Tripterygium wilfordii cryptomeridiol synthase, coding gene thereof and recombinant yeast containing coding gene

Abstract

Provided are a Cryptomeridiol synthase and a coding gene thereof. Also provided are a Cryptomeridiol synthase and a coding gene, a engineered yeast containing the Cryptomeridiol coding gene, and a use of same in plant breeding and biosynthesis. The cDNA full-length sequence of the Cryptomeridiol synthase gene in Tripterygium wilfordii is obtained by means of polymerase chain reaction cloning. Then, by means of synthetic biology, the engineered yeast containing the Cryptomeridiol synthase gene is constructed to realize the production of Cryptomeridiol in the yeast.

Claims

1. A yeast engineered bacteria with high yield of cryptomeridiol, wherein the yeast engineered bacteria comprises a gene coding a cryptomeridiol synthase with amino acid sequence as SEQ ID NO:2, and at least one of erg9 and rox1 genes is knocked out from the yeast engineered bacteria.

2. The yeast engineered bacteria as in claim 1, wherein the gene coding a cryptomeridiol synthase with amino acid sequence as SEQ ID NO:2 is at least one of: (1) nucleotide molecule shown in SEQ ID NO:1; (2) nucleotide sequence resulted from the nucleotide molecule shown in SEQ ID NO:1 being substituted, deleted or added with one or more nucleotide, with expressing same function of protein; (3) nucleotide sequence hybridized with the nucleotide molecules shown in SEQ ID NO:1 under stringent conditions, wherein the stringent conditions are that hybridizing in 0.1×SSPE solution containing 0.1% of SDS or in 0.1×SSC solution containing 0.1% of SDS.

3. The yeast engineered bacteria as in claim 1, wherein erg9 gene is knocked out from the yeast engineered bacteria, or erg9 and rox1 genes are knocked out from the yeast engineered bacteria.

4. The yeast engineered bacteria as in claim 1, which contains following gene fragments resulting from homologous recombination on the yeast self and integration into genome thereof: recombinant expression vector pYX212-IDI+TwCS, which is constructed from promoter TPIp, IDI gene, yeast terminator FBA1t, yeast promoter TEF1p, cryptomeridiol synthase expression gene TwCS, and terminator pYX12t into plasmid pYX212; recombinant expression vector p424-tHMG1, which is constructed from yeast promoter TDH3p, gene tHMG1 of truncated HMG-COA reductase with amino acid sequence as SEQ ID NO:44, and yeast terminator TDH3t into plasmid p424, wherein gene tHMG1 encodes amino acid as SEQ ID NO:44.

5. The yeast engineered bacteria as in claim 1, wherein the yeast engineered bacteria is GEN.PK series of Saccharomyces cerevisiae or BY series of Saccharomyces cerevisiae.

6. The yeast engineered bacteria as in claim 5, wherein the BY series of Saccharomyces cerevisiae is BY4741 Saccharomyces cerevisiae.

7. A method for building the engineered bacteria as in claim 1, comprising steps of: (1) constructing mutant strains: knocking out the erg9 gene in the BY4741 yeast strain, to obtain mutant strain BY4741erg9::Δ-200--176; or knocking out the erg9 gene and the rox1 gene in the BY4741 yeast strain, to obtain mutant strain BY4741 erg9::Δ-200--176 rox1::mut; (2) constructing recombinant expression vectors pYX212-IDI+TwCS and p424-tHMG1; (3) transforming recombinant expression vectors pYX212-IDI+TwCS and p424-tHMG1 into the mutant strain BY4741 erg9::Δ-200--176, to obtain yeast engineering strain TE8; or transforming recombinant expression vectors pYX212-IDI+TwCS and p424-tHMG1 into the mutant yeast strain BY4741 erg9::Δ-200--176 rox1::mut to obtain the yeast engineering strain TE9.

8. The method of claim 7, wherein a method for constructing the mutant strain is a modification by CRISP/Cas9 gene editing technology.

9. The method of claim 8, wherein in the CRISP/Cas9 gene editing technology, an expression vector containing Cas9 is a p414-TEF 1p-Cas9-CYC1t vector, and TRP screening marker in the p414-TEF1p-Cas9-CYC1t vector is replaced with LEU screening marker.

10. A method of synthesis of cryptomeridiol or eucalyptol using the engineered bacteria of claim 1.

Description

DESCRIPTION OF THE FIGURES

(1) FIG. 1 is a brief diagram of plasmid type of TE1-TE7 strain.

