Recombinant microorganism having heterologous genes introduced thereto and method for producing useful material from formic acid and carbon dioxide using same microorganism
11214816 · 2022-01-04
Assignee
Inventors
Cpc classification
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Y206/01045
CHEMISTRY; METALLURGY
C12Y208/03015
CHEMISTRY; METALLURGY
C12Y105/01005
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C12Y603/04003
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a recombinant microorganism having heterologous genes introduced thereto and a method for producing a useful material from formic acid and carbon dioxide using the microorganism. The present invention provides a novel microorganism having a cyclic metabolic pathway introduced thereto through which C3 or higher carbon organic compounds can be synthesized from formic acid and carbon dioxide, whereby carbon dioxide rich in nature and formic acid that is of low toxicity and suitable for anabolic reaction in view of reaction kinetics and which can be easily and rapidly synthesized from carbon dioxide can be used to effectively synthesize the C3 organic compound pyruvic acid from which various high-value added compound can be synthesized.
Claims
1. A recombinant microorganism having improved assimilation from formic acid and carbon dioxide, obtained by introducing a gene encoding an enzyme involved in a formic acid assimilation pathway, wherein the microorganism is Escherichia coli capable of synthesizing a C3 or larger carbon compound under the formic acid assimilation pathway combined with a cyclic pathway for fixing carbon dioxide, wherein the gene encoding an enzyme involved in a formic acid assimilation pathway comprises: the gene encoding formate-tetrahydrofolate ligase comprising the nucleic acid molecule of SEQ ID NO: 7; the gene encoding methenyl tetrahydrofolate cyclohydrolase comprising the nucleic acid molecule of SEQ ID NO: 8; and the gene encoding methylene-tetrahydrofolate dehydrogenase comprising the nucleic acid of SEQ ID NO: 9 or SEQ ID NO: 19; and wherein the gene encoding an enzyme involved in the cyclic pathway for fixing carbon dioxide comprises one or more genes selected from: the gene encoding a serine-glyoxylate transaminase comprising the nucleic acid of SEQ ID NO: 6, SEQ ID NO: 13, SEQ ID NO: 16, or SEQ ID NO: 21; the gene encoding a malyl-CoA lyase comprising the nucleic acid of SEQ ID NO: 5, SEQ ID NO: 14, or SEQ ID NO: 15; and the gene encoding a malate-CoA ligase comprising the nucleic acid of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 11, or SEQ ID NO: 12.
2. The recombinant microorganism according to claim 1, wherein the gene encoding an enzyme involved in a cyclic pathway for fixing carbon dioxide further comprises: the gene encoding a succinyl-CoA:(S)-malate CoA-transferase comprising the nucleic acid of SEQ ID NO: 17 or SEQ ID NO: 18; the gene encoding a phosphoenolpyruvate carboxykinase comprising the nucleic acid of SEQ ID NO: 20; and/or the gene encoding hydroxypyruvate reductase comprising the nucleic acid of SEQ ID NO: 10.
3. The recombinant microorganism according to claim 1, wherein a gene encoding pyruvate formate lyase or a recombinant vector containing the gene is further introduced into or overexpressed in the recombinant microorganism.
4. The recombinant microorganism according to claim 3, wherein the gene encoding pyruvate formate lyase is the nucleic acid molecule of SEQ ID NO: 22.
5. The recombinant microorganism according to claim 3, wherein the gene is overexpressed by any one strong promoter selected from the group consisting of a trc promoter, a tac promoter, a T7 promoter, a lac promoter and a trp promoter.
6. The recombinant microorganism according to claim 1, wherein a glycine cleavage complex is enhanced, amplified or further introduced into the recombinant microorganism.
7. The recombinant microorganism according to claim 6, wherein the glycine cleavage complex is the nucleic acid molecule of SEQ ID NO: 63.
8. The recombinant microorganism according to claim 6, wherein the expression of the genes constituting the glycine cleavage complex is enhanced by introducing a plasmid containing the genes constituting the glycine cleavage complex, or substituting an intrinsic promoter of the gene with any one strong promoter selected from the group consisting of a trc promoter, a tac promoter, a T7 promoter, a lac promoter and a trp promoter.
9. The recombinant microorganism according to claim 6, wherein a gcvR gene is further deleted from the recombinant microorganism.
10. The recombinant microorganism according to claim 9, wherein the gcvR gene is the nucleic acid molecule of SEQ ID NO: 66.
11. The recombinant microorganism according to claim 1, wherein serine deaminase is enhanced, amplified or further introduced into the recombinant microorganism.
12. The recombinant microorganism according to claim 11, wherein the serine deaminase is the nucleic acid molecule of SEQ ID NO: 69.
13. The recombinant microorganism according to claim 1, wherein the recombinant microorganism is capable of biosynthesizing pyruvate, glycine and serine assimilated from formic acid and carbon dioxide.
14. A method for producing a useful compound having a C3 compound as an intermediate product comprising: (a) culturing the recombinant microorganism according to claim 1 with formic acid and carbon dioxide as a carbon source to produce a useful substance having a C3 compound as an intermediate product; and (b) recovering the resulting useful substance.
15. The method according to claim 14, wherein the C3 compound is pyruvate and the useful substance is selected from the group consisting of butanol, isobutanol, hexanol, heptanol, octanol, nonanol, decanol, tert-butanol, 1-pentanol, 2-pentanol, 3-pentanol, 2-methyl-1-butanol, 3-methyl-1-butanol, 2-methyl-2-butanol, putrescine, L-ornithine, arginine, polycyclic aromatic hydrocarbons (PAHs), polylactate, polylactate-co-glycolate, poly(2-hydroxyisovalerate-co-lactate), polyhydroxybutyrate (PHB), 4-hydroxybutyrate, biodiesel, gasoline, olefin, 5-aminovaleric acid, gamma-butyric acid, 3-hydroxypropionic acid, 3-aminopropionic acid, acrylic acid, 1,3-aminopropane, caprolactam, threonine, valine, isoleucine, fumaric acid, malic acid, succinic acid, ceramide, astaxanthin, silybin, lycopene, lutein, and retinol.
16. A method for producing a C3 compound comprising: (a) culturing the recombinant microorganism according to claim 1 with formic acid and carbon dioxide as a carbon source to produce a C3 compound; and (b) recovering the produced C3 compound.
Description
DESCRIPTION OF DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
(2) Reference will now be made in detail to the preferred embodiments of the present invention, examples of which are illustrated in the accompanying drawings. Wherever possible, the same reference numbers will be used throughout the drawings to refer to the same or like parts.
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
BEST MODE
(16) Unless defined otherwise, all technical and scientific terms used herein have the same meanings as appreciated by those skilled in the field to which the present invention pertains. In general, the nomenclature used herein is well-known in the art and is ordinarily used.
