23 96.7 5.6 8.5 0.5 57.3 5.9 AD-392731 39.8 10.9 99.6 12.7 4.5 2.5 41.1 11.1 AD-392709 74.4 24.7 107.4 13.6 11.8 0.7 78.2 5.3 AD-392723 58.8 23.6 119.7 22.1 14.2 3.1 72.1 3.9 AD-392948 32.8 7.4 84.3 2.3 6.5 0.5 33 2.3 AD-392724 59.7 13.5 93.8 7.2 13 1.6 58.3 5.5 AD-392949 49 2.8 92.9 2 15.8 1.7 70.8 2.6 AD-392725 40.2 6.5 95.7 5.9 10 2.8 54.4 2.5 AD-392950 25.1 4.1 83.7 5.5 8.2 0.9 50.2 3.9 AD-392732 27.6 5.2 92.4 16.7 7.4 1.1 30.6 1.5 AD-392726 57.8 9.3 96 4.8 9 0.6 70 5.9 AD-392733 79.3 18 92.3 5 40.3 1.9 96.6 7.5 AD-392906 75.4 3.6 104.5 2.1 37.2 4 107 18.3 AD-392862 33.1 2.3 84.5 4.2 10.7 2 54 5.2 AD-392951 41 6.5 94.1 8 13.4 0.5 70.5 4.1 AD-392871 46.6 11.3 95.8 14.3 12.2 1.8 35.7 5.2 AD-392872 69.6 11 92 7.4 17.5 3 55.4 6.7 AD-392952 74.8 6.9 101.1 5.8 73 4.1 94.5 4.3 AD-392907 74.8 4.4 99.4 4.5 71.4 6.2 102.2 16.2 AD-392953 79.5 5.3 101.7 4.3 72.4 3.5 90.6 3.7 AD-392741 85 16.2 93.1 4.3 90.3 5.6 97 5.7 AD-392908 71.7 5 105.4 2.3 72.2 1.6 95 9 AD-392977 93.7 7.9 111.3 3.2 68 2.7 80.1 2.5 AD-392847 92.1 1.9 97.9 1.8 82.4 5 85.7 8.1 AD-392809 93.5 7 93.9 10 81.9 7.5 83.3 5.7 AD-392810 93 6.1 88.8 5.9 76.9 5.4 90.6 2.9 AD-392777 88.2 20.1 92.7 7.2 86 5 101.9 13 AD-392960 85 8.7 103.7 8.7 73 3.8 87 6 AD-392873 95.5 2.9 95.5 5.6 76.4 3.7 49.1 15.4 AD-392889 64.1 5.5 126.2 36.5 71.1 4.8 85.6 7.4 AD-392954 68.9 7.2 98.1 6 66.7 3.5 75.1 4.3 AD-392955 83 3.1 98.6 5.7 73.6 1.3 88.6 2.9 AD-392909 61.4 4.4 101.1 5.8 67.3 4.7 85.8 10.4 AD-392710 110 29.8 165.2 53.6 66.7 3.8 86 9.1 AD-392956 71.5 9.3 93.1 3.8 63.5 4.5 78.9 2.7 AD-392874 77.2 2.9 98.8 4.1 67.5 9.5 64.9 15.1 AD-392957 59.5 10.6 98.9 19 60.5 4.8 72.4 2 AD-392958 80.4 5.5 95.9 8.2 83.3 5 102.9 6.3 AD-392959 67.6 6.5 99 6.1 75.9 3.1 89.4 3.3 AD-392788 106.7 6 111.9 9.1 92.1 4 87.4 6.6
[0771] Certain groups of agents were identified as residing in regions of particularly efficacious APP knockdown targeting. As shown in the above results, some regions of the APP transcript appear to be relatively more susceptible to targeting with RNAi agents of the disclosure than other regions—e.g., the agents that target APP positions 2639 to 2689 in the NM_000484 sequence (i.e., RNAi agents AD-392785, AD-392829, AD-392920, AD-392921, AD-392768, AD-392805, AD-392769, AD-392753, AD-392714, AD-392703 and AD-392715) exhibited particularly robust knockdown results in the Be(2)C cell line, suggesting a possible “hotspot”, with likely similar activity of other, overlapping RNAi agents targeting these positions of the APP transcript. It is therefore expressly contemplated that any RNAi agents possessing target sequences that reside fully within the following windows of NM_000484 positions are likely to exhibit robust APP inhibitory effect: APP NM_00484 positions 1891-1919; APP NM_00484 positions 2282-2306; APP NM_00484 positions 2464-2494; APP NM_00484 positions 2475-2638; APP NM_00484 positions 2621-2689; APP NM_00484 positions 2682-2725; APP NM_00484 positions 2705-2746; APP NM_00484 positions 2726-2771; APP NM_00484 positions 2754-2788; APP NM_00484 positions 2782-2813; APP NM_00484 positions 2801-2826; APP NM_00484 positions 2847-2890; APP NM_00484 positions 2871-2896; APP NM_00484 positions 2882-2960; APP NM_00484 positions 2942-2971; APP NM_00484 positions 2951-3057; APP NM_00484 positions 3172-3223; APP NM_00484 positions 3209-3235; NM_00484 positions 3256-3289; NM_00484 positions 3302-3338; APP NM_00484 positions 3318-3353; and APP NM_00484 positions 3334-3361.
TABLE-US-00025 TABLE 5A Mouse APP Modified Sequences Anti- Sense sense Se- Se- mRNA quence SEQ quence SEQ target SEQ Duplex 5′ to ID (5′ to ID se- ID Name 3′) NO 3′) NO quence NO AD-397175 csasu 1403 VPusU 1404 GCCAU 1405 gu(Uh fsgag GUUCU d)Cfu UfuUf GUGGU GfUfG Afcca AAACU fguaa cAfgA CAA acuca facau aL96 gsgsc AD-397176 usgsu 1406 VPusG 1407 CAUGU 1408 uc(Uh fsuug UCUGU d)Gfu AfgUf GGUAA GfGfU Ufuac ACUCA faaac cAfcA ACA ucaac fgaac aL96 asusg AD-397177 asusg 1409 VPusU 1410 CCAUG 1411 uu(Ch fsuga UUCUG d)Ufg GfuUf UGGUA UfGfG Ufacc AACUC fuaaa aCfaG AAC cucaa faaca aL96 usgsg AD-397178 csusg 1412 VPusG 1413 UUCUG 1414 ug(Gh fscau UGGUA d)Ufa GfuUf AACUC AfAfC Gfagu AACAU fucaa uUfaC GCA caugc fcaca aL96 gsasa AD-397179 gsgsu 1415 VPusA 1416 GUGGU 1417 aa(Ah fsugu AAACU d)Cfu GfcAf CAACA CfAfA Ufguu UGCAC fcaug gAfgU AUG cacau fuuac aL96 csasc AD-397180 usgsu 1418 VPusU 1419 UCUGU 1420 gg(Uh fsgca GGUAA d)Afa UfgUf ACUCA AfCfU Ufgag ACAUG fcaac uUfuA CAC augca fccac aL96 asgsa AD-397181 gsasa 1421 VPusC 1422 GAGAA 1423 ga(Gh fsgug GAGCA d)Cfa CfaAf CUAAC CfUfA Gfuua UUGCA facuu gUfgC CGA gcacg fucuu aL96 csusc AD-397182 cscsg 1424 VPusU 1425 UCCCG 1426 cu(Gh fsgac CUGGU d)Gfu AfuCf ACUUU AfCfU Afaag GAUGU fuuga uAfcC CAC uguca fagcg aL96 gsgsa AD-397183 cscsa 1427 VPusG 1428 CGCCA 1429 ug(Uh fsagu UGUUC d)Ufc UfuAf UGUGG UfGfU Cfcac UAAAC fggua aGfaA UCA aacuc fcaug aL96 gscsg AD-397184 gsusg 1430 VPusG 1431 CUGUG 1432 gu(Ah fsugc GUAAA d)Afa AfuGf CUCAA CfUfC Ufuga CAUGC faaca gUfuU ACA ugcac facca aL96 csasg AD-397185 gsasa 1433 VPusA 1434 CUGAA 1435 cu(Gh fscgu CUGCA d)Cfa UfuGf GAUCA GfAfU Ufgau CAAAC fcaca cUfgC GUG aacgu faguu aL96 csasg AD-397186 asasg 1436 VPusU 1437 AGAAG 1438 ag(Ch fscgu AGCAC d)Afc GfcAf UAACU UfAfA Afguu UGCAC fcuug aGfuG GAC cacga fcucu aL96 uscsu AD-397187 asgsc 1439 VPusU 1440 AGAGC 1441 ac(Uh fsagu ACUAA d)Afa CfgUf CUUGC CfUfU Gfcaa ACGAC fgcac gUfuA UAU gacua fgugc aL96 uscsu AD-397188 gscsa 1442 VPusA 1443 GAGCA 1444 cu(Ah fsuag CUAAC d)Afc UfcGf UUGCA UfUfG Ufgca CGACU fcacg aGfuU AUG acuau fagug aL96 csusc AD-397189 asasa 1445 VPusG 1446 CCAAA 1447 gu(Uh fsgua GUUUA d)Ufa GfuCf CUCAA CfUfC Ufuga GACUA faaga gUfaA CCA cuacc facuu aL96 usgsg AD-397190 csgsc 1448 VPusG 1449 AGCGC 1450 au(Gh fsaca AUGAA d)Afa GfaGf CCAGU CfCfA Afcug CUCUG fgucu gUfuC UCC cuguc faugc aL96 gscsu AD-397191 csasc 1451 VPusC 1452 CCCAC 1453 au(Ch fsggu AUCGU d)Gfu AfaGf GAUUC GfAfU Gfaau CUUAC fuccu cAfcG CGU uaccg faugu aL96 gsgsg AD-397192 asusg 1454 VPusC 1455 ACAUG 1456 cu(Gh fsgga CUGAA d)Afa CfgUf GAAGU GfAfA Afcuu ACGUC fguac cUfuC CGU guccg fagca aL96 usgsu AD-397193 gsasg 1457 VPusA 1458 ACGAG 1459 cg(Ch fsgag CGCAU d)Afu AfcUf GAACC GfAfA Gfguu AGUCU fccag cAfuG CUG ucucu fcgcu aL96 csgsu AD-397194 gsasg 1460 VPusU 1461 AGGAG 1462 ca(Gh fscgu CAGAA d)Afa CfgGf CUACU CfUfA Afgua CCGAC fcucc gUfuC GAU gacga fugcu aL96 cscsu AD-397195 csasc 1463 VPusA 1464 CACAC 1465 cc(Ah fsagg CCACA d)Cfa AfaUf UCGUG UfCfG Cfacg AUUCC fugau aUfgU UUA uccuu fgggu aL96 gsusg AD-397196 asgsa 1466 VPusG 1467 GAAGA 1468 gc(Ah fsucg GCACU d)Cfu UfgCf AACUU AfAfC Afagu GCACG fuugc uAfgU ACU acgac fgcuc aL96 ususc AD-397197 csasc 1469 VPusC 1470 AGCAC 1471 ua(Ah fsaua UAACU d)Cfu GfuCf UGCAC UfGfC Gfug GACUA facga caAfg UGG cuaug Ufuag aL96 ugscs u AD-397198 csusc 1472 VPusG 1473 UACUC 1474 aa(Gh fsguu AAGAC d)Afc CfaCf UACCA UfAfC Ufggu GUGAA fcagu aGfuC CCU gaacc fuuga aL96 gsusa AD-397199 asgsc 1475 VPusA 1476 ACAGC 1477 ac(Ah fsaaa ACACC d)Cfc UfgCf CUAAA CfUfA Ufuua GCAUU faagc gGfgU UUG auuuu fgugc aL96 usgsu AD-397200 asasg 1478 VPusU 1479 AGAAG 1480 ga(Gh fscgg GAGCA d)Cfa AfgUf GAACU GfAfA Afguu ACUCC fcuac cUfgC GAC uccga fuccu aL96 uscsu AD-397201 gsgsa 1481 VPusC 1482 AAGGA 1483 gc(Ah fsguc GCAGA d)Gfa GfgAf ACUAC AfCfU Gfuag UCCGA facuc uUfcU CGA cgacg fgcuc aL96 csusu AD-397202 gsasa 1484 VPusG 1485 AAGAA 1486 ac(Ah fsgau ACAGU d)Gfu GfgAf ACACA AfCfA Ufgug UCCAU fcauc uAfcU CCA caucc fguuu aL96 csusu AD-397203 csusg 1487 VPusG 1488 CCCUG 1489 aa(Ch fsuuu AACUG d)Ufg GfuGf CAGAU CfAfG Afucu CACAA fauca gCfaG ACG caaac fuuca aL96 gsgsg AD-397204 cscsa 1490 VPusG 1491 ACCCA 1492 ca(Uh fsgua CAUCG d)Cfg AfgGf UGAUU UfGfA Afauc CCUUA fuucc aCfgA CCG uuacc fugug aL96 gsgsu AD-397205 gsusg 1493 VPusA 1494 UCGUG 1495 cc(Ch fsacu CCCGA d)Gfa UfgCf CAAGU CfAfA Afcuu GCAAG fgugc gUfcG UUC aaguu fggca aL96 csgsa AD-397206 gsasc 1496 VPusG 1497 AAGAC 1498 ua(Ch fsaag UACCA d)Cfa AfgGf GUGAA GfUfG Ufuca CCUCU faacc cUfgG UCC ucuuc fuagu aL96 csusu AD-397207 gsusc 1499 VPusA 1500 AAGUC 1501 cg(Ch fscca CGCCA d)Cfa GfuUf UCAAA UfCfA Ufuug AACUG faaaa aUfgG GUG cuggu fcgga aL96 csusu AD-397208 gsgsc 1502 VPusU 1503 CUGGC 1504 cc(Uh fsgau CCUCG d)Cfg GfuAf AGAAU AfGfA Afuuc UACAU fauua uCfgA CAC cauca fgggc aL96 csasg AD-397209 csasu 1505 VPusG 1506 AACAU 1507 gc(Uh fsgac GCUGA d)Gfa GfuAf AGAAG AfGfA Cfuuc UACGU fagua uUfcA CCG cgucc fgcau aL96 gsusu AD-397210 usgsc 1508 VPusA 1509 CAUGC 1510 ug(Ah fscgg UGAAG d)Afg AfcGf AAGUA AfAfG Ufacu CGUCC fuacg uCfuU GUG uccgu fcagc aL96 asusg AD-397211 uscsc 1511 VPusC 1512 AGUCC 1513 gc(Ch fsacc GCCAU d)Afu AfgUf CAAAA CfAfA Ufuuu ACUGG faaac gAfuG UGU uggug fgcgg aL96 ascsu AD-397212 ususg 1514 VPusA 1515 ACUUG 1516 ca(Ch fsgca CACGA d)Gfa UfgCf CUAUG CfUfA Cfaua GCAUG fuggc gUfcG CUG augcu fugca aL96 asgsu AD-397213 uscsc 1517 VPusC 1518 UGUCC 1519 ca(Gh fsauu CAGGU d)Gfu CfuCf CAUGA CfAfU Ufcau GAGAA fgaga gAfcC UGG gaaug fuggg aL96 ascsa AD-397214 csusg 1520 VPusG 1521 UGCUG 1522 aa(Gh fscac AAGAA d)Afa GfgAf GUACG GfUfA Cfgua UCCGU fcguc cUfuC GCG cgugc fuuca aL96 gscsa AD-397215 csgsu 1523 VPusA 1524 UCCGU 1525 gu(Gh fsugc GUGAU d)Afu GfcUf CUACG CfUfA Cfgua AGCGC fcgag gAfuC AUG cgcau facac aL96 gsgsa AD-397216 usasc 1526 VPusG 1527 AGUAC 1528 ug(Ch fsggu UGCCA d)Cfa AfgAf AGAGG AfGfA Cfcuc UCUAC fgguc uUfgG CCU uaccc fcagu aL96 ascsu AD-397217 csasc 1529 VPusU 1530 AGCAC 1531 cg(Ah fsggg CGAGA d)Gfa AfcAf GAGAA GfAfG Ufucu UGUCC faaug cUfcU CAG uccca fcggu aL96 gscsu AD-397218 csasa 1532 VPusG 1533 CCCAA 1534 gg(Ch fsaac GGCCU d)Cfu AfcAf CAUCA CfAfU Ufgau UGUGU fcaug gAfgG UCA uguuc fccuu aL96 gsgsg AD-397219 gscsu 1535 VPusC 1536 AUGCU 1537 ga(Ah fsacg GAAGA d)Gfa GfaCf AGUAC AfGfU Gfuac GUCCG facgu uUfcU UGC ccgug fucag aL96 csasu AD-397220 asasg 1538 VPusC 1539 UAAAG 1540 ca(Uh fsgca CAUUU d)Ufu CfaUf UGAAC UfGfA Gfuuc AUGUG facau aAfaA CGC gugcg fugcu aL96 ususa AD-397221 csasc 1541 VPusU 1542 CACAC 1543 cu(Ch fscgu CUCCG d)Cfg AfgAf UGUGA UfGfU Ufcac UCUAC fgauc aCfgG GAG uacga faggu aL96 gsusg AD-397222 gsasa 1544 VPusC 1545 CAGAA 1546 gg(Ah fsgga GGAGC d)Gfc GfuAf AGAAC AfGfA Gfuuc UACUC facua uGfcU CGA cuccg fccuu aL96 csusg AD-397223 gsasa 1547 VPusU 1548 AAGAA 1549 ga(Ah fsgga GAAAC d)Afc UfgUf AGUAC AfGfU Gfuac ACAUC facac uGfuU CAU aucca fucuu aL96 csusu AD-397224 gsusa 1550 VPusG 1551 CAGUA 1552 cu(Gh fsgua CUGCC d)Cfc GfaCf AAGAG AfAfG Cfucu GUCUA faggu uGfgC CCC cuacc fagua aL96 csusg AD-397225 ascsu 1553 VPusA 1554 GUACU 1555 gc(Ch fsggg GCCAA d)Afa UfaGf GAGGU GfAfG Afccu CUACC fgucu cUfuG CUG acccu fgcag aL96 usasc AD-397226 ascsu 1556 VPusC 1557 GCACU 1558 aa(Ch fscau AACUU d)Ufu AfgUf GCACG GfCfA Cfgug ACUAU fcgac cAfaG GGC uaugg fuuag aL96 usgsc AD-397227 gsusc 1559 VPusC 1560 GUGUC 1561 cc(Ah fscgc CCAUU d)Ufu CfgUf CUUUU CfUfU Afaaa ACGGC fuuac gAfaU GGA ggcgg fggga aL96 csasc AD-397228 asasg 1562 VPusA 1563 CAAAG 1564 cu(Gh fsacg CUGAC d)Afc GfcCf AAGAA AfAfG Ufucu GGCCG faagg uGfuC UUA ccguu fagcu aL96 ususg AD-397229 usgsa 1565 VPusG 1566 GCUGA 1567 ca(Ah fsgau CAAGA d)Gfa AfaCf AGGCC AfGfG Gfgcc GUUAU fccgu uUfcU CCA uaucc fuguc aL96 asgsc AD-397230 asgsc 1568 VPusG 1569 AAAGC 1570 au(Uh fscgc AUUUU d)Ufu AfcAf GAACA GfAfA Ufguu UGUGC fcaug cAfaA GCA ugcgc faugc aL96 ususu AD-397231 usgsu 1571 VPusU 1572 CGUGU 1573 ga(Uh fscau GAUCU d)Cfu GfcGf ACGAG AfCfG Cfucg CGCAU fagcg uAfgA GAA cauga fucac aL96 ascsg AD-397233 csasg 1574 VPusA 1575 UGCAG 1576 cg(Ah fsguu CGAGA d)Gfa AfgUf AGAGC AfGfA Gfcuc ACUAA fgcac uUfcU CUU uaacu fcgcu aL96 gscsa AD-397234 asgsc 1577 VPusA 1578 GCAGC 1579 gu(Gh fsaac GUGUC d)Ufc UfuUf AACCC AfAfC Gfggu AAAGU fccaa uGfaC UUA aguuu facgc aL96 usgsc AD-397235 usgsu 1580 VPusG 1581 CGUGU 1582 ca(Ah fsagu CAACC d)Cfc AfaAf CAAAG CfAfA Cfuuu UUUAC faguu gGfgU UCA uacuc fugac aL96 ascsg AD-397236 usgsu 1583 VPusC 1584 UGUGU 1585 cc(Ch fsgcc CCCAU d)Afu GfuAf UCUUU UfCfU Afaag UACGG fuuua aAfuG CGG cggcg fggac aL96 ascsa AD-397237 gsusg 1586 VPusA 1587 GCGUG 1588 uc(Ah fsgua UCAAC d)Afc AfaCf CCAAA CfCfA Ufuug GUUUA faagu gGfuU CUC uuacu fgaca aL96 csgsc AD-397238 asasg 1589 VPusG 1590 CCAAG 1591 au(Ch fsgga AUCCU d)Cfu AfgUf GAUAA GfAfU Ufuau ACUUC faaac cAfgG CCA uuccc faucu aL96 usgsg AD-397239 asgsa 1592 VPusU 1593 CAAGA 1594 uc(Ch fsggg UCCUG d)Ufg AfaGf AUAAA AfUfA Ufuua CUUCC faacu uCfaG CAC uccca fgauc aL96 ususg AD-397240 csusu 1595 VPusA 1596 UCCUU 1597 ac(Ch fscca ACCGU d)Gfu AfcUf UGCCU UfGfC Afggc AGUUG fcuag aAfcG GUG uuggu fguaa aL96 gsgsa AD-397241 gsusg 1598 VPusC 1599 AAGUG 1600 ug(Uh fsgua UGUCC d)Cfc AfaAf CAUUC CfAfU Gfaau UUUUA fucuu gGfgA CGG uuacg fcaca aL96 csusu AD-397242 gsusg 1601 VPusG 1602 GUGUG 1603 uc(Ch fsccg UCCCA d)Cfa UfaAf UUCUU UfUfC Afaga UUACG fuuuu aUfgG GCG acggc fgaca aL96 csasc AD-397243 csasu 1604 VPusU 1605 GUCAU 1606 ag(Ch fsgac AGCAA d)Afa AfaUf CCGUG CfCfG Cfacg AUUGU fugau gUfuG CAU uguca fcuau aL96 gsasc AD-397244 gsasa 1607 VPusU 1608 CAGAA 1609 cg(Gh fsugg CGGAU d)Afu AfuUf AUGAG AfUfG Cfuca AAUCC fagaa uAfuC AAC uccaa fcguu aL96 csusg AD-397245 usgsu 1610 VPusC 1611 AGUGU 1612 gu(Ch fscgu GUCCC d)Cfc AfaAf AUUCU AfUfU Afgaa UUUAC fcuuu uGfgG GGC uacgg facac aL96 ascsu AD-397246 gscsa 1613 VPusG 1614 UAGCA 1615 ac(Ch fsuga ACCGU d)Gfu UfgAf GAUUG GfAfU Cfaau UCAUC fuguc cAfcG ACC aucac fguug aL96 csusa AD-397247 gscsa 1616 VPusG 1617 AUGCA 1618 gc(Gh fsuua GCGAG d)Afg GfuGf AAGAG AfAfG Cfucu CACUA fagca uCfuC ACU cuaac fgcug aL96 csasu AD-397248 csasg 1619 VPusU 1620 UGCAG 1621 aa(Uh fsgaa AAUUC d)Ufc UfcAf GGACA GfGfA Ufguc UGAUU fcaug cGfaA CAG auuca fuucu aL96 gscsa AD-397249 uscsc 1622 VPusU 1623 GAUCC 1624 ug(Ah fscgu UGAUA d)Ufa GfgGf AACUU AfAfC Afagu CCCAC fuucc uUfaU GAC cacga fcagg aL96 asusc AD-397250 asgsa 1625 VPusU 1626 GCAGA 1627 ac(Gh fsgga ACGGA d)Gf UfuCf UAUGA aUfAf Ufcau GAAUC Ufgag aUfcC CAA aaucc fguuc aaL96 usgsc AD-397251 cscsu 1628 VPusC 1629 UUCCU 1630 ua(Ch fscaa UACCG d)Cfg CfuAf UUGCC UfUfG Gfgca UAGUU fccua aCfgG GGU guugg fuaag aL96 gsasa AD-397252 asusc 1631 VPusC 1632 AGAUC 1633 cu(Gh fsgug CUGAU d)Afu GfgAf AAACU AfAfA Afguu UCCCA fcuuc uAfuC CGA ccacg fagga aL96 uscsu AD-397253 cscsu 1634 VPusG 1635 AUCCU 1636 ga(Uh fsucg GAUAA d)Afa UfgGf ACUUC AfCfU Gfaag CCACG fuccc uUfuA ACA acgac fucag aL96 gsasu AD-397254 csgsg 1637 VPusG 1638 AGCGG 1639 au(Gh fsucu AUGGA d)Gfa CfaCf UGUUU UfGfU Afaac GUGAG fuugu aUfcC ACC gagac faucc aL96 gscsu AD-397255 gsasc 1640 VPusA 1641 UUGAC 1642 ac(Gh fsugc ACGGA d)Gfa AfgUf AGAGU AfGfA Afcuc ACUGC fguac uUfcC AUG ugcau fgugu aL96 csasa AD-397256 gscsa 1643 VPusU 1644 AUGCA 1645 gc(Ah fscuc GCAGA d)Gfa AfuAf ACGGA AfCfG Ufccg UAUGA fgaua uUfcU GAA ugaga fgcug aL96 csasu AD-397257 gscsa 1646 VPusG 1647 CAGCA 1648 ga(Ah fsauu GAACG d)Cfg CfuCf GAUAU GfAfU Afuau GAGAA fauga cCfgU UCC gaauc fucug aL96 csusg AD-397258 csasg 1649 VPusG 1650 AGCAG 1651 aa(Ch fsgau AACGG d)Gfg UfcUf AUAUG AfUfA Cfaua AGAAU fugag uCfcG CCA aaucc fuucu aL96 gscsu AD-397259 ascsc 1652 VPusC 1653 ACACC 1654 gu(Ch fsaug GUCGC d)Gfc UfcUf CAAAG CfAfA Cfuuu AGACA fagag gGfcG UGC acaug facgg aL96 usgsu AD-397260 gsusu 1655 VPusU 1656 AUGUU 1657 cu(Gh fsguu CUGUG d)Ufg GfaGf GUAAA GfUfA Ufuua CUCAA faacu cCfaC CAU caaca fagaa aL96 csasu AD-397261 gsgsu 1658 VPusU 1659 CUGGU 1660 ac(Uh fsuca ACUUU d)Ufu GfuGf GAUGU GfAfU Afcau CACUG fguca cAfaA AAG cugaa fguac aL96 csasg AD-397262 cscsc 1661 VPusA 1662 AACCC 1663 aa(Ah fsguc AAAGU d)Gfu UfuGf UUACU UfUfA Afgua CAAGA fcuca aAfcU CUA agacu fuugg aL96 gsusu AD-397263 cscsa 1664 VPusU 1665 ACCCA 1666 aa(Gh fsagu AAGUU d)Ufu CfuUf UACUC UfAfC Gfagu AAGAC fucaa aAfaC UAC gacua fuuug aL96 gsgsu AD-397264 csasu 1667 VPusA 1668 CUCAU 1669 ca(Uh fsgca CAUGU d)Gfu UfgUf GUUCA GfUfU Ufgaa ACAUG fcaac cAfcA CUG augcu fugau aL96 gsasg AD-397265 asasc 1670 VPusA 1671 UCAAC 1672 au(Gh fscgu AUGCU d)Cfu AfcUf GAAGA GfAfA Ufcuu AGUAC fgaag cAfgC GUC uacgu faugu aL96 usgsa AD-397266 ususc 1673 VPusA 1674 UGUUC 1675 ug(Uh fsugu UGUGG d)Gfg UfgAf UAAAC UfAfA Gfuuu UCAAC facuc aCfcA AUG aacau fcaga aL96 ascsa AD-397267 uscsu 1676 VPusC 1677 GUUCU 1678 gu(Gh fsaug GUGGU d)Gfu UfuGf AAACU AfAfA Afguu CAACA fcuca uAfcC UGC acaug facag aL96 asasc