(2) FIG. 2 is a fermentation product diagram of GC-MS analysis, in which A is fermentation product of strain TE1, product with peak position at 1 and 2 is small amount of sesquiterpene (peak position 1 is eucalyptol), and the product with peak position at 3 is identified as cryptomeridiol with retention time of 21.43 min; B is a product diagram which is expressed in empty vector without TwCS expression gene, in which there is no sesquiterpene product found; C is a GC-MS diagram of a standard product of cryptomeridiol with peak position being same as that of the peak 3 in FIG. 1; D and E are mass spectrums of product of the peak position 3 of TE1 and the standard product of cryptomeridiol, respectively.

(3) FIG. 3 is a standard curve diagram for quantification of the standard product of cryptomeridiol.

(4) FIG. 4 is a yield determination diagram of cryptomeridiol product expressed by TE1-TE7 strains.

(5) FIG. 5 is a comparative diagram of expression yields of cryptomeridiol and eucalyptol between mutant strains TE8 and TE9 obtained by CRISP/Cas9 gene editing.

DETAILED DESCRIPTION OF THE INVENTION

(6) Hereinafter, various aspects and features of embodiment of the invention will be described in detail through preferred embodiments in conjunction with the accompanying drawings. Those skilled in the art should understand that these embodiments are only for illustration, and do not limit the scope of embodiment of the invention. Without departing from the scope of the claims, those skilled in the art can make various modifications and improvements to various aspects of embodiment of the invention, and these modifications and improvements also fall within the protection scope of embodiment of the invention. For example, replacing the promoters and expression vectors used in the examples with other promoters and expression vectors commonly used in the art can be understood and realized by those of ordinary skill in the art.

(7) The experimental methods used in the following examples are conventional methods unless otherwise specified.

(8) Materials, reagents and so on used in following embodiments, unless otherwise specified, can be obtained from commercial sources. For example, both of p426-SNR52p-gRNA eukaryotic expression vector and p414-TEF1p-Cas9-CYC1t eukaryotic expression vector are bought from Addgene; pESC-LEU eukaryotic expression vector is purchased from Agilent Technologies; SC-His Yeast Medium, SC-Trp-His Yeast Medium, SC-URA-Trp-His Yeast Medium are all purchased from Beijing FunGenome Technology Ltd.

(9) In quantitative tests of following embodiments, three times of repeating experiments are set, and results thereof are averaged.

(10) Tripterygium wilfordii Hook.f. suspension cells in following embodiments was disclosed in “Cloning and expression analysis of 4-(cytidine-5-diphospho)-2-C-methyl-D-erythritol kinase gene in Tripterygium wilfordii”, China Journal of Chinese Materia Medica, 1 Nov. 2015, 40(21):4165-4170, and the public can obtain it from the Laboratory of Molecular Biomedicine and Traditional Chinese Medicine Resources of Capital Medical University.

Embodiment 1: Total RNA Extraction and Purification of Tripterygium wilfordii Suspension Cells

(11) The total RNA of suspension cells of Tripterygium wilfordii was extracted by modified CTAB method (CTAB Buffer: 2% CTAB (W/V); 100 mmol.Math.L−1Tris-HCl (pH 8.0); 25 mmol.Math.L.sup.−1 EDTA; 2.0 mol.Math.L−1 NaC 0.5 g.Math.L.sup.−1 spermidine). RNA purification kit (Tiangen BioTech Co., Ltd.) was used to purify the RNA.

Embodiment 2: Full-Length cDNA Cloning of TwCS Gene

(12) 1. Primer Design

(13) According to data annotation of Tripterygium wilfordii transcriptome, full-length gene sequence was screened, and the 5′RACE and 3′RACE primers were designed, sequence of which is as following:

(14) TABLE-US-00001 5′RACE (SEQ ID NO: 3) GTACCGTAAGCATCGTATGTGTCG 3′RACE (SEQ ID NO: 4) CTATGAAGAGGACGAGTCTCGG

(15) 2. PCR Amplification

(16) Using PrimeScript 1.sup.st Strand cDNA Synthesis Kit (from Takara Co.) kit, the RNA obtained in embodiment 1 was reverse transcribed into first strand cDNA of RACE Ready. Rapid amplification of the end of SMARTer™ RACE was carried out according to the instructions of cDNA kit.

(17) The 3′ and 5′ ends of DNA sequence of SEQ ID No. 1 were obtained by the RACE method, and then primers were designed according to the sequence information, in which sequences of the primers are as follows:

(18) TABLE-US-00002 TwCS-F (SEQ ID NO: 5) ATGGCAGCGACCACCCAATCCAC TwCS-R (SEQ ID NO: 6) TTAATCTTGCATTGGTATTTGTTG

(19) The first strand cDNA of RACE Ready was used as template for PCR amplification.

(20) The PCR reaction conditions were 98° C. 30 s, 98° C. 10 s, 60° C. 15 s, 72° C. 1 min, 35 cycles and 72° C., 7 min.

(21) Results of sequencing showed that sequence of PCR amplification product was as shown by SEQ ID No. 1, and gene shown in SEQ ID No. 1 was named TwCS.

