Protein P8 derived from lactic acid bacteria and its use as anti-cancer agent

Abstract

The present invention relates to a protein derived from lactic acid bacteria and a method for producing the same. The lactic acid bacteria-derived protein of the present invention is a purified protein isolated from lactic acid bacteria (Lactobacillus rhamnosus) having an excellent therapeutic effect against colorectal cancer. It has been demonstrated to have a remarkable effect against colorectal diseases, and thus is expected to be widely used as a natural protein therapeutic agent against colorectal diseases in the medical field.

Claims

1. A method of treating or alleviating colorectal cancer comprising: administering to a person in need of such treatment a therapeutically effective amount of a composition comprising a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 8, 9 and 10.

2. The method of claim 1, wherein the composition is in a form of a pharmaceutical composition.

3. The method of claim 1, wherein the composition is in a form of a food composition.

4. A method of treating or alleviating colorectal cancer comprising: administering to a person in need of such treatment a therapeutically effective amount of a composition comprising a transformant wherein the transformant is lactic acid bacteria comprising a vector constructed to express a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 8, 9, and 10.

5. The method of claim 4, wherein the lactic acid bacteria are Pediococcus pentosaceus.

6. The method of claim 4, wherein the composition is in a form of a pharmaceutical composition.

7. The method of claim 4, wherein the composition is in a form of a food composition.

8. The method of claim 4, wherein the peptide is one derived from lactic acid bacteria of Lactobacillus rhamnosus.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the results of separating a Lactobacillus rhamnosus cell lysate by size exclusion chromatography into a protein and a low molecular material according to one example of the present invention.

(2) FIGS. 2A, 2B, 2C, and 2D show the results of each step of a protein purification process for producing a P8 protein of the present invention according to one example of the present invention.

(3) FIG. 3 shows the results of amino acid sequencing of a P8 protein of the present invention according to one example of the present invention.

(4) FIG. 4 is a schematic view showing active site sequences shared between lactic acid bacteria-derived proteins having high amino acid sequence homology with a P8 protein of the present invention, according to one example of the present invention.

(5) FIG. 5 shows the results of examining the cell growth inhibitory effect of a P8 protein of the present invention after treating colorectal cancer cell lines (DLD-1 and HT-29) with the P8 protein according to one example of the present invention.

(6) FIG. 6 shows the results of examining the cell viability inhibitory effect of a P8 protein of the present invention after treating a colorectal cancer cell line (DLD-1) with the P8 protein according to one example of the present invention.

(7) FIG. 7 shows the results of examining the cytotoxicity of a P8 protein of the present invention after treating NIH3T3 cells with the P8 protein according to one example of the present invention.

(8) FIG. 8 shows the results of examining the cell migration inhibitory effect of a P8 protein of the present invention after treating a colorectal cancer cell line (DLD-1) with the P8 protein according to one example of the present invention.

(9) FIG. 9 shows the results of examining the cancer tissue growth inhibitory effect of a P8 protein of the present invention after treating colorectal cancer xenograft mouse models with the P8 protein according to one example of the present invention.

DETAILED DESCRIPTION

(10) Colorectal cancer DLD-1 cells were cultured in a 6-well plate at a density of 1.5×10.sup.6 cells/well, and a P8 protein of the present invention was added thereto at a concentration of 1 μg/ml or 10 μg/ml. Next, the cells were incubated for 24 to 48 hours, and then washed twice with phosphate buffered saline and treated with 1 ml of a LIVE/DEAD viability/cytotoxicity staining kit, followed by incubation for 20 to 40 minutes. By the staining, living cells were stained green, and dead cells were stained red. The cells were observed under a fluorescent microscope, and the degree of inhibition of viability thereof was analyzed. As a result, it was shown that when the colorectal cancer cells were treated with the P8 protein, the viability of the cells decreased compared to that of a negative control, and the viability of the colorectal cancer cells decreased as the concentration or time of treatment with the P8 protein increased.

