Methods of treating androgen deprivation therapy resistant prostate cancer
11168134 · 2021-11-09
Assignee
- FONDAZIONE PER L'ISTITUTO ONCOLOGICO DI RICERCA (IOR) (Bellinzona, CH)
- The Institute Of Cancer Research: Royal Cancer Hospital (London, GB)
Inventors
Cpc classification
A61K39/3955
HUMAN NECESSITIES
C07K2317/76
CHEMISTRY; METALLURGY
C12Q2600/106
CHEMISTRY; METALLURGY
A61K31/506
HUMAN NECESSITIES
A61K31/4166
HUMAN NECESSITIES
International classification
A61K39/395
HUMAN NECESSITIES
A61K31/506
HUMAN NECESSITIES
A61K31/4166
HUMAN NECESSITIES
Abstract
The present invention provides a method of treatment of prostate cancer, comprising administering a therapeutically effective amount of an inhibitor of IL-23 and/or an inhibitor of IL-23R to a mammalian patient in need thereof. The prostate cancer may be castration resistant prostate cancer (CRPC). The inhibitor may, for example, be an anti-IL-23 antibody, such as risankizumab, guselkumab or tildrakizumab. The method of treatment may further comprise administration of androgen deprivation therapy, such as enzalutamide. Also provided is a method of predicting the development of resistance to androgen deprivation therapy (ADT) in a prostate cancer in a mammalian patient and a related screening method.
Claims
1. A method of reversing resistance to androgen deprivation therapy (ADT) in a prostate cancer, comprising: identifying a prostate cancer in a mammalian patient which prostate cancer has developed resistance to the anti-tumor effects of ADT; administering a therapeutically effective amount of an antibody or antibody fragment that binds the p19 subunit of IL-23 to the patient; and administering ADT to the patient, wherein said ADT comprises an antiandrogen therapy selected from the group consisting of enzalutamide, cyproterone acetate, flutamide, nilutamide, bicalutamide, abiraterone acetate, seviteronel, apalutamide, darolutamide, galeterone, leuprolide, goserelin, triptorelin, histrelin, degarelix, and orchiectomy surgery.
2. The method of claim 1, further comprising simultaneous, sequential or separate administration of an inhibitor of interleukin 8 receptor (CXCR2), an inhibitor of RAR-related orphan receptor gamma (RORγ) and/or an inhibitor of Signal transducer and activator of transcription 3 (STAT3) to said patient.
3. The method of claim 1, wherein the prostate cancer comprises castration resistant prostate cancer (CRPC).
4. The method of claim 1, wherein said antibody or antibody fragment is sufficient to sensitize the prostate cancer to the anti-tumor effects of said ADT.
5. The method of claim 1, wherein the antibody or antibody fragment is selected from the group consisting of: guselkumab, risankizumab, and tildrakizumab.
6. The method of claim 1, wherein the method comprises administration of simultaneous, sequential or separate administration of said antibody or antibody fragment and enzalutamide.
7. The method of claim 2, wherein the inhibitor of CXCR2 comprises AZD5069.
8. The method of claim 2, wherein said inhibitor of RORγ comprises an antibody or antibody fragment that selectively binds RORγ.
9. The method of claim 1, wherein administering the antibody or antibody fragment that binds the p19 subunit of IL-23 and the ADT to the patient is simultaneous, sequential, or separate.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
DETAILED DESCRIPTION OF THE INVENTION
(13) Aspects and embodiments of the present invention will now be discussed with reference to the accompanying figures. Further aspects and embodiments will be apparent to those skilled in the art. All documents mentioned in this text are incorporated herein by reference.
(14) In describing the present invention, the following terms will be employed, and are intended to be defined as indicated below.
(15) As used herein, the term “tissue” (for example in the context of “a control sample obtained from a cancer-free tissue”) may be given a broad interpretation, in particular, specifically including any one or more cells, a biopsy of a solid tissue, or a biological liquid (e.g. blood, plasma, cerebrospinal fluid, urine or faeces) that contains the protein or nucleic acid of interest. Nevertheless, in certain cases, “tissue” may be taken to mean an ensemble of similar cells from the same origin that together carry out a specific function.
(16) Antibody Molecule
(17) As used herein with reference to all aspects of the invention, the term “antibody” or “antibody molecule” includes any immunoglobulin whether natural or partly or wholly synthetically produced. The term “antibody” or “antibody molecule” includes monoclonal antibodies (mAb) and polyclonal antibodies (including polyclonal antisera). Antibodies may be intact or fragments derived from full antibodies (see below). Antibodies may be human antibodies, humanised antibodies or antibodies of non-human origin. “Monoclonal antibodies” are homogeneous, highly specific antibody populations directed against a single antigenic site or “determinant” of the target molecule. “Polyclonal antibodies” include heterogeneous antibody populations that are directed against different antigenic determinants of the target molecule. The term “antiserum” or “antisera” refers to blood serum containing antibodies obtained from immunized animals.
(18) It has been shown that fragments of a whole antibody can perform the function of binding antigens. Thus reference to antibody herein, and with reference to the methods, arrays and kits of the invention, covers a full antibody and also covers any polypeptide or protein comprising an antibody binding fragment. Examples of binding fragments are (i) the Fab fragment consisting of V.sub.L, V.sub.H, C.sub.L and C.sub.H1 domains; (ii) the Fd fragment consisting of the V.sub.H and C.sub.H1 domains; (iii) the Fv fragment consisting of the V.sub.L and V.sub.H domains of a single antibody; (iv) the dAb fragment which consists of a V.sub.H domain; (v) isolated CDR regions; (vi) F(ab′).sub.2 fragments, a bivalent fragment comprising two linked Fab fragments (vii) single chain Fv molecules (scFv), wherein a V.sub.H domain and a V.sub.L domain are linked by a peptide linker which allows the two domains to associate to form an antigen binding site; (viii) bispecific single chain Fv dimers (WO 93/11161) and (ix) “diabodies”, multivalent or multispecific fragments constructed by gene fusion (WO94/13804; 58). Fv, scFv or diabody molecules may be stabilised by the incorporation of disulphide bridges linking the VH and VL domains. Minibodies comprising a scFv joined to a CH3 domain may also be made.