TABLE-US-00026 TABLE 5B Mouse APP Modified Sequences, No “L96” Linker, No Vinyl-Phosphate Anti- Sense sense Se- Se- quence quence mRNA (5′ SEQ (5′ SEQ target SEQ Duplex to ID to ID se- ID Name 3′) NO 3′) NO quence NO AD-397175 csasu 1403 usUfs 1404 GCCAU 1405 gu(Uh gagUf GUUCU d)Cfu uUfAf GUGGU GfUfG ccacA AAACU fguaa fgAfa CAA acuca caugs a gsc AD-397176 usgsu 1406 usGfs 1407 CAUGU 1408 uc(Uh uugAf UCUGU d)Gfu gUfUf GGUAA GfGfU uaccA ACUCA faaac fcAfg ACA ucaac aacas a usg AD-397177 asusg 1409 usUfs 1410 CCAUG 1411 uu(Ch ugaGf UUCUG d)Ufg uUfUf UGGUA UfGfG accaC AACUC fuaaa faGfa AAC cucaa acaus a gsg AD-397178 csusg 1412 usGfs 1413 UUCUG 1414 ug(Gh cauGf UGGUA d)Ufa uUfGf AACUC AfAfC aguuU AACAU fucaa faCfc GCA caugc acags a asa AD-397179 gsgsu 1415 usAfs 1416 GUGGU 1417 aa(Ah uguGf AAACU d)Cfu cAfUf CAACA CfAfA guugA UGCAC fcaug fgUfu AUG cacau uaccs a asc AD-397180 usgsu 1418 usUfs 1419 UCUGU 1420 gg(Uh gcaUf GGUAA d)Afa gUfUf ACUCA AfCfU gaguU ACAUG fcaac fuAfc CAC augca cacas a gsa AD-397181 gsasa 1421 usCfs 1422 GAGAA 1423 ga(Gh gugCf GAGCA d)Cfa aAfGf CUAAC CfUfA uuagU UUGCA facuu fgCfu CGA gcacg cuucs a usc AD-397182 cscsg 1424 usUfs 1425 UCCCG 1426 cu(Gh gacAf CUGGU d)Gfu uCfAf ACUUU AfCfU aaguA GAUGU fuuga fcCfa CAC uguca gcggs a gsa AD-397183 cscsa 1427 usGfs 1428 CGCCA 1429 ug(Uh aguUf UGUUC d)Ufc uAfCf UGUGG UfGfU cacaG UAAAC fggua faAfc UCA aacuc auggs a csg AD-397184 gsusg 1430 usGfs 1431 CUGUG 1432 gu(Ah ugcAf GUAAA d)Afa uGfUf CUCAA CfUfC ugagU CAUGC faaca fuUfa ACA ugcac ccacs a asg AD-397185 gsasa 1433 usAfs 1434 CUGAA 1435 cu(Gh cguUf CUGCA d)Cfa uGfUf GAUCA GfAfU gaucU CAAAC fcaca fgCfa GUG aacgu guucs a asg AD-397186 asasg 1436 usUfs 1437 AGAAG 1438 ag(Ch cguGf AGCAC d)Afc cAfAf UAACU UfAfA guuaG UGCAC fcuug fuGfc GAC cacga ucuus a csu AD-397187 asgsc 1439 usUfs 1440 AGAGC 1441 ac(Uh aguCf ACUAA d)Afa gUfGf CUUGC CfUfU caagU ACGAC fgcac fuAfg UAU gacua ugcus a csu AD-397188 gscsa 1442 usAfs 1443 GAGCA 1444 cu(Ah uagUf CUAAC d)Afc cGfUf UUGCA UfUfG gcaaG CGACU fcacg fuUfa AUG acuau gugcs a usc AD-397189 asasa 1445 usGfs 1446 CCAAA 1447 gu(Uh guaGf GUUUA d)Ufa uCfUf CUCAA CfUfC ugagU GACUA faaga faAfa CCA cuacc cuuus a gsg AD-397190 csgsc 1448 usGfs 1449 AGCGC 1450 au(Gh acaGf AUGAA d)Afa aGfAf CCAGU CfCfA cuggU CUCUG fgucu fuCfa UCC cuguc ugcgs a csu AD-397191 csasc 1451 usCfs 1452 CCCAC 1453 au(Ch gguAf AUCGU d)Gfu aGfGf GAUUC GfAfU aaucA CUUAC fuccu fcGfa CGU uaccg ugugs a gsg AD-397192 asusg 1454 usCfs 1455 ACAUG 1456 cu(Gh ggaCf CUGAA d)Afa gUfAf GAAGU GfAfA cuucU ACGUC fguac fuCfa CGU guccg gcaus a gsu AD-397193 gsasg 1457 usAfs 1458 ACGAG 1459 cg(Ch gagAf CGCAU d)Afu cUfGf GAACC GfAfA guucA AGUCU fccag fuGfc CUG ucucu gcucs a gsu AD-397194 gsasg 1460 usUfs 1461 AGGAG 1462 ca(Gh cguCf CAGAA d)Afa gGfAf CUACU CfUfA guagU CCGAC fcucc fuCfu GAU gacga gcucs a csu AD-397195 csasc 1463 usAfs 1464 CACAC 1465 cc(Ah aggAf CCACA d)Cfa aUfCf UCGUG UfCfG acgaU AUUCC fugau fgUfg UUA uccuu ggugs a usg AD-397196 asgsa 1466 usGfs 1467 GAAGA 1468 gc(Ah ucgUf GCACU d)Cfu gCfAf AACUU AfAfC aguuA GCACG fuugc fgUfg ACU acgac cucus a usc AD-397197 csasc 1469 usCfs 1470 AGCAC 1471 ua(Ah auaGf UAACU d)Cfu uCfGf UGCAC UfGfC ugcaA GACUA facga fgUfu UGG cuaug agugs a csu AD-397198 csusc 1472 usGfs 1473 UACUC 1474 aa(Gh guuCf AAGAC d)Afc aCfUf UACCA UfAfC gguaG GUGAA fcagu fuCfu CCU gaacc ugags a usa AD-397199 asgsc 1475 usAfs 1476 ACAGC 1477 ac(Ah aaaUf ACACC d)Cfc gCfUf CUAAA CfUfA uuagG GCAUU faagc fgUfg UUG auuuu ugcus a gsu AD-397200 asasg 1478 usUfs 1479 AGAAG 1480 ga(Gh cggAf GAGCA d)Cfa gUfAf GAACU GfAfA guucU ACUCC fcuac fgCfu GAC uccga ccuus a csu AD-397201 gsgsa 1481 usCfs 1482 AAGGA 1483 gc(Ah gucGf GCAGA d)Gfa gAfGf ACUAC AfCfU uaguU UCCGA facuc fcUfg CGA cgacg cuccs a usu AD-397202 gsasa 1484 usGfs 1485 AAGAA 1486 ac(Ah gauGf ACAGU d)Gfu gAfUf ACACA AfCfA guguA UCCAU fcauc fcUfg CCA caucc uuucs a usu AD-397203 csusg 1487 usGfs 1488 CCCUG 1489 aa(Ch uuuGf AACUG d)Ufg uGfAf CAGAU CfAfG ucugC CACAA fauca faGfu ACG caaac ucags a gsg AD-397204 cscsa 1490 usGfs 1491 ACCCA 1492 ca(Uh guaAf CAUCG d)Cfg gGfAf UGAUU UfGfA aucaC CCUUA fuucc fgAfu CCG uuacc guggs a gsu AD-397205 gsusg 1493 usAfs 1494 UCGUG 1495 cc(Ch acuUf CCCGA d)Gfa gCfAf CAAGU CfAfA cuugU GCAAG fgugc fcGfg UUC aaguu gcacs a gsa AD-397206 gsasc 1496 usGfs 1497 AAGAC 1498 ua(Ch aagAf UACCA d)Cfa gGfUf GUGAA GfUfG ucacU CCUCU faacc fgGfu UCC ucuuc agucs a usu AD-397207 gsusc 1499 usAfs 1500 AAGUC 1501 cg(Ch ccaGf CGCCA d)Cfa uUfUf UCAAA UfCfA uugaU AACUG faaaa fgGfc GUG cuggu ggacs a usu AD-397208 gsgsc 1502 usUfs 1503 CUGGC 1504 cc(Uh gauGf CCUCG d)Cfg uAfAf AGAAU AfGfA uucuC UACAU fauua fgAfg CAC cauca ggccs a asg AD-397209 csasu 1505 usGfs 1506 AACAU 1507 gc(Uh gacGf GCUGA d)Gfa uAfCf AGAAG AfGfA uucuU UACGU fagua fcAfg CCG cgucc caugs a usu AD-397210 usgsc 1508 usAfs 1509 CAUGC 1510 ug(Ah cggAf UGAAG d)Afg cGfUf AAGUA AfAfG acuuC CGUCC fuacg fuUfc GUG uccgu agcas a usg AD-397211 uscsc 1511 usCfs 1512 AGUCC 1513 gc(Ch accAf GCCAU d)Afu gUfUf CAAAA CfAfA uuugA ACUGG faaac fuGfg UGU uggug cggas a csu AD-397212 ususg 1514 usAfs 1515 ACUUG 1516 ca(Ch gcaUf CACGA d)Gfa gCfCf CUAUG CfUfA auagU GCAUG fuggc fcGfu CUG augcu gcaas a gsu AD-397213 uscsc 1517 usCfs 1518 UGUCC 1519 ca(Gh auuCf CAGGU d)Gfu uCfUf CAUGA CfAfU caugA GAGAA fgaga fcCfu UGG gaaug gggas a csa AD-397214 csusg 1520 usGfs 1521 UGCUG 1522 aa(Gh cacGf AAGAA d)Afa gAfCf GUACG GfUfA guacU UCCGU fcguc fuCfu GCG cgugc ucags a csa AD-397215 csgsu 1523 usAfs 1524 UCCGU 1525 gu(Gh ugcGf GUGAU d)Afu cUfCf CUACG CfUfA guagA AGCGC fcgag fuCfa AUG cgcau cacgs a gsa AD-397216 usasc 1526 usGfs 1527 AGUAC 1528 ug(Ch gguAf UGCCA d)Cfa gAfCf AGAGG AfGfA cucuU UCUAC fgguc fgGfc CCU uaccc aguas a csu AD-397217 csasc 1529 usUfs 1530 AGCAC 1531 cg(Ah gggAf CGAGA d)Gfa cAfUf GAGAA GfAfG ucucU UGUCC faaug fcUfc CAG uccca ggugs a csu AD-397218 csasa 1532 usGfs 1533 CCCAA 1534 gg(Ch aacAf GGCCU d)Cfu cAfUf CAUCA CfAfU gaugA UGUGU fcaug fgGfc UCA uguuc cuugs a gsg AD-397219 gscsu 1535 usCfs 1536 AUGCU 1537 ga(Ah acgGf GAAGA d)Gfa aCfGf AGUAC AfGfU uacuU GUCCG facgu fcUfu UGC ccgug cagcs a asu AD-397220 asasg 1538 usCfs 1539 UAAAG 1540 ca(Uh gcaCf CAUUU d)Ufu aUfGf UGAAC UfGfA uucaA AUGUG facau faAfu CGC gugcg gcuus a usa AD-397221 csasc 1541 usUfs 1542 CACAC 1543 cu(Ch cguAf CUCCG d)Cfg gAfUf UGUGA UfGfU cacaC UCUAC fgauc fgGfa GAG uacga ggugs a usg AD-397222 gsasa 1544 usCfs 1545 CAGAA 1546 gg(Ah ggaGf GGAGC d)Gfc uAfGf AGAAC AfGfA uucuG UACUC facua fcUfc CGA cuccg cuucs a usg AD-397223 gsasa 1547 usUfs 1548 AAGAA 1549 ga(Ah ggaUf GAAAC d)Afc gUfGf AGUAC AfGfU uacuG ACAUC facac fuUfu CAU aucca cuucs a usu AD-397224 gsusa 1550 usGfs 1551 CAGUA 1552 cu(Gh guaGf CUGCC d)Cfc aCfCf AAGAG AfAfG ucuuG GUCUA faggu fgCfa CCC cuacc guacs a usg AD-397225 ascsu 1553 usAfs 1554 GUACU 1555 gc(Ch gggUf GCCAA d)Afa aGfAf GAGGU GfAfG ccucU CUACC fgucu fuGfg CUG acccu cagus a asc AD-397226 ascsu 1556 usCfs 1557 GCACU 1558 aa(Ch cauAf AACUU d)Ufu gUfCf GCACG GfCfA gugcA ACUAU fcgac faGfu GGC uaugg uagus a gsc AD-397227 gsusc 1559 usCfs 1560 GUGUC 1561 cc(Ah cgcCf CCAUU d)Ufu gUfAf CUUUU CfUfU aaagA ACGGC fuuac faUfg GGA ggcgg ggacs a asc AD-397228 asasg 1562 usAfs 1563 CAAAG 1564 cu(Gh acgGf CUGAC d)Afc cCfUf AAGAA AfAfG ucuuG GGCCG faagg fuCfa UUA ccguu gcuus a usg AD-397229 usgsa 1565 usGfs 1566 GCUGA 1567 ca(Ah gauAf CAAGA d)Gfa aCfGf AGGCC AfGfG gccuU GUUAU fccgu fcUfu CCA uaucc gucas a gsc AD-397230 asgsc 1568 usGfs 1569 AAAGC 1570 au(Uh cgcAf AUUUU d)Ufu cAfUf GAACA GfAfA guucA UGUGC fcaug faAfa GCA ugcgc ugcus a usu AD-397231 usgsu 1571 usUfs 1572 CGUGU 1573 ga(Uh cauGf GAUCU d)Cfu cGfCf ACGAG AfCfG ucguA CGCAU fagcg fgAfu GAA cauga cacas a csg AD-397233 csasg 1574 usAfs 1575 UGCAG 1576 cg(Ah guuAf CGAGA d)Gfa gUfGf AGAGC AfGfA cucuU ACUAA fgcac fcUfc CUU uaacu gcugs a csa AD-397234 asgsc 1577 usAfs 1578 GCAGC 1579 gu(Gh aacUf GUGUC d)Ufc uUfGf AACCC AfAfC gguuG AAAGU fccaa faCfa UUA aguuu cgcus a gsc AD-397235 usgsu 1580 usGfs 1581 CGUGU 1582 ca(Ah aguAf CAACC d)Cfc aAfCf CAAAG CfAfA uuugG UUUAC faguu fgUfu UCA uacuc gacas a csg AD-397236 usgsu 1583 usCfs 1584 UGUGU 1585 cc(Ch gccGf CCCAU d)Afu uAfAf UCUUU UfCfU aagaA UACGG fuuua fuGfg CGG cggcg gacas a csa AD-397237 gsusg 1586 usAfs 1587 GCGUG 1588 uc(Ah guaAf UCAAC d)Afc aCfUf CCAAA CfCfA uuggG GUUUA faagu fuUfg CUC uuacu acacs a gsc AD-397238 asasg 1589 usGfs 1590 CCAAG 1591 au(Ch ggaAf AUCCU d)Cfu gUfUf GAUAA GfAfU uaucA ACUUC faaac fgGfa CCA uuccc ucuus a gsg AD-397239 asgsa 1592 usUfs 1593 CAAGA 1594 uc(Ch gggAf UCCUG d)Ufg aGfUf AUAAA AfUfA uuauC CUUCC faacu faGfg CAC uccca aucus a usg AD-397240 csusu 1595 usAfs 1596 UCCUU 1597 ac(Ch ccaAf ACCGU d)Gfu cUfAf UGCCU UfGfC ggcaA AGUUG fcuag fcGfg GUG uuggu uaags a gsa AD-397241 gsusg 1598 usCfs 1599 AAGUG 1600 ug(Uh guaAf UGUCC d)Cfc aAfGf CAUUC CfAfU aaugG UUUUA fucuu fgAfc CGG uuacg acacs a usu AD-397242 gsusg 1601 usGfs 1602 GUGUG 1603 uc(Ch ccgUf UCCCA d)Cfa aAfAf UUCUU UfUfC agaaU UUACG fuuuu fgGfg GCG acggc acacs a asc AD-397243 csasu 1604 usUfs 1605 GUCAU 1606 ag(Ch gacAf AGCAA d)Afa aUfCf CCGUG CfCfG acggU AUUGU fugau fuGfc CAU uguca uaugs a asc AD-397244 gsasa 1607 usUfs 1608 CAGAA 1609 cg(Gh uggAf CGGAU d)Afu uUfCf AUGAG AfUfG ucauA AAUCC fagaa fuCfc AAC uccaa guucs a usg AD-397245 usgsu 1610 usCfs 1611 AGUGU 1612 gu(Ch cguAf GUCCC d)Cfc aAfAf AUUCU AfUfU gaauG UUUAC fcuuu fgGfa GGC uacgg cacas a csu AD-397246 gscsa 1613 usGfs 1614 UAGCA 1615 ac(Ch ugaUf ACCGU d)Gfu gAfCf GAUUG GfAfU aaucA UCAUC fuguc fcGfg ACC aucac uugcs a usa AD-397247 gscsa 1616 usGfs 1617 AUGCA 1618 gc(Gh uuaGf GCGAG d)Afg uGfCf AAGAG AfAfG ucuuC CACUA fagca fuCfg ACU cuaac cugcs a asu AD-397248 csasg 1619 usUfs 1620 UGCAG 1621 aa(Uh gaaUf AAUUC d)Ufc cAfUf GGACA GfGfA guccG UGAUU fcaug faAfu CAG auuca ucugs a csa AD-397249 uscsc 1622 usUfs 1623 GAUCC 1624 ug(Ah cguGf UGAUA d)Ufa gGfAf AACUU AfAfC aguuU CCCAC fuucc faUfc GAC cacga aggas a usc AD-397250 asgsa 1625 usUfs 1626 GCAGA 1627 ac(Gh ggaUf ACGGA d)Gfa uCfUf UAUGA UfAfU cauaU GAAUC fgaga fcCfg CAA aucca uucus a gsc AD-397251 cscsu 1628 usCfs 1629 UUCCU 1630 ua(Ch caaCf UACCG d)Cfg uAfGf UUGCC UfUfG gcaaC UAGUU fccua fgGfu GGU guugg aaggs a asa AD-397252 asusc 1631 usCfs 1632 AGAUC 1633 cu(Gh gugGf CUGAU d)Afu gAfAf AAACU AfAfA guuuA UCCCA fcuuc fuCfa CGA ccacg ggaus a csu AD-397253 cscsu 1634 usGfs 1635 AUCCU 1636 ga(Uh ucgUf GAUAA d)Afa gGfGf ACUUC AfCfU aaguU CCACG fuccc fuAfu ACA acgac caggs a asu AD-397254 csgsg 1637 usGfs 1638 AGCGG 1639 au(Gh ucuCf AUGGA d)Gfa aCfAf UGUUU UfGfU aacaU GUGAG fuugu fcCfa ACC gagac uccgs a csu AD-397255 gsasc 1640 usAfs 1641 UUGAC 1642 ac(Gh ugcAf ACGGA d)Gfa gUfAf AGAGU AfGfA cucuU ACUGC fguac fcCfg AUG ugcau ugucs a asa AD-397256 gscsa 1643 usUfs 1644 AUGCA 1645 gc(Ah cucAf GCAGA d)Gfa uAfUf ACGGA AfCfG ccguU UAUGA fgaua fcUfg GAA ugaga cugcs a asu AD-397257 gscsa 1646 usGfs 1647 CAGCA 1648 ga(Ah auuCf GAACG d)Cfg uCfAf GAUAU GfAfU uaucC GAGAA fauga fgUfu UCC gaauc cugcs a usg AD-397258 csasg 1649 usGfs 1650 AGCAG 1651 aa(Ch gauUf AACGG d)Gfg cUfCf AUAUG AfUfA auauC AGAAU fugag fcGfu CCA aaucc ucugs a csu AD-397259 ascsc 1652 usCfs 1653 ACACC 1654 gu(Ch augUf GUCGC d)Gfc cUfCf CAAAG CfAfA uuugG AGACA fagag fcGfa UGC acaug cggus a gsu AD-397260 gsusu 1655 usUfs 1656 AUGUU 1657 cu(Gh guuGf CUGUG d)Ufg aGfUf GUAAA GfUfA uuacC CUCAA faacu faCfa CAU caaca gaacs a asu AD-397261 gsgsu 1658 usUfs 1659 CUGGU 1660 ac(Uh ucaGf ACUUU d)Ufu uGfAf GAUGU GfAfU caucA CACUG fguca faAfg AAG cugaa uaccs a asg AD-397262 cscsc 1661 usAfs 1662 AACCC 1663 aa(Ah gucUf AAAGU d)Gfu uGfAf UUACU UfUfA guaaA CAAGA fcuca fcUfu CUA agacu ugggs a usu AD-397263 cscsa 1664 usUfs 1665 ACCCA 1666 aa(Gh aguCf AAGUU d)Ufu uUfGf UACUC UfAfC aguaA AAGAC fucaa faCfu UAC gacua uuggs a gsu AD-397264 csasu 1667 usAfs 1668 CUCAU 1669 ca(Uh gcaUf CAUGU d)Gfu gUfUf GUUCA GfUfU gaacA ACAUG fcaac fcAfu CUG augcu gaugs a asg AD-397265 asasc 1670 usAfs 1671 UCAAC 1672 au(Gh cguAf AUGCU d)Cfu cUfUf GAAGA GfAfA cuucA AGUAC fgaag fgCfa GUC uacgu uguus a gsa AD-397266 ususc 1673 usAfs 1674 UGUUC 1675 ug(Uh uguUf UGUGG d)Gfg gAfGf UAAAC UfAfA uuuaC UCAAC facuc fcAfc AUG aacau agaas a csa AD-397267 uscsu 1676 usCfs 1677 GUUCU 1678 gu(Gh augUf GUGGU d)Gfu uGfAf AAACU AfAfA guuuA CAACA fcuca fcCfa UGC acaug cagas a asc
TABLE-US-00027 TABLE 6 APP Unmodified Sequences, Mouse NM_001198823.1 Targeting SEQ SEQ Duplex Sense ID Position in Antisense ID Position in Name Sequence (5′ to 3′) NO NM_001198823.1 Sequence (5′ to 3′) NO NM_001198823.1 AD-397183 CCAUGUUCUGUGGUAAACUCA 1679 253-273 UGAGUUUACCACAGAACAUGGCG 1680 251-273 AD-397175 CAUGUUCUGUGGUAAACUCAA 1681 254-274 UUGAGUUUACCACAGAACAUGGC 1682 252-274 AD-397177 AUGUUCUGUGGUAAACUCAAA 1683 255-275 UUUGAGUUUACCACAGAACAUGG 1684 253-275 AD-397176 UGUUCUGUGGUAAACUCAACA 1685 256-276 UGUUGAGUUUACCACAGAACAUG 1686 254-276 AD-397260 GUUCUGUGGUAAACUCAACAA 1687 257-277 UUGUUGAGUUUACCACAGAACAU 1688 255-277 AD-397266 UUCUGUGGUAAACUCAACAUA 1689 258-278 UAUGUUGAGUUUACCACAGAACA 1690 256-278 AD-397267 UCUGUGGUAAACUCAACAUGA 1691 259-279 UCAUGUUGAGUUUACCACAGAAC 1692 257-279 AD-397178 CUGUGGUAAACUCAACAUGCA 1693 260-280 UGCAUGUUGAGUUUACCACAGAA 1694 258-280 AD-397180 UGUGGUAAACUCAACAUGCAA 1695 261-281 UUGCAUGUUGAGUUUACCACAGA 1696 259-281 AD-397184 GUGGUAAACUCAACAUGCACA 1697 262-282 UGUGCAUGUUGAGUUUACCACAG 1698 260-282 AD-397179 GGUAAACUCAACAUGCACAUA 1699 264-284 UAUGUGCAUGUUGAGUUUACCAC 1700 262-284 AD-397224 GUACUGCCAAGAGGUCUACCA 1701 362-382 UGGUAGACCUCUUGGCAGUACUG 1702 360-382 AD-397216 UACUGCCAAGAGGUCUACCCA 1703 363-383 UGGGUAGACCUCUUGGCAGUACU 1704 361-383 AD-397225 ACUGCCAAGAGGUCUACCCUA 1705 364-384 UAGGGUAGACCUCUUGGCAGUAC 1706 362-384 AD-397203 CUGAACUGCAGAUCACAAACA 1707 382-402 UGUUUGUGAUCUGCAGUUCAGGG 1708 380-402 AD-397185 GAACUGCAGAUCACAAACGUA 1709 384-404 UACGUUUGUGAUCUGCAGUUCAG 1710 382-404 AD-397195 CACCCACAUCGUGAUUCCUUA 1711 473-493 UAAGGAAUCACGAUGUGGGUGUG 1712 471-493 AD-397204 CCACAUCGUGAUUCCUUACCA 1713 476-496 UGGUAAGGAAUCACGAUGUGGGU 1714 474-496 AD-397191 CACAUCGUGAUUCCUUACCGA 1715 477-497 UCGGUAAGGAAUCACGAUGUGGG 1716 475-497 AD-397251 CCUUACCGUUGCCUAGUUGGA 1717 489-509 UCCAACUAGGCAACGGUAAGGAA 1718 487-509 AD-397240 CUUACCGUUGCCUAGUUGGUA 1719 490-510 UACCAACUAGGCAACGGUAAGGA 1720 488-510 AD-397205 GUGCCCGACAAGUGCAAGUUA 1721 534-554 UAACUUGCACUUGUCGGGCACGA 1722 532-554 AD-397254 CGGAUGGAUGUUUGUGAGACA 1723 567-587 UGUCUCACAAACAUCCAUCCGCU 1724 565-587 AD-397259 ACCGUCGCCAAAGAGACAUGA 1725 603-623 UCAUGUCUCUUUGGCGACGGUGU 1726 601-623 AD-397247 GCAGCGAGAAGAGCACUAACA 1727 622-642 UGUUAGUGCUCUUCUCGCUGCAU 1728 620-642 AD-397233 CAGCGAGAAGAGCACUAACUA 1729 623-643 UAGUUAGUGCUCUUCUCGCUGCA 1730 621-643 AD-397181 GAAGAGCACUAACUUGCACGA 1731 629-649 UCGUGCAAGUUAGUGCUCUUCUC 1732 627-649 AD-397186 AAGAGCACUAACUUGCACGAA 1733 630-650 UUCGUGCAAGUUAGUGCUCUUCU 1734 628-650 AD-397196 AGAGCACUAACUUGCACGACA 1735 631-651 UGUCGUGCAAGUUAGUGCUCUUC 1736 629-651 AD-397187 AGCACUAACUUGCACGACUAA 1737 633-653 UUAGUCGUGCAAGUUAGUGCUCU 1738 631-653 AD-397188 GCACUAACUUGCACGACUAUA 1739 634-654 UAUAGUCGUGCAAGUUAGUGCUC 1740 632-654 AD-397197 CACUAACUUGCACGACUAUGA 1741 635-655 UCAUAGUCGUGCAAGUUAGUGCU 1742 633-655 AD-397226 ACUAACUUGCACGACUAUGGA 1743 636-656 UCCAUAGUCGUGCAAGUUAGUGC 1744 634-656 AD-397212 UUGCACGACUAUGGCAUGCUA 1745 642-662 UAGCAUGCCAUAGUCGUGCAAGU 1746 640-662 AD-397182 CCGCUGGUACUUUGAUGUCAA 1747 1064-1084 UUGACAUCAAAGUACCAGCGGGA 1748 1062-1084 AD-397261 GGUACUUUGAUGUCACUGAAA 1749 1069-1089 UUUCAGUGACAUCAAAGUACCAG 1750 1067-1089 AD-397241 GUGUGUCCCAUUCUUUUACGA 1751 1094-1114 UCGUAAAAGAAUGGGACACACUU 1752 1092-1114 AD-397245 UGUGUCCCAUUCUUUUACGGA 1753 1095-1115 UCCGUAAAAGAAUGGGACACACU 1754 1093-1115 AD-397242 GUGUCCCAUUCUUUUACGGCA 1755 1096-1116 UGCCGUAAAAGAAUGGGACACAC 1756 1094-1116 AD-397236 UGUCCCAUUCUUUUACGGCGA 1757 1097-1117 UCGCCGUAAAAGAAUGGGACACA 1758 1095-1117 AD-397227 GUCCCAUUCUUUUACGGCGGA 1759 1098-1118 UCCGCCGUAAAAGAAUGGGACAC 1760 1096-1118 AD-397255 GACACGGAAGAGUACUGCAUA 1761 1143-1163 UAUGCAGUACUCUUCCGUGUCAA 1762 1141-1163 AD-397234 AGCGUGUCAACCCAAAGUUUA 1763 1176-1196 UAAACUUUGGGUUGACACGCUGC 1764 1174-1196 AD-397237 GUGUCAACCCAAAGUUUACUA 1765 1179-1199 UAGUAAACUUUGGGUUGACACGC 1766 1177-1199 AD-397235 UGUCAACCCAAAGUUUACUCA 1767 1180-1200 UGAGUAAACUUUGGGUUGACACG 1768 1178-1200 AD-397262 CCCAAAGUUUACUCAAGACUA 1769 1186-1206 UAGUCUUGAGUAAACUUUGGGUU 1770 1184-1206 AD-397263 CCAAAGUUUACUCAAGACUAA 1771 1187-1207 UUAGUCUUGAGUAAACUUUGGGU 1772 1185-1207 AD-397189 AAAGUUUACUCAAGACUACCA 1773 1189-1209 UGGUAGUCUUGAGUAAACUUUGG 1774 1187-1209 AD-397198 CUCAAGACUACCAGUGAACCA 1775 1197-1217 UGGUUCACUGGUAGUCUUGAGUA 1776 1195-1217 AD-397206 GACUACCAGUGAACCUCUUCA 1777 1202-1222 UGAAGAGGUUCACUGGUAGUCUU 1778 1200-1222 AD-397238 AAGAUCCUGAUAAACUUCCCA 1779 1225-1245 UGGGAAGUUUAUCAGGAUCUUGG 1780 1223-1245 AD-397239 AGAUCCUGAUAAACUUCCCAA 1781 1226-1246 UUGGGAAGUUUAUCAGGAUCUUG 1782 1224-1246 AD-397252 AUCCUGAUAAACUUCCCACGA 1783 1228-1248 UCGUGGGAAGUUUAUCAGGAUCU 1784 1226-1248 AD-397249 UCCUGAUAAACUUCCCACGAA 1785 1229-1249 UUCGUGGGAAGUUUAUCAGGAUC 1786 1227-1249 AD-397253 CCUGAUAAACUUCCCACGACA 1787 1230-1250 UGUCGUGGGAAGUUUAUCAGGAU 1788 1228-1250 AD-397217 CACCGAGAGAGAAUGUCCCAA 1789 1353-1373 UUGGGACAUUCUCUCUCGGUGCU 1790 1351-1373 AD-397213 UCCCAGGUCAUGAGAGAAUGA 1791 1368-1388 UCAUUCUCUCAUGACCUGGGACA 1792 1366-1388 AD-397228 AAGCUGACAAGAAGGCCGUUA 1793 1423-1443 UAACGGCCUUCUUGUCAGCUUUG 1794 1421-1443 AD-397229 UGACAAGAAGGCCGUUAUCCA 1795 1427-1447 UGGAUAACGGCCUUCUUGUCAGC 1796 1425-1447 AD-397208 GGCCCUCGAGAAUUACAUCAA 1797 1562-1582 UUGAUGUAAUUCUCGAGGGCCAG 1798 1560-1582 AD-397218 CAAGGCCUCAUCAUGUGUUCA 1799 1603-1623 UGAACACAUGAUGAGGCCUUGGG 1800 1601-1623 AD-397264 CAUCAUGUGUUCAACAUGCUA 1801 1611-1631 UAGCAUGUUGAACACAUGAUGAG 1802 1609-1631 AD-397265 AACAUGCUGAAGAAGUACGUA 1803 1623-1643 UACGUACUUCUUCAGCAUGUUGA 1804 1621-1643 AD-397209 CAUGCUGAAGAAGUACGUCCA 1805 1625-1645 UGGACGUACUUCUUCAGCAUGUU 1806 1623-1645 AD-397192 AUGCUGAAGAAGUACGUCCGA 1807 1626-1646 UCGGACGUACUUCUUCAGCAUGU 1808 1624-1646 AD-397210 UGCUGAAGAAGUACGUCCGUA 1809 1627-1647 UACGGACGUACUUCUUCAGCAUG 1810 1625-1647 AD-397219 GCUGAAGAAGUACGUCCGUGA 1811 1628-1648 UCACGGACGUACUUCUUCAGCAU 1812 1626-1648 AD-397214 CUGAAGAAGUACGUCCGUGCA 1813 1629-1649 UGCACGGACGUACUUCUUCAGCA 1814 1627-1649 AD-397199 AGCACACCCUAAAGCAUUUUA 1815 1666-1686 UAAAAUGCUUUAGGGUGUGCUGU 1816 1664-1686 AD-397220 AAGCAUUUUGAACAUGUGCGA 1817 1677-1697 UCGCACAUGUUCAAAAUGCUUUA 1818 1675-1697 AD-397230 AGCAUUUUGAACAUGUGCGCA 1819 1678-1698 UGCGCACAUGUUCAAAAUGCUUU 1820 1676-1698 AD-397221 CACCUCCGUGUGAUCUACGAA 1821 1746-1766 UUCGUAGAUCACACGGAGGUGUG 1822 1744-1766 AD-397215 CGUGUGAUCUACGAGCGCAUA 1823 1752-1772 UAUGCGCUCGUAGAUCACACGGA 1824 1750-1772 AD-397231 UGUGAUCUACGAGCGCAUGAA 1825 1754-1774 UUCAUGCGCUCGUAGAUCACACG 1826 1752-1774 AD-397193 GAGCGCAUGAACCAGUCUCUA 1827 1764-1784 UAGAGACUGGUUCAUGCGCUCGU 1828 1762-1784 AD-397190 CGCAUGAACCAGUCUCUGUCA 1829 1767-1787 UGACAGAGACUGGUUCAUGCGCU 1830 1765-1787 AD-397222 GAAGGAGCAGAACUACUCCGA 1831 1850-1870 UCGGAGUAGUUCUGCUCCUUCUG 1832 1848-1870 AD-397200 AAGGAGCAGAACUACUCCGAA 1833 1851-1871 UUCGGAGUAGUUCUGCUCCUUCU 1834 1849-1871 AD-397201 GGAGCAGAACUACUCCGACGA 1835 1853-1873 UCGUCGGAGUAGUUCUGCUCCUU 1836 1851-1873 AD-397194 GAGCAGAACUACUCCGACGAA 1837 1854-1874 UUCGUCGGAGUAGUUCUGCUCCU 1838 1852-1874 AD-397248 CAGAAUUCGGACAUGAUUCAA 1839 2167-2187 UUGAAUCAUGUCCGAAUUCUGCA 1840 2165-2187 AD-397207 GUCCGCCAUCAAAAACUGGUA 1841 2196-2216 UACCAGUUUUUGAUGGCGGACUU 1842 2194-2216 AD-397211 UCCGCCAUCAAAAACUGGUGA 1843 2197-2217 UCACCAGUUUUUGAUGGCGGACU 1844 2195-2217 AD-397243 CAUAGCAACCGUGAUUGUCAA 1845 2282-2302 UUGACAAUCACGGUUGCUAUGAC 1846 2280-2302 AD-397246 GCAACCGUGAUUGUCAUCACA 1847 2286-2306 UGUGAUGACAAUCACGGUUGCUA 1848 2284-2306 AD-397223 GAAGAAACAGUACACAUCCAA 1849 2321-2341 UUGGAUGUGUACUGUUUCUUCUU 1850 2319-2341 AD-397202 GAAACAGUACACAUCCAUCCA 1851 2324-2344 UGGAUGGAUGUGUACUGUUUCUU 1852 2322-2344 AD-397256 GCAGCAGAACGGAUAUGAGAA 1853 2405-2425 UUCUCAUAUCCGUUCUGCUGCAU 1854 2403-2425 AD-397257 GCAGAACGGAUAUGAGAAUCA 1855 2408-2428 UGAUUCUCAUAUCCGUUCUGCUG 1856 2406-2428 AD-397258 CAGAACGGAUAUGAGAAUCCA 1857 2409-2429 UGGAUUCUCAUAUCCGUUCUGCU 1858 2407-2429 AD-397250 AGAACGGAUAUGAGAAUCCAA 1859 2410-2430 UUGGAUUCUCAUAUCCGUUCUGC 1860 2408-2430 AD-397244 GAACGGAUAUGAGAAUCCAAA 1861 2411-2431 UUUGGAUUCUCAUAUCCGUUCUG 1862 2409-2431