MODE FOR INVENTION

(11) Hereinafter, the present invention will be described in further detail. It will be obvious to those skilled in the art that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Example 1: Isolation and Purification of Protein from Lactic Acid Bacteria

Example 1-1: Purification of Protein from Lactic Acid Bacteria

(12) The colorectal cancer line DLD-1 was treated with culture supernatants or cell lysates of various kinds of lactic acid bacteria, and the anticancer activities thereof were examined. Among them, a Lactobacillus rhamnosus (KCTC 12202BP) cell lysate showing the highest anticancer activity was selected.

(13) In order to purify an anticancer protein as an active ingredient from the Lactobacillus rhamnosus cell lysate, size exclusion chromatography (Sephadex G-25, desalting column, GE Healthcare) was performed using a FPLC (fast protein liquid chromatography) system (GE Healthcare), thereby isolating only the protein. A peak graph showing separation into the protein and a low molecular material is shown in FIG. 1.

(14) The fraction containing only the separated protein was dialyzed against 20 mM Tris buffer (pH8.0), and the protein not adsorbed on HiTrap DEAE FF (GE Healthcare) was collected, concentrated through a 3-KDa membrane, and then dialyzed again against 0.05 M phosphate (pH 6.0) solution, adsorbed on HiTrap DEAE SP (GE Healthcare), and then subjected to sequential separation according to the concentration gradient of 0.5 M sodium chloride. Colorectal cancer cells were treated with each of the separated fractions, and the anticancer activities of the fractions were analyzed. The fraction having the highest anticancer activity was concentrated and analyzed by SDS-PAGE, thereby isolating an 8-KDa protein which was named “P8 protein”. FIGS. 2 A, 2B, 2C, and 2D show the results of each step of the process for producing the P8 protein.

Example 1-2: Purification of Protein Derived from Lactic Acid Bacteria

(15) The P8 protein purified by the method of Example 1-1 was stained with Coomassie Blue-250, and then subjected to MALDI-TOF (Matrix Assisted Laser Desorption Ionization Time Of Flight) mass spectrometry, thereby obtaining the ID “unidentified protein LGG_02452 [Lactobacillus rhamnosus]”. The protein was transferred to a PVDF membrane and identified by N-terminal amino acid sequencing. As a result, it was found that the N-terminal amino acid sequence of the protein was A-T-V-D-P-E-K-T-L-F (SEQ ID NO: 11). The results are shown in FIG. 3.

(16) In addition, using the DNA sequence of the “unidentified protein LGG_02452” as a template, PCR was performed with the primers shown in Table 1 below, and sequencing was performed. As a result, the nucleotide sequence and amino acid sequence of the protein were identified as shown in Table 2 below.

(17) TABLE-US-00001 TABLE 1 Primer sequence of “unidentified protein LGG_ 02452” Forward (F) 5′- atggaggtaatcattatggcaac-3′ (SEQ ID NO: 12) Reverse (R) 5′- cttcttgagaaccttttctg-3′ (SEQ ID NO: 13)

(18) TABLE-US-00002 TABLE 2 Kind of sequence SEQ ID NO Sequence of “P8 protein” Nucleotide SEQ ID NO: gcaacagtagatcctgaaaagacattgtt sequence 1 tctcgatgaaccaatgaacaaggtatttg actggagcaacagcgaagcacctgtacgt gatgcgctgtgggattattacatggaaaa gaacagccgtgataccatcaagactgaag aagaaatgaaaccagtcctagacatgtcc gacgatgaggtcaaagccctagcagaaaa aggttctcaagaagta Amino acid SEQ ID NO: ATVDPEKTLFLDEPMNKVFDWSNSEAPVR sequence 2 DALWDYYMEKNSRDTIKTEEEMKPVLDMS DDEVKALAEKVLKK

Example 1-3: Identification of Active Site of Protein Derived from Lactic Acid Bacteria

(19) In order to trace the active site of the P8 protein purified in Example 1-1, lactic acid bacteria-derived proteins having sequences similar to that of the P8 protein were investigated, and the results are shown in Table 3 below. The sequences of three active sites determined by analyzing the sequence homology between the P8 protein and the proteins shown in Table 3 are shown in Table 4 below. FIG. 4 is a schematic view showing active site sequences shared between the lactic acid bacteria-derived proteins.