(19) In relation to a an antibody molecule, the term “selectively binds” may be used herein to refer to the situation in which one member of a specific binding pair will not show any significant binding to molecules other than its specific binding partner(s). The term is also applicable where e.g. an antigen-binding site is specific for a particular epitope that is carried by a number of antigens, in which case the specific binding member carrying the antigen-binding site will be able to bind to the various antigens carrying the epitope.
(20) Pharmaceutical Compositions and Therapy
(21) The active agents disclosed herein for the treatment of cancer may be administered alone, but it is generally preferable to provide them in pharmaceutical compositions that additionally comprise with one or more pharmaceutically acceptable carriers, adjuvants, excipients, diluents, fillers, buffers, stabilisers, preservatives, lubricants, or other materials well known to those skilled in the art and optionally other therapeutic or prophylactic agents. Examples of components of pharmaceutical compositions are provided in Remington's Pharmaceutical Sciences, 20th Edition, 2000, pub. Lippincott, Williams & Wilkins.
(22) The term “pharmaceutically acceptable” as used herein includes compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgement, suitable for use in contact with the tissues of a subject (e.g. human) without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. Each carrier, excipient, etc. must also be “acceptable” in the sense of being compatible with the other ingredients of the formulation.
(23) The active agents disclosed herein for the treatment of cancer according to the present invention are preferably for administration to an individual in a “prophylactically effective amount” or a “therapeutically effective amount” (as the case may be, although prophylaxis may be considered therapy), this being sufficient to show benefit to the individual. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Prescription of treatment, e.g. decisions on dosage etc., is within the responsibility of general practitioners and other medical doctors, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington's Pharmaceutical Sciences, 20th Edition, 2000, Lippincott, Williams & Wilkins. A composition may be administered alone or in combination with other treatments, either simultaneously or sequentially, dependent upon the condition to be treated.
(24) The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. Such methods include the step of bringing the active compound into association with a carrier, which may constitute one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association the active compound with liquid carriers or finely divided solid carriers or both, and then if necessary shaping the product.
(25) The agents disclosed herein for the treatment of cancer may be administered to a subject by any convenient route of administration, whether systemically/peripherally or at the site of desired action, including but not limited to, oral (e.g. by ingestion); topical (including e.g. transdermal, intranasal, ocular, buccal, and sublingual); pulmonary (e.g. by inhalation or insufflation therapy using, e.g. an aerosol, e.g. through mouth or nose); rectal; vaginal; parenteral, for example, by injection, including subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcuticular, intraarticular, subarachnoid, and intrasternal; by implant of a depot, for example, subcutaneously or intramuscularly.
(26) Formulations suitable for oral administration (e.g., by ingestion) may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active compound; as a powder or granules; as a solution or suspension in an aqueous or non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion; as a bolus; as an electuary; or as a paste.
(27) Formulations suitable for parenteral administration (e.g., by injection, including cutaneous, subcutaneous, intramuscular, intravenous and intradermal), include aqueous and non-aqueous isotonic, pyrogen-free, sterile injection solutions which may contain anti-oxidants, buffers, preservatives, stabilisers, bacteriostats, and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents, and liposomes or other microparticulate systems which are designed to target the compound to blood components or one or more organs. Examples of suitable isotonic vehicles for use in such formulations include Sodium Chloride Injection, Ringer's Solution, or Lactated Ringer's Injection. Typically, the concentration of the active compound in the solution is from about 1 ng/ml to about 10 mg/ml, for example from about 10 ng/ml to about 1 mg/ml. The formulations may be presented in unit-dose or multi-dose sealed containers, for example, ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets. Formulations may be in the form of liposomes or other microparticulate systems which are designed to target the active compound to blood components or one or more organs.
(28) Compositions comprising agents disclosed herein for the treatment of cancer may be used in the methods described herein in combination with standard chemotherapeutic regimes or in conjunction with radiotherapy. Examples of other chemotherapeutic agents include Amsacrine (Amsidine), Bleomycin, Busulfan, Capecitabine (Xeloda), Carboplatin, Carmustine (BCNU), Chlorambucil (Leukeran), Cisplatin, Cladribine (Leustat), Clofarabine (Evoltra), Crisantaspase (Erwinase), Cyclophosphamide, Cytarabine (ARA-C), Dacarbazine (DTIC), Dactinomycin (Actinomycin D), Daunorubicin, Docetaxel (Taxotere), Doxorubicin, Epirubicin, Etoposide (Vepesid, VP-16), Fludarabine (Fludara), Fluorouracil (5-FU), Gemcitabine (Gemzar), Hydroxyurea (Hydroxycarbamide, Hydrea), Idarubicin (Zavedos). Ifosfamide (Mitoxana), Irinotecan (CPT-11, Campto), Leucovorin (folinic acid), Liposomal doxorubicin (Caelyx, Myocet), Liposomal daunorubicin (DaunoXome®) Lomustine, Melphalan, Mercaptopurine, Mesna, Methotrexate, Mitomycin, Mitoxantrone, Oxaliplatin (Eloxatin), Paclitaxel (Taxol), Pemetrexed (Alimta), Pentostatin (Nipent), Procarbazine, Raltitrexed (Tomudex®), Streptozocin (Zanosar®), Tegafur-uracil (Uftoral), Temozolomide (Temodal), Teniposide (Vumon), Thiotepa, Tioguanine (6-TG) (Lanvis), Topotecan (Hycamtin), Treosulfan, Vinblastine (Velbe), Vincristine (Oncovin), Vindesine (Eldisine) and Vinorelbine (Navelbine).
(29) Administration in vivo can be effected in one dose, continuously or intermittently (e.g., in divided doses at appropriate intervals) throughout the course of treatment. Methods of determining the most effective means and dosage of administration are well known to those of skill in the art and will vary with the formulation used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician.
(30) In general, a suitable dose of the active compound is in the range of about 100 mg to about 250 mg per kilogram body weight of the subject per day. Where the active compound is a salt, an ester, prodrug, or the like, the amount administered is calculated on the basis of the parent compound, and so the actual weight to be used is increased proportionately.
(31) In combination therapy envisaged by the present invention the two active agents (or compositions comprising them) may be administered at the same time or spaced apart in time and/or site of administration. In some cases, the time between administration of the first of the two active agents and administration of the second of the two active agents may be between 1 minute and 1 week, e.g., between 5 minutes and 1 day, or between 5-60 minutes. Repeat doses of the respective inhibitors may be the same or different.