TABLE-US-00028 TABLE 7 APP Single Dose Screen in Primary Mouse Hepatocytes and Neuro2A Cell Line Data are expressed as percent message remaining relative to AD-1955 non-targeting control. Primary Mouse Hepatocytes Neuro2A Cell Line Duplex 10 nM 10 nM 0.1 nM 0.1 nM 10 nM 10 nM 0.1 nM 0.1 nM Name Avg SD Avg SD Avg SD Avg SD AD-397183 4.2 1.4 37.3 24.3 7.94 2.86 52.66 5.87 AD-397175 1.6 0.7 4.7 1.3 0.75 0.32 29.72 6.47 AD-397177 1.3 1.1 3.9 2.6 0.4 0.13 18.06 3.73 AD-397176 1.5 0.5 35.1 11.3 4.7 1.45 69.36 7.89 AD-397260 11.2 1.5 73.4 23.1 20.53 3.62 81.33 2.21 AD-397266 2.8 2 65.1 4.5 4.35 0.58 73.16 8.45 AD-397267 0.8 0.3 23.6 4.2 1.18 0.28 37.78 3.45 AD-397178 5.1 4.1 33.3 6.1 1.8 0.38 54.61 3.11 AD-397180 1.3 0.4 28 13.9 0.47 0.06 37.8 3.96 AD-397184 15.7 8.9 67.8 13.5 8.86 2.55 87.82 5.6 AD-397179 5.7 1.6 45.1 26 3.12 0.86 57.24 5.19 AD-397224 52.9 18.5 63.8 10.6 17.15 2.47 67.99 7.6 AD-397216 25.6 17.9 104.2 21.6 34.91 7.44 98.89 4.08 AD-397225 45.1 21.9 60.8 13.7 9.72 5.52 63.44 7.19 AD-397203 3.3 1.6 71.9 8.2 5.1 0.98 75.87 3.29 AD-397185 4.9 2.1 40.3 8.1 2.7 0.35 61.49 8.12 AD-397195 2.5 1.3 49.8 21.8 1.64 0.08 63.95 5.83 AD-397204 8.3 2 68 10.7 4.37 0.89 50.83 7.41 AD-397191 1.5 0.5 39.9 14.8 1.5 1.06 55.07 10.78 AD-397251 7.8 1.7 91.7 5.7 3.86 2.5 84.36 6.5 AD-397240 4.2 1.9 61.9 6.8 2.48 0.7 62.39 1.48 AD-397205 13.5 10.5 86 11.4 13.06 7.61 76.77 2.64 AD-397254 1.9 1.1 27.6 24.3 3.77 2.77 57.26 14.42 AD-397259 3.5 0.7 79 22.8 9.43 1.12 82.49 3.19 AD-397247 5.5 1 90.4 16.9 10.95 2.85 94.95 4.55 AD-397233 6.7 6.2 84.4 10.3 3.4 1.14 76.36 4.66 AD-397181 4.7 0.9 60.5 25.2 6.28 2.17 62.62 3.59 AD-397186 53 17 82 14.7 42.07 9.63 95.63 6.67 AD-397196 1.9 0.4 40.9 11.3 4.66 4.19 56.2 1.82 AD-397187 28.4 11.2 77.5 13.3 25.64 8.56 86.64 5.99 AD-397188 65.1 15.9 76.2 20 43.32 13.51 84.69 5.63 AD-397197 2 1 41.9 10.7 2.11 0.41 55.63 2.15 AD-397226 10.3 4.3 30 5 0.69 0.43 47.42 5.33 AD-397212 1.8 0.1 65.4 9.3 1.94 0.48 63 29.9 AD-397182 2.1 0.6 11.3 5.3 12.2 3.42 35.13 6.78 AD-397261 2.3 0.6 32.6 10 29.93 2.71 48.28 24.73 AD-397241 23 3.5 102.7 13.3 41.16 4.58 92.7 5.11 AD-397245 60.9 8.6 60.9 14.3 55.71 4.45 68.27 6.83 AD-397242 5.6 1.1 90.5 16.2 30.83 2.94 85.43 4.05 AD-397236 16.9 6.2 71.9 5.7 32.58 2.93 67.13 3.06 AD-397227 48.7 29.8 50.5 19.4 19.55 9.28 59.59 3.24 AD-397255 6.1 0.8 73.8 33 24.01 5 86.3 9.24 AD-397234 100.3 39.9 93.7 7.8 51.88 13.54 80.77 2.1 AD-397237 36.2 28.6 49.5 14 32.83 17.93 51.76 10.71 AD-397235 58 20.9 76.2 8 41.15 19.69 73.72 6 AD-397262 22.1 6.9 51.8 16.2 61.74 5.34 65.6 14.12 AD-397263 19.9 8 57.9 6.1 59.09 7.38 82.09 11.31 AD-397189 17 5.1 56.2 9.5 49.48 18.93 73.89 5.4 AD-397198 19.8 2.4 38.8 9.1 50.52 28.37 62.16 9.56 AD-397206 18.8 1.7 41 12.6 62.65 21.77 61.59 8.42 AD-397238 16.3 2 61.5 27.8 71.66 9.3 86.52 7.97 AD-397239 34.6 11.4 101 22.8 74.11 7.37 91.24 4.34 AD-397252 23.1 7.5 93.8 3.1 55.54 4.89 75.74 5.31 AD-397249 35.6 4 104.9 10.9 70.19 3.96 97.86 6.43 AD-397253 29.6 5.5 44.6 19.2 66.41 8.65 66.4 6.46 AD-397217 11.5 6.3 102.4 20.9 18.85 3.87 98.69 3.04 AD-397213 7.3 1.9 79.4 21.9 10.91 2.81 87.03 4.86 AD-397228 68.7 66.7 43.2 9.3 23.79 8.45 53.36 3.55 AD-397229 3.9 0.3 15.8 9.4 1.67 1.35 31.6 5.21 AD-397208 18.2 3.9 96.2 27.2 37.55 9.28 97.91 5.09 AD-397218 35 14.6 106 20.7 30.88 7.34 101.82 3.13 AD-397264 4.2 2.2 98 12.9 19.97 2.06 104.79 4.61 AD-397265 3 2.3 81.2 7.8 5.98 4.03 84.1 8.97 AD-397209 10.9 9.3 90.5 22.2 17.18 3.16 81.66 5.17 AD-397192 4.7 1.8 80.6 13 6.51 1.99 95.04 4.22 AD-397210 22.6 6.4 83.6 24.7 6.55 1.38 82.6 3.83 AD-397219 10.2 3.6 101.8 21.8 16.76 3.62 87.34 4.87 AD-397214 5.8 0.9 34.4 14.3 12.78 5.24 54.95 18.66 AD-397199 62.2 14.3 63.4 35 87.69 22.23 85.84 4.93 AD-397220 5.2 0.5 99.2 18.2 5.91 1.12 91.13 2.97 AD-397230 6.3 3.9 61.5 23.1 5.51 3.99 77.38 3.26 AD-397221 10.5 3.4 111.2 42.5 24.53 4.87 93.86 3.22 AD-397215 14.3 2.9 80.7 40 44.04 14.01 91.83 10.03 AD-397231 17.1 3.2 108.7 19.6 21.54 1.56 79.31 4.22 AD-397193 3.3 0.3 93.1 21.6 12.76 1.97 93.03 6.46 AD-397190 2.7 0.5 27.8 13.5 3.63 2.79 45.56 7.21 AD-397222 62.9 9.1 57.2 17 25.04 11.48 80.41 4.04 AD-397200 8.6 8.2 89.6 18.6 9.63 1.79 88.31 6.27 AD-397201 85.2 40.7 106 17.5 41.76 9.95 105.41 3.36 AD-397194 35.4 12.2 92 8.3 51.26 11.38 107.07 3.23 AD-397248 7.8 1.1 97.5 17.7 17.64 1.67 103.37 4.94 AD-397207 6.9 4 59.5 39.1 6.28 2.65 82.18 8.76 AD-397211 18.2 8.6 101.1 20.6 14.71 4.06 96.99 2.56 AD-397243 2.2 1.5 63.1 11.2 0.6 0.32 55.57 2.17 AD-397246 1.5 0.6 46.6 22.5 0.86 0.64 63.09 3.39 AD-397223 46.8 15.8 63.3 17.2 9.73 2.48 73.44 2.51 AD-397202 32.5 7.6 103.4 25.9 20.68 4.37 95.57 5.11 AD-397256 2.1 0.7 71.4 8 1.77 1.21 79.93 1.89 AD-397257 2.4 0.7 76.1 23.3 5.45 2.7 84.43 7.45 AD-397258 0.9 0.2 45.4 8.3 0.63 0.4 55.81 5.17 AD-397250 0.8 0.1 54.9 11.3 0.52 0.23 46.87 3.19 AD-397244 2.2 1.2 74.2 12 1.87 1.87 67.15 3.5
As noted for Table 4 above, it is expressly contemplated that any RNAi agents possessing target sequences that reside fully within the following windows of NM_001198823.1 positions are likely to exhibit robust APP inhibitory effect: APP NM_001198823.1 positions 251-284; APP NM_001198823.1 positions 362-404; APP NM_001198823.1 positions 471-510; APP NM_001198823.1 positions 532-587; APP NM_001198823.1 positions 601-649; APP NM_001198823.1 positions 633-662; APP NM_001198823.1 positions 1351-1388; APP NM_001198823.1 positions 1609-1649; APP NM_001198823.1 positions 1675-1698; APP NM_001198823.1 positions 1752-1787; APP NM_001198823.1 positions 2165-2217; APP NM_001198823.1 positions 2280-2344; and APP NM_001198823.1 positions 2403-2431.
Example 2. In Vivo Evaluation of RNAi Agents
[0772] Selected APP-targeting RNAi agents were evaluated for in vivo efficacy in respective proof of concept and lead identification screens for human APP knockdown in AAV mice. The selected RNAi agents for such studies included AD-392911, AD-392912, AD-392911, AD-392912, AD-392913, AD-392843, AD-392844, AD-392824, AD-392704, AD-392790, AD-392703, AD-392866, AD-392927, AD-392916, AD-392714 and AD-392926, having sequences as recited in Table 2A above, corresponding unmodified sequences as shown in Table 3 above, and as graphically depicted in
[0773] In such studies, an AAV vector harboring Homo sapiens APP was intravenously injected to 6-8 week old C57BL/6 female mice, and at 14 days post-AAV administration, a selected RNAi agent or a control agent were subcutaneously injected at 3 mg/kg to mice (n=3 per group), with mice sacrificed and livers assessed for APP mRNA levels at 14 days post-subcutaneous injection of RNAi agent or control. Significant levels of in vivo human APP mRNA knockdown in liver were observed for all RNAi agents tested, as compared to PBS and Naïve (AAV only) controls, with particularly robust levels of knockdown observed, e.g., for AD-392911, AD-392912, AD-392911, AD-392912, AD-392913, AD-392843, AD-392844, AD-392824, AD-392866, AD-392927, AD-392916, AD-392714 and AD-392926 (
TABLE-US-00029 TABLE 8 hsAPP In Vivo Knockdown Screen Results (3 mg/kg, day 14, liver) % message Treatment remaining stdev PBS 100.00 15.77 naïve (AAV-only) 104.17 1.89 AD-392911 53.75 8.76 AD-392912 46.47 14.18 AD-392913 42.34 7.95 AD-392843 27.25 0.46 AD-392844 44.25 9.04 AD-392824 42.64 0.87 AD-392704 72.99 8.76 AD-392790 72.71 11.66 AD-392703 69.60 4.70 AD-392866 35.94 23.08 AD-392927 38.91 10.60 AD-392916 43.27 7.17 AD-392714 58.08 9.55 AD-392926 50.26 10.29
Example 3: Identification of Potent Human APP siRNAs Against Hereditary Cerebral Amyloid Angiopathy (hCAA)
[0774] Hereditary cerebral amyloid angiopathy (hCAA) is driven by autosomal dominant mutations in the gene encoding Amyloid Precursor Protein (APP) (Van Etten et al. 2016 Neurology). In the disease, neuron-derived beta amyloid is deposited in vasculature causing significant structural alterations and a distinctive double barreling of vessels. hCAA appears to be a relatively pure angiopathy with minimal presence of parenchymal plaques or tau tangles (Natte et al. 2012 Annals of Neurology). Ultimately, increased deposition of amyloid beta leads to microhemorrhages, dementia and stroke. hCAA is a rapidly progressing disease with life expectancy of 7-10 years following symptom onset (Charidimou A et al. J Neurol Neurosurg Psychiatry 2012; 83: 124-137). As noted herein, there are currently no disease-modifying therapies available. In the instant disclosure, combining stable siRNA designs with alternative conjugation strategies provided potent, long-lasting silencing across the CNS following a single intrathecal administration with 95% target knockdown observed out to three months.
Be(2)C Cell Screening and In Vivo Liver Based Screens
[0775] To identify potent hAPP siRNAs, siRNAs were first screened in vitro in Be(2)C cells. As shown in
[0776] APP siRNA transfected at 10 nM, 1 nM, and 0.1 nM into Be(2)C neuronal cells was evaluated for knockdown of APP mRNA, as well as soluble AAP α/β levels, at both 24 and 48 hours after transfection (see e.g.,
Example 4: Intrathecal (IT) Dosing Delivered APP siRNA Throughout the Spinal Cord and Brain of Non-Human Primates
Non-Human Primate Studies
Dose Formulation and Preparation
Test Oligonucleotides and Vehicle Information
Test Oligonucleotides: AD-454972
[0777] AD-454973 [0778] AD-454842 [0779] AD-454843 [0780] AD-454844
[0781] The current state of scientific knowledge and the applicable guidelines cited previously in this protocol do not provide acceptable alternatives, in vitro or otherwise, to the use of live animals to accomplish the purpose of this study. The development of knowledge necessary for the improvement of the health and well-being of humans as well as other animals requires in vivo experimentation with a wide variety of animal species. Whole animals are essential in research and testing because they best reflect the dynamic interactions between the various cells, tissues, and organs comprising the human body. The beagle is the usual non-rodent model used for evaluating the toxicity of various test articles and for which there is a large historical database. However, the monkey is also an animal model used to evaluate toxicity. The monkey was selected specifically for use in this study because it is the pharmacologically relevant species. The siRNA in the test oligonucleotides is directed against the amyloid precursor protein (APP) mRNA target sequence in monkeys and humans.
TABLE-US-00030 STUDY DESIGN Number Dose Level Dose Dose of (mg/animal volume Concentration Animals Necropsy Necropsy Group Treatment fixed dose) (mL) (mg/mL) (total) (Day 29) (Day 85) 1 AD-454972 72 2.4 30 5 3 2 2 AD-454973 72 2.4 30 5 3 2 3 AD-454842 72 2.4 30 5 3 2 4 AD-454843 72 2.4 30 5 3 2 5 AD-454844 72 2.4 30 5 3 2 6* No Treatment 0 0 0 2 2 0 *Used for tissues collection to provide normal tissue, CSF, and plasma levels of APP in cynomolgus primates. Animals from Groups 1 to 5 with unsuccessful intrathecal cannulation may have been exchanged for those assigned Group 6 animals if no oligonucleotide was given. Animals were necropsied at or before Day 29.
The sequence and structure of the oligonucleotides used in the aforementioned non-human primate studies are described in greater detail in Table 9, below.
TABLE-US-00031 TABLE 9 SEQ SEQ Strand ID ID Agent (Target) oligoSeq NO: transSeq NO: AD- Sense usasuga(Ahd)GfuUfCfAfucaucaaasasa 1863 UAUGAAGUUCAUCAUCAAAAA 1864 454972 (APP) Antis VPusUfsuuug(Agn)ugaugaAfcUfucauasusc 1865 UUUUUGAUGAUGAACUUCAUAUC 1866 (APP) AD- Sense gsgscua(Chd)GfaAfAfAfuccaaccusasa 1867 GGCUACGAAAAUCCAACCUAA 1868 454973 (APP) Antis VPusUfsaggu(Tgn)ggauuuUfcGfuagccsgsu 1869 UUAGGUTGGAUUUUCGUAGCCGU 1870 (APP) AD- Sense ususugu(Ghd)UfaCfUfGfuaaagaaususa 1871 UUUGUGUACUGUAAAGAAUUA 1872 454842 (APP) Antis VPusAfsauuc(Tgn)uuacagUfaCfacaaasasc 1873 UAAUUCTUUACAGUACACAAAAC 1874 (APP) AD- Sense usasgug(Chd)AfuGfAfAfuagauucuscsa 1875 UAGUGCAUGAAUAGAUUCUCA 1876 454843 (APP) Antis VPusGfsagaa(Tgn)cuauucAfuGfcacuasgsu 1877 UGAGAATCUAUUCAUGCACUAGU 1878 (APP) AD- Sense asasaau(Chd)CfaAfCfCfuacaaguuscsa 1879 AAAAUCCAACCUACAAGUUCA 1880 454844 (APP) Antis VPusGfsaacu(Tgn)guagguUfgGfauuuuscsg 1881 UGAACUTGUAGGUUGGAUUUUCG 1882 (APP) Table 9 key: U = uridine-3′-phosphate, u = 2′-O-methyluridine-3′-phosphate, us = 2′-O-methyluridine-3′-phosphorothioate, a = 2′-O-methyladenosine-3′-phosphate, A = adenosine-3′-phosphate, as = 2′-O-methyladenosine-3′-phosphorothioate, (Ahd) = 2′-O-hexadecyl-adenosine-3′-phosphate, Gf = 2′-fluoroguanosine-3′-phosphate, Uf = 2′-fluorouridine-3′-phosphate, Cf = 2′-fluorocytidine-3′-phosphate, Af = 2′-fluoroadenosine-3′-phosphate, cs = 2′-O-methylcytidine-3′-phosphate, VP = Vinylphosphate 5′, (Agn) = Adenosine-glycol nucleic acid (GNA), gs = 2′-O-methylguanosine-3′-phosphorothioate, (Chd) = 2′-O-hexadecyl-cytidine-3′-phosphate, (Tgn) = Thymidine-glycol nucleic acid (GNA) S-Isomer, (Ghd) = 2′-O-hexadecyl-guanosine-3′-phosphate, and cs = 2′-O-methylcytidine-3′-phosphorothioate.
[0782] The following are non-limiting examples of knockdown of CSF biomarker and tissue mRNA via intrathecal (IT) injection of 72 mg drug to the CNS tissues of cynomolgus monkeys. A single IT injection, via percutaneous needle stick, of 72 mg of an APP siRNA of interest was administered in cynomolgus monkeys between L2/L3 or L4/L5 in the lumbar cistern (see Methods and Materials below). As shown in
[0783]
[0784]
[0785]
[0786]
[0787]
[0788]
APP mRNA Knockdown in Non-Human Primate Striatum at Day 29 Post Dose
[0789] A single intrathecal (IT) injection, via percutaneous needle stick, of 72 mg of the APP siRNA of interest was administered in cynomolgus monkeys between L2/L3 or L4/L5 in the lumbar cistern. In the instant disclosure, the notable discovery was made that siRNA conjugate compound delivery resulted in APP mRNA knockdown within the striatum. The following siRNAs were observed to knockdown APP mRNA in non-human primate striatum at day 29 post dose: AD-454972, AD-454973, AD-454842, AD-454843, and AD-454844 (as shown in
Materials and Methods
Soluble APP Alpha/Soluble APP Beta
[0790] CSF levels of sAPPα and sAPPβ were determined utilizing a sandwich immunoassay MSD® 96-well MULTI-SPOT sAPPα/sAPPβ assay (Catalog no. K15120E; Meso Scale Discovery, Rockville, Md., USA) according to the manufacturer's protocol with some modifications. The standards, blanks, and non-human primate CSF samples (8× dilution) were prepared with the 1% Blocker-A/TBST (provided in the kit). Pre-coated plate (provided in the kit) was blocked with 150 μL/well of 3% Blocker A/TBST solution at room temperature for 1 hour with shaking. After three washes with 1×TBST, 25 μL/well of prepared standard, blanks, and CSF samples were added to the plate in two replicates and incubated for 1 hour at room temperature with shaking. Following subsequent plate washes, 50 μL/well of detection antibody prepared in 1% Blocker A/TBST (50× dilution) was added and incubated at room temperature for 1 hour with shaking. After plate washes, 1× Read Buffer T was added to the plate and incubated for 10 minutes at room temperature (without shaking) before imaging and analyzing in MSD QuickPlex Imager.
[0791] Raw data were analyzed using SoftMax Pro, version 7.1 (Molecular Devices). A 5-parameter, logistic curve fitting with 1/Y.sup.2 weighing function was used to model the individual calibration curves and calculate the concentration of analytes in the samples. Beta Amyloid Panel (Aβ40, Aβ38, Aβ42)
[0792] CSF levels of Beta-amyloid (Aβ40, Aβ38, Aβ42) were determined utilizing a sandwich immunoassay multiplex kit MSD® 96-well MULTI-SPOT AB Peptide Panel 1 V-Plex (Catalog No. K15200E, Meso Scale Discovery, Rockville, Md., USA) according to the manufacturer's protocol with some modifications. The standards, blanks, and non-human primate CSF (8× dilution) were prepared with Diluent 35 (provided in the kit). Detection antibody (supplied at 50×) was prepared at a working concentration of 1× in Diluent 100 (provided in the kit) combined with 30 μL of Aβ40 Blocker. Pre-coated plate (provided in the kit) was blocked with 150 μL/well with Diluent 35 for 1 hour at room temperature with shaking. After three washes with 1×PBST, 25 μl/well of prepared detection antibody solution was added to the plate. Following with the addition of 25 μL/well of prepared standards, blanks, and samples in two replicates, plate was incubated at room temperature for 2 hours with shaking. Following subsequent plate washes, 150 μL/well of 2× Read buffer T was added and plate was imaged and analyzed in the MSD QuickPlex Imager immediately.
[0793] Raw data were analyzed using SoftMax Pro, version 7.1 (Molecular Devices, San Jose, Calif., USA). A 4-parameter, logistic curve fitting with 1/Y.sup.2 weighing function was used to model the individual calibration curves and calculate the concentration of analytes in the samples.