(17) The present inventors first experimentally identified a novel cyclic metabolic pathway capable of synthesizing compounds composed of three or more carbon atoms from formic acid and carbon dioxide. That is, the present inventors designed the cyclic metabolic pathways shown in
(18) Specifically, the present inventors constructed a novel cyclic metabolic pathway for assimilating formic acid and have identified that formic acid was assimilated through the metabolic pathway when the metabolic pathway was introduced into the host microorganism. In addition, the present inventors have found that the assimilation efficiency of formic acid was significantly increased when using some enzymes involved in the metabolic pathway introduced from exotic microorganisms (
(19) Therefore, in one aspect, the present invention is directed to a recombinant microorganism obtained by introducing a gene encoding an enzyme involved in a formic acid assimilation pathway or a recombinant vector containing the gene into a host microorganism having a central carbon assimilation pathway.
(20) In the present invention, the central carbon assimilation pathway is a cyclic pathway for fixing carbon dioxide in microorganisms. Genes, coenzymes and energy transfer substances involved in the central carbon assimilation pathway of E. coli are shown in
(21) In the present invention, the formic acid assimilation pathway can be combined with the central carbon assimilation pathway to synthesize a C3 or larger carbon compound. The host microorganism inherently possesses a central carbon assimilation pathway i); or has a central carbon assimilation pathway introduced externally ii).
(22) The enzyme involved in the formic acid assimilation pathway in the present invention may be a gene of any one selected from the group consisting of formate-tetrahydrofolate ligase, methenyl tetrahydrofolate cyclohydrolase and methylene-tetrahydrofolate dehydrogenase, but is not limited thereto.
(23) In the present invention, the genes may be derived from any one selected from the group consisting of Methylobacterium, Roseobacter, Rhodobacter, Chloroflexus, Acetobacterium, Mannheimia, Escherichia and Arabidopsis, but are not limited thereto.
(24) In the present invention, the gene encoding formate-tetrahydrofolate ligase may be a nucleic acid molecule represented by SEQ ID NO: 7, the gene encoding methenyl tetrahydrofolate cyclohydrolase may be a nucleic acid molecule represented by SEQ ID NO: 8, and the gene encoding methylene-tetrahydrofolate dehydrogenase may be a nucleic acid represented by SEQ ID NO: 9 or SEQ ID NO: 19, but is not limited thereto.
(25) Meanwhile, the present inventors have verified whether or not formic acid assimilated by the formic acid assimilation pathway was assimilated into glycolysis, which is one of the central carbon metabolic processes of the host microorganism. Also the present inventors have found that assimilation efficiency was improved when substituting a part of genes involved in the main carbon metabolism with heterologous genes (
(26) Accordingly, in another aspect, the present invention is directed to a recombinant microorganism that has an improvement in a central carbon assimilation pathway of a host microorganism.
(27) In the present invention, at least one enzyme involved in the central carbon assimilation pathway and selected from the group consisting of serine-glyoxylate aminotransferase, malyl-CoA lyase, malate-CoA ligase, succinyl-CoA:(S)-malate CoA-transferase, phosphoenolpyruvate carboxykinase, and hydroxypyruvate reductase may be substituted, further introduced or amplified but is not limited thereto.
(28) The substituted or further introduced enzymes may be enzymes derived from any one selected from the group consisting of Methylobacterium, Roseobacter, Rhodobacter, Chloroflexus, Acetobacterium, Mannheimia, Escherichia and Arabidopsis, but are not limited thereto.
(29) In the present invention, the enzyme involved in the central carbon assimilation pathway may be substituted with one of the following:
(30) i) a serine-glyoxylate transaminase encoded by a nucleic acid molecule selected from the group consisting of a nucleic acid molecule represented by SEQ ID NO: 6, a nucleic acid molecule represented by SEQ ID NO: 13, a nucleic acid molecule represented by SEQ ID NO: 16, and a nucleic acid molecule represented by SEQ ID NO: 21;
(31) ii) malyl-CoA lyase encoded by a nucleic acid molecule selected from the group consisting of a nucleic acid molecule represented by SEQ ID NO: 5, a nucleic acid molecule represented by SEQ ID NO: 14, and a nucleic acid molecule represented by SEQ ID NO: 15;
(32) iii) malate-CoA ligase encoded by a nucleic acid molecule selected from the group consisting of a nucleic acid molecule represented by SEQ ID NO: 3, a nucleic acid molecule represented by SEQ ID NO: 4, a nucleic acid molecule represented by SEQ ID NO: 11, and a nucleic acid molecule represented by SEQ ID NO: 12;
(33) iv) succinyl-CoA:(S)-malate CoA-transferase encoded by a nucleic acid molecule represented by SEQ ID NO: 17 or a nucleic acid molecule represented by SEQ ID NO: 18;
(34) v) phosphoenolpyruvate carboxykinase encoded by a nucleic acid molecule represented by SEQ ID NO: 20; and/or
(35) vi) hydroxypyruvate reductase encoded by a nucleic acid molecule of SEQ ID NO: 10, but is not limited thereto.
(36) In one embodiment of the present invention, regarding the enzyme, the enzyme involved in the central carbon assimilation pathway of the Escherichia genus shown in
(37) In the present invention, the genes may be transformed into a host microorganism in the form of a plasmid containing a synthetic operon (see
(38) Meanwhile, when the formic acid assimilation pathway is combined with the central carbon assimilation pathway of the host microorganism, carbon dioxide and formic acid are converted into acetyl-CoA. The present inventors have found that formic acid could be further assimilated to produce a C3 compound by further introducing a metabolic pathway based on pyruvate formate lyase (
(39) Thus, in another aspect, the present invention is directed to a recombinant microorganism having a C3 compound synthesis metabolic pathway, in which the formic acid assimilation pathway is combined with a central carbon assimilation pathway and a pyruvate formate lyase is further introduced thereto.
(40) In the present invention, the recombinant microorganism may be further introduced with a gene encoding pyruvate formate lyase or a recombinant vector containing the gene.
(41) In the present invention, the gene encoding pyruvate formate lyase may be a nucleic acid molecule represented by SEQ ID NO: 22, but is not limited thereto.
(42) Another type of central carbon assimilation pathway developed in the present invention is a pathway for fixing formic acid and carbon dioxide in microorganisms, and
(43) In the present invention, the formic acid and carbon dioxide assimilation pathways synthesize one molecule of glycine from carbon dioxide and formic acid, and synthesizes one molecule of serine from glycine and one molecule of formic acid. The synthesized serine is converted into pyruvate through serine deaminase and a C3 or longer compound can be synthesized from pyruvate. The host microorganism has the carbon assimilation capability by externally introducing the formic acid and carbon dioxide assimilation pathways.
(44) That is, the present invention verified that serine and glycine can be synthesized from formic acid and carbon dioxide via the formic acid and carbon dioxide assimilation pathways, and it was confirmed that assimilation efficiency is improved through the change of the gene expression intensity and the deletion of a specific gene in the host microorganism (
(45) In addition, the present invention verified that pyruvate can be synthesized from formic acid and carbon dioxide via the formic acid and carbon dioxide assimilation pathways, and it was confirmed that assimilation efficiency is improved through the change of the gene expression intensity and the deletion of a specific gene in the host microorganism (
(46) In the present invention, the genes could be transformed into a host microorganism in the form of a plasmid containing a synthetic operon (
(47) The results of transformation of the plasmid containing the synthetic operon into the host microorganism showed that the recombinant microorganism into which such a novel metabolic pathway was introduced exhibited considerably improved capability to synthesize glycine, serine and pyruvate from formic acid and carbon dioxide.