(20) TABLE-US-00003 TABLE 3 Sequences of “P8 protein” Lactic acid and similar proteins bacteria derived from species SEQ ID NO lactic acid bacteria Lactobacillus SEQ ID NO: ATVDPEKTLFLDEPMNKVFD rhamnosus 2 WSNSEAPVRDALWDYYMEKNSRDTI KTEEEMKPVLDMSDDEVKALAEKVL KK Lactobacillus SEQ ID NO: ADEIIKTALLDRHMKEAFDWSDSDMP acidophilus 3 VRDALWDYFMEKNGRDTMKTEEDML PFLKDSDEKIEAFVNENLKK Lactobacillus SEQ ID NO: ASVDPEKTLFLDEPMNKVFDWSDSEA paracasei 4 PVRDALWDYYMEKNSRDTIKTEEEM KPVLDMSDDEVKALAEKVLKK Lactobacillus SEQ ID NO: AAAVEMNSMLDEKMTDVFDWSDSK plantarum 5 LPVRDAIWNHFMDADSHDTDKTADE VAPYMSMDEAKLKSEVEKLLKA Pediococcus SEQ ID NO: ATTLKTELLDQKMTEVFDWSNDQTPL pentosaceus 6 RDAMWNHVMDDNGHDTMKTIAEAK KWENMNDAELKKTAEQMLK Lactobacillus SEQ ID NO: AVVEKTALLDEKMNEVFDWSDSKEP brevis 7 VRDALWNHFMESNGHNTDETEASMK EIDAKSDADVRSYVEDNLKK

(21) TABLE-US-00004 TABLE 4 SEQ ID Amino acid sequences of Size NO active sites Active 25 mer SEQ ID ATVDPEKTLFLDEPMNKVFDWSNSE site 1 NO: 8 Active  33 mer SEQ ID MNKVFDWSNSEAPVRDALWDYYMEKN site 2 NO: 9 SRDTIKT Active 47 mer SEQ ID APVRDALWDYYMEKNSRDTIKTEEEMK site 3 NO: 10 PVLDMSDDEVKALAEKVLKK

Example 1-4: Examination of Anticancer Effect of Active Site of Protein Derived from Lactic Acid Bacteria

(22) Colorectal cancer DLD-1 cells were cultured in a 96-well plate at a density of 1×10.sup.4 cells/well, and each of active sites 1 to 3 (SEQ ID NOs: 8 to 10) of Example 1-3 was added thereto at a concentration of 10 μg/ml. As a negative control, 0.1% PBS buffer used in protein purification was used. The cells were incubated for 24 hours, and then each well was treated with 100 of a cell survival rate measurement kit (Dojindo Cell count kit WST-8) and incubated for 2 hours. The absorbance of each well at 450 nm was measured using a microplate reader (Amersham, Biorad, USA, Japan), and based on the measured values, cell survival rates were calculated. As a result, it was shown that the cell growth of the colorectal cancer cell line DLD-1 in the test groups treated with active sites 1 to 3 was significantly inhibited compared to that of the negative control.

Example 2: In Vitro Evaluation of Anticancer Effect of Protein (P8 Protein) Derived from Lactic Acid Bacteria

Example 2-1: Analysis of Cell Survival Rate

(23) Each of the colorectal cancer cell line DLD-1 and the HT-29 cell line was cultured in a 96-well plate at a density of 1×10.sup.4 cells/well, and the P8 protein of Example 1 was added thereto at a concentration of 0.39 μl/ml to 100 μl/ml. As a negative control, 0.1% PBS buffer used in protein purification was used. The cells were incubated for 24 hours, and then each well was treated with 100 of a cell survival rate measurement kit (Dojindo Cell count kit WST-8) and incubated for 2 hours. The absorbance of each well at 450 nm was measured using a microplate reader (Amersham, Biorad, USA, Japan), and based on the measured values, cell survival rates were calculated. The results are shown in FIG. 5.

(24) As a result, it was shown that the P8 protein showed a cell growth inhibitory effect of about 20% against the colorectal cancer cell lines (DLD-1 and HT-29), indicating that it has an inhibitory effect on the growth of cancer cells.