Mass Spec Method
[0794] Drug concentrations in plasma, CSF and CNS tissue samples were quantitated using a qualified LC-MS/MS method. Briefly, tissue samples were homogenized in lysis buffer, then the oligonucleotides were extracted from plasma, CSF or tissue lysate by solid phase extraction and analyzed using ion-pairing reverse phase liquid chromatography coupled with mass spectrometry under negative ionization mode. The concentration of the full-length antisense strand of the dosed duplex was measured. The drug concentrations were reported as the antisense-based duplex concentrations. The calibration range is 10-5000 ng/mL for plasma and CSF samples, and 100-50000 ng/g for CNS tissue samples. Concentrations that were calculated below the LLOQ are reported as <LLOQ. An analog duplex with different molecular weight was used as internal standard.
mRNA Knockdown by qPCR Method
[0795] Total RNA was isolated from rat brain and spinal cord tissue samples using the miRNeasy Mini Kit from (Qiagen, Catalog No. 217004) according to the manufacturer's instructions. Following isolation, RNA was reverse transcribed using SuperScript™ IV VILO™ Reverse Transcriptase (Thermo Fisher Scientific). Quantitative PCR analysis was performed using a ViiA7 Real-Time PCR System from Thermo Fisher Scientific of Waltham Mass. 02451 (Catalog No. 4453537) with Taqman Fast Universal PCR Master Mix (Applied Biosystems Catalog No. 4352042), pre-validated amyloid beta precursor protein (APP) (Mf01552291_m1) and peptidylprolyl isomerase B (PPIB) (Mf02802985_m1) Taqman Gene Expression Assays (Thermo Fisher Scientific).
[0796] The relative reduction of APP mRNA was calculated using the comparative cycle threshold (Ct) method. During qPCR, the instrument sets a baseline in the exponential phase of the amplification curve and assigns a Ct value based on the intersection point of the baseline with the amplification curve. The APP mRNA reduction was normalized to the experimental untreated control group as a percentage for each respective group using the Ct values according to the following calculations:
ΔCt.sub.App=Ct.sub.App−Ct.sub.Ppib
ΔΔCt.sub.App=ΔCt.sub.App−ΔCt.sub.untreated control group mean
Relative mRNA level=2.sup.−ΔΔCt
Example 5: Additional RNAi Agent Design, Synthesis, and In Vitro Screening in Cos-7, be(2)-C, and Neuro-2a Cell Lines
[0797] This Example describes methods for the design, synthesis, selection, and in vitro screening of additional APP RNAi agents in Cos-7 (Dual-Luciferase psiCHECK2 vector), Be(2)-C, and Neuro-2a cells.
Source of Reagents
[0798] Where the source of a reagent is not specifically given herein, such reagent can be obtained from any supplier of reagents for molecular biology at a quality/purity standard for application in molecular biology.
Cell Culture and Transfections:
[0799] Cos-7 cells (ATCC) were transfected by adding 5 μl of 1 ng/μ1, diluted in Opti-MEM, C9orf72 intron 1 psiCHECK2 vector (Blue Heron Biotechnology), 4.9 μl of Opti-MEM plus 0.1 μl of Lipofectamine 2000 per well (Invitrogen, Carlsbad Calif. cat #11668-019) to 5 μl of siRNA duplexes per well, with 4 replicates of each siRNA duplex, into a 384-well plate, and incubated at room temperature for 15 minutes. Thirty-five μ1 of Dulbecco's Modified Eagle Medium (ThermoFisher) containing ˜5×10.sup.3 cells were then added to the siRNA mixture. Cells were incubated for 48 hours followed by Firefly (transfection control) and Renilla (fused to target sequence) luciferase measurements. Three dose experiments were performed at 10 nM, 1 nM, and 0.1 nM.
[0800] Be(2)-C cells (ATCC) were transfected by adding 4.9 μl of Opti-MEM plus 0.1 μl of RNAiMAX per well (Invitrogen, Carlsbad Calif. cat #13778-150) to 5 μl of siRNA duplexes per well, with 4 replicates of each siRNA duplex, into a 384-well plate, and incubated at room temperature for 15 minutes. Forty μ1 of 1:1 mixture of Minimum Essential Medium and F12 Medium (ThermoFisher) containing ˜5×10.sup.3 cells were then added to the siRNA mixture. Cells were incubated for 48 hours prior to RNA purification. Two dose experiments were performed at 10 nM and 0.1 nM.
[0801] Neuro-2a cells (ATCC) were transfected by adding 4.9 μl of Opti-MEM plus 0.1 μl of RNAiMAX per well (Invitrogen, Carlsbad Calif. cat #13778-150) to 5 μl of siRNA duplexes per well, with 4 replicates of each siRNA duplex, into a 384-well plate, and incubated at room temperature for 15 minutes. Forty μ1 of Minimum Essential Medium (ThermoFisher) containing ˜5×10.sup.3 cells were then added to the siRNA mixture. Cells were incubated for 48 hours prior to RNA purification. Two dose experiments were performed at 10 nM and 0.1 nM.
Total RNA Isolation Using DYNABEADS mRNA Isolation Kit:
[0802] RNA was isolated using an automated protocol on a BioTek-EL406 platform using DYNABEADs (Invitrogen, cat #61012). Briefly, 70 μl of Lysis/Binding Buffer and 10 μl of lysis buffer containing 3 μl of magnetic beads were added to the plate with cells. Plates were incubated on an electromagnetic shaker for 10 minutes at room temperature and then magnetic beads were captured and the supernatant was removed. Bead-bound RNA was then washed 2 times with 150 μl Wash Buffer A and once with Wash Buffer B. Beads were then washed with 150 μl Elution Buffer, re-captured and the supernatant was removed.
cDNA Synthesis Using ABI High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, Calif., Cat #4368813):
[0803] Ten μl of a master mix containing 1 μl 10× Buffer, 0.4 ul 25× dNTPs, 1 μl 10× Random primers, 0.5 μReverse Transcriptase, 0.5 μl RNase inhibitor and 6.6 μl of H.sub.2O per reaction was added to RNA isolated above. Plates were sealed, mixed, and incubated on an electromagnetic shaker for 10 minutes at room temperature, followed by 2 h 37° C.
Real Time PCR:
[0804] Two μl of cDNA and 5 μl Lightcycler 480 probe master mix (Roche Cat #04887301001) were added to either 0.5 μl of Human GAPDH TaqMan Probe (4326317E) and 0.5 μl C9orf72 Human probe (Hs00376619 ml, Thermo) or 0.5 μl Mouse GAPDH TaqMan Probe (4352339E) and 0.5 μl C9orf72 Mouse probe (Mm01216837_m1, Thermo) per well in a 384 well plates (Roche cat #04887301001). Real time PCR was done in a LightCycler480 Real Time PCR system (Roche). Each duplex was tested at least two times and data were normalized to cells transfected with a non-targeting control siRNA. To calculate relative fold change, real time data were analyzed using the ΔΔCt method and normalized to assays performed with cells transfected with a non-targeting control siRNA.
Additional APP Oligonucleotide Sequences:
[0805] Table 10 through Table 16B list additional modified and target APP sequences.
TABLE-US-00032 TABLE 10 Additional Human APP Modified Sequences Sense SEQ SEQ SEQ Duplex Sequence ID Antisense ID ID Name (5′ to 3′) NO Sequence (5′ to 3′) NO mRNA target sequence NO AD- asasagagCfaAfAfAf 1883 asUfscugAfaUfAfguuuUfg 1884 AGAAAGAGCAAAACUAUUCAGAU 1885 506935.2 cuauucagauL96 Cfucuuuscsu AD- ususggccAfaCfAfUf 1886 asUfscacUfaAfUfcaugUfu 1887 UCUUGGCCAACAUGAUUAGUGAA 1888 507065.2 gauuagugauL96 Gfgccaasgsa AD- uscsugggUfuGfAfCf 1889 asUfsugaUfaUfUfugucAfa 1890 GUUCUGGGUUGACAAAUAUCAAG 1891 507159.2 aaauaucaauL96 Cfccagasasc AD- ususuaugAfuUfUfAf 1892 asGfsauaAfuGfAfguaaAfu 1893 GUUUUAUGAUUUACUCAUUAUCG 1894 507538.2 cucauuaucuL96 Cfauaaasasc AD- asusgccuGfaAfCfUf 1895 asAfsuuaAfuUfCfaaguUfc 1896 AGAUGCCUGAACUUGAAUUAAUC 1897 507624.2 ugaauuaauuL96 Afggcauscsu AD- asgsaugcCfuGfAfAf 1898 asUfsaauUfcAfAfguucAfg 1899 GUAGAUGCCUGAACUUGAAUUAA 1900 507724.2 cuugaauuauL96 Gfcaucusasc AD- gscscugaAfcUfUfGf 1901 asGfsgauUfaAfUfucaaGfu 1902 AUGCCUGAACUUGAAUUAAUCCA 1903 507725.2 aauuaauccuL96 Ufcaggcsasu AD- gsusgguuUfgUfGfAf 1904 asUfsuaaUfuGfGfgucaCfa 1905 UUGUGGUUUGUGACCCAAUUAAG 1906 507789.2 cccaauuaauL96 Afaccacsasa AD- csasgaugCfuUfUfAf 1907 asAfsaauCfuCfUfcuaaAfg 1908 UUCAGAUGCUUUAGAGAGAUUUU 1909 507874.2 gagagauuuuL96 Cfaucugsasa AD- uscsuugcCfuAfAfGf 1910 asAfsaagGfaAfUfacuuAfg 1911 UCUCUUGCCUAAGUAUUCCUUUC 1912 507928.2 uauuccuuuuL96 Gfcaagasgsa AD- ususgcugCfuUfCfUf 1913 asAfsaauAfuAfGfcagaAfg 1914 GAUUGCUGCUUCUGCUAUAUUUG 1915 507949.2 gcuauauuuuL96 Cfagcaasusc Table 10 key: U = uridine-3′-phosphate, u = 2′-O-methyluridine-3′-phosphate, us = 2′-O-methyluridine-3′-phosphorothioate, a = 2′-O-methyladenosine-3′-phosphate, A = adenosine-3′-phosphate, as = 2′-O-methyladenosine-3′-phosphorothioate, (Ahd) = 2′-O-hexadecyl-adenosine-3′-phosphate, Gf = 2′-fluoroguanosine-3′-phosphate, Uf = 2′-fluorouridine-3′-phosphate, Cf = 2′-fluorocytidine-3′-phosphate, Af = 2′-fluoroadenosine-3′-phosphate, cs = 2′-O-methylcytidine-3′-phosphate, VP = Vinylphosphate 5′, (Agn) = Adenosine-glycol nucleic acid (GNA), gs = 2′-O-methylguanosine-3′-phosphorothioate, (Chd) = 2′-O-hexadecyl-cytidine-3′-phosphate, (Tgn) = Thymidine-glycol nucleic acid (GNA) S-Isomer, (Ghd) = 2′-O-hexadecyl-guanosine-3′-phosphate, and cs = 2′-O-methylcytidine-3′-phosphorothioate.
TABLE-US-00033 TABLE 11 Additional Human APP Unmodified Sequences; NM_000484.3 and NM_201414.2 Targeting Duplex Sense SEQ SEQ Name Sequence ID Source Name Antisense ID Source Name Cross NO (5′ to 3′) NO (Range) Sequence (5′ to 3′) NO (Range) Species AD- AAAGAGCAAAACU 1916 NM_000484.3_1902- AUCUGAAUAGUUUUGCUCUUUCU 1917 NM_201414.2_1675- UNK 506935.2 AUUCAGAU 1922_s 1697_as (1902-1922) (1900-1922) AD- UUGGCCAACAUGA 1918 NM_201414.2_1704- AUCACUAAUCAUGUUGGCCAAGA 1919 NM_201414.2_1702- UNK 507065.2 UUAGUGAU 1724_A21U_s 1724_U1A_as (1704-1724) (1702-1724) AD- UCUGGGUUGACAA 1920 NM_000484.3_2166- AUUGAUAUUUGUCAACCCAGAAC 1921 NM_201414.2_1939- UNK 507159.2 AUAUCAAU 2186_G21U_s 1961_C1A_as (2166-2186) (2164-2186) AD- UUUAUGAUUUACU 1922 NM_000484.3_2613- AGAUAAUGAGUAAAUCAUAAAAC 1923 NM_201414.2_2386- UNK 507538.2 CAUUAUCU 2633_G21U_s 2408_C1A_as (2613-2633) (2611-2633) AD- AUGCCUGAACUUG 1924 NM_000484.3_2665- AAUUAAUUCAAGUUCAGGCAUCU 1925 NM_201414.2_2438- UNK 507624.2 AAUUAAUU 2685_C21U_s 2460_G1A_as (2665-2685) (2663-2685) AD- AGAUGCCUGAACU 1926 NM_201414.2_2438- AUAAUUCAAGUUCAGGCAUCUAC 1927 NM_201414.2_2436- UNK 507724.2 UGAAUUAU 2458_A21U_s 2458_U1A_as (2438-2458) (2436-2458) AD- GCCUGAACUUGAA 1928 NM_201414.2_2442- AGGAUUAAUUCAAGUUCAGGCAU 1929 NM_201414.2_2440- UNK 507725.2 UUAAUCCU 2462_A21U_s 2462_U1A_as (2442-2462) (2440-2462) AD- GUGGUUUGUGACC 1930 NM_000484.3_2853- AUUAAUUGGGUCACAAACCACAA 1931 NM_201414.2_2626- UNK 507789.2 CAAUUAAU 2873_G21U_s 2648_C1A_as (2853-2873) (2851-2873) AD- CAGAUGCUUUAGA 1932 NM_000484.3_3006- AAAAUCUCUCUAAAGCAUCUGAA 1933 NM_201414.2_2779- UNK 507874.2 GAGAUUUU 3026_s 2801_as (3006-3026) (3004-3026) AD- UCUUGCCUAAGUA 1934 NM_201414.2_2718- AAAAGGAAUACUUAGGCAAGAGA 1935 NM_201414.2_2716- UNK 507928.2 UUCCUUUU 2738_C21U_s 2738_G1A_as (2718-2738) (2716-2738) AD- UUGCUGCUUCUGC 1936 NM_201414.2_2831- AAAAUAUAGCAGAAGCAGCAAUC 1937 NM_201414.2_2829- UNK 507949.2 UAUAUUUU 2851_G21U_s 2851_C1A_as (2831-2851) (2829-2851)
TABLE-US-00034 TABLE 12 Additional Human APP Modified Sequences. SEQ ID SEQ ID Duplex Name Sense Sequence (5′ to 3′) NO Antisense Sequence (5′ to 3′) NO AD-738012.1 csgscuu(Uhd)CfuAfCfAfcuguauuacaL96 1938 VPusGfsuaaUfaCfAfguguAfgAfaagcgsasu 1939 AD-738013.1 gscsuuu(Chd)UfaCfAfCfuguauuacaaL96 1940 VPusUfsguaAfuAfCfagugUfaGfaaagcsgsa 1941 AD-738014.1 ususcua(Chd)AfcUfGfUfauuacauaaaL96 1942 VPusUfsuauGfuAfAfuacaGfuGfuagaasasg 1943 AD-738015.1 ususucu(Ahd)CfaCfUfGfuauuacauaaL96 1944 VPusUfsaugUfaAfUfacagUfgUfagaaasgsc 1945 AD-738016.1 asusuua(Ghd)CfuGfUfAfucaaacuagaL96 1946 VPusCfsuagUfuUfGfauacAfgCfuaaaususc 1947 AD-738017.1 ususccu(Ghd)AfuCfAfCfuaugcauuuaL96 1948 VPusAfsaauGfcAfUfagugAfuCfaggaasasg 1949 AD-738018.1 gsusgcu(Ghd)UfaAfCfAfcaaguagauaL96 1950 VPusAfsucuAfcUfUfguguUfaCfagcacsasg 1951 AD-738019.1 ususuag(Chd)UfgUfAfUfcaaacuaguaL96 1952 VPusAfscuaGfuUfUfgauaCfaGfcuaaasusu 1953 AD-738020.1 ususucc(Uhd)GfaUfCfAfcuaugcauuaL96 1954 VPusAfsaugCfaUfAfgugaUfcAfggaaasgsg 1955 AD-738021.1 asasugg(Ghd)UfuUfUfGfuguacuguaaL96 1956 VPusUfsacaGfuAfCfacaaAfaCfccauusasa 1957 AD-738022.1 asusugu(Ahd)CfaGfAfAfucauugcuuaL96 1958 VPusAfsagcAfaUfGfauucUfgUfacaauscsa 1959 AD-738023.1 ususgua(Chd)AfgAfAfUfcauugcuuaaL96 1960 VPusUfsaagCfaAfUfgauuCfuGfuacaasusc 1961 AD-738024.1 ususacu(Ghd)UfaCfAfGfauugcugcuaL96 1962 VPusAfsgcaGfcAfAfucugUfaCfaguaasasa 1963 AD-738025.1 asusaug(Chd)UfgAfAfGfaaguacgucaL96 1964 VPusGfsacgUfaCfUfucuuCfaGfcauaususg 1965 AD-738026.1 ascscau(Uhd)GfcUfUfCfacuacccauaL96 1966 VPusAfsuggGfuAfGfugaaGfcAfauggususu 1967 AD-738027.1 csusgug(Chd)UfgUfAfAfcacaaguagaL96 1968 VPusCfsuacUfuGfUfguuaCfaGfcacagscsu 1969 AD-738028.1 usgscug(Uhd)AfaCfAfCfaaguagaugaL96 1970 VPusCfsaucUfaCfUfugugUfuAfcagcascsa 1971 AD-738029.1 ascsagc(Uhd)GfuGfCfUfguaacacaaaL96 1972 VPusUfsuguGfuUfAfcagcAfcAfgcuguscsa 1973 AD-738030.1 gscsugu(Ahd)AfcAfCfAfaguagaugcaL96 1974 VPusGfscauCfuAfCfuuguGfuUfacagcsasc 1975 AD-738031.1 uscsaaa(Chd)UfaGfUfGfcaugaauagaL96 1976 VPusCfsuauUfcAfUfgcacUfaGfuuugasusa 1977 AD-738032.1 csasaac(Uhd)AfgUfGfCfaugaauagaaL96 1978 VPusUfscuaUfuCfAfugcaCfuAfguuugsasu 1979 AD-738033.1 usgscag(Ghd)AfuGfAfUfuguacagaaaL96 1980 VPusUfsucuGfuAfCfaaucAfuCfcugcasgsa 1981 AD-738034.1 gscsagg(Ahd)UfgAfUfUfguacagaauaL96 1982 VPusAfsuucUfgUfAfcaauCfaUfccugcsasg 1983 AD-738035.1 csasgga(Uhd)GfaUfUfGfuacagaaucaL96 1984 VPusGfsauuCfuGfUfacaaUfcAfuccugscsa 1985 AD-738036.1 usasuca(Ahd)AfcUfAfGfugcaugaauaL96 1986 VPusAfsuucAfuGfCfacuaGfuUfugauascsa 1987 AD-738037.1 ususugu(Ghd)CfcUfGfUfuuuaugugcaL96 1988 VPusGfscacAfuAfAfaacaGfgCfacaaasgsa 1989 AD-738038.1 ususgug(Chd)CfuGfUfUfuuaugugcaaL96 1990 VPusUfsgcaCfaUfAfaaacAfgGfcacaasasg 1991 AD-738039.1 csusgca(Ghd)GfaUfGfAfuuguacagaaL96 1992 VPusUfscugUfaCfAfaucaUfcCfugcagsasa 1993 AD-738040.1 csasggu(Chd)AfuGfAfGfagaaugggaaL96 1994 VPusUfscccAfuUfCfucucAfuGfaccugsgsg 1995 AD-738041.1 usasugu(Ghd)CfaCfAfCfauuaggcauaL96 1996 VPusAfsugcCfuAfAfugugUfgCfacauasasa 1997 AD-738042.1 usgsugc(Ahd)CfaCfAfUfuaggcauugaL96 1998 VPusCfsaauGfcCfUfaaugUfgUfgcacasusa 1999 AD-738043.1 gsgsaug(Ahd)UfuGfUfAfcagaaucauaL96 2000 VPusAfsugaUfuCfUfguacAfaUfcauccsusg 2001 AD-738044.1 ascscau(Chd)CfaGfAfAfcuggugcaaaL96 2002 VPusUfsugcAfcCfAfguucUfgGfaugguscsa 2003 AD-738045.1 usasugc(Uhd)GfaAfGfAfaguacguccaL96 2004 VPusGfsgacGfuAfCfuucuUfcAfgcauasusu 2005 AD-738046.1 asusgcu(Ghd)AfaGfAfAfguacguccgaL96 2006 VPusCfsggaCfgUfAfcuucUfuCfagcausasu 2007 AD-738047.1 asasacc(Ahd)UfuGfCfUfucacuacccaL96 2008 VPusGfsgguAfgUfGfaagcAfaUfgguuususg 2009 AD-738048.1 asascca(Uhd)UfgCfUfUfcacuacccaaL96 2010 VPusUfsgggUfaGfUfgaagCfaAfugguususu 2011 AD-397217.2 csasccg(Ahd)GfaGfAfGfaaugucccaaL96 2012 VPusUfsgggAfcAfUfucucUfcUfcggugscsu 2013 AD-738049.1 gsusugu(Ahd)UfaUfUfAfuucuuguggaL96 2014 VPusCfscacAfaGfAfauaaUfaUfacaacsusg 2015 AD-738050.1 ususaug(Uhd)GfcAfCfAfcauuaggcaaL96 2016 VPusUfsgccUfaAfUfguguGfcAfcauaasasa 2017 AD-738051.1 asusgug(Chd)AfcAfCfAfuuaggcauuaL96 2018 VPusAfsaugCfcUfAfauguGfuGfcacausasa 2019 AD-738052.1 gsusgca(Chd)AfcAfUfUfaggcauugaaL96 2020 VPusUfscaaUfgCfCfuaauGfuGfugcacsasu 2021 AD-738053.1 usgsauu(Ghd)UfaCfAfGfaaucauugcaL96 2022 VPusGfscaaUfgAfUfucugUfaCfaaucasusc 2023 AD-738054.1 gscsuuc(Ahd)CfuAfCfCfcaucgguguaL96 2024 VPusAfscacCfgAfUfggguAfgUfgaagcsasa 2025 AD-738055.1 ususuua(Uhd)GfuGfCfAfcacauuaggaL96 2026 VPusCfscuaAfuGfUfgugcAfcAfuaaaascsa 2027 AD-738056.1 csgscuu(Uhd)CfuAfCfAfcuguauuacaL96 2028 VPusGfsuaau(Agn)caguguAfgAfaagcgsasu 2029 AD-738057.1 gscsuuu(Chd)UfaCfAfCfuguauuacaaL96 2030 VPusUfsguaa(Tgn)acagugUfaGfaaagcsgsa 2031 AD-738058.1 ususcua(Chd)AfcUfGfUfauuacauaaaL96 2032 VPusUfsuaug(Tgn)aauacaGfuGfuagaasasg 2033 AD-738059.1 ususucu(Ahd)CfaCfUfGfuauuacauaaL96 2034 VPusUfsaugu(Agn)auacagUfgUfagaaasgsc 2035 AD-738060.1 asusuua(Ghd)CfuGfUfAfucaaacuagaL96 2036 VPusCfsuagu(Tgn)ugauacAfgCfuaaaususc 2037 AD-738061.1 ususccu(Ghd)AfuCfAfCfuaugcauuuaL96 2038 VPusAfsaaug(Cgn)auagugAfuCfaggaasasg 2039 AD-738062.1 gsusgcu(Ghd)UfaAfCfAfcaaguagauaL96 2040 VPusAfsucua(Cgn)uuguguUfaCfagcacsasg 2041 AD-738063.1 ususuag(Chd)UfgUfAfUfcaaacuaguaL96 2042 VPusAfscuag(Tgn)uugauaCfaGfcuaaasusu 2043 AD-738064.1 ususucc(Uhd)GfaUfCfAfcuaugcauuaL96 2044 VPusAfsaugc(Agn)uagugaUfcAfggaaasgsg 2045 AD-738065.1 asasugg(Ghd)UfuUfUfGfuguacuguaaL96 2046 VPusUfsacag(Tgn)acacaaAfaCfccauusasa 2047 AD-738066.1 ususacu(Ghd)UfaCfAfGfauugcugcuaL96 2048 VPusAfsgcag(Cgn)aaucugUfaCfaguaasasa 2049 AD-738067.1 asusugu(Ahd)CfaGfAfAfucauugcuuaL96 2050 VPusAfsagca(Agn)ugauucUfgUfacaauscsa 2051 AD-738068.1 ususgua(Chd)AfgAfAfUfcauugcuuaaL96 2052 VPusUfsaagc(Agn)augauuCfuGfuacaasusc 2053 AD-738069.1 asusaug(Chd)UfgAfAfGfaaguacgucaL96 2054 VPusGfsacgu(Agn)cuucuuCfaGfcauaususg 2055 AD-738070.1 ascscau(Uhd)GfcUfUfCfacuacccauaL96 2056 VPusAfsuggg(Tgn)agugaaGfcAfauggususu 2057 AD-738071.1 csusgug(Chd)UfgUfAfAfcacaaguagaL96 2058 VPusCfsuacu(Tgn)guguuaCfaGfcacagscsu 2059 AD-738072.1 usgscug(Uhd)AfaCfAfCfaaguagaugaL96 2060 VPusCfsaucu(Agn)cuugugUfuAfcagcascsa 2061 AD-738073.1 ascsagc(Uhd)GfuGfCfUfguaacacaaaL96 2062 VPusUfsugug(Tgn)uacagcAfcAfgcuguscsa 2063 AD-738074.1 gscsugu(Ahd)AfcAfCfAfaguagaugcaL96 2064 VPusGfscauc(Tgn)acuuguGfuUfacagcsasc 2065 AD-738075.1 uscsaaa(Chd)UfaGfUfGfcaugaauagaL96 2066 VPusCfsuauu(Cgn)augcacUfaGfuuugasusa 2067 AD-738076.1 csasaac(Uhd)AfgUfGfCfaugaauagaaL96 2068 VPusUfscuau(Tgn)caugcaCfuAfguuugsasu 2069 AD-738077.1 usgscag(Ghd)AfuGfAfUfuguacagaaaL96 2070 VPusUfsucug(Tgn)acaaucAfuCfcugcasgsa 2071 AD-738078.1 gscsagg(Ahd)UfgAfUfUfguacagaauaL96 2072 VPusAfsuucu(Ggn)uacaauCfaUfccugcsasg 2073 AD-738079.1 csasgga(Uhd)GfaUfUfGfuacagaaucaL96 2074 VPusGfsauuc(Tgn)guacaaUfcAfuccugscsa 2075 AD-738080.1 usasuca(Ahd)AfcUfAfGfugcaugaauaL96 2076 VPusAfsuuca(Tgn)gcacuaGfuUfugauascsa 2077 AD-738081.1 ususugu(Ghd)CfcUfGfUfuuuaugugcaL96 2078 VPusGfscaca(Tgn)aaaacaGfgCfacaaasgsa 2079 AD-738082.1 ususgug(Chd)CfuGfUfUfuuaugugcaaL96 2080 VPusUfsgcac(Agn)uaaaacAfgGfcacaasasg 2081 AD-738083.1 csusgca(Ghd)GfaUfGfAfuuguacagaaL96 2082 VPusUfscugu(Agn)caaucaUfcCfugcagsasa 2083 AD-738084.1 csasggu(Chd)AfuGfAfGfagaaugggaaL96 2084 VPusUfsccca(Tgn)ucucucAfuGfaccugsgsg 2085 AD-738085.1 usasugc(Uhd)GfaAfGfAfaguacguccaL96 2086 VPusGfsgacg(Tgn)acuucuUfcAfgcauasusu 2087 AD-738086.1 asusgcu(Ghd)AfaGfAfAfguacguccgaL96 2088 VPusCfsggac(Ggn)uacuucUfuCfagcausasu 2089 AD-738087.1 asasacc(Ahd)UfuGfCfUfucacuacccaL96 2090 VPusGfsggua(Ggn)ugaagcAfaUfgguuususg 2091 AD-738088.1 asascca(Uhd)UfgCfUfUfcacuacccaaL96 2092 VPusUfsgggu(Agn)gugaagCfaAfugguususu 2093 AD-738089.1 usasugu(Ghd)CfaCfAfCfauuaggcauaL96 2094 VPusAfsugcc(Tgn)aaugugUfgCfacauasasa 2095 AD-738090.1 usgsugc(Ahd)CfaCfAfUfuaggcauugaL96 2096 VPusCfsaaug(Cgn)cuaaugUfgUfgcacasusa 2097 AD-738091.1 gsgsaug(Ahd)UfuGfUfAfcagaaucauaL96 2098 VPusAfsugau(Tgn)cuguacAfaUfcauccsusg 2099 AD-738092.1 ascscau(Chd)CfaGfAfAfcuggugcaaaL96 2100 VPusUfsugca(Cgn)caguucUfgGfaugguscsa 2101 AD-738093.1 csasccg(Ahd)GfaGfAfGfaaugucccaaL96 2102 VPusUfsggga(Cgn)auucucUfcUfcggugscsu 2103 AD-738094.1 gsusugu(Ahd)UfaUfUfAfuucuuguggaL96 2104 VPusCfscaca(Agn)gaauaaUfaUfacaacsusg 2105 AD-738095.1 ususaug(Uhd)GfcAfCfAfcauuaggcaaL96 2106 VPusUfsgccu(Agn)auguguGfcAfcauaasasa 2107 AD-738096.1 asusgug(Chd)AfcAfCfAfuuaggcauuaL96 2108 VPusAfsaugc(Cgn)uaauguGfuGfcacausasa 2109 AD-738097.1 gsusgca(Chd)AfcAfUfUfaggcauugaaL96 2110 VPusUfscaau(Ggn)ccuaauGfuGfugcacsasu 2111 AD-738098.1 usgsauu(Ghd)UfaCfAfGfaaucauugcaL96 2112 VPusGfscaau(Ggn)auucugUfaCfaaucasusc 2113 AD-738099.1 gscsuuc(Ahd)CfuAfCfCfcaucgguguaL96 2114 VPusAfscacc(Ggn)auggguAfgUfgaagcsasa 2115 AD-738100.1 ususuua(Uhd)GfuGfCfAfcacauuaggaL96 2116 VPusCfscuaa(Tgn)gugugcAfcAfuaaaascsa 2117 Table 12 key: U = uridine-3′-phosphate, u = 2′-O-methyluridine-3′-phosphate, us = 2′-O-methyluridine-3 -phosphorothioate, a = 2′-O-phosphate, methyladenosine-3′-phosphate, A = adenosine-3′-phosphate, as = 2′-O-methyladenosine-3′-phosphorothioate, (Ahd) = 2′-O-hexadecyl-adenosine-3′-phosphate, Gf = 2′-fluoroguanosine-3′-phosphate, Uf = 2′-fluorouridine-3′-phosphate, Cf = 2′-fluorocytidine-3′-phosphate, Af = 2′-fluoroadenosine-3′-phosphate, cs = 2′-O-methylcytidine-3′-phosphate, VP = Vinylphosphate 5′, (Agn) = Adenosine-glycol nucleic acid (GNA), gs = 2′-O-methylguanosine-3′-phosphorothioate, (Chd) = 2′-O-hexadecyl-cytidine-3′-phosphate, (Tgn) = Thymidine-glycol nucleic acid (GNA) S-Isomer, (Ghd) = 2′-O-hexadecyl-guanosine-3′-phosphate, and cs = 2′-O-methylcytidine-3′-phosphorothioate.