(32) Generally, the dosing pattern of each of the two active agents will be dictated by the pharmacokinetics and pharmacodynamics of the respective agents in the subject to be treated. Thus, where one agent is metabolised or cleared more quickly than the other, it may require more frequent dosing in order to maintain effective combination therapy.
(33) Determining MDSC IL-23 Secretion and/or Expression in the Tumor Microenvironment or Blood/Plasma
(34) As described in detail in the Examples herein, the present inventors have found that IL-23 secreted by myeloid-derived suppressor cells (MDSCs) confer castration resistance to prostate cancer cells. In particular embodiments, determining protein expression and/or level (e.g. IL-23 protein) comprises one or more of: determining protein expression in a tumour sample or blood or plasma sample using immunohistochemistry, immunofluorescence, measuring protein levels in a cell lysate or blood/plasma extract by ELISA or Western blotting, and/or using a binding agent capable of specifically binding to the IL-23 or subunit thereof (e.g. the p19 subunit), or a fragment thereof.
(35) In certain cases, determining the expression of the gene of interest (e.g. the IL-23 gene) comprises extracting RNA from a sample of MDSCs in the tumor microenvironment and measuring expression by real time PCR and/or by using a probe capable of hybridising to RNA encoding the protein (e.g. IL-23), or a fragment thereof. Quantitative RT-PCR may employ primers having the sequences described in the Example, particularly the IL23p19 forward and reverse primers of SEQ ID NO: 13 and 14, respectively.
(36) “and/or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example “A and/or B” is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein.
(37) The features disclosed in the foregoing description, or in the following claims, or in the accompanying drawings, expressed in their specific forms or in terms of a means for performing the disclosed function, or a method or process for obtaining the disclosed results, as appropriate, may, separately, or in any combination of such features, be utilised for realising the invention in diverse forms thereof.
(38) While the invention has been described in conjunction with the exemplary embodiments described above, many equivalent modifications and variations will be apparent to those skilled in the art when given this disclosure. Accordingly, the exemplary embodiments of the invention set forth above are considered to be illustrative and not limiting. Various changes to the described embodiments may be made without departing from the spirit and scope of the invention. For the avoidance of any doubt, any theoretical explanations provided herein are provided for the purposes of improving the understanding of a reader. The inventors do not wish to be bound by any of these theoretical explanations.
(39) Any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.
(40) Throughout this specification, including the claims which follow, unless the context requires otherwise, the word “comprise” and “include”, and variations such as “comprises”, “comprising”, and “including” will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps. It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent “about,” it will be understood that the particular value forms another embodiment. The term “about” in relation to a numerical value is optional and means for example +/−10%.
(41) The following is presented by way of example and is not to be construed as a limitation to the scope of the claims.
EXAMPLES
Materials and Methods
Animals
(42) All mice were maintained under specific pathogen-free conditions in the IRB facility and experiments were performed according to state guidelines and approved by the local ethics committee. Male C57BL/6 or FVB mice 6-8 weeks of age were purchased from Jackson Laboratories (Envigo), and acclimated for at least a week before use. C57BL/6 IL-23p19KO (IL23ko) mice [20] were kindly provided by Prof. Federica Sallusto (IRB, Bellinzona). Pten.sup.pc−/− mice were generated and genotyped as previously described [17]. Female Pten.sup.loxP/loxP mice were crossed with male PB-Cre4 transgenic mice and genotyped for Cre using following primers: primer 1 (5′-AAAAGTTCCCCTGCTGATGATTTGT-3′) and primer 2 (5′-TGTTTTTGACCAATTAAAGTAGGCTGTG-3′) for PTEN.sup.loxP/loxP; primer 1 (5′ TGATGGACATGTTCAGGGATC 3′) and primer 2 (5′CAGCCACCAGCTTGCATGA 3′) for Probasin-CRE. Surgical castration was performed under anesthesia with isoflurane. Mice were monitored postoperatively for recovery from anesthesia and checked daily for 2 days postoperatively. Surgical skin clips were removed on postoperative day 5. Mice undergoing treatment were administered control vehicle or therapeutic doses of the appropriate agents. Any mouse suffering distress or greater than 15% weight loss during treatment was euthanized by CO.sub.2 asphyxiation. At the completion of study, mice were euthanized by CO2 asphyxiation and tissue was collected for histology, mRNA analysis, protein analysis, and single cell suspensions for flow cytometry. For allograft experiments, 2.5×10.sup.6 TRAMP-C1 cells, 2.5×10.sup.6 TRAMP-C1 IL23RKO, or 2×10.sup.6 MyC-CaP cells were injected subcutaneously into the flank of male respectively C57BL/6 or FVB mice. When tumors were approximately 100 mm.sup.3, mice were randomized to the treatment groups. Tumor growth was monitored daily by measuring the tumor size with caliper. The tumor volume was estimated by calculating R1*R2*R3*4/3π, where R1 and R2 are the longitudinal and lateral radii, and R3 is the thickness of tumor protruding from the surface of normal skin. Animals were sacrificed when the tumor reached approximately 600 mm.sup.3.
Treatments
(43) αCXCR2 (AZD5069; AstraZeneca) was administered with daily intraperitoneal injections at a final concentration of 100 mg/kg on a Monday through Friday schedule. Control animals received vehicle. Enzalutamide (APExBio) was administered daily by oral gavage with a dose of 30 mg/kg/day on a Monday through Friday schedule. Rat anti-IL23 antibody (100 ng per mouse; G23-8; IgG1, kappa; eBioscience) or rat IgG1 isotype control (eBioscience) were administered weekly via intraperitoneal injection.
Bone Marrow Reconstitution
(44) Bone marrow was flushed from the femors of male C57BL/6 or IL23p19ko mice under sterile conditions with RPMI 1640 using a 21-gauge needle. Mononuclear cells were filtered, collected and checked for viability using trypan blue. Before transplantation, bone marrow derived cells were depleted of CD3.sup.+ T cells, NK1.1.sup.+ NK cells and CD19.sup.+ B cells by magnetic bead separation (STEMCELL Technologies). Recipient C57BL/6 or Pten.sup.pc−/− mice were lethally irradiated (900 rad) and transplanted i.v. two hours after with 1×10.sup.7 viable bone marrow cells from either C57/BL6 or IL23p19ko mice.
