Downy mildew resistant <i>Impatiens</i>
11166424 · 2021-11-09
Assignee
Inventors
- Colleen Y. Warfield (Batavia, IL, US)
- Cornelis van Petersen (Hilversum, NL)
- Rudolfus A. Brinkkemper (Enkhuizen, NL)
- Simone E. Crain (Montgomery, IL, US)
Cpc classification
International classification
Abstract
The present disclosure provides seed and plants of downy mildew resistant Impatiens plants. The present disclosure thus relates to the plants, seeds, and tissue cultures of downy mildew resistant Impatiens plants, to methods for producing a downy mildew resistant plant of the present disclosure by crossing such plants with themselves or with another Impatiens plant, such as a plant of another genotype, variety, or cultivar, and methods of identifying downy mildew resistant Impatiens plants. The present disclosure further relates to seeds and plants produced by such crossing. The present disclosure further relates to parts of such plants. The present disclosure also relates to methods of identifying an Impatiens plant having resistance to downy mildew.
Claims
1. An Impatiens walleriana plant of a cultivated variety comprising in its genome an introgressed locus that confers resistance to downy mildew relative to a wild-type plant, wherein said locus comprises SEQ ID NO:24 or SEQ ID NO:27, and wherein a representative sample of seed comprising said locus has been deposited under ATCC Accession No. PTA-123803.
2. The plant of claim 1, wherein said locus further comprises SEQ ID NO:18 or SEQ ID NO:13.
3. The plant of claim 1, wherein the plant is inbred.
4. The plant of claim 1, wherein the plant is hybrid.
5. A plurality of plants according to claim 1 cultivated in a field.
6. A plant part of the plant of claim 1, wherein the plant part comprises at least one cell of said plant.
7. The plant part of claim 6, further defined as a cutting, leaf, pollen, a meristem, a cell, a seed, or an ovule.
8. The plant of claim 1, wherein the locus is inherited from Impatiens sp. T041, wherein a representative deposit of seed comprising the locus from Impatiens sp. T041 has been made under ATCC Accession No. PTA-123803.
9. A seed that produces the plant of claim 1.
10. A method of producing a downy mildew resistant Impatiens seed, the method comprising crossing the plant of claim 1 with itself or a second Impatiens plant.
11. The method of claim 10, further defined as comprising crossing said plant with a second, distinct Impatiens plant to produce an F1 hybrid Impatiens seed.
12. The method of claim 11, wherein the method further comprises: (a) crossing a plant grown from said F1 hybrid Impatiens seed with itself or a different Impatiens plant to produce a seed of a progeny plant of a subsequent generation; (b) growing a progeny plant of a subsequent generation from said seed of a progeny plant of a subsequent generation.
13. The method of claim 12, further comprising (c) crossing the progeny plant of a subsequent generation with itself or a second plant to produce a progeny plant of a further subsequent generation.
14. An F1 hybrid Impatiens seed produced by the method of claim 11.
15. A method of identifying an Impatiens plant having resistance to downy mildew relative to a wild-type plant, said method comprising: a) obtaining a biological sample from an Impatiens plant; and b) screening said biological sample for a SNP 26 marker as set forth in SEQ ID NO:24 or a SNP 29 marker as set forth in SEQ ID NO:27, wherein the presence of the SNP 26 or SNP 29 marker identifies the Impatiens plant as having downy mildew resistance relative to a wild-type plant.
16. The method of claim 15, wherein said biological material is also screened for a SNP 20 marker as set forth in SEQ ID NO:18 or a SNP 14 marker as set forth in SEQ ID NO:13.
17. The method of claim 15, wherein said Impatiens plant comprises an introgression that confers resistance to downy mildew that is found in Impatiens sp. T041, wherein a representative deposit of seed comprising the locus from Impatiens sp. T041 has been made under ATCC Accession No. PTA-123803.
18. The method of claim 15, wherein the Impatiens plant is an Impatiens walleriana plant.
19. The method of claim 15, wherein the Impatiens plant is inbred.
20. The method of claim 15, wherein the Impatiens plant is hybrid.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The present disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
DETAILED DESCRIPTION OF THE INVENTION
A. Breeding Impatiens Plants
(24) One aspect of the current disclosure concerns methods for producing seed of downy mildew resistant Impatiens plants as described herein. Alternatively, in other embodiments of the present disclosure, a downy mildew resistant Impatiens plant may be crossed with itself or with any second plant. Such methods can be used for propagation of downy mildew resistant (DMR) Impatiens plants or can be used to produce plants that are derived from the downy mildew resistant Impatiens plants disclosed herein. Plants derived from the downy mildew resistant Impatiens plants disclosed herein may be used, in certain embodiments, for the development of new Impatiens varieties.
(25) The development of new varieties using one or more starting varieties is well known in the art. In accordance with the present disclosure, novel varieties may be created by crossing downy mildew resistant Impatiens plants followed by multiple generations of breeding according to such well known methods. New varieties may be created by crossing with any second plant. In selecting such a second plant to cross for the purpose of developing novel lines, it may be desired to choose those plants which either themselves exhibit one or more selected desirable characteristics or which exhibit the desired characteristic(s) when in hybrid combination. Once initial crosses have been made, inbreeding and selection take place to produce new varieties. For development of a uniform line, often five or more generations of selling and selection are involved.
(26) Backcrossing can be used to improve a variety, and may be used, for example, to introduce a desired allele or trait into the plant genetic background of any plant that is sexually compatible with a plant of the present disclosure. Backcrossing transfers a specific desired trait from one inbred or non-inbred source to a variety that lacks that trait. This can be accomplished, for example, by first crossing a variety of a desired genetic background (recurrent parent) to a donor inbred (non-recurrent parent), which carries the appropriate allele or loci for the desired trait(s) in question. The progeny of this cross are then mated back to the recurrent parent, followed by selection in the resultant progeny for the desired trait to be transferred from the non-recurrent parent. The process is repeated, for example for five or more backcross generations with selection for the desired trait, until a plant is obtained wherein essentially all of the desired morphological and physiological characteristics of the recurrent parent are recovered in the converted plant, in addition to the single transferred locus from the nonrecurrent parent. The progeny thus have the characteristic being transferred, but are like the superior parent for most or almost all other loci. The last backcross generation can be selfed to give true-breeding progeny when the trait being transferred is introgressed into a true-breeding variety.
(27) The recurrent parent therefore provides the desired genetic background, while the choice of the particular nonrecurrent parent will depend on the purpose of the backcross. One of the major purposes is to add some commercially desirable trait to the plant. The exact backcrossing protocol will depend on the characteristic or trait being altered and the genetic distance between the recurrent and nonrecurrent parents. Although backcrossing methods are simplified when the characteristic being transferred is a dominant allele, a recessive allele or an additive allele (between recessive and dominant) may also be transferred. In this instance it may be necessary to introduce a test of the progeny to determine if the desired characteristic has been successfully transferred.
(28) Modified backcrossing may also be used with plants of the present disclosure. This technique uses different recurrent parents during the backcrossing. Modified backcrossing may be used to replace the original recurrent parent with a variety having certain more desirable characteristics or multiple parents may be used to obtain different desirable characteristics from each.
(29) The plants of the present disclosure are particularly well suited for the development of new lines based on the genetic background of the plants. In selecting a second plant to cross with a downy mildew resistant Impatiens plant disclosed herein for the purpose of developing novel Impatiens lines, it will typically be preferred to choose those plants which either themselves exhibit one or more selected desirable characteristics or which exhibit the desired characteristic(s) when in hybrid combination. Examples of desirable traits may include, in specific embodiments, high flower yield, flower quality, high seed germination, seedling vigor, disease resistance, and adaptability for soil and climate conditions such as drought or heat. Consumer-driven traits, such as flower color, shape, and texture, even aroma and taste are other examples of traits that may be incorporated into new lines of Impatiens plants developed by this disclosure.
B. Further Embodiments of the Disclosure
(30) In other embodiments, the present disclosure provides methods of vegetatively propagating a plant of the present disclosure. Such a method may comprise the steps of: (a) collecting tissue capable of being propagated from the plant; (b) cultivating the tissue to obtain proliferated shoots; and (c) rooting the proliferated shoots to obtain rooted plantlets. In other embodiments, such a method may further comprise growing downy mildew resistant Impatiens plants from the rooted plantlets. In still further embodiments, a plant of the present disclosure is propagated by seed, wherein a plant may be used as either a female or a male parent for producing progeny seed and plants.
(31) Also provided are methods of producing a downy mildew resistant Impatiens plant of the present disclosure, the method comprising introgressing a desired allele from a plant comprising the allele into a plant of a different genotype. In certain embodiments, such an allele may be inherited from or introgressed from Impatiens sp. T041 or Impatiens sp. 7511, or a progeny or progenitor of any generation thereof comprising the allele. Impatiens sp. 7511 is a family of siblings created from self-crosses of Impatiens sp. T041, which comprises the genetic source for downy mildew resistance. The deposited Impatiens sp. 7511 seed has the downy mildew resistance trait from Impatiens sp. T041.