TABLE-US-00035 TABLE 13 Additional Human APP Unmodified Sequences; XM_005548887.2 and NM_001198823.1 Targeting. SEQ Duplex Sense ID Antisense SEQ Name Sequence (5′ to 3′) NO Sequence (5′ to 3′) ID NO Source Name AD- CGCUUUCUACACUGUAUUACA 2118 UGUAAUACAGUGUAGAAAGCGAU 2119 XM_005548887.2_3401- 738012.1 3423_as AD- GCUUUCUACACUGUAUUACAA 2120 UUGUAAUACAGUGUAGAAAGCGA 2121 XM_005548887.2_3402- 738013.1 3424_as AD- UUCUACACUGUAUUACAUAAA 2122 UUUAUGUAAUACAGUGUAGAAAG 2123 NM_001198823 .1_3306- 738014.1 3328_as AD- UUUCUACACUGUAUUACAUAA 2124 UUAUGUAAUACAGUGUAGAAAGC 2125 NM_001198823 .1_3305- 738015.1 3327_as AD- AUUUAGCUGUAUCAAACUAGA 2126 UCUAGUUUGAUACAGCUAAAUUC 2127 XM_005548887.2_2837- 738016.1 2859_as AD- UUCCUGAUCACUAUGCAUUUA 2128 UAAAUGCAUAGUGAUCAGGAAAG 2129 XM_005548887.2_3030- 738017.1 3052_as AD- GUGCUGUAACACAAGUAGAUA 2130 UAUCUACUUGUGUUACAGCACAG 2131 NM_001198823 .1_2602- 738018.1 2624_C1A_as AD- UUUAGCUGUAUCAAACUAGUA 2132 UACUAGUUUGAUACAGCUAAAUU 2133 XM_005548887.2_2838- 738019.1 2860_as AD- UUUCCUGAUCACUAUGCAUUA 2134 UAAUGCAUAGUGAUCAGGAAAGG 2135 XM_005548887.2_3029- 738020.1 3051_as AD- AAUGGGUUUUGUGUACUGUAA 2136 UUACAGUACACAAAACCCAUUAA 2137 XM_005548887.2_2813- 738021.1 2835_as AD- AUUGUACAGAAUCAUUGCUUA 2138 UAAGCAAUGAUUCUGUACAAUCA 2139 NM_001198823.1_3272- 738022.1 3294_as AD- UUGUACAGAAUCAUUGCUUAA 2140 UUAAGCAAUGAUUCUGUACAAUC 2141 NM_001198823.13273- 738023.1 3295_as AD- UUACUGUACAGAUUGCUGCUA 2142 UAGCAGCAAUCUGUACAGUAAAA 2143 XM_005548887.2_3113- 738024.1 3135_as AD- AUAUGCUGAAGAAGUACGUCA 2144 UGACGUACUUCUUCAGCAUAUUG 2145 XM_005548887.2_1740- 738025.1 1762_as AD- ACCAUUGCUUCACUACCCAUA 2146 UAUGGGUAGUGAAGCAAUGGUUU 2147 NM_001198823 .1_2506- 738026.1 2528_G1A_as AD- CUGUGCUGUAACACAAGUAGA 2148 UCUACUUGUGUUACAGCACAGCU 2149 NM_001198823 .1_2600- 738027.1 2622_as AD- UGCUGUAACACAAGUAGAUGA 2150 UCAUCUACUUGUGUUACAGCACA 2151 NM_001198823 .1_2603- 738028.1 2625_G1A_as AD- ACAGCUGUGCUGUAACACAAA 2152 UUUGUGUUACAGCACAGCUGUCA 2153 NM_001198823 .1_2596- 738029.1 2618_C1A_as AD- GCUGUAACACAAGUAGAUGCA 2154 UGCAUCUACUUGUGUUACAGCAC 2155 NM_001198823 .1_2604- 738030.1 2626_G1A_as AD- UCAAACUAGUGCAUGAAUAGA 2156 UCUAUUCAUGCACUAGUUUGAUA 2157 NM_001198823 .1_2742- 738031.1 2764_as AD- CAAACUAGUGCAUGAAUAGAA 2158 UUCUAUUCAUGCACUAGUUUGAU 2159 NM_001198823 .1_2743- 738032.1 2765_as AD- UGCAGGAUGAUUGUACAGAAA 2160 UUUCUGUACAAUCAUCCUGCAGA 2161 NM_001198823.13263- 738033.1 3285_as AD- GCAGGAUGAUUGUACAGAAUA 2162 UAUUCUGUACAAUCAUCCUGCAG 2163 NM_001198823.13264- 738034.1 3286_G1A_as AD- CAGGAUGAUUGUACAGAAUCA 2164 UGAUUCUGUACAAUCAUCCUGCA 2165 NM_001198823.13265- 738035.1 3287_as AD- UAUCAAACUAGUGCAUGAAUA 2166 UAUUCAUGCACUAGUUUGAUACA 2167 NM_001198823.12740- 738036.1 2762_as AD- UUUGUGCCUGUUUUAUGUGCA 2168 UGCACAUAAAACAGGCACAAAGA 2169 NM_001198823.1_3070- 738037.1 3092_as AD- UUGUGCCUGUUUUAUGUGCAA 2170 UUGCACAUAAAACAGGCACAAAG 2171 NM_001198823.1_3071- 738038.1 3093_G1A_as AD- CUGCAGGAUGAUUGUACAGAA 2172 UUCUGUACAAUCAUCCUGCAGAA 2173 NM_001198823.1_3262- 738039.1 3284_as AD- CAGGUCAUGAGAGAAUGGGAA 2174 UUCCCAUUCUCUCAUGACCUGGG 2175 NM_001198823.1_1369- 738040.1 1391_as AD- UAUGUGCACACAUUAGGCAUA 2176 UAUGCCUAAUGUGUGCACAUAAA 2177 NM_001198823.13083- 738041.1 3105_as AD- UGUGCACACAUUAGGCAUUGA 2178 UCAAUGCCUAAUGUGUGCACAUA 2179 NM_001198823.1_3085- 738042.1 3107_as AD- GGAUGAUUGUACAGAAUCAUA 2180 UAUGAUUCUGUACAAUCAUCCUG 2181 NM_001198823.13267- 738043.1 3289_as AD- ACCAUCCAGAACUGGUGCAAA 2182 UUUGCACCAGUUCUGGAUGGUCA 2183 NM_001198823.1_424- 738044.1 446_C1A_as AD- UAUGCUGAAGAAGUACGUCCA 2184 UGGACGUACUUCUUCAGCAUAUU 2185 XM_005548887.2_1741- 738045.1 1763_as AD- AUGCUGAAGAAGUACGUCCGA 2186 UCGGACGUACUUCUUCAGCAUAU 2187 XM_005548887.2_1742- 738046.1 1764_as AD- AAACCAUUGCUUCACUACCCA 2188 UGGGUAGUGAAGCAAUGGUUUUG 2189 XM_005548887.2_2614- 738047.1 2636_as AD- AACCAUUGCUUCACUACCCAA 2190 UUGGGUAGUGAAGCAAUGGUUUU 2191 XM_005548887.2_2615- 738048.1 2637_as AD- CACCGAGAGAGAAUGUCCCAA 2192 UUGGGACAUUCUCUCUCGGUGCU 2193 NM_001198823.1_1351- 397217.2 1373_C1A_as AD- GUUGUAUAUUAUUCUUGUGGA 2194 UCCACAAGAAUAAUAUACAACUG 2195 XM_005548887.2_2906- 738049.1 2928_as AD- UUAUGUGCACACAUUAGGCAA 2196 UUGCCUAAUGUGUGCACAUAAAA 2197 NM_001198823.13082- 738050.1 3104_as AD- AUGUGCACACAUUAGGCAUUA 2198 UAAUGCCUAAUGUGUGCACAUAA 2199 NM_001198823.1_3084- 738051.1 3106_C1A_as AD- GUGCACACAUUAGGCAUUGAA 2200 UUCAAUGCCUAAUGUGUGCACAU 2201 NM_001198823.13086- 738052.1 3108_C1A_as AD- UGAUUGUACAGAAUCAUUGCA 2202 UGCAAUGAUUCUGUACAAUCAUC 2203 NM_001198823.13270- 738053.1 3292_as AD- GCUUCACUACCCAUCGGUGUA 2204 UACACCGAUGGGUAGUGAAGCAA 2205 NM_001198823.12512- 738054.1 2534_as AD- UUUUAUGUGCACACAUUAGGA 2206 UCCUAAUGUGUGCACAUAAAACA 2207 NM_001198823.13080- 738055.1 3102_G1A_as AD- CGCUUUCUACACUGUAUUACA 2208 UGUAAUACAGUGUAGAAAGCGAU 2209 XM_005548887.2_3401- 738056.1 3423_as AD- GCUUUCUACACUGUAUUACAA 2210 UUGUAATACAGUGUAGAAAGCGA 2211 XM_005548887.2_3402- 738057.1 3424_as AD- UUCUACACUGUAUUACAUAAA 2212 UUUAUGTAAUACAGUGUAGAAAG 2213 XM_005548887.2_3405- 738058.1 3427_as AD- UUUCUACACUGUAUUACAUAA 2214 UUAUGUAAUACAGUGUAGAAAGC 2215 XM_005548887.2_3404- 738059.1 3426_as AD- AUUUAGCUGUAUCAAACUAGA 2216 UCUAGUTUGAUACAGCUAAAUUC 2217 XM_005548887.2_2837- 738060.1 2859_as AD- UUCCUGAUCACUAUGCAUUUA 2218 UAAAUGCAUAGUGAUCAGGAAAG 2219 XM_005548887.2_3030- 738061.1 3052_as AD- GUGCUGUAACACAAGUAGAUA 2220 UAUCUACUUGUGUUACAGCACAG 2221 XM_005548887.2_2716- 738062.1 2738_as AD- UUUAGCUGUAUCAAACUAGUA 2222 UACUAGTUUGAUACAGCUAAAUU 2223 XM_005548887.2_2838- 738063.1 2860_as AD- UUUCCUGAUCACUAUGCAUUA 2224 UAAUGCAUAGUGAUCAGGAAAGG 2225 XM_005548887.2_3029- 738064.1 3051_as AD- AAUGGGUUUUGUGUACUGUAA 2226 UUACAGTACACAAAACCCAUUAA 2227 XM_005548887.2_2813- 738065.1 2835_as AD- UUACUGUACAGAUUGCUGCUA 2228 UAGCAGCAAUCUGUACAGUAAAA 2229 XM_005548887.2_3113- 738066.1 3135_as AD- AUUGUACAGAAUCAUUGCUUA 2230 UAAGCAAUGAUUCUGUACAAUCA 2231 XM_005548887.2_3371- 738067.1 3393_as AD- UUGUACAGAAUCAUUGCUUAA 2232 UUAAGCAAUGAUUCUGUACAAUC 2233 XM_005548887.2_3372- 738068.1 3394_as AD- AUAUGCUGAAGAAGUACGUCA 2234 UGACGUACUUCUUCAGCAUAUUG 2235 XM_005548887.2_1740- 738069.1 1762_as AD- ACCAUUGCUUCACUACCCAUA 2236 UAUGGGTAGUGAAGCAAUGGUUU 2237 XM_005548887.2_2616- 738070.1 2638_as AD- CUGUGCUGUAACACAAGUAGA 2238 UCUACUTGUGUUACAGCACAGCU 2239 XM_005548887.2_2714- 738071.1 2736_as AD- UGCUGUAACACAAGUAGAUGA 2240 UCAUCUACUUGUGUUACAGCACA 2241 XM_005548887.2_2717- 738072.1 2739_as AD- ACAGCUGUGCUGUAACACAAA 2242 UUUGUGTUACAGCACAGCUGUCA 2243 XM_005548887.2_2710- 738073.1 2732_as AD- GCUGUAACACAAGUAGAUGCA 2244 UGCAUCTACUUGUGUUACAGCAC 2245 XM_005548887.2_2718- 738074.1 2740_as AD- UCAAACUAGUGCAUGAAUAGA 2246 UCUAUUCAUGCACUAGUUUGAUA 2247 XM_005548887.2_2848- 738075.1 2870_as AD- CAAACUAGUGCAUGAAUAGAA 2248 UUCUAUTCAUGCACUAGUUUGAU 2249 XM_005548887.2_2849- 738076.1 2871_as AD- UGCAGGAUGAUUGUACAGAAA 2250 UUUCUGTACAAUCAUCCUGCAGA 2251 XM_005548887.2_3362- 738077.1 3384_as AD- GCAGGAUGAUUGUACAGAAUA 2252 UAUUCUGUACAAUCAUCCUGCAG 2253 XM_005548887.2_3363- 738078.1 3385_as AD- CAGGAUGAUUGUACAGAAUCA 2254 UGAUUCTGUACAAUCAUCCUGCA 2255 XM_005548887.2_3364- 738079.1 3386_as AD- UAUCAAACUAGUGCAUGAAUA 2256 UAUUCATGCACUAGUUUGAUACA 2257 XM_005548887.2_2846- 738080.1 2868_as AD- UUUGUGCCUGUUUUAUGUGCA 2258 UGCACATAAAACAGGCACAAAGA 2259 XM_005548887.2_3180- 738081.1 3202_as AD- UUGUGCCUGUUUUAUGUGCAA 2260 UUGCACAUAAAACAGGCACAAAG 2261 XM_005548887.2_3181- 738082.1 3203_as AD- CUGCAGGAUGAUUGUACAGAA 2262 UUCUGUACAAUCAUCCUGCAGAA 2263 XM_005548887.2_3361- 738083.1 3383_as AD- CAGGUCAUGAGAGAAUGGGAA 2264 UUCCCATUCUCUCAUGACCUGGG 2265 XM_005548887.2_1487- 738084.1 1509_as AD- UAUGCUGAAGAAGUACGUCCA 2266 UGGACGTACUUCUUCAGCAUAUU 2267 XM_005548887.2_1741- 738085.1 1763_as AD- AUGCUGAAGAAGUACGUCCGA 2268 UCGGACGUACUUCUUCAGCAUAU 2269 XM_005548887.2_1742- 738086.1 1764_as AD- AAACCAUUGCUUCACUACCCA 2270 UGGGUAGUGAAGCAAUGGUUUUG 2271 XM_005548887.2_2614- 738087.1 2636_as AD- AACCAUUGCUUCACUACCCAA 2272 UUGGGUAGUGAAGCAAUGGUUUU 2273 XM_005548887.2_2615- 738088.1 2637_as AD- UAUGUGCACACAUUAGGCAUA 2274 UAUGCCTAAUGUGUGCACAUAAA 2275 XM_005548887.2_3193- 738089.1 3215_as AD- UGUGCACACAUUAGGCAUUGA 2276 UCAAUGCCUAAUGUGUGCACAUA 2277 XM_005548887.2_3195- 738090.1 3217_as AD- GGAUGAUUGUACAGAAUCAUA 2278 UAUGAUTCUGUACAAUCAUCCUG 2279 XM_005548887.2_3366- 738091.1 3388_as AD- ACCAUCCAGAACUGGUGCAAA 2280 UUUGCACCAGUUCUGGAUGGUCA 2281 XM_005548887.2_767- 738092.1 789_as AD- CACCGAGAGAGAAUGUCCCAA 2282 UUGGGACAUUCUCUCUCGGUGCU 2283 XM_005548887.2_1469- 738093.1 1491_as AD- GUUGUAUAUUAUUCUUGUGGA 2284 UCCACAAGAAUAAUAUACAACUG 2285 XM_005548887.2_2906- 738094.1 2928_as AD- UUAUGUGCACACAUUAGGCAA 2286 UUGCCUAAUGUGUGCACAUAAAA 2287 XM_005548887.2_3192- 738095.1 3214_as AD- AUGUGCACACAUUAGGCAUUA 2288 UAAUGCCUAAUGUGUGCACAUAA 2289 XM_005548887.2_3194- 738096.1 3216_as AD- GUGCACACAUUAGGCAUUGAA 2290 UUCAAUGCCUAAUGUGUGCACAU 2291 XM_005548887.2_3196- 738097.1 3218_as AD- UGAUUGUACAGAAUCAUUGCA 2292 UGCAAUGAUUCUGUACAAUCAUC 2293 XM_005548887.2_3369- 738098.1 3391_as AD- GCUUCACUACCCAUCGGUGUA 2294 UACACCGAUGGGUAGUGAAGCAA 2295 XM_005548887.2_2622- 738099.1 2644_as AD- UUUUAUGUGCACACAUUAGGA 2296 UCCUAATGUGUGCACAUAAAACA 2297 XM_005548887.2_3190- 738100.1 3212_as
TABLE-US-00036 TABLE 14 Additional Human APP ModifiedSequences. SEQ SEQ Duplex ID ID Target Name Sense Sequence (5′ to 3′) NO Antisense Sequence (5′ to 3′) NO APP AD- usasgug(Chd)AfuGfAfAfuagauucucaL96 2298 VPusGfsagaa(Tgn)cuauucAfuGfcacuasgsu 2299 886823.1 APP AD- usasgug(Chd)AfugAfAfuagauucucaL96 2300 VPusGfsagaa(Tgn)cuauucAfuGfcacuasgsu 2301 886824.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2302 VPusGfsagaa(Tgn)cuauucAfuGfcacuasgsu 2303 886825.1 APP AD- usasgug(Chd)AfudGadAuagauucucaL96 2304 VPusGfsagaa(Tgn)cuauUfcAfuGfcacuasgsu 2305 886826.1 APP AD- usasgug(Chd)AfuGfAfAfuagauucucaL96 2306 VPusdGsagaa(Tgn)cuauucAfuGfcacuasgsu 2307 886827.1 APP AD- usasgug(Chd)AfuGfAfAfuagauucucaL96 2308 VPusGfsagaa(Tgn)cuauucAfugcacuasgsu 2309 886828.1 APP AD- usasgug(Chd)AfuGfAfAfuagauucucaL96 2310 VPusGfsagaa(Tgn)cuauucAfudGcacuasgsu 2311 886829.1 APP AD- usasgug(Chd)AfuGfaAfuagauucucaL96 2312 VPusGfsagaa(Tgn)cuaudTcAfudGcacuasgsu 2313 886830.1 APP AD- usasgug(Chd)AfuGfaAfuagauucucaL96 2314 VPusGfsagaa(Tgn)cuaudTcAfugcacuasgsu 2315 886831.1 APP AD- usasgug(Chd)AfuGfAfAfuagauucucaL96 2316 VPusdGsagaa(Tgn)cuauucAfudGcacuasgsu 2317 886832.1 APP AD- usasgug(Chd)AfuGfaAfuagauucucaL96 2318 VPusdGsagaa(Tgn)cuaudTcAfudGcacuasgsu 2319 886833.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2320 VPusdGsagaa(Tgn)cuauucAfuGfcacuasgsu 2321 886834.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2322 VPusGfsagaa(Tgn)cuauucAfudGcacuasgsu 2323 886836.1 APP AD- usasgug(Chd)AfudGaAfuagauucucaL96 2324 VPusGfsagaa(Tgn)cuaudTcAfudGcacuasgsu 2325 886837.1 APP AD- usasgug(Chd)AfudGaAfuagauucucaL96 2326 VPusGfsagaa(Tgn)cuaudTcAfugcacuasgsu 2327 886838.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2328 VPusdGsagaa(Tgn)cuauucAfudGcacuasgsu 2329 886839.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2330 VPusdGsagaa(Tgn)cuauucAfudGcacuasgsu 2331 886839.2 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2332 VPusdGsagaa(Tgn)cuaudTcAfudGcacuasgsu 2333 886840.1 APP AD- usasgug(Chd)AfudGaAfuagauucucaL96 2334 VPusdGsagaa(Tgn)cuaudTcAfudGcacuasgsu 2335 886841.1 APP AD- usasgug(Chd)AfudGadAuagauucucaL96 2336 VPusdGsagaa(Tgn)cuaudTcAfudGcacuasgsu 2337 886842.1 APP AD- usasgug(Chd)audGadAuagauucucaL96 2338 VPusdGsagaa(Tgn)cuaudTcAfudGcacuasgsu 2339 886843.1 APP AD- usasgug(Chd)audGadAuagauucucaL96 2340 VPudGagaa(Tgn)cuaudTcAfudGcacuasgsu 2341 886844.1 APP AD- usasgug(Chd)audGadAuagauucucaL96 2342 VPudGagaa(Tgn)cuauUfcAfudGcacuasgsu 2343 886845.1 APP AD- usasgug(Chd)audGadAuagauucucaL96 2344 VPudGadGadAucuauUfcAfudGcacuasgsu 2345 886846.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2346 VPudGagaa(Tgn)cuauucAfudGcacuasgsu 2347 886847.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2348 VPusdGsagadA(Tgn)cuauucAfudGcacuasgsu 2349 886848.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2350 VPusdGsagdAa(Tgn)cuauucAfudGcacuasgsu 2351 886849.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2352 VPusdGsagadA(Tgn)cuaudTcAfudGcacuasgsu 2353 886850.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2354 VPusdGsagdAa(Tgn)cuaudTcAfudGcacuasgsu 2355 886851.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2356 VPusdGsagadA(Tgn)cuaudTcAfugcacuasgsu 2357 886852.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2358 VPusdGsagdAa(Tgn)cuaudTcAfugcacuasgsu 2359 886853.1 APP AD- usasgug(Chd)AfudGadAuagauucucaL96 2360 VPusdGsagdAa(Tgn)cuaudTcAfugcacuasgsu 2361 886854.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2362 VPudGagadA(Tgn)cuauucAfudGcacuasgsu 2363 886855.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2364 VPudGagdAa(Tgn)cuauucAfudGcacuasgsu 2365 886856.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2366 VPudGagadA(Tgn)cuaudTcAfudGcacuasgsu 2367 886857.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2368 VPudGagdAa(Tgn)cuaudTcAfudGcacuasgsu 2369 886858.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2370 VPudGagadA(Tgn)cuaudTcAfugcacuasgsu 2371 886859.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2372 VPudGagdAa(Tgn)cuaudTcAfugcacuasgsu 2373 886860.1 APP AD- usasgug(Chd)AfuGfAfAfuagauucucaL96 2374 VPusGfsagaa(Tgn)cuauucAfuGfcacuasusg 2375 886861.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2376 VPusdGsagadA(Tgn)cuaudTcAfudGcacuasusg 2377 886862.1 APP AD- usasgug(Chd)AfudGAfAfuagauucucaL96 2378 VPusdGsagdAa(Tgn)cuaudTcAfudGcacuasusg 2379 886863.1 APP AD- gsgscua(Chd)GfaAfAfAfuccaaccuaaL96 2380 VPusUfsaggu(Tgn)ggauuutlfcGfuagccsgsu 2381 886864.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2382 VPusUfsaggu(Tgn)ggauuutlfcGfuagccsgsu 2383 886865.1 APP AD- gsgscua(Chd)dGaAfAfAfuccaaccuaaL96 2384 VPusUfsaggu(Tgn)ggauuutlfcGfuagccsgsu 2385 886866.1 APP AD- gsgscua(Chd)GfaAfAfAfuccaaccuaaL96 2386 VPuUfaggu(Tgn)ggauuutlfcGfuagccsgsu 2387 886867.1 APP AD- gsgscua(Chd)GfaAfAfAfuccaaccuaaL96 2388 VPusUfsaggu(Tgn)ggauuutlfcguagccsgsu 2389 886868.1 APP AD- gsgscua(Chd)GfaAfAfAfuccaaccuaaL96 2390 VPusUfsaggu(Tgn)ggauuutifcdGuagccsgsu 2391 886869.1 APP AD- gsgscua(Chd)GfaAfAfAfuccaaccuaaL96 2392 VPusUfsaggu(Tgn)ggaudTuUfcdGuagccsgsu 2393 886870.1 APP AD- gsgscua(Chd)gaAfaAfuccaaccuaaL96 2394 VPusUfsaggu(Tgn)ggaudTuUfcdGuagccsgsu 2395 886871.1 APP AD- gsgscua(Chd)gaAfaAfuccaaccuaaL96 2396 VPusUfsaggu(Tgn)ggauUfuUfcdGuagccsgsu 2397 886872.1 APP AD- gsgscua(Chd)gadAadAuccaaccuaaL96 2398 VPusUfsaggu(Tgn)ggaudTuUfcdGuagccsgsu 2399 886873.1 APP AD- gsgscua(Chd)GfaAfAfAfuccaaccuaaL96 2400 VPusUfsaggu(Tgn)ggaudTuUfcguagccsgsu 2401 886874.1 APP AD- gsgscua(Chd)gaAfaAfuccaaccuaaL96 2402 VPusUfsaggu(Tgn)ggaudTuUfcguagccsgsu 2403 886875.1 APP AD- gsgscua(Chd)gaAfaAfuccaaccuaaL96 2404 VPusUfsaggu(Tgn)ggauUfuUfcguagccsgsu 2405 886876.1 APP AD- gsgscua(Chd)gadAadAuccaaccuaaL96 2406 VPusUfsaggu(Tgn)ggaudTuUfcguagccsgsu 2407 886877.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2408 VPusUfsaggu(Tgn)ggauuuUfcguagccsgsu 2409 886878.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2410 VPusUfsaggu(Tgn)ggauuutifcdGuagccsgsu 2411 886879.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2412 VPusUfsaggu(Tgn)ggaudTuUfcdGuagccsgsu 2413 886880.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2414 VPusUfsaggu(Tgn)ggaudTuUfcguagccsgsu 2415 886881.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2416 VPuUfaggdT(Tgn)ggauuuUfcguagccsgsu 2417 886882.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2418 VPuUfaggdT(Tgn)ggauuuUfcdGuagccsgsu 2419 886883.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2420 VPuUfaggdT(Tgn)ggaudTuUfcdGuagccsgsu 2421 886884.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2422 VPuUfaggdT(Tgn)ggaudTuUfcguagccsgsu 2423 886885.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2424 VPuUfagdGu(Tgn)ggauuuUfcguagccsgsu 2425 886886.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2426 VPuUfagdGu(Tgn)ggauuuUfcdGuagccsgsu 2427 886887.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2428 VPuUfagdGu(Tgn)ggaudTuUfcdGuagccsgsu 2429 886888.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2430 VPuUfagdGu(Tgn)ggaudTuUfcguagccsgsu 2431 886889.1 APP AD- gsgscua(Chd)GfaAfAfAfuccaaccuaaL96 2432 VPusUfsaggu(Tgn)ggauuuUfcGfuagccsusg 2433 886890.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2434 VPusUfsaggu(Tgn)ggauuuUfcdGuagccsusg 2435 886891.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2436 VPuUfaggdT(Tgn)ggaudTuUfcdGuagccsusg 2437 886892.1 APP AD- gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2438 VPuUfagdGu(Tgn)ggaudTuUfcdGuagccsusg 2439 886893.1 APP AD- asasaga(Ghd)CfaAfAfAfcuauucagaaL96 2440 VPusUfscugAfaUfAfguuuUfgCfucuuuscsu 2441 886894.1 APP AD- asasag(Ahd)gCfaAfAfAfcuauucagaaL96 2442 VPusUfscugAfaUfAfguuuUfgCfucuuuscsu 2443 886895.1 APP AD- asasagag(Chd)aAfAfAfcuauucagaaL96 2444 VPusUfscugAfaUfAfguuuUfgCfucuuuscsu 2445 886896.1 APP AD- asasagagCfaAfAfAfcua(Uhd)ucagaaL96 2446 VPusUfscugAfaUfAfguuuUfgCfucuuuscsu 2447 886897.1 APP AD- asasagagCfaAfAfAfcuau(Uhd)cagaaL96 2448 VPusUfscugAfaUfAfguuuUfgCfucuuuscsu 2449 886898.1 APP AD- asasagagCfaAfAfAfcuauu(Chd)agaaL96 2450 VPusUfscugAfaUfAfguuuUfgCfucuuuscsu 2451 886899.1 APP AD- asasaga(Ghd)CfaAfAfAfcuauucagaaL96 2452 VPusUfscugAfauaguuuUfgCfucuuuscsu 2453 886900.1 APP AD- asasaga(Ghd)CfaAfAfAfcuauucagaaL96 2454 VPuUfcugAfaUfAfguuuUfgCfucuuuscsu 2455 886901.1 APP AD- asasaga(Ghd)CfaAfAfAfcuauucagaaL96 2456 VPuUfcugAfauaguuuUfgCfucuuuscsu 2457 886902.1 APP AD- asasag(Ahd)gCfaAfAfAfcuauucagaaL96 2458 VPuUfcugAfaUfAfguuuUfgCfucuuuscsu 2459 886903.1 APP AD- asasag(Ahd)gCfaAfAfAfcuauucagaaL96 2460 VPuUfcugAfauaguuuUfgCfucuuuscsu 2461 886904.1 APP AD- asasagag(Chd)aAfAfAfcuauucagaaL96 2462 VPuUfcugAfaUfAfguuuUfgCfucuuuscsu 2463 886905.1 APP AD- asasagag(Chd)aAfAfAfcuauucagaaL96 2464 VPuUfcugAfauaguuuUfgCfucuuuscsu 2465 886906.1 APP AD- asasagag(Chd)aAfaAfcuauucagaaL96 2466 VPuUfcugAfauagudTuUfgCfucuuuscsu 2467 886907.1 APP AD- asasagag(Chd)adAadAcuauucagaaL96 2468 VPuUfcugAfauagudTuUfgCfucuuuscsu 2469 886908.1 APP AD- asasagag(Chd)adAadAcuauucagaaL96 2470 VPuUfcugdAauagudTuUfgdCucuuuscsu 2471 886909.1 APP AD- asasaga(Ghd)CfaAfAfAfcuauucagaaL96 2472 VPusUfscugAfauaguuuUfgCfucuuususg 2473 886910.1 APP AD- asasagagCfaAfAfAfcua(Uhd)ucagaaL96 2474 VPuUfcugAfauaguuuUfgCfucuuususg 2475 886911.1 APP AD- asasagag(Chd)aAfAfAfcuauucagaaL96 2476 VPuUfcugAfauaguuuUfgCfucuuususg 2477 886912.1 APP AD- ususuau(Ghd)AfuUfUfAfcucauuaucaL96 2478 VPusGfsauaAfuGfAfguaaAfuCfauaaasasc 2479 886913.1 APP AD- ususua(Uhd)gAfuUfUfAfcucauuaucaL96 2480 VPusGfsauaAfuGfAfguaaAfuCfauaaasasc 2481 886914.1 APP AD- ususuaug(Ahd)uUfUfAfcucauuaucaL96 2482 VPusGfsauaAfuGfAfguaaAfuCfauaaasasc 2483 886915.1 APP AD- ususuaugAfuUfUfAfcuc(Ahd)uuaucaL96 2484 VPusGfsauaAfuGfAfguaaAfuCfauaaasasc 2485 886916.1 APP AD- ususuaugAfuUfUfAfcuca(Uhd)uaucaL96 2486 VPusGfsauaAfuGfAfguaaAfuCfauaaasasc 2487 886917.1 APP AD- ususuaugAfuUfUfAfcucau(Uhd)aucaL96 2488 VPusGfsauaAfuGfAfguaaAfuCfauaaasasc 2489 886918.1 APP AD- ususuau(Ghd)AfuUfUfAfcucauuaucaL96 2490 VPusGfsauaAfugaguaaAfuCfauaaasasc 2491 886919.1 APP AD- ususuau(Ghd)AfuUfUfAfcucauuaucaL96 2492 VPusdGsauaAfugaguaaAfuCfauaaasasc 2493 886920.1 APP AD- ususuau(Ghd)AfuUfUfAfcucauuaucaL96 2494 VPudGauaAfugaguaaAfuCfauaaasasc 2495 886921.1 APP AD- ususua(Uhd)gAfuUfUfAfcucauuaucaL96 2496 VPusdGsauaAfugaguaaAfuCfauaaasasc 2497 886922.1 APP AD- ususua(Uhd)gAfuUfUfAfcucauuaucaL96 2498 VPudGauaAfugaguaaAfuCfauaaasasc 2499 886923.1 APP AD- ususuaug(Ahd)uUfUfAfcucauuaucaL96 2500 VPusdGsauaAfugaguaaAfuCfauaaasasc 2501 886924.1 APP AD- ususuaug(Ahd)uUfUfAfcucauuaucaL96 2502 VPudGauaAfugaguaaAfuCfauaaasasc 2503 886925.1 APP AD- ususuaug(Ahd)uUfuAfcucauuaucaL96 2504 VPudGauadAugagudAaAfuCfauaaasasc 2505 886926.1 APP AD- ususuaug(Ahd)uUfudAcucauuaucaL96 2506 VPudGauadAugagudAaAfuCfauaaasasc 2507 886927.1 APP AD- ususuaug(Ahd)uUfudAcucauuaucaL96 2508 VPudGauadAugagudAaAfudCauaaasasc 2509 886928.1 APP AD- ususuau(Ghd)AfuUfUfAfcucauuaucaL96 2510 VPusGfsauaAfugaguaaAfuCfauaaasusg 2511 886929.1 APP AD- ususuaugAfuUfUfAfcuc(Ahd)uuaucaL96 2512 VPusdGsauaAfugaguaaAfuCfauaaasusg 2513 886930.1 APP AD- ususuaug(Ahd)uUfUfAfcucauuaucaL96 2514 VPusdGsauaAfugaguaaAfuCfauaaasusg 2515 886931.1 Table 14 key: U = uridine-3′-phosphate, u = 2′-O-methyluridine-3′-phosphate, us = 2′-O-methyluridine-3′-phosphorothioate, a = 2′-O-methyladenosine-3′-phosphate, A = adenosine-3′-phosphate, as = 2′-O-methyladenosine-3′-phosphorothioate, (Ahd) = 2′-O-hexadecyl-adenosine-3′-phosphate, Gf = 2′-fluoroguanosine-3′-phosphate, Uf = 2′-fluorouridine-3′-phosphate, Cf = 2′-fluorocytidine-3′-phosphate, Af = 2′-fluoroadenosine-3′-phosphate, cs = 2′-O-methylcytidine-3′-phosphate, VP = Vinylphosphate 5′, (Agn) = Adenosine-glycol nucleic acid (GNA), gs = 2′-O-methylguanosine-3′-phosphorothioate, (Chd) = 2′-O-hexadecyl-cytidine-3′-phosphate, (Tgn) = Thymidine-glycol nucleic acid (GNA) S-Isomer, (Ghd) = 2′-O-hexadecyl-guanosine-3′-phosphate, and cs = 2′-O-methylcytidine-3′-phosphorothioate.?