(48) Accordingly, in another aspect, the present invention is directed to a recombinant microorganism having a metabolic pathway for synthesizing a C3 compound wherein glycine, serine and pyruvate are synthesized from formic acid and carbon dioxide through the introduction of a novel metabolic pathway.
(49) The present invention relates to a recombinant microorganism having improved assimilation from formic acid and carbon dioxide through introduction of a gene encoding an enzyme involved in a formic acid assimilation pathway or a recombinant vector containing the gene into a host microorganism having a central carbon assimilation pathway. The enzyme is at least one selected from the group consisting of formate-tetrahydrofolate ligase, methenyl tetrahydrofolate cyclohydrolase, and methylene-tetrahydrofolate dehydrogenase.
(50) In the present invention, the gene encoding formate-tetrahydrofolate ligase is a nucleic acid molecule represented by SEQ. ID. NO: 7, the gene encoding methenyl tetrahydrofolate cyclohydrolase is a nucleic acid molecule represented by SEQ ID NO: 8, and the gene encoding methylene-tetrahydrofolate dehydrogenase is a nucleic acid molecule represented by SEQ ID NO: 9 or SEQ ID NO: 19, but the present invention is not limited thereto.
(51) In the present invention, a glycine cleavage complex may be enhanced, amplified or further introduced into the recombinant microorganism, and expression of the gene constituting the glycine cleavage complex may be reinforced by substituting an intrinsic promoter with any one strong promoter selected from the group consisting of a trc promoter, a tac promoter, a T7 promoter, a lac promoter and a trp promoter, or is overexpressed through a plasmid overexpression system. The glycine cleavage complex may be a nucleic acid molecule represented by SEQ ID NO: 63, but is not limited thereto.
(52) In one embodiment of the present invention, a recombinant microorganism that glycine cleavage complex is enhanced, amplified in or further introduced into is produced by overexpressing the glycine cleavage complex represented by SEQ ID NO: 63 through a plasmid overexpression system or substituting the intrinsic promoter located upstream of the gcvT gene of the glycine cleavage complex with a strong promoter {SEQ ID NO: 67 (NCBI information: NC_000913.3 Region 3049125-3050667 was substituted with SEQ ID NO: 68, and the changed sequence corresponds to the promoter}.
(53) In the present invention, the recombinant microorganism may be characterized in that the gcvR gene is deleted, and the gcvR gene may be a nucleic acid molecule represented by SEQ ID NO: 66, but the present invention is not limited thereto.
(54) In the present invention, serine diaminase may be enhanced, amplified or further introduced into the recombinant microorganism, and the serine deaminase may be a nucleic acid molecule represented by SEQ ID NO: 69, but the present invention is not limited thereto.
(55) In the present invention, the host microorganism may inherently possess a central carbon assimilation pathway i); or may have a central carbon assimilation pathway introduced externally ii).
(56) In the present invention, the genes may be derived from any one selected from the group consisting of the genera Methylobacterium, Roseobacter, Rhodobacter, Chloroflexus, Acetobacterium, Mannheimia, Escherichia and Arabidopsis, but the present invention is not limited thereto.
(57) In the present invention, the recombinant microorganism is capable of biosynthesizing pyruvate, glycine or serine assimilated from formic acid and carbon dioxide, but the present invention is not limited thereto.
(58) In the present invention, the recombinant microorganism may be selected from the group consisting of the genera Escherichia, Mannheimia, Rhodobacter and Methylobacterium, but the present invention is not limited thereto.
(59) The gene of the present invention may undergo variations in many ways in the coding region so long as the amino acid sequence of the protein expressed from the coding region is not changed, and may undergo variations or modifications so long as the expression of genes is not affected in a region excluding the coding region, and such varied or modified genes also fall within the scope of the present invention.
(60) Therefore, the present invention also includes a polynucleotide having a base sequence substantially identical to the gene as well as a fragment of the gene. The term “substantially identical polynucleotide” means a gene encoding an enzyme having the same function as that used in the present invention, regardless of the homology of the sequence. The term “fragment of the gene” also means a gene encoding an enzyme having the same function as that used in the present invention, regardless of the length of the fragment.
(61) In addition, the amino acid sequence of the protein, which is an expression product of the gene of the present invention, can be obtained from biological resources such as various microorganisms, so long as the titer and activity of the corresponding enzyme are not affected, and these biological resources also fall within the scope of the present invention.
(62) Thus, the present invention also includes polypeptides having amino acid sequences substantially identical to the protein, as well as fragments of the polypeptides. The term “substantially identical polypeptide” means a protein having the same function as that used in the present invention regardless of the homology of the amino acid sequence. The term “fragment of the polypeptide” also means a protein having the same function as that used in the present invention, regardless of the length of the fragment.
(63) As used herein, the term “vector” means a DNA product containing a DNA sequence operably linked to a regulation sequence capable of expressing DNA in a suitable host, and may be a plasmid, phage particle or a simple potential genome insert. Once the vector is transformed with an appropriate host, it may replicate and function independently of the genome of the host, or may often be integrated with the genome itself. Since the plasmid is the most commonly used type of vector, the terms “plasmid” and “vector” are sometimes used interchangeably throughout the specification of the present invention. For the purpose of the present invention, a plasmid vector is preferably used. A typical plasmid vector that can be used for this purpose includes (a) a replication origin to efficiently conduct replication so as to include several to several hundred plasmid vectors per host cell, (b) an antibiotic resistance gene to screen a host cell transformed with the plasmid vector and (C) a restriction enzyme cleavage site into which a foreign DNA fragment is inserted. Even if an appropriate restriction enzyme cleavage site is not present, the vector and foreign DNA can be easily ligated using a synthetic oligonucleotide adapter or a linker according to a conventional method. After ligation, the vector should be transformed into an appropriate host cell. Transformation can be easily carried out using a calcium chloride method or electroporation (Neumann, et al., EMBO J., 1: 841, 1982).
(64) Expression vectors well-known in the art can be used as vectors for enhancing or overexpressing genes according to the present invention.
(65) When a nucleotide sequence is aligned with another nucleotide sequence based on functional relation, it is “operably linked” thereto. This may be gene(s) and regulatory sequence(s) linked in such a way so as to enable gene expression when a suitable molecule (e.g., a transcriptional activator protein) is linked to the regulatory sequence(s). For example, DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide, when expressed as a pre-protein involved in the secretion of the polypeptide; and a promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence; or a ribosome-binding site is operably linked to a coding sequence when it affects the transcription of the sequence; or the ribosome-binding site is operably linked to a coding sequence when positioned to facilitate translation. Generally, “operably linked” means that the linked DNA sequence is in contact therewith, or a secretory leader is in contact therewith and is present in the reading frame. However, the enhancer need not be in contact. The linkage of these sequences is carried out by ligation (linkage) at convenient restriction enzyme sites. When no such site exists, a synthetic oligonucleotide adapter or a linker according to a conventional method is used. As is well known in the art, in order to increase the expression level of a transgene in a host cell, the gene should be operably linked to a transcriptional/translational expression regulation sequence that functions in a selected expression host. Preferably, the expression regulation sequence and the corresponding gene are included in one recombinant vector containing both a bacterial selection marker and a replication origin. When the host cell is a eukaryotic cell, the recombinant vector should further include a useful expression marker in the eukaryotic expression host.