(22) This DNA sequence encodes protein composed of 553 amino acids, and the protein was named TwCS, with amino acid sequence of SEQ ID No. 2.

Embodiment 3: Construction of Plasmi

(23) 1. Cloning of Promoter and Terminator

(24) Promoter and terminator used in the present embodiment are publicly available on SGD website (https://www.yeastgenome.org).

(25) Total DNA of yeast BY4741 was extracted by yeast genome extraction kit (Tiangen BioTech Co., Ltd.). Then by using this DNA as a template, following primers were designed:

(26) TABLE-US-00003 TEF1p-F (SEQ ID NO: 7) ATAGCTTCAAAATGTTTCTACTC TEF1p-R (SEQ ID NO: 8) TTTGTAATTAAAACTTAGATTAG FBA1t-F (SEQ ID NO: 9) GTTAATTCAAATTAATTGATATAG FBA1t-R (SEQ ID NO: 10) AGTAAGCTACTATGAAAGACTTT

(27) Promoter TEF1p (TEF1 SGD ID: S000006284) and terminator FBA1t (FBA1 SGD ID: S000001543) fragments were obtained by PCR amplification.

(28) Using pYX212 plasmid as a template, promoter TPIp and terminator pYX2121 were obtained by PCR amplification (as in embodiment 2). Amplification primers are as follows:

(29) TABLE-US-00004 TPIp-F (SEQ ID NO: 11) GAATTGGGGATCTACGTATGGTC TPIp-R (SEQ ID NO: 12) AGTTTATGTATGTGTTTTTTG pYX212t-F (SEQ ID NO: 13) GAATTGGGGATCTACGTATGGTC pYX212t-R (SEQ ID NO: 14) TGCCGTAAACCACTAAATCGGAACC

(30) 2. Acquisition of EGR20 Gene (Yeast FPP and GPP Synthase Gene)

(31) According to gene sequence of yeast EGR20 (SGD ID: S000003703), primers are designed as follows:

(32) TABLE-US-00005 ERG20-F: (SEQ ID NO: 15) ATGGCTTCAGAAAAAGAAATTAG ERG20-R: (SEQ ID NO: 16) CTATTTGCTTCTCTTGTAAAC

(33) Gene sequence of the yeast EGR20 was obtained by PCR amplification (specific steps are same as those in embodiment 2).

(34) 3. Acquisition of IDI Gene

(35) According to gene sequence of yeast IDI (SGD ID:S000006038), primers were designed as follows:

(36) TABLE-US-00006 IDI-F: (SEQ ID NO: 17) ATGACTGCCGACAACAATAGTATGC IDI-R: (SEQ ID NO: 18) TTATAGCATTCTATGAATTTGCCTG

(37) Gene sequence of yeast IDI was obtained by PCR amplification (specific steps are same as those in embodiment 2).

(38) 4. Construction of Expression Module

(39) Using PCR method, following modules were built:

(40) TPIp-ERG20-FBA1t-TEF1p

(41) TPIp-IDI-FBA1t-TEF1p

(42) TPIp-IDI/ERG20-FBA1t-TEF1p

(43) TPIp-ERG20/IDI-FBA1t-TEF1p

(44) TEF1p-TwCS-pYX2121

(45) TPIp-TwCS-pYX212t

(46) Construction method is as follows: (1) mixing DNA fragments: promoters, genes, terminators, promoters . . . are mixed according to molar ratio of 1:3:5:7:XX:7:5:3:1, in which amount of DNA with ratio portion of 1 is 50 to 100 ng/kb; (2) first step of PCR: using mixed DNA from (1) as a template and amplifying by PCR without adding primers, in which reaction conditions of PCR were 98° C. 30 s; 98° C. 10 s, 60° C. 15 s, 72° C. 1 min, 15 cycles; and 72° C. 7 min; (3) second step PCR: taking 2 μL of PCR product from (2) as a template, using forward primers of the initial promoter, terminal terminator or reverse primers of the promoter for PCR amplification (specific steps are same as those of embodiment 2); (4) using EZNA Gel Extraction Kit (from OMEGA co.), purifying the PCR product according to instruction manual; (5) purifying the product, according to instruction manual of pEASY-Blunt Simple Cloning Kit (from Beijing TransGen Biotech Co., Ltd.), which was linked, transformed, and identified by sequencing, to get corresponding module DNA.

(47) There is a

(48) TABLE-US-00007 (SEQ ID NO: 44) GGGS (SEQ ID NO: 49) (GGT GGTGGT TCT
linker connection between IDI and ERG20.

(49) 5. Construction of plasmid by homologous recombination method Using the method of homologous recombination on yeast, constructed module was connected to expression vector pYX212, specific operations of which are as follows:

(50) (1) digesting expression vector pYX212 by BamH I endonuclease (from NEB Co.).