TABLE-US-00037 TABLE 15 Additional APP Unmodified Sequences. Duplex SEQ ID SEQ ID Name Sense Sequence (5′ to 3′) NO Antisense Sequence (5′ to 3′) NO AD- UAGUGCAUGAAUAGAUUCUCA 2516 UGAGAATCUAUUCAUGCACUAGU 2517 886823.1 AD- UAGUGCAUGAAUAGAUUCUCA 2518 UGAGAATCUAUUCAUGCACUAGU 2519 886824.1 AD- UAGUGCAUGAAUAGAUUCUCA 2520 UGAGAATCUAUUCAUGCACUAGU 2521 886825.1 AD- UAGUGCAUGAAUAGAUUCUCA 2522 UGAGAATCUAUUCAUGCACUAGU 2523 886826.1 AD- UAGUGCAUGAAUAGAUUCUCA 2524 UGAGAATCUAUUCAUGCACUAGU 2525 886827.1 AD- UAGUGCAUGAAUAGAUUCUCA 2526 UGAGAATCUAUUCAUGCACUAGU 2527 886828.1 AD- UAGUGCAUGAAUAGAUUCUCA 2528 UGAGAATCUAUUCAUGCACUAGU 2529 886829.1 AD- UAGUGCAUGAAUAGAUUCUCA 2530 UGAGAATCUAUTCAUGCACUAGU 2531 886830.1 AD- UAGUGCAUGAAUAGAUUCUCA 2532 UGAGAATCUAUTCAUGCACUAGU 2533 886831.1 AD- UAGUGCAUGAAUAGAUUCUCA 2534 UGAGAATCUAUUCAUGCACUAGU 2535 886832.1 AD- UAGUGCAUGAAUAGAUUCUCA 2536 UGAGAATCUAUTCAUGCACUAGU 2537 886833.1 AD- UAGUGCAUGAAUAGAUUCUCA 2538 UGAGAATCUAUUCAUGCACUAGU 2539 886834.1 AD- UAGUGCAUGAAUAGAUUCUCA 2540 UGAGAATCUAUUCAUGCACUAGU 2541 886836.1 AD- UAGUGCAUGAAUAGAUUCUCA 2542 UGAGAATCUAUTCAUGCACUAGU 2543 886837.1 AD- UAGUGCAUGAAUAGAUUCUCA 2544 UGAGAATCUAUTCAUGCACUAGU 2545 886838.1 AD- UAGUGCAUGAAUAGAUUCUCA 2546 UGAGAATCUAUUCAUGCACUAGU 2547 886839.1 AD- UAGUGCAUGAAUAGAUUCUCA 2548 UGAGAATCUAUUCAUGCACUAGU 2549 886839.2 AD- UAGUGCAUGAAUAGAUUCUCA 2550 UGAGAATCUAUTCAUGCACUAGU 2551 886840.1 AD- UAGUGCAUGAAUAGAUUCUCA 2552 UGAGAATCUAUTCAUGCACUAGU 2553 886841.1 AD- UAGUGCAUGAAUAGAUUCUCA 2554 UGAGAATCUAUTCAUGCACUAGU 2555 886842.1 AD- UAGUGCAUGAAUAGAUUCUCA 2556 UGAGAATCUAUTCAUGCACUAGU 2557 886843.1 AD- UAGUGCAUGAAUAGAUUCUCA 2558 UGAGAATCUAUTCAUGCACUAGU 2559 886844.1 AD- UAGUGCAUGAAUAGAUUCUCA 2560 UGAGAATCUAUUCAUGCACUAGU 2561 886845.1 AD- UAGUGCAUGAAUAGAUUCUCA 2562 UGAGAAUCUAUUCAUGCACUAGU 2563 886846.1 AD- UAGUGCAUGAAUAGAUUCUCA 2564 UGAGAATCUAUUCAUGCACUAGU 2565 886847.1 AD- UAGUGCAUGAAUAGAUUCUCA 2566 UGAGAATCUAUUCAUGCACUAGU 2567 886848.1 AD- UAGUGCAUGAAUAGAUUCUCA 2568 UGAGAATCUAUUCAUGCACUAGU 2569 886849.1 AD- UAGUGCAUGAAUAGAUUCUCA 2570 UGAGAATCUAUTCAUGCACUAGU 2571 886850.1 AD- UAGUGCAUGAAUAGAUUCUCA 2572 UGAGAATCUAUTCAUGCACUAGU 2573 886851.1 AD- UAGUGCAUGAAUAGAUUCUCA 2574 UGAGAATCUAUTCAUGCACUAGU 2575 886852.1 AD- UAGUGCAUGAAUAGAUUCUCA 2576 UGAGAATCUAUTCAUGCACUAGU 2577 886853.1 AD- UAGUGCAUGAAUAGAUUCUCA 2578 UGAGAATCUAUTCAUGCACUAGU 2579 886854.1 AD- UAGUGCAUGAAUAGAUUCUCA 2580 UGAGAATCUAUUCAUGCACUAGU 2581 886855.1 AD- UAGUGCAUGAAUAGAUUCUCA 2582 UGAGAATCUAUUCAUGCACUAGU 2583 886856.1 AD- UAGUGCAUGAAUAGAUUCUCA 2584 UGAGAATCUAUTCAUGCACUAGU 2585 886857.1 AD- UAGUGCAUGAAUAGAUUCUCA 2586 UGAGAATCUAUTCAUGCACUAGU 2587 886858.1 AD- UAGUGCAUGAAUAGAUUCUCA 2588 UGAGAATCUAUTCAUGCACUAGU 2589 886859.1 AD- UAGUGCAUGAAUAGAUUCUCA 2590 UGAGAATCUAUTCAUGCACUAGU 2591 886860.1 AD- UAGUGCAUGAAUAGAUUCUCA 2592 UGAGAATCUAUUCAUGCACUAUG 2593 886861.1 AD- UAGUGCAUGAAUAGAUUCUCA 2594 UGAGAATCUAUTCAUGCACUAUG 2595 886862.1 AD- UAGUGCAUGAAUAGAUUCUCA 2596 UGAGAATCUAUTCAUGCACUAUG 2597 886863.1 AD- GGCUACGAAAAUCCAACCUAA 2598 UUAGGUTGGAUUUUCGUAGCCGU 2599 886864.1 AD- GGCUACGAAAAUCCAACCUAA 2600 UUAGGUTGGAUUUUCGUAGCCGU 2601 886865.1 AD- GGCUACGAAAAUCCAACCUAA 2602 UUAGGUTGGAUUUUCGUAGCCGU 2603 886866.1 AD- GGCUACGAAAAUCCAACCUAA 2604 UUAGGUTGGAUUUUCGUAGCCGU 2605 886867.1 AD- GGCUACGAAAAUCCAACCUAA 2606 UUAGGUTGGAUUUUCGUAGCCGU 2607 886868.1 AD- GGCUACGAAAAUCCAACCUAA 2608 UUAGGUTGGAUUUUCGUAGCCGU 2609 886869.1 AD- GGCUACGAAAAUCCAACCUAA 2610 UUAGGUTGGAUTUUCGUAGCCGU 2611 886870.1 AD- GGCUACGAAAAUCCAACCUAA 2612 UUAGGUTGGAUTUUCGUAGCCGU 2613 886871.1 AD- GGCUACGAAAAUCCAACCUAA 2614 UUAGGUTGGAUUUUCGUAGCCGU 2615 886872.1 AD- GGCUACGAAAAUCCAACCUAA 2616 UUAGGUTGGAUTUUCGUAGCCGU 2617 886873.1 AD- GGCUACGAAAAUCCAACCUAA 2618 UUAGGUTGGAUTUUCGUAGCCGU 2619 886874.1 AD- GGCUACGAAAAUCCAACCUAA 2620 UUAGGUTGGAUTUUCGUAGCCGU 2621 886875.1 AD- GGCUACGAAAAUCCAACCUAA 2622 UUAGGUTGGAUUUUCGUAGCCGU 2623 886876.1 AD- GGCUACGAAAAUCCAACCUAA 2624 UUAGGUTGGAUTUUCGUAGCCGU 2625 886877.1 AD- GGCUACGAAAAUCCAACCUAA 2626 UUAGGUTGGAUUUUCGUAGCCGU 2627 886878.1 AD- GGCUACGAAAAUCCAACCUAA 2628 UUAGGUTGGAUUUUCGUAGCCGU 2629 886879.1 AD- GGCUACGAAAAUCCAACCUAA 2630 UUAGGUTGGAUTUUCGUAGCCGU 2631 886880.1 AD- GGCUACGAAAAUCCAACCUAA 2632 UUAGGUTGGAUTUUCGUAGCCGU 2633 886881.1 AD- GGCUACGAAAAUCCAACCUAA 2634 UUAGGTTGGAUUUUCGUAGCCGU 2635 886882.1 AD- GGCUACGAAAAUCCAACCUAA 2636 UUAGGTTGGAUUUUCGUAGCCGU 2637 886883.1 AD- GGCUACGAAAAUCCAACCUAA 2638 UUAGGTTGGAUTUUCGUAGCCGU 2639 886884.1 AD- GGCUACGAAAAUCCAACCUAA 2640 UUAGGTTGGAUTUUCGUAGCCGU 2641 886885.1 AD- GGCUACGAAAAUCCAACCUAA 2642 UUAGGUTGGAUUUUCGUAGCCGU 2643 886886.1 AD- GGCUACGAAAAUCCAACCUAA 2644 UUAGGUTGGAUUUUCGUAGCCGU 2645 886887.1 AD- GGCUACGAAAAUCCAACCUAA 2646 UUAGGUTGGAUTUUCGUAGCCGU 2647 886888.1 AD- GGCUACGAAAAUCCAACCUAA 2648 UUAGGUTGGAUTUUCGUAGCCGU 2649 886889.1 AD- GGCUACGAAAAUCCAACCUAA 2650 UUAGGUTGGAUUUUCGUAGCCUG 2651 886890.1 AD- GGCUACGAAAAUCCAACCUAA 2652 UUAGGUTGGAUUUUCGUAGCCUG 2653 886891.1 AD- GGCUACGAAAAUCCAACCUAA 2654 UUAGGTTGGAUTUUCGUAGCCUG 2655 886892.1 AD- GGCUACGAAAAUCCAACCUAA 2656 UUAGGUTGGAUTUUCGUAGCCUG 2657 886893.1 AD- AAAGAGCAAAACUAUUCAGAA 2658 UUCUGAAUAGUUUUGCUCUUUCU 2659 886894.1 AD- AAAGAGCAAAACUAUUCAGAA 2660 UUCUGAAUAGUUUUGCUCUUUCU 2661 886895.1 AD- AAAGAGCAAAACUAUUCAGAA 2662 UUCUGAAUAGUUUUGCUCUUUCU 2663 886896.1 AD- AAAGAGCAAAACUAUUCAGAA 2664 UUCUGAAUAGUUUUGCUCUUUCU 2665 886897.1 AD- AAAGAGCAAAACUAUUCAGAA 2666 UUCUGAAUAGUUUUGCUCUUUCU 2667 886898.1 AD- AAAGAGCAAAACUAUUCAGAA 2668 UUCUGAAUAGUUUUGCUCUUUCU 2669 886899.1 AD- AAAGAGCAAAACUAUUCAGAA 2670 UUCUGAAUAGUUUUGCUCUUUCU 2671 886900.1 AD- AAAGAGCAAAACUAUUCAGAA 2672 UUCUGAAUAGUUUUGCUCUUUCU 2673 886901.1 AD- AAAGAGCAAAACUAUUCAGAA 2674 UUCUGAAUAGUUUUGCUCUUUCU 2675 886902.1 AD- AAAGAGCAAAACUAUUCAGAA 2676 UUCUGAAUAGUUUUGCUCUUUCU 2677 886903.1 AD- AAAGAGCAAAACUAUUCAGAA 2678 UUCUGAAUAGUUUUGCUCUUUCU 2679 886904.1 AD- AAAGAGCAAAACUAUUCAGAA 2680 UUCUGAAUAGUUUUGCUCUUUCU 2681 886905.1 AD- AAAGAGCAAAACUAUUCAGAA 2682 UUCUGAAUAGUUUUGCUCUUUCU 2683 886906.1 AD- AAAGAGCAAAACUAUUCAGAA 2684 UUCUGAAUAGUTUUGCUCUUUCU 2685 886907.1 AD- AAAGAGCAAAACUAUUCAGAA 2686 UUCUGAAUAGUTUUGCUCUUUCU 2687 886908.1 AD- AAAGAGCAAAACUAUUCAGAA 2688 UUCUGAAUAGUTUUGCUCUUUCU 2689 886909.1 AD- AAAGAGCAAAACUAUUCAGAA 2690 UUCUGAAUAGUUUUGCUCUUUUG 2691 886910.1 AD- AAAGAGCAAAACUAUUCAGAA 2692 UUCUGAAUAGUUUUGCUCUUUUG 2693 886911.1 AD- AAAGAGCAAAACUAUUCAGAA 2694 UUCUGAAUAGUUUUGCUCUUUUG 2695 886912.1 AD- UUUAUGAUUUACUCAUUAUCA 2696 UGAUAAUGAGUAAAUCAUAAAAC 2697 886913.1 AD- UUUAUGAUUUACUCAUUAUCA 2698 UGAUAAUGAGUAAAUCAUAAAAC 2699 886914.1 AD- UUUAUGAUUUACUCAUUAUCA 2700 UGAUAAUGAGUAAAUCAUAAAAC 2701 886915.1 AD- UUUAUGAUUUACUCAUUAUCA 2702 UGAUAAUGAGUAAAUCAUAAAAC 2703 886916.1 AD- UUUAUGAUUUACUCAUUAUCA 2704 UGAUAAUGAGUAAAUCAUAAAAC 2705 886917.1 AD- UUUAUGAUUUACUCAUUAUCA 2706 UGAUAAUGAGUAAAUCAUAAAAC 2707 886918.1 AD- UUUAUGAUUUACUCAUUAUCA 2708 UGAUAAUGAGUAAAUCAUAAAAC 2709 886919.1 AD- UUUAUGAUUUACUCAUUAUCA 2710 UGAUAAUGAGUAAAUCAUAAAAC 2711 886920.1 AD- UUUAUGAUUUACUCAUUAUCA 2712 UGAUAAUGAGUAAAUCAUAAAAC 2713 886921.1 AD- UUUAUGAUUUACUCAUUAUCA 2714 UGAUAAUGAGUAAAUCAUAAAAC 2715 886922.1 AD- UUUAUGAUUUACUCAUUAUCA 2716 UGAUAAUGAGUAAAUCAUAAAAC 2717 886923.1 AD- UUUAUGAUUUACUCAUUAUCA 2718 UGAUAAUGAGUAAAUCAUAAAAC 2719 886924.1 AD- UUUAUGAUUUACUCAUUAUCA 2720 UGAUAAUGAGUAAAUCAUAAAAC 2721 886925.1 AD- UUUAUGAUUUACUCAUUAUCA 2722 UGAUAAUGAGUAAAUCAUAAAAC 2723 886926.1 AD- UUUAUGAUUUACUCAUUAUCA 2724 UGAUAAUGAGUAAAUCAUAAAAC 2725 886927.1 AD- UUUAUGAUUUACUCAUUAUCA 2726 UGAUAAUGAGUAAAUCAUAAAAC 2727 886928.1 AD- UUUAUGAUUUACUCAUUAUCA 2728 UGAUAAUGAGUAAAUCAUAAAUG 2729 886929.1 AD- UUUAUGAUUUACUCAUUAUCA 2730 UGAUAAUGAGUAAAUCAUAAAUG 2731 886930.1 AD- UUUAUGAUUUACUCAUUAUCA 2732 UGAUAAUGAGUAAAUCAUAAAUG 2733 886931.1
TABLE-US-00038 TABLE 16A Additional Human APP Modified Sense Sequences and Targets. SEQ SEQ Duplex Name target Sense Sequence (5′ to 3′) ID NO mRNA Target Sequence ID NO AD-961583 APP gsgscua(Chd)gadAadAuccaaccusasa 2734 GGCUACGAAAAUCCAACCUAA 2735 AD-961584 APP asasagag(Chd)aAfaAfcuauucagsasa 2736 AAAGAGCAAAACUAUUCAGAA 2737 AD-961585 APP asasagag(Chd)adAadAcuauucagsasa 2738 AAAGAGCAAAACUAUUCAGAA 2739 AD-961586 APP ususuau(Ghd)AfuUfUfAfcucauuauscsa 2740 UUUAUGAUUUACUCAUUAUCA 2741 Table 16A key: U = uridine-3′-phosphate, u = 2′-O-methyluridine-3′-phosphate, us = 2′-O-methyluridine-3′-phosphorothioate, a = 2′-O-methyladenosine-3′-phosphate, A = adenosine-3′-phosphate, as = 2′-O-methyladenosine-3′-phosphorothioate, (Ahd) = 2′-O-hexadecyl-adenosine-3′-phosphate, Gf = 2′-fluoroguanosine-3′-phosphate, Uf = 2′-fluorouridine-3′-phosphate, Cf = 2′-fluorocytidine-3′-phosphate, Af = 2′-fluoroadenosine-3′-phosphate, cs = 2′-O-methylcytidine-3′-phosphate, VP = Vinylphosphate 5′, (Agn) = Adenosine-glycol nucleic acid (GNA), gs = 2′-O-methylguanosine-3′-phosphorothioate, (Chd) = 2′-O-hexadecyl-cytidine-3′-phosphate, (Tgn) = Thymidine-glycol nucleic acid (GNA) S-Isomer, (Ghd) = 2′-O-hexadecyl-guanosine-3′-phosphate, and cs = 2′-O-methylcytidine-3′-phosphorothioate.
TABLE-US-00039 TABLE 16B Additional Human APP Modified Antisense Sequences and Targets SEQ SEQ Duplex Name target Antisense Sequence (5′ to 3′) ID NO mRNA Target Sequence ID NO AD-961583 APP VPusUfsaggu(Tgn)ggaudTuUfcdGuagccsgsu 2742 UUAGGUTGGAUTUUCGUAGCCGU 2743 AD-961584 APP VPuUfcugAfauagudTuUfgCfucuuuscsu 2744 UUCUGAAUAGUTUUGCUCUUUCU 2745 AD-961585 APP VPuUfcugdAauagudTuUfgdCucuuuscsu 2746 UUCUGAAUAGUTUUGCUCUUUCU 2747 AD-961586 APP VPusGfsauaAfugaguaaAfuCfauaaasusg 2748 UGAUAAUGAGUAAAUCAUAAAUG 2749 Table 16B key: U = uridine-3′-phosphate, u = 2′-O-methyluridine-3′-phosphate, us = 2′-O-methyluridine-3′-phosphorothioate, a = 2′-O-methyladenosine-3′-phosphate, A = adenosine-3′-phosphate, as = 2′-O-methyladenosine-3′-phosphorothioate, (Ahd) = 2′-O-hexadecyl-adenosine-3′-phosphate, Gf = 2′-fluoroguanosine-3′-phosphate, Uf = 2′-fluorouridine-3′-phosphate, Cf = 2′-fluorocytidine-3′-phosphate, Af = 2′-fluoroadenosine-3′-phosphate, cs = 2′-O-methylcytidine-3′-phosphate, VP = Vinylphosphate 5′, (Agn) = Adenosine-glycol nucleic acid (GNA), gs = 2′-O-methylguanosine-3′-phosphorothioate, (Chd) = 2′-O-hexadecyl-cytidine-3′-phosphate, (Tgn) = Thymidine-glycol nucleic acid (GNA) S-Isomer, (Ghd) = 2′-O-hexadecyl-guanosine-3′-phosphate, and cs = 2′-O-methylcytidine-3′-phosphorothioate.
[0806] Table 17 summarizes results from a multi-dose APP screen in Be(2) cells conducted at either 10 nM, 1 nM or 0.1 nM. Data are expressed as percent message remaining relative to AD-1955 non-targeting control.