Magnetic Resonance Imaging
(45) Magnetic Resonance Imaging (MRI) was performed on castrated-Pten.sup.pc−/− mice 0, 4, 8, 12 and 16 weeks after surgical castration or on CTX IL23wt and CTX IL23ko Pten.sup.pc−/− mice 4, 8, 12 and 16 weeks after surgical castration using a 7T preclinical magnetic resonance scanner (Bruker, BioSpec 70/30 USR, Paravision 5.1), equipped with 450/675 mT/m gradients (slew-rate: 3400-4500 T/m/s; rise-time 140 μs) and a mouse body volume coil. Mice were under general anesthesia by 1.5-2% isoflurane vaporized in 100% oxygen (flow: 1 L/min).
(46) Breathing and body temperature were monitored (SA Instruments, Inc., Stony Brook, N.Y., USA) and maintained around 30 breaths-per-minute and 37° C., respectively. MRI studies included a Rapid Acquisition with Relaxation Enhancement (RARE) High-Resolution T2-weighted (T2w) sequence with fat suppression acquired in the axial plane (TR=3800 ms, TE=45 ms, FOV=27 mm×18 mm, spatial resolution=0.094×0.087 mm/pixel, scan time=8 min, thickness 0.70 mm, 26 slices) and in the coronal plane (TR=3500 ms, TE=38 ms, FOV=33 mm×33 mm, spatial resolution=0.129×0.129 mm/pixel, scan time=5 min, thickness 0.60 mm, 20 slices). Images were analyzed using NIH software MIPAV (version 7.4.0). Circumference of the whole prostate was outlined on each RARE T2w axial slice containing identifiable prostate and the number of bounded pixels in each slice was computed and added to yield the prostate volume. Coronal T2w images were used for an accurate identification of the basal and apical limits of the prostate.
Differentiation of MDSCs in Vitro
(47) Murine MDSCs were differentiated in vitro as previously described [25]. Briefly, bone marrow precursors were flushed from the femors of C57/BL6 or IL23p19ko mice with RPMI 1640 medium. The cell pellet was resuspended (one femor in 10 ml) in RPMI 1640 containing 10% heat-inactivated FBS, and the cells were cultured in vitro in the presence of 40 ng/ml GM-CSF and 40 ng/ml IL-6. On day 4, the cells were washed and resuspended with RPMI 1640 containing 10% heat-inactivated Charcoal Stripped-FBS. The day after the cells were stimulated with PMA/ionomycin and after 4 hours the supernatant was collected and stored at −80° C. Analysis of soluble molecules was conducted with Mouse CytokineMAP B version 1.0 by Rules Based Medicine (Austin, Tex.).
(48) Human MDSCs were differentiated in vitro seeding 10.sup.6/ml bone marrow precursors in T25 flasks with RPMI 1640 containing 10% heat-inactivated FBS in the presence of 10 ng/ml GM-CSF and 10 ng/ml IL-6 for 7 days [26]. Complete medium was changed when required. After 7 days, the cells were analyzed by flow cytometry for CD11b, CD33, CD15, HLA-DR expression and when the population CD11b.sup.+, CD33.sup.+, CD15.sup.+, HLA-DR.sup.neg was higher than 80% the cells resuspended in RPMI 1640 containing 10% heat-inactivated Charcoal Stripped-FBS and after one day stimulated with PMA/ionomycin for 5 hours. The supernatant was then collected and stored at −80° C.
In Vitro Co-Culture Experiments
(49) Prostate cancer cell lines were starved in Charcoal Stripped FBS (CS-FBS) medium for 72 h and then cultured with RPMI 1640 containing 10% heat-inactivated FBS (normal medium) or kept in full androgen deprivation medium (RPMI 1640 containing 10% heat-inactivated Charcoal Stripped-FBS plus Enzalutamide 10 μM; F.A.D.). Then, the cells were stimulated with or without condition media obtained from activated BM-derived MDSCs, or recombinant IL23 (100 ng/ml; R&D System), with or without αRORγ (5 μM; SR2211; Calbiochem®). Then, the cells were analyzed for Crystal Violet assay or stained with Annexin V/7AAD or collected for RNA extraction.
(50) Analyses of IL23 and IL23R mRNA expression in clinical tumors HSPC RNA seq data for 550 patients was downloaded from the UCSC Cancer Browser (https://genome-cancer.ucsc.edu/proj/site/hgHeatmap/). mCRPC RNA seq data for 122 mCRPC patients was generated as part of SU2C effort [27]. The paired-end transcriptome sequencing reads were aligned to the human reference genome (GRCh37/hg19) using Tophat2 [28] (Tophat 2.1.0). Gene expression, as fragments per kilobase of exon per million fragments mapped (FPKM; normalized measure of gene expression), was calculated using Cufflinks [29]. MDSC marker (CD11b, CD33, CD14 and CD15) positive and negative was defined by the high quantiles and low quantiles RNA expression of each transcript and IL23/IL23R expression level in each biomarker groups were compared by student t test. In order to compare gene expression level between TCGA and SU2C with minimum experimental bias, we only included genes expressed in both TCGA and SU2C with median expression level (FPKM)>>0. The gene expression levels in each sample were quantile normalized, and IL23 expression levels in HSPC and CRPC were compared using t test.
Human Organoids
(51) Organoids were grown in 3D Matrigel® (cat.356231, Corning) under prostate epithelial conditions [30]. Cell viability was measured using 3D CellTiter-Glo® 3D reagent (cat.G9681, Promega) by quantifying metabolically active cells releasing ATP. Cell line-derived organoids were plated at a density of 2000 cells per well in 96-well optical plates (cat.3610, Corning) embedded in Matrigel® as hanging drops (5 μl per well). Cells were treated with recombinant IL23 (cat 300-01A, PeproTech) at 100 ng/ml or culture with Enzalutamide (10 uM) with or without recombinant IL23. The luminescence measurement was performed after 7 days in culture. Each IL23 condition was normalized for its experimental control.