Example 2-2: Evaluation of Anticancer Effect

(25) Colorectal cancer DLD-1 cells were cultured in a 6-well plate at a density of 1.5×10.sup.6 cells/well, and the P8 protein of Example 1 was added thereto at a concentration of 1 μg/ml or 10 μg/ml. Each well was incubated for 24 to 48 hours, and then washed twice with phosphate buffered saline and treated with 1 ml of a LIVE/DEAD viability/cytotoxicity staining kit, followed by incubation for 20 to 40 minutes. By the staining, live cells were stained green, and dead cells were stained red. The cells were observed under a fluorescent microscope, and the degree of inhibition of viability thereof was analyzed. The results of the analysis are shown in FIG. 6. As a result, it was shown that when the colorectal cancer cells were treated with the P8 protein, the viability of the cells decreased compared to that of the negative control, and the viability of the colorectal cancer cell lines decreased as the concentration or time of treatment with the P8 protein increased.

Example 2-3: Analysis of Cytotoxicity

(26) In order to examine whether the P8 protein of Example 1 is cytotoxic, a cytotoxicity assay was performed using the P8 protein, highly expressed in NIH3T3 cells (mouse embryonic fibroblast cells), and BSA (bovine serum albumin) as a positive control.

(27) First, NIH3T3 cells were cultured in a 96-well plate at a density of 1×10.sup.4 cells/well, and each of BSA and the highly expressed and purified P8 protein was added thereto at a concentration of 0.39 μg/ml to 100 μg/ml. Each well was incubated for 24 hours, and then treated with 100 of a cell survival rate measurement kit (Dojindo Cell count kit WST-8), followed by incubation for 2 hours. The absorbance of each well at 450 nm was measured using a microplate reader (Amersham, Biorad, USA, Japan), and based on the measured values, cell survival rates were calculated. The results are shown in FIG. 7.

(28) As a result, it was shown that the survival rate of the cells treated with the P8 protein did not significantly differ from that of the cells treated with BSA, indicating that the P8 protein itself is not cytotoxic.

Example 2-4: Evaluation of Inhibitory Effect on Migration of Colorectal Cancer Cells

(29) Colorectal cancer DLD-1 cells were treated daily with 1 μg/ml of the P8 protein of Example 1 for 1, 3 or 7 days, and then dispensed into each well of a 6-well plate.

(30) The dispensed DLD-1 cells were cultured overnight, and then the plate having the cells cultured thereon was scratched with a 200 μl tip. To remove suspended material resulting from the scratch, the plate was washed twice with PBS, and then additionally incubated for 24 hours. The results are shown in FIG. 8.

(31) As a result, it was shown that in the control group not treated with the P8 protein, the scratched portion was filled with the cells, whereas in the test group treated with the P8 protein, the rate at which the scratched portion was filled with the cells decreased. In particular, it was observed that the migration rate of the cells significantly decreased in proportion to the duration of time (1, 3 or 7 days) during which the cells were treated with the P8 protein. The results were statistically processed, and as a result, it was shown that the migration rate of the cells decreased by 15.7% for 1-day treatment with the P8 protein, 45.9% for 3-day treatment, and 58.3% for 7-day treatment, compared to the cell-filled area in the control group not treated with the P8 protein.

Example 3: In Vivo Evaluation of Anticancer Effect of Protein (P8 Protein) Derived from Lactic Acid Bacteria

Example 3-1: Construction of Colorectal Cancer Xenograft Models

(32) The human colorectal cancer cell line (DLD-1) was transplanted subcutaneously into nude mice, thereby constructing xenograft models. Using the xenograft models, the anticancer activity of the P8 protein of Example 1 was evaluated.