(66) The host cell transformed with the recombinant vector described above constitutes another aspect of the present invention. As used herein, the term “transformation” means introducing DNA into a host and allowing the DNA to be replicable by an extrachromosomal factor or chromosomal integration.
(67) It should be understood that not all vectors function identically in expressing the DNA sequences of the present invention. Likewise, not all hosts function identically for the same expression system. However, those skilled in the art will be able to make appropriate selections from among a variety of vectors, expression regulation sequences and hosts without excessive burden of experimentation and without departing from the scope of the present invention. For example, selection of a vector should be carried out in consideration of a host because the vector should be replicated therein. The number of replications of the vector, the ability to control the number of replications, and the expression of other proteins encoded by the corresponding vector, such as the expression of antibiotic markers, should be also considered.
(68) In addition, the gene introduced in the present invention may be introduced into the genome of a host cell and exist as a chromosomal factor. It will be apparent to those skilled in the art that even insertion of the gene into the genome of the host cell has the same effect as introducing the recombinant vector into the host cell.
(69) Any host microorganism can be used as the host microorganism of the present invention without limitation and the host microorganism is preferably an Escherichia genus, Mannheimia genus, Rhodobacter genus or Methylobacterium genus microorganism.
(70) The present inventors have also developed a metabolic pathway for synthesizing a C3 compound by combining the above-mentioned cyclic metabolic pathway with the reverse reaction of pyruvate formate lyase, and identified that the metabolic pathway enables formic acid and carbon dioxide to be effectively fixed into a C3 compound.
(71) Therefore, in another aspect, the present invention is directed to a recombinant microorganism capable of producing a C3 compound, wherein a gene encoding pyruvate formate lyase or a recombinant vector containing the gene is further introduced into the recombinant microorganism.
(72) In the present invention, the pyruvate formate lyase has a forward reaction activity of decomposing pyruvate into formate and acetyl-CoA as well as a reverse reaction activity thereof, and has excellent reverse reaction activity, with the conversion number of reverse reaction of 280 per sec, and previous research has demonstrated that pyruvate can be synthesized through the reverse reaction of the enzyme (Zelcbuch et al., Biochemistry, 55:17, 2423-2426, 2016). The pyruvate formate lyase is inherently found in E. coli as a host microorganism, but, when depending on inherent expression, it is difficult to maintain the expression amount above a predetermined level, since the expression of the enzyme is regulated by culturing conditions. Therefore, in order to synthesize a stable C3 compound, in the present invention, the enzyme is further introduced based on the plasmid, or is controlled to be overexpressed using a strong promoter.
(73) In the present invention, the gene encoding pyruvate formate lyase may be a nucleic acid molecule represented by SEQ ID NO: 22.
(74) In the present invention, the gene may be overexpressed by any one strong promoter selected from the group consisting of a trc promoter, a tac promoter, a T7 promoter, a lac promoter, a BBa23100 synthetic promoter and a trp promoter.
(75) In another aspect, the present invention is directed to a method for producing a useful substance having a C3 compound as an intermediate product using the recombinant microorganism.
(76) The method for producing the useful substance according to the present invention includes: (a) culturing the recombinant microorganism with formic acid and carbon dioxide as a carbon source to produce a useful substance having a C3 compound as an intermediate product; and (b) recovering the resulting useful substance. In the present invention, the C3 compound may be pyruvate. Examples of the useful substance include alcohols, amino acids, organic acids, alkenes and polymeric monomers. More specifically, the C3 compound includes, but is not limited to, straight or branched alcohols having 3 or more carbon atoms, isobutanol, propanol, hexanol, heptanol, octanol, nonanol, decanol, tert-butanol, 1-pentanol, 2-pentanol, 3-pentanol, 2-methyl-1-butanol, 3-methyl-1-butanol, 2-methyl-2-butanol, putrescine, L-ornithine, arginine, polycyclic aromatic hydrocarbons (PAHs), polylactate, polylactate-co-glycolate, poly(2-hydroxyisovalerate-co-lactate), polyhydroxybutyrate (PHB), 4-hydroxybutyrate, biodiesel, gasoline, olefin, 5-aminovaleric acid, gamma-butyric acid, 3-hydroxypropionic acid, 3-aminopropionic acid, acrylic acid, 1,3-diaminopropane, caprolactam, threonine, valine, isoleucine, fumaric acid, malic acid, succinic acid, ceramide, astaxanthin, silybin, lycopene, lutein, retinol and the like. Pyruvate is an intermediate which is formed during the decomposition process of biomass including glycolipid and wood through glycolysis in most microorganism genera including the genus Escherichia. Pyruvate is a substance that is in center of carbon rearrangement reactions through native metabolic pathways in microorganisms and thus can be converted into all useful substances reported to be capable of being produced in microorganisms through the native metabolic pathways of microorganisms or additional metabolic pathways introduced from the outside, which will be apparent to those skilled in the art. Accordingly, the present invention includes all substances that can be synthesized using pyruvate produced by the recombinant microorganism according to the present invention.
(77) In another aspect, the present invention is directed to a method for producing a C3 compound using the recombinant microorganism.
(78) The method according to the present invention includes: (a) culturing the recombinant microorganism in formic acid and carbon dioxide as a carbon source to produce a C3 compound; and (b) recovering the produced C3 compound, wherein the C3 compound is pyruvate, serine or glycine, but is not limited thereto.
(79) Hereinafter, the present invention will be described in more detail with reference to the following examples. However, it will be obvious to those skilled in the art that the following examples are provided only for illustration of the present invention and should not be construed as limiting the scope of the present invention.
Example 1: Production of Recombinant Plasmid for Introduction of Foreign Genes and Production of Recombinant E. coli
(80) In order to construct a formic acid and carbon dioxide assimilation pathway and to synthesize a C3 compound with high efficiency, necessary genes were introduced into Escherichia coli, which is a target microorganism, using a recombinant plasmid. The plasmid used for construction of the assimilation pathway was a p10099A plasmid including an Ampicillin resistance gene, a pBR322 replication origin, and the synthetic promoter BBa 23100. PCR was conducted using the plasmid as a template and the primers of SEQ ID NO: 1 and SEQ ID NO: 2, and the amplified gene fragment was then recovered and purified to prepare a gene fragment used as a plasmid backbone for the production of the recombinant plasmid.
(81) TABLE-US-00001 [SEQ ID NO: 1]: 5′-ACTGATAAGCCTTTCGGTAAGGTACCCGGGGATCCTCTAG-3′ [SEQ ID NO: 2]: 5′-TCGTGTAAGTGTCTCAACAAGAGCTCGAATTCGCTAGCAC-3
(82) The foreign gene fragments required for plasmid production were prepared by conducting PCR using the genomic DNA of microorganisms having the corresponding gene as a template and using a primer designed for amplification of the gene, and then collecting and purifying the amplified gene fragment, and the corresponding genes and primer sequences are shown in Tables 1 and 2 below.