(51) TABLE-US-00008 Enzyme digestion reaction system (50 μL system) 10 × Cutsmart Buffer 5 μL DNA ≤1 μg BamH I 1 μL adding ddH.sub.2O to total volume 50 μL

(52) After reaction at 37° C. for 2 h, agarose gel electrophoresis was used to purify digested products according to instruction manual of EZNA Gel Extraction Kit (from OMEGA Co.).

(53) (2) mixing TPIp-TwCS-pYX212t module with linear expression vector pYX212 obtained in (1), in which molar concentration of the module was 100 ng/kb and molar concentration of the vector was 60-80 ng/kb, then co-electrotransformation was performed to make them transformed into yeast BY4741 competent state, under conditions of 2.5 kV, 25 μF and 200Ω (Bio-Rad Gene Pulsers).

(54) The yeast BY4741 competent state was prepared by lithium acetate transformation method.

(55) (3) Saccharomyces cerevisiae strains were cultured in their respective screening dropout medium for 2 to 3 days, 30° C. A single colony is picked, by using E.Z.N.A. Yeast Plasmid Mini Kit (from OMEGA co.), with reference to the instruction manual, to extract yeast plasmids.

(56) (4) using plasmids from (3) as a template, screening was performed by PCR method, in which primers for screening were TPIp-F and pYX212t-R (refer to “1. Cloning of promoter and terminator”). After sequencing and identification, recombinant plasmid pYX212-TPIp-TwCS-pYX2121 was obtained, abbreviated as pYX212-TwCS.

(57) (5) repeating the steps in (1) to (4), constructing TPIp-ERG20-FBA1t-TEF1p, TPIp-IDI-FBA1t-TEF1p, TPIp-IDI/ERG20-FBA1t-TEF1p, TPIp-ERG20/IDI-FBA1t-TEF1p, TEF1p-TwCS-pYX212t modules into vector pYX212 in turn, and obtaining following recombinant plasmids:

(58) pYX212-TPIp-ERG20-FBA1t-TEF1p-TwCS-pYX212t, abbreviated as pYX212-ERG20+TwCS;

(59) pYX212-TPIp-IDI-FBA1t-TEF1p-TwCS-pYX212t, abbreviated as pYX212-IDI+TwCS;

(60) pYX212-TPIp-IDI/ERG20-FBA1t-TEF1p-TwCS-pYX212t, abbreviated as pYX212-(IDI-ERG20)+TwCS;

(61) pYX212-TPIp-ERG20/IDI-FBA1t-TEF1p-TwCS-pYX212t, abbreviated as pYX212-(ERG20-IDI)+TwCS.

(62) (6) plasmid p424-tHMG1 is obtained by constructing yeast promoter TDH3p, gene tHMG1, yeast terminator TDH31 into plasmid p424, carries HIS3marker. Detailed construction method can be found in “Zhou, Y. J.; Gao, W.; Rong, Q.; Jin, G.; Chu, H.; Liu, W.; Yang, W.; Zhu, Z.; Li, G.; Zhu, G. J. Am. Chem. Soc. 2012, 134, 3234-3241.”, can be obtained according to literature records, and can also be obtain by the public from the Laboratory of Molecular Pharmacognosy and traditional Chinese Medicine Resources of Capital Medical University.

Embodiment 4: Modification of Yeast Strain

(63) (1) gRNA sequence: referring to paper “Jakoqiiangnas, T.; Bonde, I.; Herrg å rd, M.; Harrison, S. J.; Kristensen, M.; Pedersen, L. E.; Jensen, M. K.; Keasling, J. D. Metab. Eng. 2015, 28, 213-222.”, gRNA sequences of rox1 and erg9 promoters were designed as follows:

(64) TABLE-US-00009 rox1 (SEQ ID NO: 19) ACAGGATCTTAATAGACGAAGTTTTAGAGCTAGAA erg9p (SEQ ID NO: 20) TTTCCACTGCACTTTGCATGTTTTAGAGCTAGAA

(65) (2) Modification of gRNA Vector

(66) P426-SNR52p-gRNA vector (from Addgene co.) was modified by inserting two opposite restriction sites AarI at the 20 bp single RNA site, sequences of the restriction sites are as follows:

(67) TABLE-US-00010 AarI: (SEQ ID NO: 50) 5′...CACCTGC(N)4↑... 3′ (SEQ ID NO: 51) 3′...GTGGACG(N)8↑... 5′

(68) Using PCR amplification method (specific steps are same as those in embodiment 2), primers thereof are as follows:

(69) TABLE-US-00011 pU01-F (SEQ ID NO: 21) GTCACACCTGCATCGGATCATTTATCTTTCACTGCG pU01-R (SEQ ID NO: 22) CTTGCACCTGCATCGGTTTTAGAGCTAGAAATAGCA

(70) Content with underline is sequence of AarI restriction site.