(32) Many single locus traits have been identified that are not regularly selected for in the development of a new inbred but that can be improved by backcrossing techniques. Single locus traits may or may not be transgenic; examples of these traits include, but are not limited to, resistance to bacterial, fungal, or viral disease, or herbicide or insect resistance. These comprise genes generally inherited through the nucleus.
(33) Direct selection may be applied where the single locus acts as a dominant trait. For this selection process, the progeny of the initial cross are assayed for viral resistance and/or the presence of the corresponding gene prior to the backcrossing. Selection eliminates any plants that do not have the desired gene and resistance trait, and only those plants that have the trait are used in the subsequent backcross. This process is then repeated for all additional backcross generations.
(34) Selection of Impatiens plants for breeding is not necessarily dependent on the phenotype of a plant and instead can be based on genetic investigations. Thus, in one embodiment, the present disclosure provides the genetic complement of a downy mildew resistant Impatiens plant as described herein. “Genetic complement” as used herein refers to the aggregate of nucleotide sequences, the expression of which sequences defines the phenotype of, in the present case, a downy mildew resistant Impatiens plant, or a cell or tissue of that plant. A genetic complement thus represents the genetic makeup of a cell, tissue or plant, and a hybrid genetic complement represents the genetic make-up of a hybrid cell, tissue or plant. The genetic complement of a downy mildew resistant Impatiens plant as disclosed herein may be identified by any of the many well-known techniques in the art. For example, one can utilize a suitable genetic marker which is closely genetically linked to a trait of interest. One of these markers can be used to identify the presence or absence of a trait in the offspring of a particular cross, and can be used in selection of progeny for continued breeding. This technique is commonly referred to as marker-assisted selection.
(35) Any other type of genetic marker or other assay which is able to identify the relative presence or absence of a trait of interest in a plant can also be useful for breeding purposes. Procedures for marker-assisted selection are well known in the art. Such methods will be of particular utility in the case of recessive traits and variable phenotypes, or where conventional assays may be more expensive, time consuming or otherwise disadvantageous. Types of genetic markers which could be used in accordance with the present disclosure include, but are not necessarily limited to, Simple Sequence Length Polymorphisms (SSLPs), Randomly Amplified Polymorphic DNAs (RAPDs; Williams, et al., Nucleic Acids Res. 18:6531-6535:1990), DNA Amplification Fingerprinting (DAF), Sequence Characterized Amplified Regions (SCARs), Arbitrary Primed Polymerase Chain Reaction (AP-PCR), Amplified Fragment Length Polymorphisms (AFLPs) (EP 534 858, specifically incorporated herein by reference in its entirety), and Single Nucleotide Polymorphisms (SNPs) (Wang, et al., Science 280:1077-1082, 1998).
(36) With the development of molecular markers associated with particular traits, it is possible to add additional traits into an established germ line, such as represented here, with the end result being substantially the same base germplasm with the addition of a new trait or traits. Molecular breeding, as described in Moose and Mumm, 2008 (Plant Physiology, 147: 969-977), for example, and elsewhere, provides a mechanism for integrating single or multiple traits or QTL into a line. This molecular breeding-facilitated movement of a trait or traits into a line or variety may encompass incorporation of a particular genomic fragment associated with a particular trait of interest into the line or variety by the mechanism of identification of the integrated genomic fragment with the use of flanking or associated marker assays. In the embodiment represented here, one, two, three or four genomic loci, for example, may be integrated into a line via this methodology. When this line containing the additional loci is further crossed with another parental line to produce hybrid offspring, it is possible to then incorporate at least eight separate additional loci into the hybrid. These additional loci may confer, for example, such traits as disease resistance, drought or heat tolerance, or a flower quality trait. In one embodiment, each locus may confer a separate trait. In another embodiment, loci may need to be homozygous and exist in each parent line to confer a trait in the hybrid. In yet another embodiment, multiple loci may be combined to confer a single robust phenotype of a desired trait.
C. Plants Derived by Genetic Engineering
(37) Many useful traits that can be introduced by backcrossing, as well as directly into a plant, are those which are introduced by genetic transformation techniques. Genetic transformation may therefore be used to insert a selected transgene into a plant of the present disclosure or may, alternatively, be used for the preparation of transgenes which can be introduced by backcrossing. Methods for the transformation of plants that are well known to those of skill in the art and applicable to many plant species include, but are not limited to, electroporation, microprojectile bombardment, Agrobacterium-mediated transformation and direct DNA uptake by protoplasts.
(38) To effect transformation by electroporation, one may employ either friable tissues, such as a suspension culture of cells or embryogenic callus or alternatively one may transform immature embryos or other organized tissue directly. In this technique, one would partially degrade the cell walls of the chosen cells by exposing them to pectin-degrading enzymes (pectolyases) or mechanically wound tissues in a controlled manner.
(39) An efficient method for delivering transforming DNA segments to plant cells is microprojectile bombardment. In this method, particles are coated with nucleic acids and delivered into cells by a propelling force. Exemplary particles include those comprised of tungsten, platinum, and preferably, gold. For the bombardment, cells in suspension are concentrated on filters or solid culture medium. Alternatively, immature embryos or other target cells may be arranged on solid culture medium. The cells to be bombarded are positioned at an appropriate distance below the microprojectile stopping plate.
(40) An illustrative embodiment of a method for delivering DNA into plant cells by acceleration is the Biolistics Particle Delivery System, which can be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a surface covered with target cells. The screen disperses the particles so that they are not delivered to the recipient cells in large aggregates. Microprojectile bombardment techniques are widely applicable, and may be used to transform virtually any plant species.
(41) Agrobacterium-mediated transfer is another widely applicable system for introducing gene loci into plant cells (Marton, et al., Nature 277:129-131, 1978). An advantage of the technique is that DNA can be introduced into whole plant tissues, thereby bypassing the need for regeneration of an intact plant from a protoplast. Modern Agrobacterium transformation vectors are capable of replication in E. coli as well as Agrobacterium, allowing for convenient manipulations (Nester, et al., Basic Life Sci. 30:815-822, 1985). Moreover, recent technological advances in vectors for Agrobacterium-mediated gene transfer have improved the arrangement of genes and restriction sites in the vectors to facilitate the construction of vectors capable of expressing various polypeptide coding genes. The vectors described have convenient multi-linker regions flanked by a promoter and a polyadenylation site for direct expression of inserted polypeptide coding genes. Additionally, Agrobacterium containing both armed and disarmed Ti genes can be used for transformation.
(42) In those plant strains where Agrobacterium-mediated transformation is efficient, it is the method of choice because of the facile and defined nature of the gene locus transfer. The use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art (Fraley, et al., Plant Mol. Biol. 3:371-378, 1984; U.S. Pat. No. 5,563,055).
(43) Transformation of plant protoplasts also can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments (see, e.g., Potrykus, et al., Mol. Gen. Genet. 199:183-188, 1985; Omirulleh, et al., Plant Mol. Biol. 21:415-428, 1993; Fromm, et al., Nature 312:791-793, 1986; Uchimiya, et al., Mol. Gen. Genet. 204:204, 1986; Marcotte, et al., Nature 335:454, 1988). Transformation of plants and expression of foreign genetic elements is exemplified in Choi, et al. (Plant Cell Rep. 13: 344-348, 1994), and Ellul, et al. (Theor. Appl. Genet. 107:462-469, 2003).
(44) A number of promoters have utility for plant gene expression for any gene of interest including, but not limited to, selectable markers, scoreable markers, genes for pest tolerance, disease resistance, or any other gene of agronomic interest. Examples of constitutive promoters useful for plant gene expression include, but are not limited to, the cauliflower mosaic virus (CaMV) P-35S promoter, which confers constitutive, high-level expression in most plant tissues (see, e.g., Odel, et al., Nature 313:810, 1985), including in monocots (see, e.g., Dekeyser, et al., Plant Cell 2:591, 1990; Terada and Shimamoto, Mol. Gen. Genet. 220:389, 1990); a tandemly duplicated version of the CaMV 35S promoter, the enhanced 35S promoter (P-e35S); the nopaline synthase promoter (An, et al., Plant Physiol. 88:547, 1988); the octopine synthase promoter (Fromm, et al., Plant Cell 1:977, 1989); and the figwort mosaic virus (P-FMV) promoter as described in U.S. Pat. No. 5,378,619 and an enhanced version of the FMV promoter (P-eFMV) where the promoter sequence of P-FMV is duplicated in tandem; the cauliflower mosaic virus 19S promoter; a sugarcane bacilliform virus promoter; a commelina yellow mottle virus promoter; and other plant DNA virus promoters known to express in plant cells.
(45) A variety of plant gene promoters that are regulated in response to environmental, hormonal, chemical, and/or developmental signals can also be used for expression of an operably linked gene in plant cells, including promoters regulated by (1) heat (Callis, et al., Plant Physiol. 88:965-968, 1988), (2) light (e.g., pea rbcS-3A promoter, Kuhlemeier, et al., Plant Cell 1:471-478, 1989; maize rbcS promoter, Schaffner and Sheen, Plant Cell 3:997-1012, 1991; or chlorophyll a/b-binding protein promoter, Jones, et al., EMBO J. 4:2411-2418, 1985), (3) hormones, such as abscisic acid (Marcotte, et al., Plant Cell 1:969-976, 1989), (4) wounding (e.g., wunl, Siebertz, et al., Plant Cell 1:961-968, 1989); or (5) chemicals such as methyl jasmonate, salicylic acid, or Safener. It may also be advantageous to employ organ-specific promoters (e.g., Chen, et al., Genetics 116:469-477, 1987; Schernthaner, et al., EMBO J. 7:1249-1255, 1988; Bustos, et al., Plant Cell 1:839-853, 1989).