(83) TABLE-US-00002 TABLE 1 NCBI information of foreign genes to be amplified and derived microorganisms Target gene NCBI information Derived microorganism mtkA Malate-CoA ligase β-subunit Methylobacterium extorquens CP001298 REGION: 2233122-2234294 CM4 [SEQ ID NO: 3] mtkB Malate-CoA ligase α-subunit Methylobacterium extorquens CP001298 REGION: 2234317-2235207 CM4 [SEQ ID NO: 4] mcl Malyl-CoA lyase Methylobacterium extorquens CP001298 REGION: 2238448-2239422 CM4 [SEQ ID NO: 5] sga Serine-glyoxylate aminotransferase Methylobacterium extorquens CP001298 REGION: 2228409-2229617 CM4 [SEQ ID NO: 6] ftfL Formate-tetrahydrofolate ligase Methylobacterium extorquens CP001298 REGION: 434499-436172 CM4 [SEQ ID NO: 7] fch Methenyl tetrahydrofolate cyclohydrolase Methylobacterium extorquens CP001298 REGION: 2231946-2232572 CM4 [SEQ ID NO: 8] mtdA Methylene-tetrahydrofolate dehydrogenase Methylobacterium extorquens CP001298 REGION: 2230986-2231852 CM4 [SEQ ID NO: 9] hprA Hydroxypyruvate reductase Methylobacterium extorquens CP001298 REGION: 2229898-2230842 CM4 [SEQ ID NO: 10] mtkAB1 Malate-CoA ligase1 Roseobacter denitrificans CP000362 REGION: 1122758-1124841 OCh 114 [SEQ ID NO: 11] mtkAB2 Malate-Co A ligase2 Roseobacter denitrificans CP000362 REGION: 4121281-4123370 OCh 114 [SEQ ID NO: 12] sga Serine-glyoxylate aminotransferase Roseobacter denitrificans CP000362 REGION: 1677707-1678939 OCh 114 [SEQ ID NO: 13] mcl1 Malyl-CoA lyase1 Rhodobacter sphaeroides CP000577 REGION: 2779302-2780159 ATCC 17029 [SEQ ID NO: 14] mcl2 Malyl-CoA lyase2 Rhodobacter sphaeroides CP000577 REGION: 432306-433262 ATCC 17029 [SEQ ID NO: 15] sga Serine-glyoxylate aminotransferase Rhodobacter sphaeroides CP000577 REGION: 2000551-2001753 ATCC 17029 [SEQ ID NO: 16] smtA Succinyl-CoA: (S)-malate Chloroflexus aurantiacus CoA-transferase J-10-fl CP000909 REGION: 224515-225801 [SEQ ID NO: 17] smtB Succinyl-CoA: (S)-malate CoA-transferase Chloroflexus aurantiacus CP000909 REGION: 223035-224252 J-10-fl [SEQ ID NO: 18] folD Methenylene-tetrahydrofolate Acetobacterium woodii dehydrogenase CP002987 REGION: 1083442-1084347 KCTC 1655 [SEQ ID NO: 19] pckA Phosphoenolpyruvate carboxykinase Mannheimia succiniciproducens AE016827 REGION: 2222647-2224263 MBEL55E [SEQ ID NO: 20] sga Serine-glyoxylate aminotransferase Arabidopsis thaliana AB048945 REGION: 60-1265 [SEQ ID NO: 21] pfl Pyruvate formate lyase Escherichia. Coli. NCBI GeneID: 945514 [SEQ ID NO: 22]
(84) TABLE-US-00003 TABLE 2 Primer sequences used for amplification of foreign gene fragments Target gene Primer sequence mtkA [SEQ ID NO: 23]: 5′-TTGTTGAGACACTTACACGA [SEQ ID AGGAGGAATTCATGGACGTTCACGAGTACCAAG-3′ NO: 3] [SEQ ID NO: 24]: 5′-TCAGTGCTTGGCGCCGTGGC-3′ mtkB [SEQ ID NO: 25]: 5′-TGCCACGGCGCCAAGCACTGA [SEQ ID AGGAGGAATTCATGAGCATTCTCATCGACG-3′ NO: 4] [SEQ ID NO: 26]: 5′-TCACGCCGCGCGGGCGAG-3′ mcl [SEQ ID NO: 27]: 5′-CTCGCCCGCGCGGCGTGA [SEQ ID AGGAGGAATTCATGAGCTTCACCCTGATCCA G-3′ NO: 5] [SEQ ID NO: 28]: 5′-TTACTTTCCGCCCATCGCG-3′ sga [SEQ ID NO: 29]: 5′-CGCGATGGGCGGAAAGTAA [SEQ ID AGGAGGAATTCATGGCGGCAACGAGACGTCC-3′ NO: 6] [SEQ ID NO: 30]: 5′-TCAAGCCTTGGCGAGCGGG-3′ ftfL [SEQ ID NO: 31]: 5′-CCCGCTCGCCAAGGCTTGA [SEQ ID AGGAGGAATTCATGCCCTCAGATATCGAGATC-3′ NO: 7] [SEQ ID NO: 32]: 5′-CTAGAACAGCCCGTCGATC-3′ fch [SEQ ID NO: 33]: 5′-GATCGACGGGCTGTTCTAG [SEQ ID AGGAGGAATTCATGGCCGGCAACGAGACGATC-3′ NO: 8] [SEQ ID NO: 34]: 5′-TCAGTTTACCTTGGACTTCAC- 3′ mtdA [SEQ ID NO: 35]: 5′-GTGAAGTCCAAGGTAAACTGA [SEQ ID AGGAGGAATTCATGTCCAAGAAGCTGCTCTTC-3′ NO: 9] [SEQ ID NO: 36]: 5′-TCATCCGCCAAAACAGCCAAG TCAGGCCATTTCCTTGGCC-3′ hprA [SEQ ID NO: 37]: 5′-TTGTTGAGACACTTACACGA [SEQ ID AGGAGGAATTCATGACAAAGAAAGTCGTCTTC-3′ NO: 10] [SEQ ID NO: 38]: 5′-TCATCCGCCAAAACAGCCAA GTTACGCCTCGACGACGTTCTG-3′ mtkAB1 [SEQ ID NO: 39]: 5′-TTGTTGAGACACTTACACGA [SEQ ID AGGAGGAATTCATGGATATCCACGAATACCAAG-3′ NO: 11] [SEQ ID NO: 40]: 5′-TCATGCGGCCTCCTTCCTCA G-3′ mtkAB2 [SEQ ID NO: 41]: 5′-TTGTTGAGACACTTACACGA [SEQ ID AGGAGGAATTCATGGATATCCATGAATACCAAG-3′ NO: 12] [SEQ ID NO: 42]: 5′-TCACGCGGCCTCCATCACTT TG-3′ sga [SEQ ID NO: 43]: 5′-TTGTTGAGACACTTACACGA [SEQ ID AGGAGGAATTCATGACCCAAAAAAGCAACCTG-3′ NO. 13] [SEQ ID NO: 44]: 5′-TCATCCGCCAAAACAGCCAA GCTACTCCGACGCCCCCGCCG-3′ mcl1 [SEQ ID NO: 45]: 5′-TTGTTGAGACACTTACACGA [SEQ ID AGGAGGAATTCATGGCGCATCAGGCTCATCC-3′ NO: 14] [SEQ ID NO: 46]: 5′-TCAGCTTGCCCTGAACGCGG-3′ mcl2 [SEQ ID NO: 47]: 5′-CCGCGTTCAGGGCAAGCTGA [SEQ ID AGGAGGAATTCATGAGCTTCCGCCTTCAGCC-3′ NO: 15] [SEQ ID NO: 48]: 5′-TCAGGCCGAGATCATTTCTG-3′ sga [SEQ ID NO: 49]: 5′-TTGTTGAGACACTTACACGA [SEQ ID AGGAGGAATTCATGTCGCTTGCGCACGGCCG-3′ NO: 16] [SEQ ID NO: 50]: 5′-TCATCCGCCAAAACAGCCAA GTCAGGCCGCCGCGCCGAGGC-3′ smtA [SEQ ID NO: 51]: 5′-TTGTTGAGACACTTACACGA-3′ [SEQ ID [SEQ ID NO: 52]: 5′-CTAGATAATCTTACGGCTGC-3′ NO: 17] smtB [SEQ ID NO: 53]: 5′-GCAGCCGTAAGATTATCTAG-3′ [SEQ ID [SEQ ID NO: 54]: 5′-CTAAATGACACGTTTGGAAC-3′ NO: 18] folD [SEQ ID NO: 55]: 5′- [SEQ ID GTGAAGTCCAAGGTAAACTGAAGGAGGAATTCATGGCAGCAA NO: 19] AATTATTAAG-3′ [SEQ ID NO: 56]: 5′-TCATCCGCCAAAACAGCCAAGC TATAATAAGCCGTTTTGC-3′ pckA [SEQ ID NO: 57]: 5′-TTGTTGAGACACTTACACGA [SEQ ID AGGAGGAATTCATGACAGATCTTAATCAATTAAC-3′ NO: 20] [SEQ ID NO: 58]: 5′-TTATGCTTTAGGACCGGCAG-3′ sga [SEQ ID NO: 59]: 5′-TTGTTGAGACACTTACACGA [SEQ ID AGGAGGAATTCATGGACTATATGTATGGACC-3′ NO: 21] [SEQ ID NO: 60]: 5′-TCATCCGCCAAAACAGCCAA GTTAGATTCTAGAGGGAATGAG-3′ Pfl [SEQ ID NO: 61]: 5′- [SEQ ID AGAACGTCGTCGAGGCGTAAAGGAGGAATTCATGACGAATCGT NO: 22] ATCTCTCG-3′ [SEQ ID NO: 62]: 5′-TTACAGCTGATGCGCTGTCC-3′