(33) First, for construction of colorectal cancer xenograft models, DLD-1 cells were transplanted subcutaneously into nude mice at a concentration of 1×10.sup.7 cells/100 μl. 10 to 15 Days after the transplantation, the transplanted state of the tumor cells was checked, and mice showing a stable transplanted state were continuously observed. Before tumor's central necrosis occurred, mice showing rapid tumor growth due to supply of sufficient blood were selected, and tumor tissues were collected therefrom. Of the collected tumor tissue, the outer portion in which rapid cell division mainly occurred was cut into a predetermined size (3×3×3 mm), thereby constructing a tumor fragment. Then, the tumor fragment was placed on the tip of a puncture needle (Trocar), and the anterior side of the left rear leg of each animal was incised about 4 mm. The prepared puncture needle was inserted through the incision such that the tip reached the interbody side on the rear side of the left front leg. The puncture needle was removed by lightly and quickly turning it at an angle of 360° such that the tumor fragment was located at a target point. The incised portion was sterilized. The position of the tumor fragment was determined by touching the skin with hand. Tumor growth was observed twice or more a week, and only mice showing a successfully transplanted state were selected and used in an experiment.

Example 3-2: Evaluation of Anticancer Effect

(34) The colorectal cancer xenograft models constructed according to the method of Example 3-1 were grouped as shown in Table 5 below, and were administered intraperitoneally with a drug twice a week for 4 weeks (a total of 8 times).

(35) TABLE-US-00005 TABLE 5 Group Drug administration G1 NC PBS G2 PC1 Anticancer agent: 5-fluorouracil_10 mg/Kg G3 PC2 Anticancer agent: oxaliplatin_4 mg/Kg G4 T1 P8 protein_1 mg/Kg G5 T2 P8 protein_5 mg/Kg G6 T3 P8 protein_10 mg/Kg

(36) During drug administration, the tumor size was measured using Vernier calipers once every two days. Based on the measured value, the tumor volume was calculated using the equation shown in Table 6 below. After a total of 8-times administration, the tumors were dissected and photographed. FIG. 9 shows a graph obtained by calculating the volume and a photograph of the tumors dissected from the mice.

(37) TABLE-US-00006 TABLE 6 Tumor volume {length of long axis × (length of short axis × length of short axis)}/2

(38) As a result, it was shown that cancer growth in the test groups treated with all the concentrations of the P8 protein was significantly inhibited compared to that in the negative control group and that when the P8 protein was used for treatment at a concentration of 10 mg/Kg or higher, it could exhibit cancer growth inhibitory effects superior to those of conventional anticancer agents.

INDUSTRIAL APPLICABILITY

(39) The present invention relates to a protein derived from lactic acid bacteria and a method for producing the same. The lactic acid bacteria-derived protein of the present invention is a purified protein isolated from lactic acid bacteria (Lactobacillus rhamnosus) having an excellent therapeutic effect against colorectal cancer. It has been demonstrated to have a remarkable effect against colorectal diseases, and thus is expected to be widely used as a natural protein therapeutic agent against colorectal diseases in the medical field.