(46) Exemplary nucleic acids which may be introduced to plants of this disclosure include, for example, DNA sequences or genes from another species, or even genes or sequences which originate with or are present in the same species, but are incorporated into recipient cells by genetic engineering methods rather than classical reproduction or breeding techniques. However, the term “exogenous” is also intended to refer to genes that are not normally present in the cell being transformed, or perhaps simply not present in the form, structure, etc., as found in the transforming DNA segment or gene, or genes which are normally present and that one desires to express in a manner that differs from the natural expression pattern, e.g., to over-express. Thus, the term “exogenous” gene or DNA is intended to refer to any gene or DNA segment that is introduced into a recipient cell, regardless of whether a similar gene may already be present in such a cell. The type of DNA included in the exogenous DNA can include DNA which is already present in the plant cell, DNA from another plant, DNA from a different organism, or a DNA generated externally, such as a DNA sequence containing an antisense message of a gene, or a DNA sequence encoding a synthetic or modified version of a gene.
(47) Many hundreds if not thousands of different genes are known and could potentially be introduced into a downy mildew resistant Impatiens plant according to the present disclosure. Non-limiting examples of particular genes and corresponding phenotypes one may choose to introduce into a downy mildew resistant Impatiens plant include one or more genes for insect tolerance, such as a Bacillus thuringiensis (B.t.) gene, pest tolerance such as genes for fungal disease control, herbicide tolerance such as genes conferring glyphosate tolerance, and genes for quality improvements such as environmental or stress tolerances, or any desirable changes in plant physiology, growth, development, morphology or plant product(s). For example, structural genes would include any gene that confers insect tolerance including but not limited to a Bacillus insect control protein gene as described in WO 99/31248, herein incorporated by reference in its entirety, U.S. Pat. No. 5,689,052, herein incorporated by reference in its entirety, U.S. Pat. Nos. 5,500,365 and 5,880,275, herein incorporated by reference in their entirety. In another embodiment, the structural gene can confer tolerance to the herbicide glyphosate as conferred by genes including, but not limited to Agrobacterium strain CP4 glyphosate resistant EPSPS gene (aroA:CP4) as described in U.S. Pat. No. 5,633,435, herein incorporated by reference in its entirety, or glyphosate oxidoreductase gene (GOX) as described in U.S. Pat. No. 5,463,175, herein incorporated by reference in its entirety.
(48) Alternatively, the DNA coding sequences can affect these phenotypes by encoding a non-translatable RNA molecule that causes the targeted inhibition of expression of an endogenous gene, for example via antisense- or co-suppression-mediated mechanisms (see, for example, Bird, et al., Biotechnol. Genet. Eng. Rev. 9:207-227, 1991). The RNA could also be a catalytic RNA molecule (i.e., a ribozyme) engineered to cleave a desired endogenous mRNA product (see for example, Gibson and Shillitoe, Mol. Biotechnol. 7:125-137, 1997). Thus, any gene which produces a protein or mRNA which expresses a phenotype or morphology change of interest is useful for the practice of the present disclosure.
D. Definitions
(49) In the description and tables herein, a number of terms are used. In order to provide a clear and consistent understanding of the specification and claims, the following definitions are provided:
(50) Allele: Any of one or more alternative forms of a gene locus, all of which alleles relate to one trait or characteristic. In a diploid cell or organism, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes.
(51) Backcrossing: A process in which a breeder repeatedly crosses hybrid progeny, for example a first generation hybrid (F1), back to one of the parents of the hybrid progeny. Backcrossing can be used to introduce one or more single locus conversions from one genetic background into another.
(52) Crossing: The mating of two parent plants.
(53) Cross-pollination: Fertilization by the union of two gametes from different plants.
(54) Diploid: A cell or organism having two sets of chromosomes.
(55) Emasculate: The removal of plant male sex organs or the inactivation of the organs with a cytoplasmic or nuclear genetic factor or a chemical agent conferring male sterility.
(56) Enzymes: Molecules which can act as catalysts in biological reactions.
(57) F1 Hybrid: The first generation progeny of the cross of two non-isogenic plants.
(58) Genotype: The genetic constitution of a cell or organism.
(59) Haploid: A cell or organism having one set of the two sets of chromosomes in a diploid.
(60) Hybrid: F1 progeny produced from crossing two non-identical parental lines. Parental lines may be related or unrelated. In accordance with the present disclosure, a “hybrid” may refer to Impatiens plants comprising downy mildew resistance as described herein.
(61) Inbred Line: A group of genetically and phenotypically similar plants reproduced by inbreeding.
(62) Linkage: A phenomenon wherein alleles on the same chromosome tend to segregate together more often than expected by chance if their transmission was independent.
(63) Phenotype: The detectable characteristics of a cell or organism, which characteristics are the manifestation of gene expression.
(64) Plant Part: As used herein, a plant part refers to a part of a plant of the present disclosure. A plant part may be defined as comprising a cell of such plant, such as a cutting, a leaf, a floret, an ovule, pollen, a cell, a seed, a flower, an embryo, a meristem, a cotyledon, an anther, a root, a root tip, a pistil, a stalk, a stem, and a protoplast or callus derived therefrom.
(65) Quantitative Trait Loci (QTL): Quantitative trait loci (QTL) refer to genetic loci that control to some degree numerically representable traits that are usually continuously distributed.
(66) Regeneration: The development of a plant from tissue culture. In accordance with the present disclosure, a regenerated Impatiens plant as described herein would comprise a downy mildew resistance allele that confers downy mildew resistance.
(67) Resistance: The ability of an Impatiens variety to restrict the growth and development of downy mildew or the damage it causes when compared to susceptible Impatiens varieties under similar environmental conditions and pressure from downy mildew. Resistant Impatiens varieties may exhibit some disease symptoms or damage under heavy pressure from downy mildew.
(68) Self-pollination or self-fertilization: The transfer of pollen from the anther to the stigma of the same plant. A “self-pollinated” or “self-fertilized” seed refers to a seed arising from fusion of male and female gametes produced by the same plant. In hybrid seed production, self-pollinated or self-fertilized seed refers to that portion (e.g., less than 1%) of the seed that was the result of self-pollination.
(69) Single Locus Converted (Conversion) Plant: Plants which are developed by a plant breeding technique called backcrossing, wherein essentially all of the desired morphological and physiological characteristics of an Impatiens variety are recovered in addition to the characteristics of the single locus transferred into the variety via the backcrossing technique and/or by genetic transformation.
(70) Substantially Equivalent: A characteristic that, when compared, does not show a statistically significant difference (e.g., p=0.05) from the mean.
(71) Susceptibility: The inability of an Impatiens variety to restrict the growth and development of downy mildew.
(72) Tissue Culture: A composition comprising isolated cells of the same or a different type or a collection of such cells organized into parts of a plant. A tissue culture in accordance with the present disclosure may originate from or comprise cells or protoplasts from a plant part selected from the group consisting of embryos, meristems, cotyledons, pollen, leaves, anthers, roots, root tips, pistil, flower, florets, seed, stems, and protoplasts or callus derived therefrom.
E. Deposit Information
(73) A deposit of Impatiens sp. 7511, disclosed above and recited in the claims, has been made with the American Type Culture Collection (ATCC), 10801 University Blvd., Manassas, Va. 20110-2209. The date of the deposit was Jan. 26, 2017. The accession number for those deposited seeds of Impatiens sp. 7511 is ATCC Accession Number PTA-123803. Upon issuance of a patent, all restrictions upon the deposits will be removed, and the deposits are intended to meet all of the requirements of 37 C.F.R. § 1.801-1.809. The deposits will be maintained in the depository for a period of 30 years, or 5 years after the last request, or for the effective life of the patent, whichever is longer, and will be replaced if necessary during that period.
(74) Impatiens sp. 7511 is a family of siblings created from self-crosses of Impatiens sp. T041 (see below). The deposited Impatiens sp. 7511 seed has the downy mildew resistance trait from Impatiens sp. T041.
EXAMPLES
(75) Although the foregoing disclosure has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the present disclosure, as limited only by the scope of the appended claims.
Example 1
Origin of Downy Mildew Resistant Impatiens
(76) Self-crosses from a Ball Horticultural Company proprietary Impatiens germplasm collection were screened for downy mildew resistance. One Impatiens sp. selection identified as T041 was found to be highly resistant to downy mildew and exhibited both lower disease incidence and severity when compared to the susceptible I. walleriana control and to other Impatiens sp. in the germplasm screen.