(85) Another plasmid used for constructing the assimilation pathway was a plasmid including a chloramphenicol resistance gene and a replication origin p15A and a synthetic promoter BBa_23100. PCR was conducted using the plasmid as a template and the primers of SEQ ID NO: 1 and SEQ ID NO: 2, and then the amplified gene fragment was recovered and purified to prepare a gene fragment used as a plasmid backbone for the production of the recombinant plasmid.
(86) The foreign gene fragments required for plasmid production were prepared by conducting PCR using the genomic DNA of microorganisms having the corresponding gene as a template and using a primer designed for amplification of the gene, and then collecting and purifying the amplified gene fragment, and the corresponding genes and primer sequences are shown in Tables 3 and 4 below.
(87) TABLE-US-00004 TABLE 3 NCBI information of foreign genes to be amplified and derived microorganisms Target Derived gene NCBI information microorganism GCV Glycine cleavage complex Escherichia coli. AP009048.1 REGION: 3044824-3049323 [SEQ ID NO: 63] SDA Serine deaminase Escherichia coli. CP017979.1 REGION: 1802037-1803401 [SEQ ID NO: 69]
(88) TABLE-US-00005 TABLE 4 Primer sequences used for amplification of foreign gene fragments Target gene Primer sequence GCV [SEQ ID NO: 64]: 5′- [SEQ ID TTGTTGAGACACTTACACGAAGGAGGAATTCATGGCACAACA NO: 63] GACTCCTTTG-3′ [SEQ ID NO: 65]: 5′- TCATCCGCCAAAACAGCCAAGTTACTGGTATTCGCTAATCGG- 3′
(89) The plasmid backbone gene fragments and amplified gene fragments were amplified using the Gibson assembly method (Gibson et al., Nat. Methods, 6:5, 343-345, 2009), which is commonly used for the assembly of gene fragments, and each plasmid was constructed to contain one or more of the foreign genes set forth in Table 1 or Table 3 above. In addition, a recombinant strain wherein the gcvR gene (SEQ ID NO: 66, NCBI information: NC_000913.3, Region 2599906-2600478) is deleted and the promoter of the gene constituting the glycine cleavage complex is changed {SEQ ID NO: 67 (NCBI Information: NC_000913.3 Region 3049125-3050667) is substituted as shown in SEQ ID NO: 68}. The recombinant strain having a gene deletion and substitution was produced using a homologous recombination method commonly used in the art (Datsenko et al., PNAS, 97: 12, 6640-6645, 2000). Representative plasmids prepared in the present invention are shown in Table 5 and
(90) TABLE-US-00006 TABLE 5 Plasmid Characteristics p100THF Including pBR322 replication origin, Ampicillin resistance gene, BBa_23100 synthetic promoter, SEQ ID NO: 7 formate-tetrahydrofolate ligase, SEQ ID NO: 8 methenyl tetrahydrofolate cyclohydrolase, and SEQ ID NO: 9 methylene-tetrahydrofolate dehydrogenase p100ST Including pBR322 replication origin, Ampicillin resistance gene, BBa_23100 synthetic promoter, SEQ ID NO: 7 formate-tetrahydrofolate ligase, SEQ ID NO: 8 methenyl tetrahydrofolate cyclohydrolase, SEQ ID NO: 9 methylene-tetrahydrofolate dehydrogenase, SEQ ID NO: 6 serine- glyoxylate transaminase, SEQ ID NO: 5 malyl-CoA lyase and SEQ ID NOS: 3 and 4 malate-CoA ligase p184100SGA Including p15A replication origin, chloramphenicol resistance gene, BBa_23100 synthetic promoter, SEQ ID NO: 21 serine-glyoxylate transaminase p100sucCD2mcl Including pBR322 replication origin, Ampicillin resistance gene, BBa_23100 synthetic promoter, SEQ ID NO: 5 malyl-CoA lyase and SEQ ID NOS: 17 and 18 malate-CoA ligase p184100GCV Including p15A replication origin, chloramphenicol resistance gene, BBa_23100 synthetic promoter, SEQ ID NO: 63 glycine cleavage complex pTrcTHF Including pBR322 replication origin, Ampicillin resistance gene, Trc promoter, SEQ ID NO: 7 formate-tetrahydrofolate ligase, SEQ ID NO: 8 methenyl tetrahydrofolate cyclohydrolase, and SEQ ID NO: 9 methylene- tetrahydrofolate dehydrogenase
(91) The recombinant plasmid produced by the method described above was transformed into E. coli to prepare recombinant E. coli. The E. coli used in the present invention was E. coli DH5α (Invitrogen, USA), and transformation into E. coli was carried out using a chemical transformation method commonly used in the art. Representative recombinant E. coli produced in the present invention are shown in Table 6 below.