Immune Tumor Microenvironment Characterization
(52) Tumors were disaggregated and digested in collagenase D and DNAse for 30 minutes at 37° C. to obtain single-cell suspension. For intracellular cytokine detection cells where stimulated for 5 hours with PMA/ionomycin. After neutralization of unspecific binding with αCD16/CD32 (clone 93), single-cell suspensions were stained with specific mAb (primary antibodies directly conjugated) to assess the phenotype. The antibodies used were: αCD45 (clone 30-F11); αLy-6G (clone 1A8); αLy6C (clone HK1.4), αCD11b (clone M1/70); αF4/80 (clone BM8), αCD206 (clone C068C2), αCD11c (clone N418), αB220 (clone RA3-6B2), αCD3 (clone 145-2C11), αCD8 (clone 53-6.7), αCD4 (clone GK1.5), αNK1.1 (clone PK136), αCD90.2 (clone 30-H12), αPDL1 (clone 10F.9G2), αEpCAM (clone G8.8), αIL17 (clone TC11-18H10.1), αIL23p19 (clone FC23CPG), αIL23R (clone 12B2B64). All the antibodies were purchased from eBioscience or Biolegend. Samples were acquired on a BD Fortessa flow cytometer (BD Biosciences). Data were analyzed using FlowJo software (TreeStar, Ashland, Oreg.).
Immunohistochemistry and Immunofluorescence
(53) For immunohistochemistry (IHC), tissues were fixed in 10% formalin (ThermoScientific, 5701) and embedded in paraffin in accordance with standard procedures. Preceding immunohistochemical staining, tumor sections (4 μm) were exposed to two washes with OTTIX plus solution (Diapath, X0076) and subsequent hydration with OTTIX shaper solution (Diapath, X0096) followed by deionized water. Antigen unmasking was performed by heating sections in the respective pH solutions based on the antibodies used at 98° C. for 20 minutes. Subsequently the sections were blocked for peroxidases and nonspecific binding of antibodies using 3% H2O2 (VWR chemicals, 23615.248) and Protein-Block solution (DAKO Agilent technologies, X0909) respectively for 10 mins each split by 0.5% PBST washing. H&E staining was performed according to standard procedures. Sections were stained for anti-Ki67 (Clone SP6; Lab Vision Corporation), anti-pSTAT3 (TYR705; clone D3A7; Cell Signaling), anti-CD3 (cod.A0452; DAKO). Images were obtained using objectives of 5×, 10×, 40× magnification and Pixel image of 1.12 μm and 0.28 μm respectively. All the quantifications have been done using the public online software ImmunoRatio (153.1.200.58:8080/iimunoratio/). For the immunofluorescence (IF) staining, tissue paraffin embedded sections were stained for 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI) (#70238421, Roche), anti-IL23 (ab45420; Abcam), anti-Ly6G (RB6-8C5; GeneTex). Confocal images were obtained with the Leica TCS SP5 confocal microscope using×10/1.25 oil.
In Vitro T Cell Suppression Assay
(54) In vitro suppression assays were carried out in RPMI/10% FCS in 96-well U-bottom plates (Corning, N.Y.). Naive splenocytes were labeled with 5 μM CFSE (Molecular Probes) and activated in vitro with anti-CD3 and anti-CD28 beads (Invitrogen) according to the manufacturer's instructions. Conditioned media of BM-MDSCs was added to the culture. After 3 days, the proliferation of CFSE-labelled CD8.sup.− T cells was analyzed by BDFortessa.
CRISPR-Cas9 Transfection
(55) TRAMP-C1 cells were grown in 75 cm.sup.2 flask to a 50-60% confluence in DMEM medium supplemented with 10% heat-inactivated FBS, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 2 mM L-glutamine. The transfection of the IL23R CRISPR/Cas9 KO plasmid (Santa Cruz Biotechnology) was performed using jetPRIME® transfection reagent according to the manufacturer's protocol at the 1:2 DNA/jetPRIME® ratio. 24 h after transfection, the GFP transduced cells were sorted to purity 99% and plated as single cell on 96-well plates. At day 7 after cell sorting the grown cell colonies were moved into 24-well plates for further expansion. The knock-down of IL23R gene in each cell colony was confirmed by Western blot.
NanoString
(56) The nCounter analysis system (NanoString Technologies, Seattle, Wash.) was used to screen for the expression of signature genes associated with cancer-inflammation pathway. Two specific probes (capture and reporter) for each gene of interest were employed. Briefly, 5 μl of RNA (the concentration is higher than 25 ng/μl) was hybridized with customized Reporter CodeSet and Capture ProbeSet as Mouse PanCancer Immune Profiling Panel including 700 selected genes (NanoString Technologies) according to the manufacturer's instructions for direct labeling of mRNAs of interest with molecular barcodes without the use of reverse transcription or amplification. Total RNA was quantified by NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, Del.) and RNA quality was assessed using Agilent 2100 bioanalyzer (Agilent Technologies, Santa Clara, Calif.). The hybridized samples were then recovered in the NanoString Prep Station and the mRNA molecules were counted with the NanoString nCounter. For analysis of expression, each sample profile was normalized to geometric mean of 20 housekeeping genes included in the panel.
Multiplex Immunofluorescence (IF) in Formalin Fixed Paraffin Embedded Human Tissue Section
(57) Multiplex immunofluorescence for CD15 (#M3631, Dako, clone Carb-3), CD33 (#ab11032, Abcam, clone 6C5/2), CD11b (#ab52477, Abcam, clone EP1345Y) and EpCAM Alexa Fluor® 647 conjugate (#5447S, Cell Signaling, clone VU1D9) was performed using 4 μm sections of formalin fixed paraffin embedded prostate tumor samples by sequential staining after antigen retrieval in CC1 (pH 8.5) (#950-224, Ventana) in water bath at 98° C. for 36 minutes. First, mouse monoclonal (IgG1) antibody anti-CD33 (1:100 dilution), mouse monoclonal (IgM) anti-CD15 (1:200 dilution) and rabbit monoclonal (IgG) antibody anti-CD11b (1:100 dilution) were incubated for one hour after blocking with 10% goat serum for 30 minutes. Primary antibodies were detected with goat anti-mouse IgG1 Alexa Fluor® 555-conjugated (Life Technologies, 1:200 dilution), goat anti-mouse IgM Alexa Fluor® 488-conjugated (Life Technologies, 1:200 dilution) and goat anti-rabbit IgG (H+L) Alexa Fluor® 700-conjugated (Life Technologies, 1:200 dilution) antibodies for 30 minutes. Next, tissue sections were treated with 5% mouse/rabbit normal serum for 30 minutes, followed by incubation with mouse monoclonal (IgG1) anti EpCAM antibody conjugated to Alexa Fluor® 647 (dilution, 1:200) for one hour. The samples were washed three times for 5 minutes with TBS-Tween 0.05% between incubations. Nuclei were counterstained with DAPI (#70238421, Roche) and tissue sections were mounted with ProLong Gold antifade reagent (#P36930, Molecular Probes). Slides were imaged with a multispectral fluorescence microscope (Vectra v2.0.8, PerkinElmer) under ×20 magnification.