(77) Four week old seedlings were spray-inoculated with a suspension of Plasmopara obducens sporangia (1.0×105 sporangia/ml). The isolate of P. obducens used for inoculations was obtained from naturally infected Impatiens walleriana plants growing in an outdoor field trial in Holland in August 2012 and subsequently established and maintained on seed-raised I. walleriana in a laboratory growth chamber. Inoculum was prepared by rinsing sporulating impatiens leaves in water with a drop of Tween 20. The sporangial suspension was passed through 4 layers of cheesecloth to remove mycelial fragments. Using an airbrush sprayer attached to an air compressor, the sporangial suspension was applied to adaxial and abaxial leaf surfaces as a fine mist. Plants were immediately bagged after inoculation to maintain 100% relative humidity and placed into a 17° C., dark growth chamber overnight resuming a 23° C. days and 17° C. nights and 12 hour light/dark schedule the following morning. Plants were evaluated 14 days after inoculation. The total number of leaves per plant, the number of leaves or cotyledons with visible sporulation and the degree of sporulation, the number of leaves with internal gray discoloration and the number of abscised leaves and cotyledons was recorded.
(78) All 24 inoculated plants of T041 exhibited resistance to the pathogen. Each plant had an average of 26 leaves, of which 18 plants had no visible leaf sporulation, 6 plants had 1 attached or abscised cotyledon or leaf with sparse leaf sporulation, and 9 plants had 1 or 2 leaves with internal gray discoloration but no sporulation. In comparison, the susceptible Impatiens walleriana SUPER ELFIN ‘White’ control had heavy sporulation on the abaxial surface of >90% of the leaves of each plant, as did some of the other Impatiens sp. selections.
Example 2
Impatiens Seedling Assay for Resistance to Downy Mildew
(79) Plasmopara obducens causes downy mildew of Impatiens. A seedling assay was designed to test for resistance in impatiens against this obligate parasite. The assay is conducted in a greenhouse under controlled environmental conditions.
(80) Impatiens seeds were sown into 128 cell plug trays filled with a peat-based, soilless potting mix. Trays were placed in a 25° C. mist chamber with continuous light (ca. 50 micromol/s) for approximately 4 to 6 days. Trays were transferred to an enclosed greenhouse and maintained at approximately 20° C. average day temperature with 14 hours of light per day (ca. 50 micromol/s light).
(81) The three week old seedlings were inoculated with a suspension of P. obducens sporangia (ca. 1×105 sporangia/ml). The isolate of P. obducens used for inoculations was obtained from naturally-infected Impatiens walleriana plants grown in an outdoor field trial in Holland and subsequently maintained on I. walleriana plants enclosed in plastic bags and grown in a greenhouse. Inoculum was prepared by vigorously rinsing sporulating impatiens leaves in water. After adjusting the concentration, the sporangial suspension was applied to leaves of the seedlings using a hand-pump spray bottle. Each tray was transferred into a clear plastic bag, tied closed to maintain 100% humidity and placed in the dark for 18 hours at 17° C.
(82) The bags were removed and trays were transferred back to the lighted greenhouse and maintained at approximately 20° C. average day temperature with 14 hour days. Relative humidity was approximately 60 to 75% and seedlings were watered through sub-irrigation to reduce free water on the leaves. After 10 to 14 days, trays were placed back into the clear plastic bags to promote sporulation. The bagged trays were maintained in the greenhouse for two to four days at which time the bags were removed and the seedlings were evaluated and rated a second time for signs of downy mildew infection.
(83) Seedlings were visually evaluated for visible sporulation on the abaxial leaf surfaces as well as for internal leaf discoloration. Seedlings were rated on a scale of 1-4 based on the incidence and severity of the disease as described below in Table 1.
(84) TABLE-US-00001 TABLE 1 Rating Scale for Disease Incidence and Severity Rating Scale Description of Category 1 >2 leaves, both young and fully-mature, with moderate to heavy sporulation 2 sparse sporulation on 1-2 leaves 3 leaf discoloration but no sporulation 4 no sporulation
(85) Seedlings rated 2 through 4 were transplanted into 9-cm pots filled with soilless potting mix and placed back into the greenhouse for 14 days and grown using standard practices known to those skilled in the art. After 14 days plants were transferred back into individual clear plastic bags to increase the humidity to 100% and promote sporulation for a second time. After two days, plants were removed from the bags and evaluated using the rating scale previously described in Table 1. Plants rated 3 or 4 were maintained for use in the breeding program, and those rated 1 or 2 were discarded.
Example 3
Inheritance of Downy Mildew Resistance
(86) A Ball Horticultural Company proprietary Impatiens sp. breeding line coded T041-1-B-50 was crossed as the female parent with a Ball Horticultural Company proprietary Impatiens walleriana inbred breeding line coded G0008Q as the male parent. The F1 population was screened for downy mildew resistance as described in Example 2 and rated as highly resistant. One F1 plant coded IMC-211 was selected and self-crossed. The resulting F2 population was screened for downy mildew resistance, and plant ratings were as follows: 9/16 High Resistance; 3/16 Moderate Resistance, 3/16 Low Resistance, and 1/16 No resistance.
(87) The resistant phenotype is characterized as plants at 14 to 30 days after inoculation exhibiting no or sparse sporulation and/or internal discoloration of the leaf tissue of one or two leaves. Plants without resistance are characterized at 14 to 30 days after inoculation as having leaf yellowing, dense sporulation on the abaxial leaf surfaces, extensive leaf abscission and eventual collapse of the plant.
Example 4
Introgression of Downy Mildew Resistance into Impatiens walleriana
(88) Impatiens sp. selection T041 was used in an introgression breeding program to introduce genetic downy mildew resistance into Impatiens walleriana. Individual plants selected from the method, as described in Example 2, are listed below in Table 2. All resistant plants have selection T041 Impatiens sp. in their pedigree.
(89) TABLE-US-00002 TABLE 2 Identification of Plants Having Resistant Phenotypes Female Plant Code Parent Male Parent Conclusion 6069-1 2494A-1 T041 Resistant F1 plant 6068-2 1532A-1-1- T041 Resistant F1 plant 1-1 IM15-733-1 1532A-1-1- 6068-2 Resistant BC plant 1-1 IM15-733-1-2 IM15-733-1 IM15-733-1 Resistant F2 plant IM15-905-2-5 IM15-905-2 IM15-905-2 Resistant F2 plant IM15-0122-1- IM15-0122- IM15-0122- Resistant F4 plant 1-04-2 1-1-04 1-1-04
(90) Pedigrees illustrating the introgression of genetic downy mildew resistance from Impatiens sp. selection T041 into Impatiens walleriana are shown in
(91) The downy mildew resistant Impatiens walleriana female and male parents were utilized in crosses to develop at least the F1 hybrids shown in Table 3, below.
(92) TABLE-US-00003 TABLE 3 Flower Color Hybrid Breeder ID Female Parent Male Parent white IM16-771 IMS16-675 IMS16-730 orange IM17-748 IMS17-514 IMS17-578 salmon IM17-453 IMS17-176 IMS16-555 deep salmon IM17-452 IMS17-176 IMS16-706
Example 5
Marker Development for Downy Mildew Resistance in Impatiens walleriana
(93) To develop markers for T041 mediated Downy Mildew Resistance in Impatiens, mapping populations were developed in Impatiens. Resistant parental lines (25) were chosen on the basis of disease response in the seedling assay. One susceptible parental line was chosen as the other parent (G0008Q). Crosses between the 25 resistant lines and the susceptible line resulted in 25 independent F1's, that were selfed to produce 25 F2 mapping populations. All F1's and small F2 populations were evaluated for the disease response, and on the basis of the segregation pattern one population was chosen for the initial mapping of the disease resistance locus and for marker development (IMC243).
(94) The mapping population used for marker development (IMC243) consisted of 70 F2 individuals. For marker validation also a germplasm panel was included, consisting of 74 samples, including 4 parental lines and 3 F1 hybrids in duplicate. Leaf samples from population IMC243 were collected before disease assays were started, leaf samples from germplasm were collected from a greenhouse. For this material disease resistance scores were communicated as qualitative scores (Resistant or Susceptible). The leaf samples were used for the isolation of DNA and for subsequent SBG genotyping.
(95) The panel of 144 samples was used for the preparation of SBG libraries with PstI/MseI as the enzyme combination with two selective nucleotides added to the primers (+0/+GT). The libraries were subsequently sequenced in 4 lanes of the Illumina HiSeq (single read sequencing). After sequencing Illumina reads were filtered on the basis of quality, presence of sample identification tags and the PstI restriction site motif. Subsequently, reads from all samples were used to generate a reference sequence and the produced clusters were mined for SNPs. In this step also a preliminary genotype score file was constructed.
(96) After Sequence Based Genotyping (SBG), genotypic data of samples of IMC243 and their parental lines was selected from the total dataset as the dataset that was used for mapping. For this dataset markers were selected that were segregating as expected for an F2 mapping population.
(97) In total, 2755 markers showed F2-type segregation and were used in the construction of a genetic map using Keygene proprietary software CarteBlanche. First the markers were assigned to linkage groups based on recombination frequencies. Next the order of the markers was estimated in multiple rounds and a “best map” was extracted. Finally a check for inconsistencies was performed. As a result, in total 2732 markers were mapped into 9 major (>100 markers) and 2 minor (<20 markers) linkage groups. A summary of the genetic map is presented in Table 4.