(92) TABLE-US-00007 TABLE 6 Strain name Gene type DH5α THF DH5α harboring plasmid p100THF DH5α ST1 DH5α harboring plasmid p100ST DH5α ST2 DH5α harboring plasmid p100ST and p184100SGA DH5α ST3 DH5α harboring plasmid p100sucCD2mcl DH5α RG2 DH5α harboring plasmids p100THF and p184100GCV DH5α RG3 DH5α harboring plasmids pTrcTHF and p184100GCV DH5α RG4 DH5α ΔgcvR Ptrc: gcvTHP harboring plasmid p100THF
Example 2: Identification of Assimilation of Formic Acid and Carbon Dioxide Using Carbon Isotope Analysis
(93) Carbon isotope analysis was performed to verify whether or not the recombinant E. coli produced in Example 1 could effectively assimilate formic acid and carbon dioxide. In order to verify the assimilation of formic acid, experiments were performed using wild-type Escherichia coli (DH5α WT) as a control group and recombinant Escherichia coli (DH5α THF) introduced with formate-tetrahydrofolate ligase encoded by a nucleic acid molecule represented by SEQ ID NO: 7, methenyl tetrahydrofolate cyclohydrolase encoded by a nucleic acid molecule represented by SEQ ID NO: 8, and methylene-tetrahydrofolate dehydrogenase encoded by a nucleic acid molecule represented by SEQ ID NO: 9 among the recombinant Escherichia coli produced in Example 1.
(94) In order to verify whether or not the assimilated formic acid is linked to the central carbon assimilation pathway, experiments were performed using a recombinant Escherichia coli further introduced with serine-glyoxylate transaminase encoded by a nucleic acid molecule represented by SEQ ID NO: 6, 3, 16 or 21. Further, in order to verify whether or not the assimilated formic acid is linked to the central carbon assimilation pathway and effectively synthesizes acetyl-CoA together with carbon dioxide, experiments were performed using a recombinant microorganism introduced with malyl-CoA lyase encoded by a nucleic acid molecule of SEQ ID NO: 5 or 15, and further introduced with a malate-CoA ligase encoded by a nucleic acid molecule represented by SEQ ID NO: 3, 4, 11 or 12.
(95) For the carbon isotope analysis, the control and experimental E. coli were cultured in M9 medium containing formate and bicarbonate ion labeled with a .sup.13C carbon isotope (see the composition shown in Table 7 below), and then the E. coli cell samples and acetic acid samples contained in the culture solution were analyzed. Analysis of the mass number of amino acid constituting E. coli using Escherichia coli cell samples was carried out using gas-chromatography/mass spectroscopy after hydrolysis of all the proteins constituting Escherichia coli under strongly acidic and high-temperature conditions (Zamboni et al., Nat. protocols, 4:6, 878-892, 2009). Analysis of the acetic acid sample contained in the culture solution was carried out by lyophilizing the culture solution, separating the acetic acid contained in the culture solution into acetate, and conducting analysis using the gas-chromatography/mass-spectroscopy analysis method.
(96) TABLE-US-00008 TABLE 7 Composition of M9 medium Ingredient Content (g/l) Na.sub.2HPO.sub.4 3.6 KH.sub.2PO.sub.4 3 NaCl 0.5 NH.sub.4Cl 1 MgSO.sub.4 0.24 CaCl.sub.2 0.011 Glucose 5 Sodium formate .sup.13C 2.76 Folate 0.01 Sodium bicarbonate .sup.13C 3.4 FeSO.sub.4 0.00455 NiSO.sub.4 0.00464 Sodium molybdate 0.00618 Thiamine 0.01
Example 2-1: Identification of Formic Acid Assimilation Through Formic Acid Assimilation Pathway
(97) The assimilation of formic acid in the cyclic formic acid and carbon dioxide assimilation pathway developed in the present invention is carried out though the bonding between tetrahydrofolate and formic acid among the two cyclic metabolic pathways, as shown in
(98) As shown in
(99) Meanwhile, the results of quantitative analysis of formic acid assimilation of the wild-type control (DH5α WT) and recombinant E. coli (DH5α THF) and comparison of assimilation efficiency showed that recombinant E. coli (DH5α THF) used formic acid as a main carbon source, while the wild-type control (DH5α WT) used almost no formic acid (
(100) From the above results, it could be seen that the recombinant E. coli according to the present invention exhibited significantly improved assimilation efficiency compared to that of the wild-type control.
Example 2-2 Identification of Assimilation with Central Carbon Metabolism (CCM) of Formic Acid
(101) Whether or not the formic acid assimilated through the cyclic formic acid and carbon dioxide assimilation metabolic pathway developed in the present invention was assimilated into the central carbon metabolism (CCM) of E. coli. was verified. The formic-acid-derived carbon assimilated through the metabolic pathway of Example 2-1 was migrated to 3-hydroxypyruvate through serine-glyoxylate transaminase and corresponded to the carbon at position 3 of pyruvate by a series of reactions. At this time, the proportion of carbon isotopes present in pyruvate could be determined by analysis of alanine and valine (Zelcbuch et al., Biochemistry, vol. 55:17, 2423-2426, 2016). Based on this principle, the carbon isotopes contained in pyruvate were analyzed. As a result, as shown in
Example 2-3 Identification of Production of Acetyl-CoA Through Carbon Dioxide Assimilation and Regeneration of Glyoxylate
(102) The identification of the production of acetyl-CoA and regeneration of glyoxylate through the carbon dioxide assimilation process, which is the last part of the cyclic process of the cyclic formic acid and carbon dioxide assimilation pathway developed in the present invention, was carried out by measuring the contents of carbon isotopes in acetic acid produced by the recombinant E. coli of Example 1 and the wild-type E. coli. That is, the carbon-dioxide-derived carbon corresponds to the carbon at position 1 of the acetyl-CoA synthesized by the cyclic formic acid and the carbon dioxide assimilation pathway developed in the present invention. Generally, acetyl-CoA is converted at a certain proportion into acetic acid in Escherichia coli. Therefore, analysis of acetic acid provides analysis of the content of isotopes in acetyl-CoA.
(103) The results of analysis of the carbon isotope content in acetyl-CoA based on this principle showed that the recombinant Escherichia coli (DH5α ST3) having the metabolic pathway had an increased isotope content in acetic acid compared to wild-type Escherichia coli. Therefore, it could be seen that the recombinant E. coli according to the present invention was effective for carbon dioxide assimilation and glyoxylate regeneration.