(71) p426-SNR52p-gRNA vector was constructed into a first-class general vector pTY-U01.

(72) (3) Construction of Single gRNA (sgRNA) Vector

(73) gRNA site was designed as a 24 nt Oligo with a complementary sticky end to the vector to form a double strand under the annealing procedure. Sequence of Oligo is shown in a table below.

(74) TABLE-US-00012 erg9p-F (SEQ ID NO: 23) GATCTTTTCCACTGCACTTTGCAT erg9p-R (SEQ ID NO: 24) AAACATGCAAAGTGCAGTGGAAAA

(75) TABLE-US-00013 system: Annealing Buffer  2 μL Oligo-F  9 μL Oligo-R  9 μL Total 20 μL

(76) Conditions: 95° C., 5 min; 95 to 25° C., −1° C./min, 71 cycles, 10° C. hold.

(77) Golden Gate reaction was used for connection.

(78) system: AarI 2 μL

(79) 10× Buffer AarI 2 μL

(80) 50× oligonucleotide (0.025 mM) 0.4 μL

(81) T4 Ligase(HC) 1 μL

(82) T4 Ligase Buffer 2 μL

(83) pTY-U0130 fmol

(84) Annealing oligo 2 μL

(85) ddH.sub.2Oup to 20 μL

(86) conditions: 37° C., 4 h; 50° C., 5 min; 80° C., 5 min; 4° C. hold

(87) The connection product was screened by transforming, positive cloning, and sample sequencing, to obtain erg9p-gRNA vector.

(88) By repeating steps (1) to (3), gRNA of rox1 was inserted into the vector, in which gRNA sequence is as follows:

(89) TABLE-US-00014 rox1-F (SEQ ID NO: 25) GATCACAGGATCTTAATAGACGAA  rox1-R (SEQ ID NO: 26) AAACTTCGTCTATTAAGATCCTGT 
erg9p-rox1-gRNA vector was obtained.

(90) (4) Obtaining dsOligo

(91) dsOligo of rox1 gene was obtained by synthesizing 120 nt long-stranded Oligo, annealing to form DNA double strand, which was then purified by using EZNA Gel Extraction Kit (from OMEGA co.) with reference to the instruction manual.

(92) Synthetic sequence is as follows:

(93) TABLE-US-00015 rox1-Oligo-F (SEQ ID NO: 27) CATTATTCCAGAAAATACTAATACTTCTTCACACAAAAGAACGCAGT TAGACAATCAACATTTTTTTTTTCCATTTCTTCTTTCCGTTATATTATA TTATACTATATTCCCTTTAACTAA rox1-Oligo-R (SEQ ID NO: 28) TTAGTTAAAGGGAATATAGTATAATATAATATAACGGAAAGAAGAA ATGGAAAAAAAAAATGTTGATTGTCTAACTGCGTTCTTTTGTGTGAA GAAGTATTAGTATTTTCTGGAATAATG

(94) erg9p directly adopts a method of synthesizing double-stranded DNA (from Beijing RuiBiotech Co., Ltd.), and then dsOligo of erg9p can be obtained by amplification using PCR method. Oligo sequence and amplification primers are as follows:

(95) TABLE-US-00016 erg9p-OLIGO: (SEQ ID NO: 29) 5′-CTAGAGACCCTGCGAGCGTGTCCCGGTGGGTTCTGGGAGCTCTAA CTCCGCAGGAACTACAAACCTTGCTTACACAGAGTGAACCTGCTGCC TGGCGTGCTCTGACTCAGTACATTTCATAGCCCATCTTCAACAACAA TACCGACTTCATCAGAATGCGTTATCGGTTTTGGGTTTAGTGCCTAA ACGAGCAGCGAGAACACGACCACGGGCTATATAAATGGAAAGTTAG GACAGGGGCAAAGAATAAGAGCACAGAAGAAGAGAAAAGACGAAG AGCAGAAGCGGAAAACGTATA-3′ ERG9p-OLIGO-F (SEQ ID NO: 30) CTAGAGACCCTGCGAGCGTGTC ERG9p-OLIGO-R (SEQ ID NO: 31) TATACGTTTTCCGCTTCTGCTCTTC

(96) (5) Modification and Transformation of Cas 9 Vector

(97) Because screening marker TRP of p414-TEF1p-Cas9-CYC1t vector (from Addgene co.) is not suitable for BY4741 yeast, TRP screening marker was replaced by LEU, by seamless splicing in this experiment, in which LEU sequence template is eukaryotic expression vector pESC-LEU (from Agilent Technologies, Co.) was used in this experiment.