(98) TABLE-US-00004 TABLE 4 Summary of the Genetic Map Name # Loci Length (cM) Group - I 551 216.4 Group - II 409 216.9 Group - III 337 146.4 Group - IV 310 163.1 Group - V 288 140 Group - VI 235 136.3 Group - VII 231 115.4 Group - VIII 187 109.8 Group - IX 149 110.7 Group - X 19 11.7 Group - XI 16 47.9 Total 2732 1414.6
(99) For population IMC243 disease response data were collected from single F2 plants on 5 dates according to a modified version of the protocol described in Table 1. Seedlings were rated on a scale of 0 to 5, with 0 being just the stem left or a dead plant, 1 being major leaf drop, and the plant near collapse, 2 being some leaf drop and/or yellowing, 3 being major sporulation, with the plant still appearing well, 4 being minor sporulation, and a healthy looking plant, and 5 being no sporulation. Disease development in the F2 individuals over time was monitored. Data collected on different dates were considered as separate traits. The overall mean over the 5 dates was also determined and used as trait. Subsequently, correlations between the traits were estimated and are presented in Table 5. A strong correlation was observed between the traits of the final three dates, and of the trait representing the overall mean.
(100) TABLE-US-00005 TABLE 5 Correlations Between the Traits T19-12 Tmean_22-12 Tmean_27-12 Tmean_30-12 Tmean_02-01 Toverall_mean T19-12 Tmean_22-12 0.61 Tmean_27-12 0.26 0.44 Tmean_30-12 0.21 0.46 0.86 Tmean_02-01 0.22 0.45 0.81 0.95 Toverall_mean 0.46 0.65 0.89 0.94 0.94
(101) A QTL mapping was performed using the data of the six traits individually and the genotypic data of the IMC243 population. QTL were identified for all traits on Linkage Group 2 (LG2) and/or Linkage Group 5 (LG5). The QTL on LG5 was observed in the early stages of disease development and the QTL on LG2 was observed during the later stages of disease development when also a clear separation between susceptible and resistant individuals was observed. Since there was little correlation between the early response QTL and the later response QTL the later QTL seemed more meaningful. Therefore, the correlation between genotype and phenotype was investigated for the LG2 QTL region.
(102) The association of the LG2 QTL region with the disease response at timepoints 3, 4 and 5 was recorded. It was observed that disease scores 1 and 2 (indicative for susceptibility) were highly associated with Balleles, disease scores 4 and 5 were highly associated with A or H alleles, disease scores 3 were most frequently observed associated with H-scores. Therefore it was concluded that the T041 resistance gene mapped on LG2 around 75 cM. Since the number of individuals in the F2 population and therefore the number of recombinations was limited, the T041 gene could not be more precisely positioned among the available markers.
(103) The germplasm panel consisted of 67 samples, including 4 parental lines (T041-1-B50 alias TP25-1, T041-1-B3 alias TP3-2, T041-1-B4 alias TP4-2 as resistant lines, G0008Q alias TP26-1 and their 3 F1 hybrids TF1-24B, TF1-3B and TF1-4B, respectively). For the germplasm samples, disease resistance scores were communicated as qualitative scores (Resistant or Susceptible). For the association analysis only the mapped markers were selected from the total dataset. In addition, filtering was done for <10% missing data and <90% Major Allele Frequency, resulting 2424 mapped markers in the data set for association analysis.
(104) Two clearly associated regions were identified, on LG2 and on LG4. Interestingly, LG2 was overlapping with the identified region in the QTL mapping. LG4 was not found associated with disease resistance in the QTL mapping, and the LG5 region identified in the QTL mapping was not confirmed in the association analysis. It was also observed that several markers were not present in the association analysis that were present in the region of interest on the basis of the genetic mapping. Those markers were retrieved from the original dataset and it turned out that they had been removed from the dataset for association mapping on the basis of % U-scores. Clearly the marker alleles were amplified in the resistant germplasm, however not in the susceptible germplasm. These markers were subsequently integrated in the dataset for association analysis using the marker order in the genetic map.
(105) The association of the markers in the LG2 QTL region with the disease response (Resistant or Susceptible) was examined. Again the region around 75 cM was most clearly associated with resistance, and markers in this area showed 100% association with the disease response phenotype.
(106) Nine markers were selected in the T041 resistance associated region on chromosome 2 on the basis of the genetic map and were converted to KASPar markers. Names and position of the markers are provided in Table 6, SNP sequences are provided in Table 7 (the resistant allele (T041-B-50) is shown as the first letter in the SNP position, the susceptible allele (IMS17-226) is shown as the second letter in the SNP position). Markers were selected for two purposes: 1) Validation of markers to select for T041 mediated resistance; 2) Validation of markers at the borders of the best associated region to select for recombinants in the region as part of the T041 gene isolation project.
(107) TABLE-US-00006 TABLE 6 Overview of the SNPs Selected for Validation as KASPar Assays # SBG marker cM position SNP8 16090187_Impatience_SBG_365004_60 66.3 SNP3 16090187_Impatience_SBG_285385_35 69.4 SNP6 16090187_Impatience_SBG_353380_68 75.1 SNP5 16090187_Impatience_SBG_298705_40 75.2 SNP4 16090187_Impatience_SBG_1494592_69 75.3 SNP1 16090187_Impatience_SBG_1295214_40 75.8 SNP7 16090187_Impatience_SBG_282803_70 77.7 SNP9 16090187_Impatience_SBG_232915_83 77.9 SNP2 16090187_Impatience_SBG_1469463_50 80.3
(108) TABLE-US-00007 TABLE 7 KASPar Markers with Their Sequence and SNP SNP# SBG Marker SNP Sequence (SNP in brackets) 1 16090187_Impatience_ CCAACCTTTCACTCAGCCGTCTGTTTCCATATCCT SBG_1295214_40 CATG[C/T]GGCTTCGATGAACTATCCATCGGTAGC TCAAAATGCTCCGCTATTACCCTCTTYGGTTTTAG GCWGCTAACAGA (SEQ ID NO: 1) 2 16090187_Impatience_ AACGACGCGTGGCCGAAGCCCTCGAGCGAGCGC SBG_1469463_50 GAACATACCAAGTCCT[C/T]AGAGCGAACGAGGC CGAGTTCGAAGTGATATCTCACGAGGGAACCCAC GTCGTGGATATMCGTA (SEQ ID NO: 2) 3 16090187_Impatience_ ACAATGGTTTGACTGTCGTAGTYGGTGGAGGAGC SBG_285385_35 [C/T]GCAATTGCAGCCCATGGATCATCGCTATCCAM WGAAGGGGGGATGCTTTTTGGGATCAATGGTCTTG ATGTTGATTTCG (SEQ ID NO: 3) 4 16090187_Impatience_ TGACCAATACATCACTTGAAAATGTTATGTTAGTG SBG_1494592_69 GAAGATATGTTCATGAAATCTTCTAAAGAGAGT [G/T]TAGTTTCTTGGAACGTGATGATTTCTGTCTAC TTGAAGAATTCCC (SEQ ID NO: 4) 5 16090187_Impatience_ TGTGGTATTTGGAGATGCTCTTAGTGGTTGTAAG SBG_298705_40 GCGGG[T/A]GCAGGTTGTCCTTACGCTGTTACTTA CGGAGATGGGAGCTCGACTTCTGGACATTTTGTGA AGGATATCGTACA (SEQ ID NO: 5) 6 16090187_Impatience_ TTCAAGCTGCCATTCTGTGTGGGGAGGGAAATCC SBG_353380 68 ACAAGTGCGAGACCTTGTGCTTCTCGATGTCAC [T/A]CCTCTGTCTCTTGGARTTKATRTACTTGGAGG CATTATGTCAGTGT (SEQ ID NO: 6) 7 16090187_Impatience_ ACAGTTATAGCTTAGGGTAGAAACTTCGGGAGAGA SBG_282803_70 CGGAGAGATGGGGGCCAAACTCACAAGCAATGGA [G/C]GAAGCATTGGAAGGGAGGAGAGAAGATGGGT TATTGGGAGATGG (SEQ ID NO: 7) 8 16090187_Impatience_ TTCGAYCATCCTCTGTTGCAAAAGAGCAATCGCGC SBG_365004_60 CGATGCATCCGTAAACAGGATCGC[C/T]GAGCCTGA CCTCAGCCTGGAATACGAGAGAGTTGACGGCGTCT RYGCGGCGATC (SEQ ID NO: 8) 9 16090187_Impatience_ KTTCAGGGACAGACGATTTTGGGCCGTGCCCTCTA SBG_232915_83 TCAGAAGCGAACCGCATACAGATTGGAGTTGACGT CGAAGAGGGGG[A/G]TCTTGGATAAGTGTGACTTCT TCCGGTGAAG (SEQ ID NO: 9)
(109) The nine KASPar markers were validated on the same panel of samples. Besides the germplasm also three times 16 F2 individuals were included from mapping populations IMC222, IMC223, and IMC243 respectively. Results for a subset of the susceptible germplasm and all resistant germplasm were examined next to the original genotyping results using SBG.