Example 3: Identification of Production of Pyruvate Through Cyclic Metabolic Pathway Using Carbon Isotope Analysis
(104) The pyruvate formate lyase was further introduced into the cyclic metabolic pathway to identify whether or not pyruvate was synthesized from acetyl-CoA and formic acid through the reverse reaction of the enzyme, which can be identified through carbon isotope analysis. That is, when formic acid and carbon dioxide labeled with a carbon isotope having a mass number of 13 are supplied, pyruvate synthesized through the corresponding cyclic metabolic pathway and the reverse reaction of pyruvate formate lyase has formic-acid-derived carbon at positions 1 and 3 and carbon-dioxide-derived carbon at position 2.
(105) Based on this principle, pyruvate was analyzed by the same method as the carbon isotope analysis used in Example 2-2. As a result, it could be seen that, in the case of recombinant E. coli (DH5α ST2) having a cyclic metabolic pathway produced in the present invention, the proportion of amino acids increased by 3 or more above the original mass number of corresponding amino acids in valine and alanine, was significantly increased compared to wild-type E. coli.
Example 4: Identification of Production of Glycine, Serine and Pyruvate from Formic Acid and Carbon Dioxide Using Carbon Isotope Analysis
(106) Carbon isotope analysis was performed to verify whether or not the recombinant E. coli produced in Example 1 could assimilate formic acid and carbon dioxide to produce glycine, serine and pyruvate. For the verification of formic acid assimilation, the experiments were carried out using the wild-type Escherichia coli (DH5α WT), as a control group, and recombinant E. coli (DH5α RG2) introduced with formate-tetrahydrofolate ligase encoded by a nucleic acid molecule represented by SEQ ID NO: 7, methenyl tetrahydrofolate cyclohydrolase encoded by the nucleic acid molecule represented by SEQ ID NO: 8, methylene-tetrahydrofolate dehydrogenase encoded by the nucleic acid molecule represented by SEQ ID NO: 9, and a glycine cleavage complex encoded by the nucleic acid molecule represented by SEQ ID NO: 63 among the recombinant Escherichia coli produced in Example 1.
(107) In order to verify the improvement in assimilation efficiency of formic acid and carbon dioxide, experiments were performed using recombinant Escherichia coli (DH5α RG4) obtained by deleting a gcvR gene (SEQ ID NO: 66, NCBI information: NC_000913.3, Region 2599906-2600478) and changing a promoter of a gene constituting the glycine cleavage complex {substituting SEQ ID NO: 67 (NCBI information: NC_000913.3 Region 3049125-3050667) with SEQ ID NO: 68) in the recombinant E. coli (DH5α RG2).
(108) For the carbon isotope analysis, the control and experimental E. coli were cultured in M9 medium containing formate and bicarbonate ion labeled with .sup.13C carbon isotope (see the composition shown in Table 7 above), and then the E. coli cell samples were analyzed. Analysis of the mass number of amino acid constituting E. coli using E. coli cell samples was carried out using gas-chromatography/mass spectroscopy after hydrolysis of all of the proteins constituting Escherichia coli under strongly acidic and high-temperature conditions (Zamboni et al., Nat. protocols, 4:6, 878-892, 2009).
Example 4-1: Identification of Synthesis of Glycine, Serine and Pyruvate from Formic Acid and Carbon Dioxide
(109) The recombinant E. coli (DH5α RG2) synthesized glycine from one molecule of formic acid and one molecule of carbon dioxide through the metabolic pathway shown in
Example 4-2: Improvement of Assimilation Efficiency of Formic Acid and Carbon Dioxide Through Gene Deletion and Promoter Modification in Recombinant E. coli
(110) In order to improve the synthesis of glycine, serine and pyruvate from formic acid, a recombinant strain (DH5α RG4) was prepared by changing a regulatory gene (gcvR) controlling the expression of the glycine cleavage complex and the promoter of the glycine cleavage complex in the recombinant E. coli (DH5α RG2). The synthesis of glycine, serine and pyruvate from formic acid and carbon dioxide was analyzed. As a result, it could be seen that 96%, 86% and 7.3% of glycine, serine and pyruvate, respectively, were synthesized from formic acid and carbon dioxide.
(111) In conclusion, based on the examples described above, the recombinant E. coli according to the present invention effectively acts on assimilation of formic acid and carbon dioxide through the cyclic metabolic pathway identified in the present invention, and further introduction of pyruvate formate lyase offers a significant increase in pyruvate synthesis efficiency. In addition, it can be seen that glycine, serine and pyruvate can be synthesized with high efficiency from formic acid and carbon dioxide through formic acid and carbon dioxide assimilation metabolic pathway.
(112) Although specific configurations of the present invention have been described in detail, those skilled in the art will appreciate that this detailed description is provided as preferred embodiments for illustrative purposes and should not be construed as limiting the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the accompanying claims filed and equivalents thereto.
DESCRIPTION OF SYMBOLS
(113) Synthetic promoter 100: BBa23100 synthetic promoter
(114) ftfL: SEQ ID NO: 7, formate-tetrahydrofolate ligase
(115) fch: SEQ ID NO: 8, methenyl tetrahydrofolate cyclohydrolase
(116) mtdA: SEQ ID NO: 9, methylene-tetrahydrofolate dehydrogenase
(117) rrnBT: rrnB terminator
(118) APr: Ampicillin resistance gene
(119) pBR322 origin: pBR322 replication origin
(120) mtkA(CM4): SEQ ID NO: 3, malate-CoA ligase β-subunit
(121) mtkB(CM4): SEQ ID NO: 4, malate-CoA ligase α-subunit
(122) mcl: SEQ ID NO: 5, malyl-CoA lyase
(123) sga: SEQ ID NO: 6, serine-glyoxylate aminotransferase
(124) CmR: chloramphenicol resistance gene
(125) p15A: p15A replication origin
(126) P23100: BBa23100 synthetic promoter
(127) sgaAT: SEQ ID NO: 21, serine-glyoxylate aminotransferase
(128) rrnBT1T2: rrnB terminator
(129) sucC2 OP: SEQ ID NO: 17, succinyl-CoA:(S)-malate CoA-transferase
(130) sucD2 OP: SEQ ID NO: 18, succinyl-CoA:(S)-malate CoA-transferase
(131) gcvT: SEQ ID NO: 63, T subunit among glycine cleavage complex
(132) gcvH: SEQ ID NO: 63, H subunit among glycine cleavage complex
(133) gcvP: SEQ ID NO: 63, P subunit among glycine cleavage complex
(134) trc-pro: Trc promoter
(135) LacIq: mutant lad repressor
INDUSTRIAL APPLICABILITY
(136) The present invention provides a novel microorganism introduced with a novel cyclic metabolic pathway through which C3 or higher organic carbon compounds can be synthesized from formic acid and carbon dioxide, thereby effectively synthesizing pyruvate as a C3 organic compound using carbon dioxide, which is abundant in nature, and formic acid, which is of low toxicity and suitable for assimilation (anabolic) reactions in view of reaction kinetics and which can be easily and rapidly synthesized from carbon dioxide. As a result, the present invention is effective in economically producing organic carbon compounds, reducing carbon dioxide, which is the main cause of global warming, and synthesizing various high-value-added compounds from pyruvate as an intermediate product.