Cas9 Vector Modification Primers

(98) TABLE-US-00017 SEQ ID Vector Sequence (5′-3′) No. U-F ATAGCTTGTCACCTTACGTACAATCTTGATCCGGAGCT 32 U-R CTTAGGGGCAGACATACTCCAAGCTGCCTTTGTGT 33 LEU-F AAGGCAGCTTGGAGTATGTCTGCCCCTAAGAAGAT 34 LEU-R TACTACTCAGTAATAACTTAAGCAAGGATTTTCTTAACTTC 35 D-F AGAAAATCCTTGCTTAAGTTATTACTGAGTAGTATTTAT 36 D-R AGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGA 37

(99) (i) using pESC-LEU plasmid as template to amplify LEU sequence, p414-TEF1p-Cas9-CYC1t plasmid as template to amplify upstream sequence and downstream sequence of TRP, in which primers are LEU-F/R, U-F/R and D-F/R, respectively.

(100) TABLE-US-00018 system: NEB Phusion Master Mix 25 μL Primerl 2.5 μL Primer2 2.5 μL template 1.5 μL ddH2O up to 50 μL condition: 98° C. 30 s 98° C. 10 s 62° C. 15 s {close oversize brace} 35 cycles 72° C. 2~4 kb/min 72° C. 5 min  4° C. hold

(101) (ii) Double digestion of p414-TEF1p-Cas9-CYC1t plasmid SnaBI restriction endonuclease site of upstream 148 bp of TRP1 ORF and DraIII restriction endonuclease site of downstream 323b were selected.

(102) TABLE-US-00019 system: Cutsmart buffer 5 μL SnaBI-HF 1 μL DraIII-HF 1 μL p414-TEF1p-Cas9-CYC1t 2 μg ddH2O up to 50 μL conditions: 37° C. 2 h

(103) (iii) Glue cutting to recover each fragment

(104) (iv) In-Fusion reaction

(105) TABLE-US-00020 system: 5 × In-Fusion HD Enzyme Premix 2 μL Linearized Vector 0.01~0.25 pmol Insert 0.01~0.25 pmol ddH2O up to 10 μL

(106) Note: n(vector):n(fragment)=1:2

(107) conditions: incubated at 50° C. for 15 min; and placed on ice.

(108) (v) transforming 10 μL of splicing products into 50 μL Trans1-T1 competent cells, resuscitated at 30° C., coated with LB+Amp solid medium (from Beijing FunGenome Technology Co., Ltd.), and cultured overnight at 30° C.

(109) (vi) selecting single colony, which was cultured in shake flask with LB+Amp liquid medium at 30° C., 250 rpm for 4 to 6 hours, bacterial liquid is subjected to PCR verification, primers as follows: if the PCR product was detected by agarose gel electrophoresis that there is a band around 1740 bp, corresponding bacterial liquid would be sent to the company for sequencing.

Modification of PCR Primers in Bacterial Liquid with Cas9 Vector

(110) TABLE-US-00021 Primer Sequence (5′-3′) SEQ ID No. ScCas9-F GCACCATAAACGACATTACTATA 38 ScCas9-R ACCCCAAAAAACTTGATTAGG 39

(111) (vii) bacteria liquid with correct sequencing was cultured in shake flask, modified cas9 plasmid (Leu2-TEF1p-Cas9-CYC1t) was extracted.

(112) (viii) transforming the modified Cas9 plasmid into BY4741 yeast strain, transformation method of which was according to specification of Frozen-EZ Yeast Transformation II™ (from Zymo Research co.) to obtain strain BY4741-Cas9.

(113) (6) transforming gRNA and dsOligo into BY4741-Cas9

(114) taking about 500 ng of gRNA, 2 μg of erg9p dsOligo, 1 μg of rox1 dsOligo, according to different knockout purposes, mixed system was added to 100 μL of BY4741-Cas9 competent cells, and electrotransformation was performed.

(115) (7) Acquisition of Mutant Strains

(116) modified strain in step (6) was detected with a pair of screened primers, using unmodified strain as control. primer sequence is as follows:

(117) TABLE-US-00022 rox1-D-F (SEQ ID NO: 40) TCCTCGTATTGTCTTGCCGG rox1-D-R (SEQ ID NO: 41) CTAGACCACCTGCGCCTAAC erg9p-D-F (SEQ ID NO: 42) CTAGAGACCCTGCGAGCGTG erg9p-D-R (SEQ ID NO: 43) CAGCTACGTAGTGACAGTAC

(118) After PCR screening, positive clones were sequenced and identified, and mutated strains were obtained.