(110) The following conclusions were drawn from the validation analysis: 1) All KASPar assays showed genotyping results similar to the earlier SBG results; For SNP1, for which U-scores were observed as SBG marker, A-scores were observed as KASPar marker like in the resistant germplasm; 2) Two markers SBFF_1295214_40 (SNP5) and SBG_1494592_69 (SNP4) showed best association with the phenotype, like the original SBG marker: these markers are currently the best diagnostic markers; 3) SNPs 6, 1, 9 and 2 are informative in the mapping populations, however not in the germplasm, since they do not distinguish between susceptible and resistant material; 4) All markers were polymorphic between the parental lines (P25_1 and P26_1) of the used mapping population IMC243. Interestingly, one resistant parental line (P3_2) is not polymorphic with the susceptible parent P26_1 for SNP8, indicating that this marker is outside the R-gene region: it was also observed that indeed SNP8 was not segregating in population IMC222; 5) Three mapping populations have been selected for the screening of recombinants in the current Ta41 studies: populations IMC243 (P25×P26), IMC222 (P3×P26) and IMC 223 (P4×P26). As flanking markers for the screening of recombinants SNP 8 and 2 were selected for populations IMC243 and IMC223, SNP 3 (instead of SNP 8, since not polymorphic) and 2 for population IMC222. As best marker to test for presence of T041 SNP 5 was selected; 6).
Example 6
Chromosome Scale Scaffolding of the Genome Assembly of the Impatiens Genome
(111) Whole Genome Sequencing of Impatiens IMS16-847 (a selected T041 resistant line) consisted of 100×PACBio sequencing, followed by assembly using Falcon assembly software. On the basis of the positive assembly results, yielding an N50 contig size of 395,315 bp (>250 kbp was indicated as expected result), the polished Falcon assembly was scaffolded using Dovetail Chicago and Hi-C technologies (Dovetail Genomics, LLC, Santa Cruz, Calif., USA).
(112) An overview of the assembly results of the initial Falcon assembly and the Dovetail assembly is provided in Table 8. The total bases in the assemblies were highly similar (around 1.63 Gb). N50 sizes and indices indicated that while half of the assembly was initially covered by 1,157 largest contigs (N50 index) with an average size of 395 kbp (N50 contig size), after Dovetail scaffolding only 7 scaffolds with an average size of 88 Mb (N50 scaffold size) covered half of the assembly, showing a >200 times increase of the N50 size. Table 8 also shows the results of a BUSCO search, which is used as QC in assemblies to assess the gene completeness based on near-universal single-copy orthologs selected from OrthoDB v9 (BUSCO v2; Felipe, et al., Bioinformatics 31:3210-3212, 2015). Busco results were highly similar in both assemblies, indicating that only around 10% of the 1440 genes was missing in both assemblies.
(113) TABLE-US-00008 TABLE 8 Falcon-PacBio Dovetail Impatiens Assemblies polished contigs scaffolds Total contigs/scaffolds 13,889 8,290 Total bases 1,626,035,485 1,630,674,185 Average size 117,074 196,704 Largest size 3,319,732 172,866,230 Smallest size 3 3 N50 size 395,315 88,324,968 N50 index 1,157 7 N60 size 300,409 61,400,239 N60 index 1,631 9 N90 size 62,802 126,975 N90 index 4,803 709 N95 size 25,720 34,159 N95 index 6,891 1,948 Busco search complete_busco 1,251 1,245 % complete 86.88 86.46 complete_and_singel_- 1099 1112 copy_busco complete_and_duplicated_busco 152 133 fragmented_busco 47 54 missing_busco 142 141 % missing 9.86 9.79 total_busco_searched 1,440 1,440
Example 7
Genetic Anchoring of Reference Genome
(114) In order to link the generated genome sequence to a high quality genetic map, a high resolution genetic map was generated by genotyping 250 F2 individuals of mapping population IMC243 using SBG. An overview of the generated genetic map is shown in Table 9.
(115) TABLE-US-00009 TABLE 9 Impatiens genetic map # markers Length (cM) Group - I 347 185.8 Group - II 262 166.9 Group - IIIa 225 134.3 Group - IIIb 98 71.4 Group - IV 206 109 Group - V 180 125 Group - VI 148 88.1 Group - VII 125 67.9 Group - VIII 116 78 Total 1707 1026.4
(116) Out of the 1707 markers on the genetic map, 1684 (99%) were identified in the genome sequence, and based on subsequent selection of: 1) the best match of each genetic marker (in case of multiple matches); and 2) markers with sufficient coverage (85%) and identity (90%); a set of 1553 markers was selected that could be used for anchoring of the genome sequence. Anchoring results are shown in
(117) All remaining scaffolds that could not be anchored to the genetic map were collected in Chr0, resulting in a total assembly size of 1,631,493,185 bp. An overview of the physical length of the pseudo chromosomes (PSC) is provided in Table 10.
(118) TABLE-US-00010 TABLE 10 IW.1.0_PSC.reference bp per Pseudo Chromosome IW.1.0_ChrI 200,386,564 IW.1.0_ChrII 178,967,094 IW.1.0_ChrIIIa 156,094,943 IW.1.0_ChrIIIb 42,367,474 IW.1.0_ChrIV 119,939,839 IW.1.0_ChrV 137,391,088 IW.1.0_ChrVI 177,599,370 IW.1.0_ChrVII 103,280,203 IW.1.0_ChrVIII 105,808,463 IW.1.0_Chr0 409,658,147 Total 1,631,493,185
Example 8
Evidence Based Annotation
(119) HQ isoforms were used for the evidence based annotation of the reference sequence, generated using the same genotype as used for the genome reference sequence: Impatiens walleriana IMS16-847. Seedlings of IMS16-847 were grown in a greenhouse, samples from different tissues were harvested, and after RNA isolation samples were pooled into 2 pools. After library prep, samples were sequenced in 6 SMRT Cells on the PACBio Sequel. A more detailed report of the transcript analysis is provided below.
(120) After sequencing, the PacBio IsoSeq pipeline was used to process the data. The PacBio IsoSeq pipeline includes three steps. The first step is to obtain “reads of insert,” which are the sequences between SMRTbell adapters. If a transcript is sequenced several passes in a single PacBio raw read, a consensus sequence is generated using the arrow algorithm. The second step is to generate full length and non-chimeric reads. In this step, a few criteria are used: 5′primer identified; 3′primer identified; poly-A tail identified; and no artificial concatemer. If reads of insert fulfill all of the criteria, the reads are classified as full length and non-chimeric reads. If reads of insert do not meet the first three criteria, but fulfill the last criterion, the reads of insert are classified as not full length and non-chimeric reads. In this step, the minimum read length of 50 bp is used to further filter the sequences. 5′ and 3′primers and polyA tails in full length and non-chimeric reads are trimmed off for the next step in the process. The third step is to generate high quality and non-redundant full length transcripts. The full length non-chimeric reads are clustered based on the sequence similarity and consensus sequences (also named isoforms) are called per cluster. After that, the not full length non-chimeric reads are mapped to the isoforms and polished using a program called Quiver. Furthermore, the polished isoforms are classified as high quality (HQ) isoforms if the polished accuracy is above 0.99, as low quality (LQ), if the polished accuracy is lower than 0.99.
(121) Table 11 shows the results generated from the PacBio Isoseq analysis pipeline. About 48% of reads of insert were full length non-chimeric reads, which was according to expectation. After isoform polishing, high quality (HQ) isoforms and low quality (LQ) isoforms were separated. The analysis generated more than 110,000 HQ isoforms. The generated HQ isoforms are unique on the sequence level, however, these isoforms could still be redundant on the transcript level because of PCR errors and some sequencing errors resulting in different isoforms for the same transcripts. The redundancy in the HQ isoforms is, however, not a problem for the purpose of improving genome annotation, because the redundant isoforms are most likely aligned to the same genes on the genome.
(122) TABLE-US-00011 TABLE 11 Impatiens walleriana IsoSeq Analysis # smrtcells 6 # reads of interest 2,905,408 # reads of insert non-chimeric 2,849,264 # 5′ reads 1,703,027 # 3′ reads 1,777,150 # polyA reads 1,743,003 #filtered short reads (<50 bp) 1,692 # non-full-length reads 1,453,412 # full-length reads 1,450,304 # full-length non-chimeric reads 1,395,852 % full-length non-chimeric reads 48.04 average full-length non-chimeric read length 1,907 Unpolished isoforms 545,627 # HQ isoforms 110,441 # LQ isoforms 432,763
(123) HQ Isoforms were mapped to the reference genome and out of 110,441 isoforms identified, 104,331 could be mapped to the reference genome (94%). Results are shown in Table 12.
(124) TABLE-US-00012 TABLE 12 # Total HQ isoforms 110,441 # Mapped isoforms (cov > 90%; ide > 95%) 104,331 % Mapped isoforms (cov > 90%; ide > 95%) 94.47 # Unmapped due to low coverage 1,569 # Unmapped due to low identity 1,339 # Unmapped since not found 3,202
(125) Evidence based annotation was done for the complete genome. The annotations were used to look for potential candidate genes in the T041 region, and to annotate SNPs from re-sequencing data in the T041 region (Example 12, below).