(40) TABLE-US-00007 Sequence List Text SEQ ID NO: 1 (Lactobacillus rhamnosus, DNA) gcaacagtag atcctgaaaa gacattgttt ctcgatgaac caatgaacaa ggtatttgac tggagcaaca gcgaagcacc tgtacgtgat gcgctgtggg attattacat ggaaaagaac agccgtgata ccatcaagac tgaagaagaa atgaaaccag tcctagacat gtccgacgat gaggtcaaag ccctagcaga aaaggttctc aagaagtaa SEQ ID NO: 2 (Lactobacillus rhamnosus, PRT) Ala Thr Val Asp Pro Glu Lys Thr Leu Phe Leu Asp Glu Pro Met Asn Lys Val Phe Asp Trp Ser Asn Ser Glu Ala Pro Val Arg Asp Ala Leu Trp Asp Tyr Tyr Met Glu Lys Asn Ser Arg Asp Thr Ile Lys Thr Glu Glu Glu Met Lys Pro Val Leu Asp Met Ser Asp Asp Glu Val Lys Ala Leu Ala Glu Lys Val Leu Lys Lys SEQ ID NO: 3 (Lactobacillus acidophilus, PRT) Ala Asp Glu Ile Ile Lys Thr Ala Leu Leu Asp Arg His Met Lys Glu Ala Phe Asp Trp Ser Asp Ser Asp Met Pro Val Arg Asp Ala Leu Trp Asp Tyr Phe Met Glu Lys Asn Gly Glu Asp Met Leu Pro Phe Leu Arg Asp Thr Met Lys Thr Glu Lys Asp Ser Asp Glu Lys Ile Glu Ala Phe Val Asn Glu Asn Leu Lys Lys SEQ ID NO: 4 (Lactobacillus paracasei, PRT) Ala Ser Val Asp Pro Glu Lys Thr Leu Phe Leu Asp Glu Pro Met Asn Lys Val Phe Asp Trp Ser Asp Ser Glu Ala Pro Val Arg Asp Ala Leu Trp Asp Tyr Tyr Met Glu Lys Asn Ser Arg Asp Thr Ile Lys Thr Glu Glu Glu Met Lys Pro Val Leu Asp Met Ser Asp Asp Glu Val Lys Ala Leu Ala Glu Lys Val Leu Lys Lys SEQ ID NO: 5 (Lactobacillus plantarum, PRT) Ala Ala Ala Val Glu Met Asn Ser Met Leu Asp Glu Lys Met Thr Asp Val Phe Asp Trp Ser Asp Ser Lys Leu Pro Val Arg Asp Ala Ile Trp Asn His Phe Met Asp Ala Asp Ser His Asp Thr Asp Lys Thr Ala Asp Glu Val Ala Pro Tyr Met Ser Met Asp Glu Ala Lys Leu Lys Ser Glu Val Glu Lys Leu Leu Lys Ala SEQ ID NO: 6 (Pediococcus pentosaceus, PRT) Ala Thr Thr Leu Lys Thr Glu Leu Leu Asp Gln Lys Met Thr Glu Val Phe Asp Trp Ser Asn Asp Gln Thr Pro Leu Arg Asp Ala Met Trp Asn His Val Met Asp Asp Asn Gly His Asp Thr Met Lys Thr Ile Ala Glu Ala Lys Lys Trp Glu Asn Met Asn Asp Ala Glu Leu Lys Lys Thr Ala Glu Gln Met Leu Lys SEQ ID NO: 7 (Lactobacillus brevis, PRT) Ala Val Val Glu Lys Thr Ala Leu Leu Asp Glu Lys Met Asn Glu Val Phe Asp Trp Ser Asp Ser Lys Glu Pro Val Arg Asp Ala Leu Trp Asn His Phe Met Glu Ser Asn Gly His Asn Thr Asp Glu Thr Glu Ala Ser Met Lys Glu Ile Asp Ala Lys Ser Asp Ala Asp Val Arg Ser Tyr Val Glu Asp Asn Leu Lys Lys SEQ ID NO: 8 (Lactobacillus rhamnosus, PRT) Ala Thr Val Asp Pro Glu Lys Thr Leu Phe Leu Asp Glu Pro Met Asn Lys Val Phe Asp Trp Ser Asn Ser Glu SEQ ID NO: 9 (Lactobacillus rhamnosus, PRT) Met Asn Lys Val Phe Asp Trp Ser Asn Ser Glu Ala Pro Val Arg Asp Ala Leu Trp Asp Tyr Tyr Met Glu Lys Asn Ser Arg Asp Thr Ile Lys Thr SEQ ID NO: 10 (Lactobacillus rhamnosus, PRT) Ala Pro Val Arg Asp Ala Leu Trp Asp Tyr Tyr Met Glu Lys Asn Ser Arg Asp Thr Ile Lys Thr Glu Glu Glu Met Lys Pro Val Leu Met Ser Asp Asp Glu Val Lys Ala Leu Ala Glu Lys Val Leu Lys Lys

(41) This application contains references to amino acid sequences and/or nucleic acid sequences which have been submitted herewith as the sequence listing text file. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. § 1.52(e).

(42) This invention was made with Korean Government support under a grant No. S2367890 funded by the Ministry of Trade, Industry and Energy, under the supervision of the Republic of Korea Small and Medium Business Administration, from the WC300 project for developing drug-delivery probiotics for treatment of inveterate intestinal disease, study period was 2016 Feb. 1-2020 Dec. 31.