(119) (8) removal of Cas9 and gRNA plasmids

(120) (i) putting BY4741 mutant strain into YPD solid medium (from Beijing FunGenome Technology Co., Ltd.) and culturing at 42° C. for 3 days to grow a single colony;

(121) (ii) selecting single colony, culturing in shake flask at 42° C. in liquid medium with same composition, and sub-culturing twice;

(122) (iii) BY4741 mutant strains cultured in (ii) were put into YPD, SC-LEU and SC-URA solid medium (from Beijing FunGenome Technology Co., Ltd.) and cultured at 30° C. for 3 days. If BY4741 modified strain could grow normally on YPD solid medium but could not grow on both of SC-LEU and SC-URA solid medium, it was proved that both of Cas9 and gRNA plasmids had been removed;

(123) (iv) culturing the mutant strain without plasmid in liquid medium with shake flask, then sequencing the same again according to the method in (7) to ensure that the mutation was correct to get two kinds of mutant strains BY4741 erg9::Δ-200-176 and BY4741 erg9::Δ-200--176 rox1::mut.

Embodiment 5: Construction of Engineered Bacteria for Producing Cryptomeridiol

(124) The plasmid pYX212-TwCS in embodiment 3 is transformed into strain BY4741, in which transformation method thereof is according to specification of Frozen-EZ Yeast Transformation II™ (from Zymo Research Co.), and engineered bacteria TE1 is obtained, as shown in Table 1 and FIG. 1.

(125) The plasmid pYX212-ERG20+TwCS in embodiment 3 is transformed into strain BY4741, in which transformation method thereof is according to specification of Frozen-EZ Yeast Transformation II™ (from Zymo Research Co.), and engineered bacteria TE2 is obtained, as shown in Table 1 and FIG. 1.

(126) The plasmid pYX212-IDI+TwCS in embodiment 3 is transformed into strain BY4741, in which transformation method thereof is according to specification of Frozen-EZ Yeast Transformation II™ (from Zymo Research Co.), and engineered bacteria TE3 is obtained, as shown in Table 1 and FIG. 1.

(127) The plasmid pYX212-(IDI-ERG20)+TwCS in embodiment 3 is transformed into strain BY4741, in which transformation method thereof is according to specification of Frozen-EZ Yeast Transformation II™ (from Zymo Research Co.), and engineered bacteria TE4 is obtained, as shown in Table 1 and FIG. 1.

(128) The plasmid pYX212-(EGR20-IDI)+TwCS in embodiment 3 is transformed into strain BY4741, in which transformation method thereof is according to specification of Frozen-EZ Yeast Transformation II™ (from Zymo Research Co.), and engineered bacteria TE5 is obtained, as shown in Table 1 and FIG. 1.

(129) The plasmids pYX212-(ERG20-IDI)+TwCS and p424-tHMG1 in embodiment 3 are transformed into strain BY4741, in which transformation method thereof is according to specification of Frozen-EZ Yeast Transformation II™ (from Zymo Research Co.), and engineered bacteria TE6 is obtained, as shown in Table 1 and FIG. 1.

(130) The plasmids pYX212-IDI+TwCS and p424-tHMG1 in embodiment 3 are transformed into strain BY4741, in which transformation method thereof is according to specification of Frozen-EZ Yeast Transformation II™ (from Zymo Research Co.), and engineered bacteria TE7 is obtained, as shown in Table 1 and FIG. 1.

(131) The plasmids pYX212-IDI+TwCS and p424-tHMG1 in embodiment 3 are transformed into mutant strain BY4741 erg9::Δ-200-176, in which transformation method thereof is according to specification of Frozen-EZ Yeast Transformation II™ (from Zymo Research Co.), and engineered bacteria TE8 is obtained, as shown in Table 1.

(132) The plasmids pYX212-IDI+TwCS and p424-tHMG1 in embodiment 3 are transformed into mutant strain BY4741 erg9::Δ-200-176 rox1::mut, in which transformation method thereof is according to specification of Frozen-EZ Yeast Transformation II™ (from Zymo Research Co.), and engineered bacteria TE2 is obtained, as shown in Table 1.

(133) TABLE-US-00023 TABLE 1 genotypes and recombinant plasmids of the strains involved in embodiment of the invention strain Genotypes and foreign plasmids Origin BY4741 MATa; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0 ATCC TE1 BY4741/pYX212-TwCS embodiment TE2 BY4741/pYX212-ERG20 + TwCS embodiment TE3 BY4741/pYX212-IDI + TwCS embodiment TE4 BY4741/pYX212-(IDI-ERG20) + TwCS embodiment TE5 BY4741/pYX212-(ERG20-IDI) + TwCS embodiment TE6 BY4741/pYX212-(ERG20-IDI) + TwCS/p424- embodiment tHMG1 TE7 BY4741/pYX212-IDI + TwCS/p424-tHMG1 embodiment TE8 BY4741 erg9::Δ-200--176/pYX212- embodiment IDI + TwCS/p424-tHMG1 TE9 BY4741 erg9::Δ-200--176 rox1::mut/pYX212- embodiment IDI + TwCS/p424-tHMG1