Example 9
Additional Marker Development for the T041 Region
(126) On the basis of the genetic map detailed above in Example 5, additional markers in the T041 region were converted to KASPar markers (SNPs 11 to 16). An overview of additional KASPar markers and their genetic map position in relation to earlier KASPar markers 1 to 9 is shown in Table 13, SNP sequences are provided in Table 14 (the resistant allele (T041-B-50) is shown as the first letter in the SNP position, the susceptible allele (IMS17-226) is shown as the second letter in the SNP position).
(127) TABLE-US-00013 TABLE 13 SBG Marker KASPar Marker 16090187_Impatience_SBG_365004_60 8 16090187_Impatience_SBG_288952_24 12 16090187_Impatience_SBG_62158_55 11 16090187_Impatience_SBG_285385_35 3 16090187_Impatience_SBG_292868_45 13 16090187_Impatience_SBG_291331_32 14 16090187_Impatience_SBG_272401_100 Not possible 16090187_Impatience_SBG_200480_16 Not possible 16090187_Impatience_SBG_353380_68 6 16090187_Impatience_SBG_1295214_40 1 16090187_Impatience_SBG_298705_40 5 16090187_Impatience_SBG_1494592_69 4 16090187_Impatience_SBG_419627_90 15 16090187_Impatience_SBG_667215_62 16 16090187_Impatience_SBG_372239_7 Not possible 16090187_Impatience_SBG_339813_1 Not possible 16090187_Impatience_SBG_282803_70 7 16090187_Impatience_SBG_232915_83 9 16090187_Impatience_SBG_1469463_50 2
(128) TABLE-US-00014 TABLE 14 SNP# SBG Marker SNP Sequence (SNP in brackets) 11 16090187_Impatience_ GCACCRTCGAGCAGATTGGTCCCACGCGGTGCAGG SBG_62158_55 TACTACGTTTACCGAAAGG[T/A]ATTATTTAGGTTT TAGTTTTAGACATTTCTGTTTGAAGAGTTCGGAGAC GGGCGGTCGG (SEQ ID NO: 10) 12 16090187_Impatience_ AAAAGGACGTGGTTTCTCCCATA[A/G]CTGCCAGGT SBG_288952_24 GGCGCGCGCTAAGTGGCCGAGTTCTTCATTTGTTGC AACGGGATTCCTGATCTGACWCGTTCTTGTAAATT CATTTTGAAA (SEQ ID NO: 11) 13 16090187_Impatience_ ATCAGATCAGGTTAGCGTAACACATTCAGCAAGGC SBG_292868_45 TGAAAAACC[T/C]ACATCAAGTGAGGGCGGCGGRA ACGGGACGCAGCYGTTTTGTAGACTGAACAAGCAA AGAGAGGAGAGG (SEQ ID NO: 12) 14 16090187_Impatience_ CCGCAGTAAAGTGCGCTGGAATCCGATCCCA[G/A] SBG_291331_32 CAGACTAGGGTTTCTGATTCCAACATCTCTATTGCT AATAACGACGGAAGAAGATCTGCAATTCTAGGCCT TGCCGGCGTGC (SEQ ID NO: 13) 15 16090187_Impatience_ CTCTCATAATTTCTGGCTGTGCTGCATGTGGAAACT SBG_419627_90 TGCGGACAGCACCATTCTGTGWGGATTTACTAGTG TTTCCAAKGAAGTTGCTG[C/T]TACTGGGACCAGCT TCATCGTTCA (SEQ ID NO: 14) 16 16090187_Impatience_ AAGTGTTGATRACCATGGGCAGCAATTCGCTCCCA SBG_667215_62 ATAGCAAGAAGCTTCTTGATGAACGC[G/A]TTGAG GTTAGAACCAACTGAACATYGCGTTTGGATGAACC TGGGGCTGATTT (SEQ ID NO: 15)
(129) Table 13 shows the additional KASPar markers 11 to 16 with the original SBG marker name and their order in relation to KASPar markers 1 to 9. For some markers in the region it was not possible to design KASPar markers due to insufficient flanking sequence next to the SNP position.
Example 10
Recombinant Selection and Phenotyping of Recombinants
(130) After the initial mapping of the T041 locus on Linkage group 2 using one F2 population for genotyping and phenotyping (see Example 5, above), for the fine mapping of the T041 locus it was decided to phenotype in F3 families rather than in individual F2 plants. Three mapping populations were earlier selected: IMC222, IMC223 and IMC243 based on crosses with resistant lines T041-1-B3 (alias P3), T041-1-B4 (alias P4) and T041-1-B50 (alias P25), respectively, with susceptible genotype IMS17-226 (alias P26). Therefore, for all 3 mapping populations, F2 seeds were sown for the per plant harvesting of F3 seeds for phenotyping. Also, in an early stage leaf material was harvested from the F2 plants and DNA was isolated. Using the genetic markers identified above (see Example 5), recombinants in the region were selected to be able to just phenotype the recombinants between either SNP 8 (for populations IMC243 and 223) or SNP 3 (for population IMC222) and SNP2, that were flanking the QTL region. As best marker to test for presence of the T041 gene SNP 5 was selected: also this marker was included in the recombinant screening.
(131)
(132) Phenotyping of the recombinants (as F3 families) for the 3 mapping populations was performed at 6 time points, starting 2 weeks after infection of 4 week old seedlings. The 6 time points were divided over 3 weeks with 3 to 4 day intervals. Differences between susceptible and resistant material started from time point 4, therefore time points 4, 5 and 6 were selected for further analysis. An overview of the phenotyping results at time points 4, 5 and 6 of a selection of recombinants is shown in
(133) Recombinant selection and phenotyping was also done on extended populations of IMC222, IMC223 and IMC243. This did not result in better positioning of the T041 locus, however, from all available recombinants a selection was made with recombinations between SNPs 6 and 5. From the F3 families of those recombinants homozygous recombinants were selected that are phenotyped as F4 families, resulting in more black and white phenotypic data than by phenotyping in F3 families and resulting in more precise localization of T041.
Example 11
Resequencing of 5 Resistant and 5 Susceptible Lines
(134) To increase the number of SNPs in the T041 region, as well as to identify SNPs in potential candidate genes, 10 Impatiens breeding lines were selected for re-sequencing, consisting of 5 T041 resistant (including IMS16-847 the breeding line used for generating the reference sequence) and 5 susceptible lines. The other resistant lines were: 1934 advanced breeding line, candidate genotype for the KMB population for gene validation; 2004 advanced breeding line, candidate genotype for the KMB population for gene validation; IM1819_T041-1-B3, parental line of mapping population IMC222; and IM1821_T041-1-B50, parental line of mapping population IMC243. The susceptible lines were: A8996G, IM15-313-1, J3453Q, M3804Q and Super Elfin, all breeding lines. Re-sequencing was done by Whole Genome Shotgun (WGS) sequencing of the 10 genotypes: one Paired-end WGS library of 550 bp insert size per genotype was generated and sequenced (2×125 nt) to at least 30× raw read coverage. IMS16-847 was sequenced to 68× coverage in 4 lanes of the Illumina HiSeq 2500, the other 9 lines were sequenced in 12 lanes to 39-70× coverage per line. A description of the analysis process and results are provided below. Results of the re-sequencing analysis were used in this project to detect in-gene variants separating the 5 resistant and the 5 susceptible genotypes in the T041 region.
(135) For the analysis Genalice version 2.4.14 (doi.org/10.1073/pnas.1713830114) was utilized for mapping of high quality reads and calling of high quality variants. The analysis included the following steps: 1) pre-processing raw sequencing data such as trimming adapters; 2) mapping of pre-processed reads against the Anthurium reference genome; 3) variant calling on the mapped data and annotation; and 4) post-processing raw variant data (such as QC filtering). These steps are explained in greater detail below.
(136) Read pre-processing: the reads were trimmed using minimum base quality PHRED score of 17, while allowing a maximum of 10 bases with missing quality scores. After trimming, reads of at least 75 nt and containing less than 5 undetermined nucleotides (Ns) were retained. Genome reference mapping: read pairs that passed the filtering were mapped against the Impatiens whole genome reference sequence IW.1.0 PSC. This reference with a total genome size of 1,631,493,185 bp consisted of 8 pseudo chromosomes and an additional Chr_0 containing the scaffolds that could not be integrated with the genetic map.
(137) Variant calling: The reads with a mapping quality score of at least 60 were used for variation detection. A total of 28,151,123 raw variants were mined using gaVariant. The raw variants were subsequently filtered on allele quality of >20, sample quality of >20 and minimum allele depth of 7×. In addition, SNPs identical in all samples were discarded. After high quality filtering, a total of 21.146.844 high quality variants were retained.