(58) After staining, slides were scanned using the multi-spectral camera provided by Vectra®(Perkin Elmer) system. The number of images collected per case was dependent on tumor size (Min.=1, Max.=14, Average=5). Quantification of PMN-MDSC like cells (CD15.sup.+ CD33.sup.+ CD11b.sup.+) was performed using inForm v2.1.1 software (PerkinElmer) and the density of cells of interest are presented as number of cells per mm.sup.2. Tissue segmentation algorithm based on EpCAM positivity was used to separate tumor from adjacent stroma. The algorithm was trained to perform cell segmentation using counterstain based segmentation achieved with nuclear DAPI staining. Phenotype determination was based on positivity for CD15, CD33 and CD11b. Cells in tumor areas selected by the algorithm were then separated into bins as follows: CD15.sup.+ CD33.sup.+ CD11b.sup.+ were called PMN-MDSCs. All tissue segmentations, cell segmentation and phenotype determination maps were reviewed by a pathologist.
RNA Expression/Quantitative Real-Time PCR
(59) RNA isolation (TRIzol, Qiagen) and retro-transcription with SuperScriptIII (Invitrogen, 11752-250) were performed according to the manufacturer's instructions. Quantitative PCR (qPCR) reactions (Bio-Rad) were performed using KAPA SYBR FAST qPCR green (KK4605; Applied Biosystems) and the specific primers reported below. Primer sequences were obtained from PrimerBank (http://pga.mgh.harvard.edu/primerbank/index.html) or BIORAD. Each expression value was normalized by HPRT or GADPH level as reference.
(60) TABLE-US-00001 The primer sequences used were as follows: GranzymeB forward (SEQ ID NO: 1) 5′-CCACTCTCGACCCTACATGG-3′, reverse (SEQ ID NO: 2) 5′-GGCCCCCAAAGTGACATTTATT-3′; IFNγ forward (SEQ ID NO: 3) 5′-GCTCTGAGACAATGAACGCT-3′, reverse (SEQ ID NO: 4) 5′-AAAGAGATAATCTGGCTCT-3′; TNFα forward (SEQ ID NO: 5) 5′-CCTGTAGCCCACGTCGTAG-3′, reverse (SEQ ID NO: 6) 5′-GGGAGTAGACAAGGTACAACCC-3′; IL-10 forward (SEQ ID NO: 7) 5′-GCTCTTACTGACTGGCATGAG-3′, reverse (SEQ ID NO: 8) 5′-CGCAGCTCTAGGAGCATGTG-3′; TGFb forward, (SEQ ID NO: 9) 5f-CTCCCGTGGCTTCTAGTGC-3′; reverse, (SEQ ID NO: 10) 5′-GCCTTAGTTTGGACAGGATCTG-3′; GADPH forward, (SEQ ID NO: 11) 5′-AGGTCGGTGTGAACGGATTTG-3′; reverse, (SEQ ID NO: 12) 5′-TGTAGACCATGTAGTTGAGGT-3′; IL23p19 forward, (SEQ ID NO: 13) 5f-CCAGCAGCTCTCTCGGAATC-3′; reverse, (SEQ ID NO: 14) 5′-TCATATGTCCCGCTGGTGC-3′.
BIORAD primers used were: HPRTPrimePCR™ PreAmp for SYBR® Green Assay: Hprt, Mouse qMmuCID0005679; AR PrimePCR™ PreAmp for SYBR® Green Assay: Ar, Mouse BIORAD qMmuCID0005164; NKX3.1PrimePCR™ PreAmp for SYBR® Green Assay: Nkx3-1, Mouse qMmuCED0046482; PBSNPrimePCR™ PreAmp for SYBR® Green Assay: Pbsn, Mouse qMmuCID0017831; FKBPSPrimePCR™ PreAmp for SYBR® Green Assay: Fkbp5, Mouse qMmuCID0023283.
Western Blot Analyses and Protein Detection
(61) Tissue and cell lysates were prepared with RIPA buffer (1×PBS, 1% Nonidet P40, 0.5% sodium deoxycholate, 0.1% SDS and protease inhibitor cocktail; Roche). Total protein concentration was measured using BCA Protein Assay Kit (Cat: 23225; Pierce, Rockford). Equal amounts of proteins were separated by SDS-PAGE and Western blotted onto a 0.45 μm-nitrocellulose membrane. Membranes were blocked in 5% defatted milk or 5% BSA in Tris-buffered saline containing 0.1% Tween-20 (TBST), probed with diluted antibodies and incubated at 4° C. overnight. The following primary antibodies were utilized: rabbit polyclonal anti-HSP90 (1:1000 dilution, Cell Signaling), rabbit polyclonal anti-phospho-Stat3(Tyr705) (1:1000 dilution, Cell Signaling), rat monoclonal anti-RORγt (5:1000 dilution, clone AFKJS-9, eBioscence), rabbit polyclonal anti-IL23R (H-300) (1:1000 dilution, Santa Cruz). After washing in TBST, the membrane was incubated with secondary antibody conjugated with horseradish peroxidase (HRP) (dilution 1:5000, Cell Signaling). The protein bands were visualized using the ECL Western Blotting Substrate (Pierce).
Human Prostate Samples
(62) All patient samples consenting to the trial were men with metastatic CRPC. These patients had at diagnosis a median age of 63 years and a median PSA of 94.7. All patients had received between 1-5 lines of therapy in the castration resistant setting at the time samples were taken (including docetaxel, cabazitaxel, enzalutamide, abiraterone and Radium 223). Archival hormone-sensitive tissue samples were collected from prostatic needle biopsies, transurethral resections of the prostate or prostatectomies. CRPC samples were taken from the primary tumor or more commonly from metastases (bone, lymph node or viscera). All tissue blocks were re-sectioned and reviewed by a pathologist who confirmed adequacy of the material. PTEN protein expression was determined by immunohistochemistry with H-scores being graded by a pathologist.