TABLE-US-00040 TABLE 17 APP Dose Screen Study in Be(2)C Cell Lines at 10 nM, 1 nM, and 0.1 nM Average message Standard Dose Duplex remaining (%) Deviation Dose Unit AD-738012.1 12.47 3.92 10 nM AD-738013.1 8.78 1.74 10 nM AD-738014.1 10.27 3.95 10 nM AD-738015.1 9.84 3.00 10 nM AD-738016.1 11.79 4.10 10 nM AD-738017.1 12.85 2.41 10 nM AD-738018.1 13.22 2.40 10 nM AD-738019.1 14.57 2.64 10 nM AD-738020.1 9.06 2.84 10 nM AD-738021.1 12.95 6.42 10 nM AD-738022.1 10.55 1.29 10 nM AD-738023.1 8.22 1.41 10 nM AD-738024.1 13.51 4.75 10 nM AD-738025.1 48.96 7.46 10 nM AD-738026.1 11.78 2.88 10 nM AD-738027.1 10.71 2.22 10 nM AD-738028.1 18.52 2.12 10 nM AD-738029.1 17.74 4.49 10 nM AD-738030.1 25.60 5.77 10 nM AD-738031.1 28.70 6.14 10 nM AD-738032.1 13.38 9.34 10 nM AD-738033.1 10.13 1.96 10 nM AD-738034.1 15.22 6.91 10 nM AD-738035.1 14.59 5.75 10 nM AD-738036.1 19.64 12.56 10 nM AD-738037.1 21.74 10.22 10 nM AD-738038.1 27.23 3.73 10 nM AD-738039.1 28.08 5.99 10 nM AD-738040.1 60.35 0.96 10 nM AD-738041.1 38.29 15.92 10 nM AD-738042.1 25.54 7.15 10 nM AD-738043.1 12.59 4.84 10 nM AD-738044.1 44.57 13.69 10 nM AD-738045.1 218.56 104.83 10 nM AD-738046.1 263.77 29.64 10 nM AD-738047.1 35.84 3.46 10 nM AD-738048.1 34.43 4.01 10 nM AD-397217.2 70.05 6.00 10 nM AD-738049.1 13.20 6.16 10 nM AD-738050.1 11.02 0.82 10 nM AD-738051.1 40.85 6.01 10 nM AD-738052.1 37.45 14.43 10 nM AD-738053.1 30.69 7.50 10 nM AD-738054.1 62.81 13.33 10 nM AD-738055.1 28.18 9.27 10 nM AD-738056.1 28.91 4.29 10 nM AD-738057.1 24.47 7.91 10 nM AD-738058.1 49.05 8.41 10 nM AD-738059.1 35.32 9.27 10 nM AD-738060.1 25.40 3.87 10 nM AD-738061.1 53.19 2.95 10 nM AD-738062.1 17.28 7.65 10 nM AD-738063.1 33.40 9.94 10 nM AD-738064.1 30.75 4.43 10 nM AD-738065.1 28.34 14.64 10 nM AD-738066.1 92.51 16.17 10 nM AD-738067.1 30.74 7.71 10 nM AD-738068.1 25.12 2.84 10 nM AD-738069.1 59.72 9.34 10 nM AD-738070.1 35.03 9.43 10 nM AD-738071.1 15.79 2.79 10 nM AD-738072.1 63.54 33.06 10 nM AD-738073.1 28.05 3.62 10 nM AD-738074.1 31.74 5.88 10 nM AD-738075.1 174.04 56.95 10 nM AD-738076.1 29.35 8.89 10 nM AD-738077.1 14.69 5.00 10 nM AD-738078.1 15.15 2.61 10 nM AD-738079.1 11.40 3.42 10 nM AD-738080.1 10.80 0.91 10 nM AD-738081.1 36.37 8.31 10 nM AD-738082.1 28.65 4.80 10 nM AD-738083.1 9.98 0.75 10 nM AD-738084.1 31.76 4.26 10 nM AD-738085.1 48.74 6.11 10 nM AD-738086.1 60.41 10.30 10 nM AD-738087.1 12.21 2.15 10 nM AD-738088.1 44.49 10.16 10 nM AD-738089.1 31.43 4.82 10 nM AD-738090.1 23.34 5.54 10 nM AD-738091.1 35.28 12.92 10 nM AD-738092.1 89.59 18.72 10 nM AD-738093.1 71.33 16.07 10 nM AD-738094.1 18.69 3.23 10 nM AD-738095.1 30.93 6.90 10 nM AD-738096.1 26.70 5.20 10 nM AD-738097.1 65.74 9.99 10 nM AD-738098.1 16.18 4.17 10 nM AD-738099.1 48.95 9.69 10 nM AD-738100.1 67.26 11.31 10 nM AD-738012.1 17.40 2.53 1 nM AD-738013.1 15.51 2.70 1 nM AD-738014.1 23.54 9.95 1 nM AD-738015.1 21.35 2.38 1 nM AD-738016.1 20.20 1.90 1 nM AD-738017.1 15.67 2.60 1 nM AD-738018.1 17.00 0.80 1 nM AD-738019.1 17.58 7.97 1 nM AD-738020.1 15.47 3.64 1 nM AD-738021.1 14.81 4.24 1 nM AD-738022.1 13.71 2.86 1 nM AD-738023.1 17.33 4.91 1 nM AD-738024.1 20.64 7.04 1 nM AD-738025.1 95.81 28.98 1 nM AD-738026.1 28.29 10.28 1 nM AD-738027.1 15.94 3.44 1 nM AD-738028.1 25.76 10.62 1 nM AD-738029.1 18.83 6.50 1 nM AD-738030.1 30.24 7.29 1 nM AD-738031.1 30.77 6.54 1 nM AD-738032.1 25.98 6.57 1 nM AD-738033.1 31.28 8.14 1 nM AD-738034.1 25.06 6.27 1 nM AD-738035.1 21.67 1.11 1 nM AD-738036.1 32.29 11.81 1 nM AD-738037.1 30.77 5.48 1 nM AD-738038.1 19.03 1.00 1 nM AD-738039.1 20.25 5.55 1 nM AD-738040.1 51.87 7.09 1 nM AD-738041.1 35.67 8.23 1 nM AD-738042.1 33.70 9.34 1 nM AD-738043.1 19.76 3.35 1 nM AD-738044.1 43.40 9.46 1 nM AD-738045.1 97.99 13.43 1 nM AD-738046.1 112.65 25.09 1 nM AD-738047.1 37.50 4.18 1 nM AD-738048.1 23.67 0.94 1 nM AD-397217.2 60.11 7.67 1 nM AD-738049.1 20.00 1.41 1 nM AD-738050.1 36.49 7.06 1 nM AD-738051.1 27.03 6.08 1 nM AD-738052.1 31.82 7.17 1 nM AD-738053.1 14.96 2.91 1 nM AD-738054.1 32.00 5.62 1 nM AD-738055.1 27.57 7.73 1 nM AD-738056.1 15.16 0.70 1 nM AD-738057.1 14.83 3.32 1 nM AD-738058.1 33.09 9.91 1 nM AD-738059.1 26.76 5.77 1 nM AD-738060.1 11.79 2.64 1 nM AD-738061.1 28.49 1.35 1 nM AD-738062.1 15.89 6.49 1 nM AD-738063.1 25.01 8.31 1 nM AD-738064.1 16.91 2.56 1 nM AD-738065.1 15.45 2.85 1 nM AD-738066.1 51.85 8.48 1 nM AD-738067.1 20.90 4.96 1 nM AD-738068.1 15.82 2.70 1 nM AD-738069.1 81.26 2.84 1 nM AD-738070.1 59.48 11.42 1 nM AD-738071.1 15.12 3.89 1 nM AD-738072.1 40.16 7.78 1 nM AD-738073.1 18.46 5.20 1 nM AD-738074.1 27.74 1.97 1 nM AD-738075.1 83.53 9.94 1 nM AD-738076.1 50.62 3.51 1 nM AD-738077.1 21.52 4.49 1 nM AD-738078.1 24.49 10.05 1 nM AD-738079.1 8.66 2.69 1 nM AD-738080.1 28.88 1.12 1 nM AD-738081.1 77.35 10.22 1 nM AD-738082.1 48.10 10.63 1 nM AD-738083.1 23.74 4.60 1 nM AD-738084.1 100.84 2.83 1 nM AD-738085.1 101.30 4.73 1 nM AD-738086.1 60.29 24.33 1 nM AD-738087.1 9.71 3.71 1 nM AD-738088.1 79.16 7.79 1 nM AD-738089.1 35.37 8.78 1 nM AD-738090.1 37.16 13.37 1 nM AD-738091.1 49.56 10.83 1 nM AD-738092.1 79.50 10.15 1 nM AD-738093.1 96.42 16.26 1 nM AD-738094.1 41.63 5.90 1 nM AD-738095.1 45.03 8.10 1 nM AD-738096.1 44.52 11.55 1 nM AD-738097.1 78.88 13.42 1 nM AD-738098.1 28.84 8.43 1 nM AD-738099.1 68.10 16.73 1 nM AD-738100.1 84.53 5.73 1 nM AD-738012.1 35.64 12.05 0.1 nM AD-738013.1 29.76 5.05 0.1 nM AD-738014.1 47.17 13.55 0.1 nM AD-738015.1 35.51 13.38 0.1 nM AD-738016.1 38.17 9.76 0.1 nM AD-738017.1 30.03 7.04 0.1 nM AD-738018.1 20.38 4.76 0.1 nM AD-738019.1 30.10 4.89 0.1 nM AD-738020.1 44.67 8.48 0.1 nM AD-738021.1 30.05 5.88 0.1 nM AD-738022.1 30.24 5.96 0.1 nM AD-738023.1 25.74 7.75 0.1 nM AD-738024.1 31.43 10.51 0.1 nM AD-738025.1 112.57 14.24 0.1 nM AD-738026.1 54.28 6.70 0.1 nM AD-738027.1 26.02 4.95 0.1 nM AD-738028.1 35.82 10.41 0.1 nM AD-738029.1 40.29 3.76 0.1 nM AD-738030.1 51.38 24.04 0.1 nM AD-738031.1 40.78 11.79 0.1 nM AD-738032.1 47.97 6.74 0.1 nM AD-738033.1 38.57 7.04 0.1 nM AD-738034.1 46.53 13.21 0.1 nM AD-738035.1 43.04 12.39 0.1 nM AD-738036.1 43.08 3.41 0.1 nM AD-738037.1 87.09 39.32 0.1 nM AD-738038.1 64.97 3.06 0.1 nM AD-738039.1 74.15 30.96 0.1 nM AD-738040.1 159.41 39.34 0.1 nM AD-738041.1 108.29 36.98 0.1 nM AD-738042.1 69.15 28.46 0.1 nM AD-738043.1 45.00 17.66 0.1 nM AD-738044.1 88.04 17.84 0.1 nM AD-738045.1 238.11 15.24 0.1 nM AD-738046.1 259.68 3.44 0.1 nM AD-738047.1 136.91 44.65 0.1 nM AD-738048.1 131.72 13.39 0.1 nM AD-397217.2 222.75 51.71 0.1 nM AD-738049.1 65.58 6.12 0.1 nM AD-738050.1 63.97 11.64 0.1 nM AD-738051.1 89.72 27.54 0.1 nM AD-738052.1 140.07 36.18 0.1 nM AD-738053.1 77.09 14.75 0.1 nM AD-738054.1 205.91 46.37 0.1 nM AD-738055.1 197.02 44.70 0.1 nM AD-738056.1 85.09 14.19 0.1 nM AD-738057.1 87.72 18.23 0.1 nM AD-738058.1 164.40 24.71 0.1 nM AD-738059.1 129.01 9.61 0.1 nM AD-738060.1 63.48 35.21 0.1 nM AD-738061.1 191.48 13.85 0.1 nM AD-738062.1 108.14 8.70 0.1 nM AD-738063.1 100.27 16.53 0.1 nM AD-738064.1 46.78 12.88 0.1 nM AD-738065.1 84.72 11.97 0.1 nM AD-738066.1 218.00 48.39 0.1 nM AD-738067.1 123.65 34.39 0.1 nM AD-738068.1 90.93 17.12 0.1 nM AD-738069.1 300.08 12.73 0.1 nM AD-738070.1 238.24 7.61 0.1 nM AD-738071.1 46.50 1.25 0.1 nM AD-738072.1 58.01 21.95 0.1 nM AD-738073.1 68.05 19.98 0.1 nM AD-738074.1 134.77 30.73 0.1 nM AD-738075.1 328.84 50.48 0.1 nM AD-738076.1 237.89 30.07 0.1 nM AD-738077.1 108.45 14.70 0.1 nM AD-738078.1 127.49 44.03 0.1 nM AD-738079.1 46.06 9.44 0.1 nM AD-738080.1 57.45 19.09 0.1 nM AD-738081.1 147.89 27.56 0.1 nM AD-738082.1 169.52 28.01 0.1 nM AD-738083.1 106.74 6.93 0.1 nM AD-738084.1 242.62 60.78 0.1 nM AD-738085.1 295.62 32.59 0.1 nM AD-738086.1 221.56 21.04 0.1 nM AD-738087.1 82.58 14.78 0.1 nM AD-738088.1 88.52 10.41 0.1 nM AD-738089.1 84.36 20.12 0.1 nM AD-738090.1 120.67 19.87 0.1 nM AD-738091.1 180.61 14.25 0.1 nM AD-738092.1 240.22 16.63 0.1 nM AD-738093.1 303.63 8.82 0.1 nM AD-738094.1 146.42 25.16 0.1 nM AD-738095.1 124.16 57.91 0.1 nM AD-738096.1 56.53 8.58 0.1 nM AD-738097.1 116.46 38.97 0.1 nM AD-738098.1 59.28 19.71 0.1 nM AD-738099.1 149.49 42.85 0.1 nM AD-738100.1 89.06 17.49 0.1 nM
[0807] Table 18 summarizes results from a multi-dose APP screen in Neuro2A cells conducted at either 10 nM, 1 nM or 0.1 nM. Data are expressed as percent message remaining relative to AD-1955 non-targeting control
TABLE-US-00041 TABLE 18 APP Dose Screen Study in Neuro2A Cell Lines at 10 nM, 1 nM, and 0.1 nM. Standard Duplex Average Deviation Dose Dose Unit AD-738012.1 0.11 0.07 10 nM AD-738013.1 0.20 0.06 10 nM AD-738014.1 1.12 0.42 10 nM AD-738015.1 1.72 1.20 10 nM AD-738016.1 0.98 0.31 10 nM AD-738017.1 0.32 0.24 10 nM AD-738018.1 0.14 0.07 10 nM AD-738019.1 0.63 0.25 10 nM AD-738020.1 0.11 0.08 10 nM AD-738021.1 1.20 0.52 10 nM AD-738022.1 1.86 0.95 10 nM AD-738023.1 1.18 0.53 10 nM AD-738024.1 3.13 1.81 10 nM AD-738025.1 11.77 3.21 10 nM AD-738026.1 0.81 0.44 10 nM AD-738027.1 0.23 0.10 10 nM AD-738028.1 0.15 0.15 10 nM AD-738029.1 1.48 0.93 10 nM AD-738030.1 1.45 0.99 10 nM AD-738031.1 2.72 0.68 10 nM AD-738032.1 3.04 0.84 10 nM AD-738033.1 2.71 0.98 10 nM AD-738034.1 4.98 3.47 10 nM AD-738035.1 1.51 0.77 10 nM AD-738036.1 1.18 1.21 10 nM AD-738037.1 2.87 1.38 10 nM AD-738038.1 1.52 0.43 10 nM AD-738039.1 5.43 2.42 10 nM AD-738040.1 12.15 3.03 10 nM AD-738041.1 4.14 2.38 10 nM AD-738042.1 4.41 2.78 10 nM AD-738043.1 0.67 0.51 10 nM AD-738044.1 1.21 0.74 10 nM AD-738045.1 21.32 2.05 10 nM AD-738046.1 8.41 3.63 10 nM AD-738047.1 1.92 1.96 10 nM AD-738048.1 0.83 0.24 10 nM AD-397217.2 14.29 4.68 10 nM AD-738049.1 4.40 2.05 10 nM AD-738050.1 1.46 0.17 10 nM AD-738051.1 1.48 1.43 10 nM AD-738052.1 4.60 0.68 10 nM AD-738053.1 3.92 1.90 10 nM AD-738054.1 6.95 1.84 10 nM AD-738055.1 2.82 0.53 10 nM AD-738056.1 4.83 3.07 10 nM AD-738057.1 4.79 3.01 10 nM AD-738058.1 12.43 4.84 10 nM AD-738059.1 5.66 1.40 10 nM AD-738060.1 4.24 0.94 10 nM AD-738061.1 10.85 2.10 10 nM AD-738062.1 1.34 0.51 10 nM AD-738063.1 31.40 6.43 10 nM AD-738064.1 0.77 0.71 10 nM AD-738065.1 6.43 1.80 10 nM AD-738066.1 30.73 12.64 10 nM AD-738067.1 3.79 0.76 10 nM AD-738068.1 4.60 1.19 10 nM AD-738069.1 36.14 12.51 10 nM AD-738070.1 34.99 13.86 10 nM AD-738071.1 1.84 1.71 10 nM AD-738072.1 1.29 1.22 10 nM AD-738073.1 0.65 0.14 10 nM AD-738074.1 1.28 0.51 10 nM AD-738075.1 75.00 22.72 10 nM AD-738076.1 19.31 2.56 10 nM AD-738077.1 5.21 1.66 10 nM AD-738078.1 7.24 5.26 10 nM AD-738079.1 1.64 0.72 10 nM AD-738080.1 2.17 1.31 10 nM AD-738081.1 13.03 2.64 10 nM AD-738082.1 3.37 1.05 10 nM AD-738083.1 5.36 2.87 10 nM AD-738084.1 22.04 7.85 10 nM AD-738085.1 6.81 1.80 10 nM AD-738086.1 35.05 12.18 10 nM AD-738087.1 0.14 0.10 10 nM AD-738088.1 34.43 18.92 10 nM AD-738089.1 11.16 1.48 10 nM AD-738090.1 4.55 0.77 10 nM AD-738091.1 9.04 2.02 10 nM AD-738092.1 48.12 5.51 10 nM AD-738093.1 47.41 11.32 10 nM AD-738094.1 25.25 3.17 10 nM AD-738095.1 8.80 1.79 10 nM AD-738096.1 4.36 5.22 10 nM AD-738097.1 28.80 6.91 10 nM AD-738098.1 10.91 3.70 10 nM AD-738099.1 25.30 5.42 10 nM AD-738100.1 43.27 10.46 10 nM AD-738012.1 3.70 3.79 1 nM AD-738013.1 6.87 3.98 1 nM AD-738014.1 16.20 4.78 1 nM AD-738015.1 15.97 3.04 1 nM AD-738016.1 11.33 4.08 1 nM AD-738017.1 3.91 2.43 1 nM AD-738018.1 9.79 5.33 1 nM AD-738019.1 5.90 4.65 1 nM AD-738020.1 4.29 7.33 1 nM AD-738021.1 11.55 7.48 1 nM AD-738022.1 12.06 4.21 1 nM AD-738023.1 10.50 4.50 1 nM AD-738024.1 12.71 3.60 1 nM AD-738025.1 42.61 8.91 1 nM AD-738026.1 7.13 2.81 1 nM AD-738027.1 1.14 0.44 1 nM AD-738028.1 2.99 4.01 1 nM AD-738029.1 8.81 4.91 1 nM AD-738030.1 15.88 4.68 1 nM AD-738031.1 14.42 9.04 1 nM AD-738032.1 12.11 3.28 1 nM AD-738033.1 17.47 13.61 1 nM AD-738034.1 18.58 6.98 1 nM AD-738035.1 7.64 6.58 1 nM AD-738036.1 2.84 2.90 1 nM AD-738037.1 11.17 3.62 1 nM AD-738038.1 10.23 4.82 1 nM AD-738039.1 9.61 2.76 1 nM AD-738040.1 54.47 14.10 1 nM AD-738041.1 15.86 6.31 1 nM AD-738042.1 15.96 6.61 1 nM AD-738043.1 2.26 2.61 1 nM AD-738044.1 4.54 4.76 1 nM AD-738045.1 25.51 7.28 1 nM AD-738046.1 30.32 10.02 1 nM AD-738047.1 16.25 7.68 1 nM AD-738048.1 9.07 3.25 1 nM AD-397217.2 48.16 12.70 1 nM AD-738049.1 7.97 3.33 1 nM AD-738050.1 5.60 4.81 1 nM AD-738051.1 1.49 1.05 1 nM AD-738052.1 10.13 2.72 1 nM AD-738053.1 10.82 4.44 1 nM AD-738054.1 21.52 8.71 1 nM AD-738055.1 12.40 3.31 1 nM AD-738056.1 5.93 4.14 1 nM AD-738057.1 7.63 2.80 1 nM AD-738058.1 18.21 4.26 1 nM AD-738059.1 14.39 6.00 1 nM AD-738060.1 6.71 2.99 1 nM AD-738061.1 13.63 3.65 1 nM AD-738062.1 6.08 3.37 1 nM AD-738063.1 9.63 8.05 1 nM AD-738064.1 6.51 4.83 1 nM AD-738065.1 9.97 1.82 1 nM AD-738066.1 50.95 5.44 1 nM AD-738067.1 9.69 2.74 1 nM AD-738068.1 9.39 1.51 1 nM AD-738069.1 43.67 8.07 1 nM AD-738070.1 37.85 4.96 1 nM AD-738071.1 2.81 2.93 1 nM AD-738072.1 10.65 9.82 1 nM AD-738073.1 5.64 2.45 1 nM AD-738074.1 10.00 4.11 1 nM AD-738075.1 78.16 11.76 1 nM AD-738076.1 44.11 8.21 1 nM AD-738077.1 11.42 0.98 1 nM AD-738078.1 7.65 1.23 1 nM AD-738079.1 1.78 2.66 1 nM AD-738080.1 7.03 8.36 1 nM AD-738081.1 27.43 6.11 1 nM AD-738082.1 21.57 4.04 1 nM AD-738083.1 10.77 3.72 1 nM AD-738084.1 76.60 10.91 1 nM AD-738085.1 36.65 7.82 1 nM AD-738086.1 26.34 11.70 1 nM AD-738087.1 0.56 0.52 1 nM AD-738088.1 52.50 10.17 1 nM AD-738089.1 12.77 1.25 1 nM AD-738090.1 12.92 5.28 1 nM AD-738091.1 20.70 1.73 1 nM AD-738092.1 58.85 6.24 1 nM AD-738093.1 84.82 9.95 1 nM AD-738094.1 59.17 6.38 1 nM AD-738095.1 12.86 8.99 1 nM AD-738096.1 10.61 4.77 1 nM AD-738097.1 35.98 1.81 1 nM AD-738098.1 14.76 3.12 1 nM AD-738099.1 37.99 2.57 1 nM AD-738100.1 46.62 7.08 1 nM AD-738012.1 11.95 6.41 0.1 nM AD-738013.1 11.70 2.86 0.1 nM AD-738014.1 33.48 9.61 0.1 nM AD-738015.1 25.02 5.00 0.1 nM AD-738016.1 22.29 4.67 0.1 nM AD-738017.1 21.12 5.92 0.1 nM AD-738018.1 15.82 5.90 0.1 nM AD-738019.1 22.54 18.17 0.1 nM AD-738020.1 12.05 9.08 0.1 nM AD-738021.1 19.21 0.85 0.1 nM AD-738022.1 24.55 5.38 0.1 nM AD-738023.1 17.43 5.05 0.1 nM AD-738024.1 24.48 1.96 0.1 nM AD-738025.1 72.34 16.04 0.1 nM AD-738026.1 44.09 2.91 0.1 nM AD-738027.1 16.46 9.70 0.1 nM AD-738028.1 13.92 9.68 0.1 nM AD-738029.1 25.75 5.87 0.1 nM AD-738030.1 42.80 8.11 0.1 nM AD-738031.1 43.85 2.58 0.1 nM AD-738032.1 29.64 6.11 0.1 nM AD-738033.1 42.40 1.69 0.1 nM AD-738034.1 49.71 3.53 0.1 nM AD-738035.1 30.30 20.42 0.1 nM AD-738036.1 12.98 4.90 0.1 nM AD-738037.1 13.01 5.34 0.1 nM AD-738038.1 15.19 8.17 0.1 nM AD-738039.1 18.24 10.33 0.1 nM AD-738040.1 60.24 13.10 0.1 nM AD-738041.1 26.49 7.47 0.1 nM AD-738042.1 18.54 6.11 0.1 nM AD-738043.1 5.91 5.08 0.1 nM AD-738044.1 14.74 6.15 0.1 nM AD-738045.1 55.58 16.72 0.1 nM AD-738046.1 68.30 11.74 0.1 nM AD-738047.1 40.80 6.70 0.1 nM AD-738048.1 32.28 7.47 0.1 nM AD-397217.2 76.28 11.27 0.1 nM AD-738049.1 22.10 8.60 0.1 nM AD-738050.1 8.56 5.26 0.1 nM AD-738051.1 19.62 9.00 0.1 nM AD-738052.1 29.60 6.17 0.1 nM AD-738053.1 19.82 6.73 0.1 nM AD-738054.1 48.02 6.33 0.1 nM AD-738055.1 26.00 8.90 0.1 nM AD-738056.1 34.85 7.55 0.1 nM AD-738057.1 30.60 9.35 0.1 nM AD-738058.1 49.45 11.76 0.1 nM AD-738059.1 40.24 4.74 0.1 nM AD-738060.1 37.94 10.19 0.1 nM AD-738061.1 49.79 3.08 0.1 nM AD-738062.1 28.19 1.51 0.1 nM AD-738063.1 30.80 15.24 0.1 nM AD-738064.1 25.32 2.67 0.1 nM AD-738065.1 34.43 9.76 0.1 nM AD-738066.1 87.77 14.39 0.1 nM AD-738067.1 36.47 9.15 0.1 nM AD-738068.1 28.08 4.14 0.1 nM AD-738069.1 97.43 7.31 0.1 nM AD-738070.1 82.37 8.24 0.1 nM AD-738071.1 27.61 7.94 0.1 nM AD-738072.1 37.34 2.31 0.1 nM AD-738073.1 25.85 9.17 0.1 nM AD-738074.1 41.19 13.50 0.1 nM AD-738075.1 93.48 11.50 0.1 nM AD-738076.1 66.05 10.10 0.1 nM AD-738077.1 32.71 5.69 0.1 nM AD-738078.1 35.64 5.42 0.1 nM AD-738079.1 20.48 3.52 0.1 nM AD-738080.1 36.41 7.72 0.1 nM AD-738081.1 65.34 19.91 0.1 nM AD-738082.1 53.82 8.31 0.1 nM AD-738083.1 30.04 5.11 0.1 nM AD-738084.1 88.32 9.40 0.1 nM AD-738085.1 78.53 7.08 0.1 nM AD-738086.1 82.59 7.90 0.1 nM AD-738087.1 13.94 6.27 0.1 nM AD-738088.1 73.47 18.72 0.1 nM AD-738089.1 48.21 8.12 0.1 nM AD-738090.1 43.23 12.93 0.1 nM AD-738091.1 52.45 4.67 0.1 nM AD-738092.1 75.75 31.47 0.1 nM AD-738093.1 88.99 10.31 0.1 nM AD-738094.1 82.41 6.94 0.1 nM AD-738095.1 51.05 7.29 0.1 nM AD-738096.1 31.49 12.31 0.1 nM AD-738097.1 64.39 13.12 0.1 nM AD-738098.1 33.73 10.09 0.1 nM AD-738099.1 69.09 9.27 0.1 nM AD-738100.1 75.77 15.74 0.1 nM
Example 6. In Vivo APP Screening of Sequences with AU-Rich Seeds
[0808] In vivo screening was performed on C57BL/6 mice to test oligonucleotides having AU-rich seeds. A summary of the study design is presented in Table 19. As shown in Table 20A, the following oligonucleotides having AU-rich seeds were tested: AD-506935.2, AD-507065.2, AD-507159.2, AD-507538.2, AD-507624.2, AD-507724.2, AD-507725.2, AD-507789.2, AD-507874.2, AD-507928.2, and AD-507949.2. Table 20A enumerates the sense, antisense, and target oligonucleotide sequences for each of these AU-rich oligonucleotides. The oligonucleotide AD-392927.2 (GNAT C16 chemistry) from RLD592 was used as a positive control sequence. The structures of the AU-rich oligonucleotides are shown in
TABLE-US-00042 TABLE 19 Study Design Overview In vitro rep 646 APP NM_201414.2 Target hsAPP Goal In vivo screen of sequences with AU-rich seeds AAV Name AAV8.HsAPP-CDS3TRNC VCAV-04731 Dose 2E+11 Injection method IV (retro orbital) siRNA Injection method Subcutaneous Dose 3 mg/kg Sample Liver Collection days D14 Animals Sex Female Strain C57BL/6 Age (on arrival) 6-8 weeks Vendor Charles River Duplex No. 12* n= 3 Total animals 45 Analysis Analysis method RT-qPCR Taqman probe APP: Hs00169098_m1 (FAM) Mouse GAPDH Applied Biosystems 4351309 (VIC) Misc. Controls *AD-3929272 from RLD592 was included as positive control
TABLE-US-00043 TABLE 20A hsAPP Duplex and Target Sequences for GNA7 C16 control and AU-rich Candidates. SEQ SEQ Chemistry Duplex ID ID (Target) Name Sense Sequence (5′ to 3′) NO Antisense Sequence (5′ to 3′) NO GNA7 AD- usasgug(Chd)AfuGfAfAfuagauucucuL96 2750 asGfsagaa(Tgn)cuauucAfuGfcacuasgsu 2751 C16 392927.2 (APP) AU-rich AD- asasagagCfaAfAfAfcuauucagauL96 2752 asUfscugAfaUfAfguuuUfgCfucuuuscsu 2753 seed 506935.2 (APP) AU-rich AD- ususggccAfaCfAfUfgauuagugauL96 2755 asUfscacUfaAfUfcaugUfuGfgccaasgsa 2756 seed 507065.2 (APP) AU-rich AD- uscsugggUfuGfAfCfaaauaucaauL96 2758 asUfsugaUfaUfUfugucAfaCfccagasasc 2759 seed 507159.2 (APP) AU-rich AD- ususuaugAfuUfUfAfcucauuaucuL96 2761 asGfsauaAfuGfAfguaaAfuCfauaaasasc 2762 seed 507538.2 (APP) AU-rich AD- asusgccuGfaAfCfUfugaauuaauuL96 2764 asAfsuuaAfuUfCfaaguUfcAfggcauscsu 2765 seed 507624.2 (APP) AU-rich AD- asgsaugcCfuGfAfAfcuugaauuauL96 2767 asUfsaauUfcAfAfguucAfgGfcaucusasc 2768 seed 507724.2 (APP) AU-rich AD- gscscugaAfcUfUfGfaauuaauccuL96 2770 asGfsgauUfaAfUfucaaGfuUfcaggcsasu 2771 seed 507725.2 (APP) AU-rich AD- gsusgguuUfgUfGfAfcccaauuaauL96 2773 asUfsuaaUfuGfGfgucaCfaAfaccacsasa 2774 seed 507789.2 (APP) AU-rich AD- csasgaugCfuUfUfAfgagagauuuuL96 2776 asAfsaauCfuCfUfcuaaAfgCfaucugsasa 2777 seed 507874.2 (APP) AU-rich AD- uscsuugcCfuAfAfGfuauuccuuuuL96 2779 asAfsaagGfaAfUfacuuAfgGfcaagasgsa 2780 seed 507928.2 (APP) AU-rich AD- ususgcugCfuUfCfUfgcuauauuuuL96 2782 asAfsaauAfuAfGfcagaAfgCfagcaasusc 2783 seed 507949.2 (APP) SEQ Chemistry ID (Target) mRNA target sequence (5′ to 3′) NO GNA7 n/a n/a C16 (APP) AU-rich AGAAAGAGCAAAACUAUUCAGAU 2754 seed (APP) AU-rich UCUUGGCCAACAUGAUUAGUGAA 2757 seed (APP) AU-rich GUUCUGGGUUGACAAAUAUCAAG 2760 seed (APP) AU-rich GUUUUAUGAUUUACUCAUUAUCG 2763 seed (APP) AU-rich AGAUGCCUGAACUUGAAUUAAUC 2766 seed (APP) AU-rich GUAGAUGCCUGAACUUGAAUUAA 2769 seed (APP) AU-rich AUGCCUGAACUUGAAUUAAUCCA 2772 seed (APP) AU-rich UUGUGGUUUGUGACCCAAUUAAG 2775 seed (APP) AU-rich UUCAGAUGCUUUAGAGAGAUUUU 2778 seed (APP) AU-rich UCUCUUGCCUAAGUAUUCCUUUC 2781 seed (APP) AU-rich GAUUGCUGCUUCUGCUAUAUUUG 2784 seed (APP) Table 20A key: U = uridine-3′-phosphate, u = 2′-O-methyluridine-3′-phosphate, us = 2′-O-methyluridine-3′-phosphorothioate, a = 2′-O-methyladenosine-3′-phosphate, A = adenosine-3′-phosphate, as = 2′-O-methyladenosine-3′-phosphorothioate, (Ahd) = 2′-O-hexadecyl-adenosine-3′-phosphate, Gf = 2′-fluoroguanosine-3′-phosphate, Uf = 2′-fluorouridine-3′-phosphate, Cf = 2′-fluorocytidine-3′-phosphate, Af = 2′-fluoroadenosine-3′-phosphate, cs = 2′-O-methylcytidine-3′-phosphate, VP = Vinylphosphate 5′, (Agn) = Adenosine-glycol nucleic acid (GNA), gs = 2′-O-methylguanosine-3′-phosphorothioate, (Chd) = 2′-O-hexadecyl-cytidine-3′-phosphate, (Tgn) = Thymidine-glycol nucleic acid (GNA) S-Isomer, (Ghd) = 2′-O-hexadecyl-guanosine-3′-phosphate, and cs = 2′-O-methylcytidine-3′-phosphorothioate.