(138) TABLE-US-00015 TABLE 15 Annotated Variant Type Count Intergenic 14,429,852 Upstream 3,264,013 Downstream 3,140,578 Intragenic 7,412 Intron 1,350,071 Synonymous_Coding 267,240 Non_Synonymous_Start 105 Synonymous_Stop 614 Non_Synonymous_Coding 281,788 Codon_Insertion 3,639 Codon_Change_Plus_Codon_Insertion 2,173 Codon_Deletion 4,140 Codon_Change_Plus_Codon_Deletion 2,773 Start_Lost 802 Stop_Gained 9,461 Stop_Lost 1,409 Splice_Site_Donor 2,487 Splice_Site_Acceptor 2,356 Frame_Shift 16,360 Exon_Deleted 20
Example 12
Development of Additional in-Gene SNP Markers
(139) Integration of the genetic map of the T041 region showed that the physical region between SNP 8 and SNP 2 matched with scaffolds 10, 24 and 4, respectively (
(140) To get more resolution in the region between markers SNP1 and SNP6, the 1 Mb of sequence between SNP 6 and SNP 1 was used to develop new SNP markers (as KASPar assays). On the basis of the resequencing data, 25 in-gene SNPs were chosen separating the 5 Resistant and 5 Susceptible germplasm lines. In
(141) TABLE-US-00016 TABLE 16 SNP# IW Marker SNP Sequence (SNP in brackets) 18 IW_1_g13366_58113947 GACTTAGTTACCTTA[A/G]AAACTTCCTCTTCCT (SEQ ID NO: 16) 19 IW_1_g13376_58316783 KAAAATGATCAGAGA[T/G]AAATSTAGCGATAAT (SEQ ID NO: 17) 20 IW_1_g13367_58142564 TCATACCTAGTACTG[G/T]GTGTGATTCTTCTTC (SEQ ID NO: 18) 21 IW_1_g13377_58320042 TAGAACAGATGGATT[C/T]GCTCGTCTTTGTGAA (SEQ ID NO: 19) 22 IW_1_g13368_58148718 GCAACACCATGTCCA[C/T]CCTCCAAATCAAAAT (SEQ ID NO: 20) 23 IW_1_g13379_58386679 TCCGGATTCCCTTCA[A/G]ATTTCATCGGAAAGG (SEQ ID NO: 21) 24 IW_1_g13347_57733677 AACGCGAACCACAAC[A/C]CAATCACTTTTGTCA (SEQ ID NO: 22) 25 IW_1_g13371_58214530 TGGCTCAGCAAGGAT[T/C]TCCCAGGTTTCATTC (SEQ ID NO: 23) 26 IW_1_g13380_58404855 TGAAGTCGTTCAAAT[C/T]ACTACATTGGAAAGT (SEQ ID NO: 24) 27 IW_1_g13348_57734161 ATATCGTCGAGTCTC[C/T]AGTCCTCGGCCACTT (SEQ ID NO: 25) 28 IW_1_g13372_58228971 CACCAGATGTGAAAT[C/T]GGAGACAGTCTTGTA (SEQ ID NO: 26) 29 IW_1_g13381_58433526 GCATAAAGAGGCGCA[A/G]AGGCTTCAACTCTGA (SEQ ID NO: 27) 30 IW_1_g13354_58014378 CTGTGAATTCTTCCG[C/T]ATCTCCTTTAACGTT (SEQ ID NO: 28) 31 IW_1_g13373_58244823 GTGAGAGGAGGACCT[C/T]GAGGACGAAGGGAAA (SEQ ID NO: 29) 32 IW_1_g13382_58502163 TTAAGAACGAAGCAT[T/G]AGTAACATTCCTTAG (SEQ ID NO: 30) 33 IW_1_g13355_58015170 AATCGAGAAAGAGGG[C/T]GATCCGCAATCTCAA (SEQ ID NO: 31) 34 IW_1_g13374_58283963 CAATCTTAATAAGTT[T/C]ATGGCTTTTGAAACT (SEQ ID NO: 32) 35 IW_1_g13385_58522972 CACATTTCCATGATA[G/T]TAACATTCCTTAGTG (SEQ ID NO: 33) 36 IW_1_g13358_58031637 CAGAAGATGCAGCTC[C/G]AGAGAGAAAAGCTCC (SEQ ID NO: 34) 37 IW_1_g13375_58312087 GAATTTTTTTCTTTT[C/A]CATACGCTTTGGAAC (SEQ ID NO: 35) 38 IW_1_g13386_58553071 TTGACGCAAATCCAG[C/T]AATCCCGCCTTAATT (SEQ ID NO: 36) 39 IW_1_g13388_58567946 TTCCTTAGCCCTCCA[C/T]GCCRCCATGAAAAAA (SEQ ID NO: 37) 40 IW_1_g13389_58612395 TGGATGAATATCAAT[A/G]GAGTGCACAATTCCA (SEQ ID NO: 38) 41 IW_1_g13390_58614462 CTCTACTATACCCCG[T/G]ACCAGCACTAGCACC (SEQ ID NO: 39) 42 IW_1_g13391_58710615 TGGTACTCTGTTAGC[T/A]GCCTAAAACCRAAGA (SEQ ID NO: 40)
(142) SNPs were tested on the recombinants from populations IMC 222, 223, and 243. Out of the 25 KASPar assays tested, 14 yielded unambiguous genotypes that fit perfectly in the region between SNP 1 and SNP 6. The 14 new SNPs were almost co-segregating (as expected): only 2 recombinations within the region covered by the 14 SNPs were detected in recombinants, better specifying the earlier detected recombination between SNP 6 and 1 in those two individuals (individual 229-075 from population IMC222, and individual 231-123 from population IMC243;
(143) SNP were also tested for their diagnostic value in germplasm. Among the 25 new KASPar markers, 7 putative new diagnostic markers were identified. Among the 7 putative diagnostic markers, 3 SNP markers (SNP 20, 26 and 29) showed the best results having no contradictory results with the DM resistance phenotype like the best diagnostic markers so far, SNPs 5 and 4. SNPs 26, 29, 5 and 4 are all present in the sequence of scaffold 24, only SNP20 is present in the scaffold 10 sequence. All diagnostic SNPs are therefore present in the proposed location of the T041 gene. It was earlier found that, although tightly linked to the T041 locus in mapping populations, SNPs 6 and 1 are not diagnostic in germplasm due to detection of similar alleles in both susceptible and resistant germplasm. Results are shown in
(144) New diagnostic SNPs were also placed in the context of additional associated markers in the region, illustrating that all diagnostic markers are in the region bordered by 2 different germplasm lines: TIMS16-851 and TIMS16-224 that are together showing the maximal region to harbor the T041 gene, between marker 14 and 16090187_Impatience_SBG_372239_7. This implies that the maximal region on the basis of the germplasm analysis starts in scaffold 10 and ends in scaffold 24. Results are shown in
Example 13
Testing of SNP Markers in Breeding Germplasm
(145) SNP markers 14, 20, 26 and 29 were tested in breeding germplasm.
(146)
(147) TABLE-US-00017 TABLE 17 Sow nr PINTR Mother Mother PI Father Father Pinr IM-1934 IMS17-176 IM15 828 2 4 5 IM-2004 IMS17-428 7009 1 12 3 1 1 IM-2110 IM17-180 IMS16-722 IM16 338 3 IMS17-151 IM15 241 2 03 1 3 IM-2123 IM17-376 IMS16-663 IM16 329 1 IMS16-706 7009 1 12 3 1 IM-2139 IM16-442 IM15-302-1 IM15 005 IMS16-012 IM-2147 IM16-440 IM15-322-1 IM15 025 IMS16-012 IM15 241 2 06 IM-2267 IM16-847 IM15-336-1 IM15 039 IMS16-706 7009 1 12 3 1 IM-2179 IM17-343 IMS17-446 IM16 741 2 IMS16-706 7009 1 12 3 1 IM-2106 IM17-250 IMS16-663 IM16 329 1 IMS17-369 IM15 0 122 1 2 14 16
(148) Genotypes generated with the new markers are highly consistent with the genotypes generated with the earlier markers. SNP markers 3 and 26 generated identical genotypes, which are, however, not completely consistent with the other marker genotypes. Marker 29 generated some inconsistent scores in IM-2139 samples. On the basis of these results out of the new SNP markers, SNP 14 and 20 generate the most consistent results and have the same diagnostic value as SNP 5.
Example 14
Lead Discovery for the T041 Region
(149) The region between SNP 13 (position 55.528.477) and the end of scaffold 24 (position 62.161.464) was further investigated and genes with annotated SNPs over the panel of 10 germplasm lines were listed above in Example 11. The entire region contained 243 genes with SNPs and 186 SNPs contrasting resistant and susceptible lines. No evidence was found for the presence of NBS-LRR type of genes, however many other genes that may play a role in resistance, however from these it is currently difficult to make a selection for validation. The sequence between SNP 13 and the end of scaffold 24 was obtained using ONT (Oxford Nanopore Technologies) sequencing. This sequence proved to be highly repetitive.
(150) The use of the term “or” in the claims is used to mean “and/or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the present disclosure supports a definition that refers to only alternatives and to “and/or.” When not used in conjunction closed wording in the claims or specifically noted otherwise, the words “a” and “an” denote “one or more.”
(151) The terms “comprise,” “have,” and “include” are open-ended linking verbs. Any forms or tenses of one or more of these verbs, such as “comprises,” “comprising,” “has,” “having,” “includes,” and “including,” are also open-ended. For example, any method that “comprises,” “has” or “includes” one or more steps is not limited to possessing only those one or more steps and also covers other unlisted steps. Similarly, any cell that “comprises,” “has” or “includes” one or more traits is not limited to possessing only those one or more traits and covers other unlisted traits.
(152) All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this disclosure have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the present disclosure. More specifically, it will be apparent that certain agents that are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the present disclosure as defined by the appended claims.