Statistical Analysis and Reproducibility
(63) Data analyses used GraphPad Prism version 7. The data are presented as mean±standard error of the mean, individual values as scatter plot with column bar graphs and were analyzed using Student's t-tests (paired or unpaired according to the experimental setting) by a two-sided and, when indicated, followed by Wilcoxon posttest. One-way ANOVA was used to compare three or more groups in time point analyses. Differences were considered significant when P<0.05 and are indicated as NS, not significant, *P<0.05, **P<0.01, ***P<0.001. Non-parametric tests were applied when variables were not normally distributed using the SPSS statistical software. N values represent biological replicates. Survival curves were compared using the Log-rank test (Mantel-Cox). For statistical analyses of PMN-MDSCs in human tumor tissue a mixed effect negative binomial regression model was used including a per patient random intercept and adjusting for tumor area as an exposure variable (Coefficient: 1.12; 95% CI: 0.34 to 1.90; P=0.005). All the statistics and reproducibility are reported in the figure legend. For animal studies, sample size was defined on the basis of past experience with the models [12], to detect differences of 20% or greater between the groups (10% significance level and 80% power). For ethical reasons the minimum number of animals necessary to achieve the scientific objectives was used. Animals were allocated randomly to each treatment group. Different treatment groups were processed identically and animals in different treatment groups were exposed to the same environment.
Example 1—IL23 Secreted by Myeloid-Derived Suppressor Cells Confers Castration Resistance in Prostate Cancer
(64) Increased numbers of circulating and tumor-infiltrating MDSCs have been observed in patients affected by different tumors including prostate cancer [8,9]. MDSCs are known to support tumorigenesis by either suppressing the antitumor immune response or by promoting angiogenesis and senescence evasion 10-12. By analyzing a cohort of hormone-sensitive (HSPC) and castration resistant prostate cancer (CRPC) patients we found that Polymorphonuclear (PMN)-MDSCs (CD11b.sup.+ CD33.sup.+ CD15.sup.+ cells) [13] are enriched in the tumors of CRPC when compared to HSPC patients (
(65) To identify factors secreted by MDSCs, which may drive castration resistance, we performed a NanoString nCounter gene expression assay in Pten.sup.pc−/− tumors from sham and castrated mice. IL23 and one of the subunits of IL23 receptor (IL12Rβ1) were the most up-regulated genes in castrated tumors when compared to controls (
(66) We then checked the status of IL23 receptor (IL23R) in sham and castrated Pten.sup.pc−/− tumors and we found that IL23R levels increased in tumor cells upon castration. This finding was further validated in TRAMP-C1 cells cultured in androgen deprivation conditions in vitro (
(67) To functionally validate these findings, we cultured prostate tumor cells in the presence of C.M. of MDSCs from IL23 wild type (MDSCs.sup.IL23wt) or IL23 knockout mice (MDSCs.sup.IL23ko). While the C.M. of MDSCs.sup.IL23wt or treatment with recombinant IL23 promoted proliferation, survival and increased transcription of androgen receptor target genes in prostate tumor cells kept in F.A.D., the C.M. of MDSCs.sup.IL23ko was ineffective (
(68) To determine whether MDSCs-derived IL23 promotes the emergence of CRPCs in vivo, we reconstituted lethally irradiated sham-operated or castrated-Pten.sup.pc−/− mice with BM precursors from IL23.sup.wt or IL23.sup.ko mice (yielding Pten.sup.pc−/−; IL23.sup.wt mice and Pten.sup.pc−/−; IL23.sup.ko mice) (
(69) IL-23 has been previously shown to regulate the activation of STAT3/RORγ expression in naive CD4 T cells [18-20], and both STAT3 and RORγ are reported to impact AR signaling in prostate cancer [21,22]. We, therefore, evaluated whether IL23 secreted by MDSCs could regulate the STAT3/RORγ axis in prostate cancer by acting in a non-cell autonomous manner. Inactivation of IL23 in the myeloid compartment of castrated Pten.sup.pc−/− mice significantly decreased the overall tumor levels of pSTAT3 and RORγ in vivo (
(70) To evaluate the therapeutic relevance of our findings, we next assessed whether IL23 inhibition by antibody blockade could revert castration resistance in Pten.sup.pc−/− mice mimicking a clinical relevant setting [1]. Anti-IL23 blocking antibodies are currently used in the clinic for the treatment of autoimmune diseases [23] and are well tolerated even in patients treated for long period of time [24].
(71) Hence, we treated Pten.sup.pc−/− mice who have become resistant to surgical castration with a αIL23 in combination with enzalutamide (ENZA), the standard of care for patients insensitive to first line ADT1 (
(72) In conclusion, we have identified MDSC-derived IL23 as a novel driver of CRPC adding novel insights on the mechanism by which prostate tumor cells become insensitive to androgen deprivation. These data also add a new knowledge on the role played by MDSCs in cancer, describing a new unexpected function for this immune subset. Finally, our work proves through preclinical studies that inhibition of IL23 synergizes with the standard-of-care treatments for CRPC offering a solid basis for novel therapeutic drug combination strategies in the clinic for this commonest of male cancers (
(73) All references cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.
(74) The specific embodiments described herein are offered by way of example, not by way of limitation. Any sub-titles herein are included for convenience only, and are not to be construed as limiting the disclosure in any way.
REFERENCES
(75) [1] Watson, P. A., Arora, V. K. & Sawyers, C. L. Emerging mechanisms of resistance to androgen receptor inhibitors in prostate cancer. Nat Rev Cancer 15, 701-711, doi:10.1038/nrc4016 (2015).
(76) [2] Bianchini, D. et al. Antitumour activity of enzalutamide (MDV3100) in patients with metastatic castration-resistant prostate cancer (CRPC) pre-treated with docetaxel and abiraterone. Eur J Cancer 50, 78-84, doi:10.1016/j.ejca.2013.08.020 (2014).