Embodiment 6: Engineered Bacteria Cultivation and Product Identification

(134) (1) Engineered Bacteria Cultivation

(135) Strain was fermented to produce sesquiterpene by a bioreactor. 20 g/L of glucose was used as carbon source, and corresponding dropout medium (from Beijing FunGenome Technology Ltd) was used to pre-culture corresponding nutrient dropout strains. Medium for 3 L bioreactor was composed of 8 g/L of synthetic denitrification medium without uracil and histidine, 10 g/L (NH.sub.4).sub.2SO.sub.4, 10 g/L of KH.sub.2PO.sub.4, 1.0 g/L of MgSO.sub.4.7H.sub.2O. 50% NH.sub.3H.sub.2O used as pH regulator. The strain was pre-cultured in a shake flask at a speed of 230 rpm and at 30° C. for 48 h. Then in the 3 L stirred-tank bioreactor (Eppendorf BioFlo/CelliGen 115), 1 L of fermentation medium was inoculated with the pre-culture cells. 500 g/L glucose solution was periodically to maintain growth of the strains. A concentrated medium with 40 g/L synthetic denitrification medium lacking uracil and histidine and 100 g/L (NH.sub.4).sub.2SO.sub.4 was fermented.

(136) (2) Extraction and Separation of Products

(137) Fermentation products are sesquiterpene component, which are easily soluble in n-hexane, which is thus selected as the extraction reagent. Fermentation broth was centrifuged into two parts of cell and bacterial liquid, and same volume of n-hexane was added to the bacterial liquid then extracted for 3 times; after the cell was broken, ultrasonic extraction was performed for three times, with 3 times of volume of n-hexane. Organic layer was combined, an appropriate amount of anhydrous sodium sulfate was added, with resting for a while to remove water from the extraction liquid. The extraction liquid is concentrated extract with a rotary evaporator, in which temperature for water bath should not exceeding 35° C. (volatile components), and finally produce is transferred to a glass collection bottle.

(138) Taking a silica gel thin plate, concentrated products were expanded with n-hexane and ethyl acetate in different ratios, with vanillin sulfuric acid as chromogenic agent. Preliminary separation: then separating the same by XSelect CSH Prep C18 OBD (19×150 mm, 5 um) column, mobile phase A was 0.1% (v/w) formic acid water, and mobile phase B was acetonitrile, with flow rate of 20 mL/min. Concentration and enrichment of monomer compounds are separated.

(139) (3) Structural Identification

(140) The structure of the compound was analyzed by NMR spectrum. All data were collected from BRUKER ACANCE III 600 MHz spectrometer. Solvent was deuterated chloroform containing TMS. The compound was finally identified as cryptomeridiol, as shown in FIG. 2.

Embodiment 7: Comparison of Yields of Cryptomeridiol Produced by Engineered Bacteria

(141) In order to determine the sesquiterpene production of each strain, inoculation is at ratio of 1:100, and 50 mL solution was pre-cultured as the strain. The strain was cultured in defective medium containing 20 g/L glucose at 230 rpm at 30° C. After shaking culture for 72 hours, OD600 of all strains was detected. Same volume of n-hexane was added to culture liquid, then keeping oscillating under 200 rpm for 2 hours, and adding same volume of n-hexane for ultrasonic extraction twice. Organic layer is merged, evaporated in rotation and concentrated. Finally, the concentrated sample was fixed to 1.0 mL, then 100 uL thereof was taken to prepare GC-MS sample for GC-MS analysis. Using Thermo TRACE 1310/TSQ8000 gas chromatograph (no shunt; syringe temperature at 250 m ° C.), TG-5 MS (30 m×0.25 mm×0.25 m) capillary column; GC conditions are as follows: first, keeping the oven temperature constant at 50° C. for 2 minutes, then rising to 280° C. at speed of 8° C./min and keeping at the final temperature for 10 minutes. Temperature of syringe and detector is 50° C. Standard curve was established by using P-eudesmol as analogue of cryptomeridiol, and the standard curve equation was obtained as y=3E+06x−3E+07, as shown in FIG. 3.

(142) The specific output is calculated as follows:

(143) TABLE-US-00024 TE1 0.516 mg/L TE2  4.24 mg/L TE3  4.57 mg/L TE4  2.65 mg/L TE5  3.47 mg/L TE6  5.68 mg/L TE7  7.75 mg/L TE8 13.47 mg/L TE9 19.73 mg/L

(144) Above description is not a limitation to the present invention, nor is the invention limited to the above examples. Any changes, modifications, additions or replacements made by ordinary technical personnel in the technical field within the substantive scope of the invention shall also fall within the protection scope of the invention, and the protection scope of the invention shall be subject to the claims.