[0809] Selected AU-rich candidates were evaluated for in vivo efficacy in lead identification screens for human APP knockdown in AAV mice. Briefly, an AAV vector harboring Homo sapiens APP (e.g., hsAPP-CDS3TRNC) was intravenously injected into 6-8 week old C57BL/6 female mice, and at 14 days post-AAV administration a selected RNAi agent or a control agent was subcutaneously injected into the mice (n=3 per group at a dose of 3 mg/kg. The screening groups are summarized in Table 21.
TABLE-US-00044 TABLE 21 Screening Groups for AU-rich Candidates in AAV Mice. siRNA Date Group # Animal # Treatment Dose Timepoint 8 Mar. 2019 1 1 PBS N/A D14 8 Mar. 2019 1 2 PBS N/A D14 8 Mar. 2019 1 3 PBS N/A D14 8 Mar. 2019 1 4 PBS N/A D14 8 Mar. 2019 1 5 PBS N/A D14 8 Mar. 2019 2 6 Naïve N/A D14 8 Mar. 2019 2 7 Naïve N/A D14 8 Mar. 2019 2 8 Naïve N/A D14 8 Mar. 2019 2 9 Naïve N/A D14 8 Mar. 2019 3 10 AD-392927.2 3 mg/kg D14 (from RLD592) 8 Mar. 2019 3 11 AD-392927.2 3 mg/kg D14 (from RLD592) 8 Mar. 2019 3 12 AD-392927.2 3 mg/kg D14 (from RLD592) 8 Mar. 2019 4 13 AD-506935.2 3 mg/kg D14 8 Mar. 2019 4 14 AD-506935.2 3 mg/kg D14 8 Mar. 2019 4 15 AD-506935.2 3 mg/kg D14 8 Mar. 2019 5 16 AD-507065.2 3 mg/kg D14 8 Mar. 2019 5 17 AD-507065.2 3 mg/kg D14 8 Mar. 2019 5 18 AD-507065.2 3 mg/kg D14 8 Mar. 2019 6 19 AD-507159.2 3 mg/kg D14 8 Mar. 2019 6 20 AD-507159.2 3 mg/kg D14 8 Mar. 2019 6 21 AD-507159.2 3 mg/kg D14 8 Mar. 2019 7 22 AD-507538.2 3 mg/kg D14 8 Mar. 2019 7 23 AD-507538.2 3 mg/kg D14 8 Mar. 2019 7 24 AD-507538.2 3 mg/kg D14 8 Mar. 2019 8 25 AD-507624.2 3 mg/kg D14 8 Mar. 2019 8 26 AD-507624.2 3 mg/kg D14 8 Mar. 2019 8 27 AD-507624.2 3 mg/kg D14 8 Mar. 2019 9 28 AD-507724.2 3 mg/kg D14 8 Mar. 2019 9 29 AD-507724.2 3 mg/kg D14 8 Mar. 2019 9 30 AD-507724.2 3 mg/kg D14 8 Mar. 2019 10 31 AD-507725.2 3 mg/kg D14 8 Mar. 2019 10 32 AD-507725.2 3 mg/kg D14 8 Mar. 2019 10 33 AD-507725.2 3 mg/kg D14 8 Mar. 2019 11 34 AD-507789.2 3 mg/kg D14 8 Mar. 2019 11 35 AD-507789.2 3 mg/kg D14 8 Mar. 2019 11 36 AD-507789.2 3 mg/kg D14 8 Mar. 2019 12 37 AD-507874.2 3 mg/kg D14 8 Mar. 2019 12 38 AD-507874.2 3 mg/kg D14 8 Mar. 2019 12 39 AD-507874.2 3 mg/kg D14 8 Mar. 2019 13 40 AD-507928.2 3 mg/kg D14 8 Mar. 2019 13 41 AD-507928.2 3 mg/kg D14 8 Mar. 2019 13 42 AD-507928.2 3 mg/kg D14 8 Mar. 2019 14 43 AD-507949.2 3 mg/kg D14 8 Mar. 2019 14 44 AD-507949.2 3 mg/kg D14 8 Mar. 2019 14 45 AD-507949.2 3 mg/kg D14
[0810] The mice were sacrificed and their livers were assessed for APP mRNA levels at 14 days post-subcutaneous injection of RNAi agent or control by qPCR. As shown in Table 22 and
TABLE-US-00045 TABLE 22 Summary of Screening Results for AU-rich Candidates in AAV Mice. hsAPP AU rich seed 3mg/kg liver qPCR D14 % hsAPP message remaining relative to PBS Treatment Group Average Standard Deviation PBS 100.00 30.90 Naïve 91.48 6.43 AD-507538.2 24.23 8.73 AD-507724.2 30.90 2.95 AD-392927.2 (RLD592) 32.80 0.92 AD-507928.2 36.31 2.61 AD-506935.2 36.47 5.26 AD-507874.2 40.43 4.99 AD-507789.2 50.24 6.06 AD-507624.2 57.67 4.22 AD-507725.2 68.53 10.04 AD-507159.2 71.49 20.82 AD-507949.2 84.94 2.35 AD-507065.2 91.09 20.17
[0811] Table 23 shows a comparison of in vivo human hsAPP mRNA knockdown in liver by the above-described AU-rich RNAi agents at 3 mg/kg as compared to in vitro APP knockdown of the same AU-rich RNAi agents at either 10 nM or 0.1 nM in both DL and Be(2)C cell lines.
TABLE-US-00046 TABLE 23 Comparison of In Vivo vs. In Vitro hsAPP Knockdown. RLD 646 (in vitro) DL (dual-Luc) Be(2)C (human neuron) hsAPP % RLD 701 Dose — Unit Dose — Unit Dose — Unit Dose — Unit remaining In vivo 3 mg/kg 10 nM 10 nM 0.1 nM 0.1 nM 10 nM 10 nM 0.1 nM 0.1 nM Duplex Avg SD Avg SD Avg SD Avg SD Avg SD AD-507538 24.2 8.7 22.5 5.5 106.2 45.3 16.6 3.8 23.3 2.5 AD-507724 30.9 2.9 38.5 9.2 119.8 24.6 21.2 1.9 43.5 9.6 AD-507928 36.3 2.6 10.6 1.8 101.1 23.8 25.1 2.7 39.8 22.1 AD-506935 36.5 5.3 37.4 10.1 75.9 18.4 19.7 3.9 22.3 2.2 AD-507874 40.4 5.0 13.6 10.9 105.7 29.1 21.9 2.4 31.3 13.1 AD-507789 50.2 6.1 34.3 12.0 121.2 30.9 24.0 6.0 38.3 3.6 AD-507624 57.7 4.2 32.7 7.0 116.5 28.6 22.1 1.0 68.0 26.2 AD-507725 68.5 10.0 68.6 13.1 107.8 43.5 31.1 5.4 34.1 9.7 AD-507159 71.5 20.8 56.8 20.2 119.7 42.4 26.2 4.6 42.7 8.6 AD-507949 84.9 2.3 57.1 25.6 99.7 29.8 23.3 3.1 42.9 15.2 AD-507065 91.1 20.2 52.5 11.6 106.1 19.2 25.3 7.2 39.4 5.8
Example 7. In Vivo APP Screening of Lead Sequences for Structure Activity Relationship Studies
[0812] In vivo screening was performed on C57BL/6 mice to conduct structure activity relationship studies on lead oligonucleotides. A summary of the study design is presented in Table 25. As shown in Table 26, the following lead oligonucleotides were tested: AD-886823, AD-886839, AD-886845, AD-886853, AD-886858, AD-886864, AD-886873, AD-886877, AD-886879, AD-886883, AD-886884, AD-886889, AD-886899, AD-886900, AD-886906, AD-886907, AD-886908, AD-886909, AD-886919, AD-886928, AD-886930 and AD-886931. Table 26 lists sense and antisense sequences for each lead oligonucleotide, as well as the associated target sequence for each lead oligonucleotide. The structures of the lead oligonucleotides are shown in
TABLE-US-00047 TABLE 25 Study Design AAV Name AAV8.HsAPP-CDS3TRNC VCAV-04731 Dose 2E+11 Injection method IV (retro orbital) siRNA Injection method Subcutaneous Dose 3 mg/kg Sample Liver Collection days D14 Animals Sex Female Strain C57BL/6 Age (on arrival) 6-8 weeks Vendor Jackson Lab Duplex No. 16 n= 3 Total animals 72 Analysis Analysis method RT-qPCR Taqman probe Mouse GAPDH Applied Biosystems 4351309 APP: Hs00169098_m1 (FAM)
TABLE-US-00048 TABLE 26 hsAPP Duplex and Target Sequences for SAR Lead Candidates. SEQ SEQ ID ID Duplex Strand Oligonucleotide Sequence NO: Target Sequence NO: AD- Sense usasgug(Chd)AfuGfAfAfuagauucucaL96 2785 UAGUGCAUGAAUAGAUUCUCA 2829 886823.2 (5′ to 3′) Antisense VPusGfsagaa(Tgn)cuauucAfuGfcacuasgsu 2786 UGAGAATCUAUUCAUGCACUAGU 2830 (5′ to 3′) AD- Sense usasgug(Chd)AfudGAfAfuagauucucaL96 2787 UAGUGCAUGAAUAGAUUCUCA 2831 886839.2 (5′ to 3′) Antisense VPusdGsagaa(Tgn)cuauucAfudGcacuasgsu 2788 UGAGAATCUAUUCAUGCACUAGU 2832 (5′ to 3′) AD- Sense usasgug(Chd)audGadAuagauucucaL96 2789 UAGUGCAUGAAUAGAUUCUCA 2833 886845.2 (5′ to 3′) Antisense VPudGagaa(Tgn)cuauUfcAfudGcacuasgsu 2790 UGAGAATCUAUUCAUGCACUAGU 2834 (5′ to 3′) AD- Sense usasgug(Chd)AfudGAfAfuagauucucaL96 2791 UAGUGCAUGAAUAGAUUCUCA 2835 886853.2 (5′ to 3′) Antisense VPusdGsagdAa(Tgn)cuaudTcAfugcacuasgsu 2792 UGAGAATCUAUTCAUGCACUAGU 2836 (5′ to 3′) AD- Sense usasgug(Chd)AfudGAfAfuagauucucaL96 2793 UAGUGCAUGAAUAGAUUCUCA 2837 886858.2 (5′ to 3′) Antisense VPudGagdAa(Tgn)cuaudTcAfudGcacuasgsu 2794 UGAGAATCUAUTCAUGCACUAGU 2838 (5′ to 3′) AD- Sense gsgscua(Chd)GfaAfAfAfuccaaccuaaL96 2795 GGCUACGAAAAUCCAACCUAA 2839 886864.2 (5′ to 3′) Antisense VPusUfsaggu(Tgn)ggauuuUfcGfuagccsgsu 2796 UUAGGUTGGAUUUUCGUAGCCGU 2840 (5′ to 3′) AD- Sense gsgscua(Chd)gadAadAuccaaccuaaL96 2797 GGCUACGAAAAUCCAACCUAA 2841 886873.2 (5′ to 3′) Antisense VPusUfsaggu(Tgn)ggaudTuUfcdGuagccsgsu 2798 UUAGGUTGGAUTUUCGUAGCCGU 2842 (5′ to 3′) AD- Sense gsgscua(Chd)gadAadAuccaaccuaaL96 2799 GGCUACGAAAAUCCAACCUAA 2843 886877.2 (5′ to 3′) Antisense VPusUfsaggu(Tgn)ggaudTuUfcguagccsgsu 2800 UUAGGUTGGAUTUUCGUAGCCGU 2844 (5′ to 3′) AD- Sense gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2801 GGCUACGAAAAUCCAACCUAA 2845 886879.2 (5′ to 3′) Antisense VPusUfsaggu(Tgn)ggauuuUfcdGuagccsgsu 2802 UUAGGUTGGAUUUUCGUAGCCGU 2846 (5′ to 3′) AD- Sense gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2803 GGCUACGAAAAUCCAACCUAA 2847 886883.2 (5′ to 3′) Antisense VPuUfaggdT(Tgn)ggauuuUfcdGuagccsgsu 2804 UUAGGTTGGAUUUUCGUAGCCGU 2848 (5′ to 3′) AD- Sense gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2805 GGCUACGAAAAUCCAACCUAA 2849 886884.2 (5′ to 3′) Antisense VPuUfaggdT(Tgn)ggaudTuUfcdGuagccsgsu 2806 UUAGGTTGGAUTUUCGUAGCCGU 2850 (5′ to 3′) AD- Sense gsgscua(Chd)gaAfAfAfuccaaccuaaL96 2807 GGCUACGAAAAUCCAACCUAA 2851 886889.2 (5′ to 3′) Antisense VPuUfagdGu(Tgn)ggaudTuUfcguagccsgsu 2808 UUAGGUTGGAUTUUCGUAGCCGU 2852 (5′ to 3′) AD- Sense asasagagCfaAfAfAfcuauu(Chd)agaaL96 2809 AAAGAGCAAAACUAUUCAGAA 2853 886899.2 (5′ to 3′) Antisense VPusUfscugAfaUfAfguuuUfgCfucuuuscsu 2810 UUCUGAAUAGUUUUGCUCUUUCU 2854 (5′ to 3′) AD- Sense asasaga(Ghd)CfaAfAfAfcuauucagaaL96 2811 AAAGAGCAAAACUAUUCAGAA 2855 886900.2 (5′ to 3′) Antisense VPusUfscugAfauaguuuUfgCfucuuuscsu 2812 UUCUGAAUAGUUUUGCUCUUUCU 2856 (5′ to 3′) AD- Sense asasagag(Chd)aAfAfAfcuauucagaaL96 2813 AAAGAGCAAAACUAUUCAGAA 2857 886906.2 (5′ to 3′) Antisense VPuUfcugAfauaguuuUfgCfucuuuscsu 2814 UUCUGAAUAGUUUUGCUCUUUCU 2858 (5′ to 3′) AD- Sense asasagag(Chd)aAfaAfcuauucagaaL96 2815 AAAGAGCAAAACUAUUCAGAA 2859 886907.2 (5′ to 3′) Antisense VPuUfcugAfauagudTuUfgCfucuuuscsu 2816 UUCUGAAUAGUTUUGCUCUUUCU 2860 (5′ to 3′) AD- Sense asasagag(Chd)adAadAcuauucagaaL96 2817 AAAGAGCAAAACUAUUCAGAA 2861 886908.2 (5′ to 3′) Antisense VPuUfcugAfauagudTuUfgCfucuuuscsu 2818 UUCUGAAUAGUTUUGCUCUUUCU 2862 (5′ to 3′) AD- Sense asasagag(Chd)adAadAcuauucagaaL96 2819 AAAGAGCAAAACUAUUCAGAA 2863 886909.2 (5′ to 3′) Antisense VPuUfcugdAauagudTuUfgdCucuuuscsu 2820 UUCUGAAUAGUTUUGCUCUUUCU 2864 (5′ to 3′) AD- Sense ususuau(Ghd)AfuUfUfAfcucauuaucaL96 2821 UUUAUGAUUUACUCAUUAUCA 2865 886919.2 (5′ to 3′) Antisense VPusGfsauaAfugaguaaAfuCfauaaasasc 2822 UGAUAAUGAGUAAAUCAUAAAAC 2866 (5′ to 3′) AD- Sense ususuaug(Ahd)uUfudAcucauuaucaL96 2823 UUUAUGAUUUACUCAUUAUCA 2867 886928.2 (5′ to 3′) Antisense VPudGauadAugagudAaAfudCauaaasasc 2824 UGAUAAUGAGUAAAUCAUAAAAC 2868 (5′ to 3′) AD- Sense ususuaugAfnUfUfAfcuc(Ahd)uuaucaL96 2825 UUUAUGAUUUACUCAUUAUCA 2869 886930.2 (5′ to 3′) Antisense VPusdGsauaAfugaguaaAfuCfauaaasusg 2826 UGAUAAUGAGUAAAUCAUAAAUG 2870 (5′ to 3′) AD- Sense ususuaug(Ahd)uUfUfAfcucauuaucaL96 2827 UUUAUGAUUUACUCAUUAUCA 2871 886931.2 (5′ to 3′) Antisense VPusdGsanaAfugaguaaAfuCfanaaasusg 2828 UGAUAAUGAGUAAAUCAUAAAUG 2872 (5′ to 3′) Table 26 key: U = uridine-3′-phosphate, u = 2′-O-methyluridine-3′-phosphate, us = 2′-O-methyluridine-3′-phosphorothioate, a = 2′-O-methyladenosine-3′-phosphate, A = adenosine-3′-phosphate, as = 2′-O-methyladenosine-3′-phosphorothioate, (Ahd) = 2′-O-hexadecyl-adenosine-3′-phosphate, Gf = 2′-fluoroguanosine-3′-phosphate, Uf = 2′-fluorouridine-3′-phosphate, Cf = 2′-fluorocytidine-3′-phosphate, Af = 2′-fluoroadenosine-3′-phosphate, cs = 2′-O-methylcytidine-3′-phosphate , VP = Vinylphosphate 5′, (Agn) = Adenosine-glycol nucleic acid (GNA), gs = 2′-O-methylguanosine-3′-phosphorothioate, (Chd) = 2′-O-hexadecyl-cytidine-3′-phosphate, (Tgn) = Thymidine-glycol nucleic acid (GNA) S-Isomer, (Ghd) = 2′-O-hexadecyl-guanosine-3′-phosphate, and cs = 2′-O-methylcytidine-3′-phosphorothioate. Selected candidates were evaluated for in vivo efficacy in screens for human APP knockdown in AAV mice. Briefly, an AAV vector harboring Homo sapiens APP (e.g., AAV8.HsAPP-CDS3TRNC) was intravenously injected into 6-8 week old C57BL/6 female mice, and at 14 days post-AAV administration a selected RNAi agent or a control agent was subcutaneously injected into the mice (n = 3 per group) at a dose of 3 mg/kg. The mice were sacrificed and their livers were assessed for APP mRNA levels at 14 days post-subcutaneous injection of RNAi agent or control by qPCR. As shown in Table 28, FIG. 17A, and FIG. 17B, significant levels of in vivo human APP mRNA knockdown in liver were observed for most lead RNAi agents tested, as compared to PBS and Naive (AAV only) controls, with particularly robust levels of knockdown observed for AD-886864 (parent), AD-886873, AD-886879, AD-886883, AD-886884, AD-886889, AD-886899 (parent), AD-886900, AD-886906, AD-886907, AD-886919 (parent), and AD-886823 (parent) FIGS. 18A-18D are schematic representations of the lead RNAi agents classified by parent molecule: AD-886864 parent (FIG. 18A), AD-886899 parent (FIG. 18B), AD-886919 parent (FIG. 18 C), and AD-886823 parent (FIG. 18D), respectively
TABLE-US-00049 TABLE 28 Summary of In Vivo Screening Results for Lead Candidates in AAV Mice. 3 mg/kg SC D14 liver qPCR % message remaining Standard Treatment Group Average Deviation PBS 100.00 15.26 naïve (AAV-only) 104.01 16.49 AD-886864 (parent) 29.55 0.93 AD-886873 27.48 0.84 AD-886877 33.34 13.46 AD-886879 26.68 2.52 AD-886883 21.74 2.25 AD-886884 28.51 8.66 AD-886889 21.77 1.58 AD-886899 (parent) 27.17 7.52 AD-886900 20.80 5.81 AD-886906 19.35 5.97 AD-886907 19.12 3.16 AD-886908 30.28 6.67 AD-886909 34.56 5.55 AD-886919 (parent) 24.16 6.71 AD-886928 40.47 5.03 AD-886930 32.87 6.63 AD-886931 38.82 4.51 AD-886823 (parent) 27.81 3.36 AD-886853 43.59 9.18 AD-886858 61.16 2.23 AD-886839 60.35 13.85 AD-886845 79.73 10.09
[0813] Table 29 shows in vitro APP knockdown of the above-described (e.g., Table 26) lead RNAi agents at either 10 nM or 0.1 nM in Be(2)C cell lines.
TABLE-US-00050 TABLE 29 Summary of In Vitro Screening Results for Lead Candidates in Be(2)C Cells at 10 nM and 0.1 nM Doses. % of Message % of Message Remaining - STDEV - Remaining - STDEV - Duplex 10 nM 10 nM 0.1 nM 0.1 nM AD-886823.1 7.0 5.4 91.0 25.7 AD-886845.1 13.3 3.2 67.4 7.9 AD-886839.2 10.2 7.7 74.7 39.5 AD-886853.1 6.5 3.9 44.9 7.4 AD-886858.1 11.4 2.4 61.4 12.5 AD-886864.1 11.5 3.9 44.9 7.9 AD-886873.1 12.7 1.9 60.2 14.3 AD-886877.1 11.9 3.0 67.8 5.9 AD-886879.1 9.8 1.7 41.0 5.2 AD-886883.1 8.5 2.1 29.5 12.8 AD-886884.1 8.9 2.4 31.2 11.9 AD-886889.1 9.4 0.6 28.0 14.2 AD-886899.1 9.2 2.6 40.5 12.7 AD-886900.1 6.7 2.1 39.7 21.5 AD-886906.1 10.2 3.0 39.7 9.9 AD-886907.1 9.8 2.7 30.3 1.9 AD-886908.1 10.7 2.6 32.8 10.6 AD-886909.1 7.4 1.4 77.9 16.2 AD-886919.1 5.7 1.4 31.2 4.3 AD-886928.1 9.2 2.4 67.6 7.1 AD-886930.1 6.9 1.7 45.7 10.1 AD-886931.1 3.2 1.2 42.0 16.0
Example 8. In Vivo Knock Down of APP Via C-16 siRNA Conjugates in Non-Human Primates
[0814] Because of the efficacy of the siRNA conjugate AD-454844, structure activity relationship studies were carried out on AD-454844, and 5 new C16 compounds were then identified as lead compounds based on Cyno monkey in vivo screens of soluble APP. In vivo knock down effects of C16 siRNA conjugates were assessed in Cyno monkeys given 60 mg of AD-454844, AD-994379, AD-961583, AD-961584, AD-961585, or AD-961586 via intrathecal administration between L2/L3 or L4/L5 via percutaneous needle stick in the lumbar cistern (
[0815] Further, the C16 siRNA conjugates exhibited a significant long lasting knock down effect. Sustained pharmacodynamic effects in which soluble APP remained well below 50% over a 4 month period were observed following a single dose of 60 mg of AD-454844 (
TABLE-US-00051 TABLE 30 C16 siRNA conjugates identified to knock down APP in in vivo NHP studies SEQ SEQ ID ID Duplex Strand Oligonucleotide Sequence NO: Target Sequence NO: AD- Sense Q363sasaaaucCfaAfCfCfuacaaguuscsa 2873 CGAAAAUCCAACCUACAAGUUCU 2883 994379 (5′ to 3′) Antisense VPusGfsaacu(Tgn)guagguUfgGfauuuuscsg 2874 AGAACUUGUAGGUUGGAUUUUCG 2884 (5′ to 3′) AD- Sense gsgscua(Chd)gadAadAuccaaccusasa 2875 ACGGCUACGAAAAUCCAACCUAC 2885 961583 (5′ to 3′) Antisense VPusUfsaggu(Tgn)ggaudTuUfcdGuagccsgsu 2876 GUAGGUUGGAUUUUCGUAGCCGU 2886 (5′ to 3′) AD- Sense asasagag(Chd)aAfaAfcuauucagsasa 2877 AGAAAGAGCAAAACUAUUCAGAU 2887 961584 (5′ to 3′) Antisense VPuUfcugAfauagudTuUfgCfucuuuscsu 2878 AUCUGAAUAGUUUUGCUCUUUCU 2888 (5′ to 3′) AD- Sense asasagag(Chd)adAadAcuauucagsasa 2879 AGAAAGAGCAAAACUAUUCAGAU 2889 961585 (5′ to 3′) Antisense VPuUfcugdAauagudTuUfgdCucuuuscsu 2880 AUCUGAAUAGUUUUGCUCUUUCU 2890 (5′ to 3′) AD- Sense ususuau(Ghd)AfuUfUfAfcucauuauscsa 2881 GUUUUAUGAUUUACUCAUUAUCG 2891 961586 (5′ to 3′) Antisense VPusGfsauaAfugaguaaAfuCfauaaasusg 2882 CGAUAAUGAGUAAAUCAUAAAAC 2892 (5′ to 3′)
TABLE-US-00052 TABLE 31 Unmodified base transcripts used in the C16 conjugates of Table 30 SEQ ID Duplex Strand Oligo name Transcript Sequence NO: AD- Sense A-1701871.1 AAAAUCCAACCUACAAGUUCA 2893 994379 (5′ to 3′) Antisense A-882382.1 UGAACUTGUAGGUUGGAUUUUCG 2894 (5′ to 3′) AD- Sense A-1770584.1 GGCUACGAAAAUCCAACCUAA 2895 961583 (5′ to 3′) Antisense A-1683088.1 UUAGGUTGGAUTUUCGUAGCCGU 2896 (5′ to 3′) AD- Sense A-1770585.1 AAAGAGCAAAACUAUUCAGAA 2897 961584 (5′ to 3′) Antisense A-1683116.1 UUCUGAAUAGUTUUGCUCUUUCU 2898 (5′ to 3′) AD- Sense A-1770586.1 AAAGAGCAAAACUAUUCAGAA 2899 961585 (5′ to 3′) Antisense A-1683118.1 UUCUGAAUAGUTUUGCUCUUUCU 2900 (5′ to 3′) AD- Sense A-1770587.1 UUUAUGAUUUACUCAUUAUCA 2901 961586 (5′ to 3′) Antisense A-1683134.1 UGAUAAUGAGUAAAUCAUAAAUG 2902 (5′ to 3′)