(77) [3] Zhang, T. et al. Exploring the Clinical Benefit of Docetaxel or Enzalutamide After Disease Progression During Abiraterone Acetate and Prednisone Treatment in Men With Metastatic Castration-Resistant Prostate Cancer. Clin Genitourin Cancer 13, 392-399, doi:10.1016/j.clgc.2015.01.004 (2015).
(78) [4] Badrising, S. et al. Clinical activity and tolerability of enzalutamide (MDV3100) in patients with metastatic, castration-resistant prostate cancer who progress after docetaxel and abiraterone treatment. Cancer 120, 968-975, doi:10.1002/cncr.28518 (2014).
(79) [5] Noonan, K. L. et al. Clinical activity of abiraterone acetate in patients with metastatic castration-resistant prostate cancer progressing after enzalutamide. Ann Oncol 24, 1802-1807, doi:10.1093/annonc/mdt138 (2013).
(80) [6] Schrader, A. J. et al. Enzalutamide in castration-resistant prostate cancer patients progressing after docetaxel and abiraterone. Eur Urol 65, 30-36, doi:10.1016/j.eururo.2013.06.042 (2014).
(81) [7] Quail, D. F. & Joyce, J. A. Microenvironmental regulation of tumor progression and metastasis. Nat Med 19, 1423-1437, doi:10.1038/nm.3394 (2013).
(82) [8] Gabrilovich, D. I. & Nagaraj, S. Myeloid-derived suppressor cells as regulators of the immune system. Nat Rev Immunol 9, 162-174, doi:10.1038/nri2506 (2009).
(83) [9] Hossain, D. M. et al. TLR9-Targeted STAT3 Silencing Abrogates Immunosuppressive Activity of Myeloid-Derived Suppressor Cells from Prostate Cancer Patients. Clin Cancer Res 21, 3771-3782, doi:10.1158/1078-0432.CCR-14-3145 (2015).
(84) [10] Lu, X. et al. Effective combinatorial immunotherapy for castration-resistant prostate cancer. Nature 543, 728-732, doi:10.1038/nature21676 (2017).
(85) [11] Murdoch, C., Muthana, M., Coffelt, S. B. & Lewis, C. E. The role of myeloid cells in the promotion of tumour angiogenesis. Nat Rev Cancer 8, 618-631, doi:10.1038/nrc2444 (2008).
(86) [12] Di Mitri, D. et al. Tumour-infiltrating Gr-1+ myeloid cells antagonize senescence in cancer. Nature 515, 134-137, doi:10.1038/nature13638 (2014).
(87) [13] Bronte, V. et al. Recommendations for myeloid-derived suppressor cell nomenclature and characterization standards. Nat Commun 7, 12150, doi:10.1038/ncomms12150 (2016).
(88) [14] Lunardi, A. et al. A co-clinical approach identifies mechanisms and potential therapies for androgen deprivation resistance in prostate cancer. Nat Genet 45, 747-755, doi:10.1038/ng.2650 (2013).
(89) [15] Clinical Trial NCT03177187. https://clinicaltrials.gov/ct2/show/NCT03177187.
(90) [16] Lee, G. T. et al. Bone morphogenetic protein-6 induces castration resistance in prostate cancer cells through tumor infiltrating macrophages. Cancer Sci 104, 1027-1032, doi:10.1111/cas.12206 (2013).
(91) [17] Persson, T. et al. Expression of the neutrophil-activating CXC chemokine ENA-78/CXCL5 by human eosinophils. Clin Exp Allergy 33, 531-537 (2003).
(92) [18] Durant, L. et al. Diverse targets of the transcription factor STAT3 contribute to T cell pathogenicity and homeostasis. Immunity 32, 605-615, doi:10.1016/j.immuni.2010.05.003 (2010).
(93) [19] Kastelein, R. A., Hunter, C. A. & Cua, D. J. Discovery and biology of IL-23 and IL-27: related but functionally distinct regulators of inflammation. Annu Rev Immunol 25, 221-242, doi:10.1146/annurev.immunol.22.012703.104758 (2007).
(94) [20] Zhou, L. et al. IL-6 programs T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways. Nat Immunol 8, 967-974, doi:10.1038/ni1488 (2007).
(95) [21] Chen, T., Wang, L. H. & Farrar, W. L. Interleukin 6 activates androgen receptor-mediated gene expression through a signal transducer and activator of transcription 3-dependent pathway in LNCaP prostate cancer cells. Cancer Res 60, 2132-2135 (2000).
(96) [22] Wang, J. J. et al. ROR-gamma drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer (vol 22, pg 488, 2016). Nature Medicine 22, 692-692, doi:10.1038/nm0616-692b (2016).
(97) [23] Campa, M., Mansouri, B., Warren, R. & Menter, A. A Review of Biologic Therapies Targeting IL-23 and IL-17 for Use in Moderate-to-Severe Plaque Psoriasis. Dermatol Ther (Heidelb) 6, 1-12, doi:10.1007/s13555-015-0092-3 (2016).
(98) [24] Gordon, K. B. et al. A Phase 2 Trial of Guselkumab versus Adalimumab for Plaque Psoriasis. N Engl J Med 373, 136-144, doi:10.1056/NEJMoa1501646 (2015).
(99) [25] Marigo, I. et al. Tumor-induced tolerance and immune suppression depend on the C/EBPbeta transcription factor. Immunity 32, 790-802, doi:10.1016/j.immuni.2010.05.010 (2010).
(100) [26] Lechner, M. G., Liebertz, D. J. & Epstein, A. L. Characterization of cytokine-induced myeloid derived suppressor cells from normal human peripheral blood mononuclear cells. J Immunol 185, 2273-2284, doi:10.4049/jimmunol.1000901 (2010).
(101) [27] Robinson, D. et al. Integrative clinical genomics of advanced prostate cancer. Cell 161, 1215-1228, doi:10.1016/j.cell.2015.05.001 (2015).
(102) [28] Kim, D. et al. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol 14, R36, doi:10.1186/gb-2013-14-4-r36 (2013).
(103) [29] Trapnell, C. et al. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 7, 562-578, doi:10.1038/nprot.2012.016 (2012).
(104) [30] Drost, J. et al. Organoid culture systems for prostate epithelial and cancer tissue. Nat Protoc 11, 347-358, doi:10.1038/nprot.2016.006 (2016).