RNAi agents for inhibiting expression of alpha-ENaC and methods of use
11214802 · 2022-01-04
Assignee
Inventors
- Zhen Li (Westfield, NJ, US)
- Rui Zhu (Middleton, WI, US)
- Tao Pei (Middleton, WI, US)
- Anthony Nicholas (Oregon, WI, US)
- Erik W Bush (Verona, WI, US)
Cpc classification
C12N15/113
CHEMISTRY; METALLURGY
C12N15/1138
CHEMISTRY; METALLURGY
C12N2320/32
CHEMISTRY; METALLURGY
A61P5/40
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Described are RNAi agents, compositions that include RNAi agents, and methods for inhibition of an alpha-ENaC (SCNN1A) gene. The alpha-ENaC RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of an alpha-ENaC gene. Pharmaceutical compositions that include one or more alpha-ENaC RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the described alpha-ENaC RNAi agents to epithelial cells, such as pulmonary epithelial cells, in vivo, provides for inhibition of alpha-ENaC gene expression and a reduction in ENaC activity, which can provide a therapeutic benefit to subjects, including human subjects.
Claims
1. An RNAi agent for inhibiting expression of an alpha-ENaC gene, comprising: an antisense strand comprising the nucleotides: (i) UAUUUGUUCUGGUUGCACAGG (SEQ ID NO:3); or (ii) UAUUUGUUCUGGUUGCACAGC (SEQ ID NO:7); and a sense strand comprising a nucleotide sequence that is partially complementary, substantially complementary, or fully complementary to the antisense strand.
2. The RNAi agent of claim 1, wherein the sense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 255, 273, 276, 284 and 296.
3. The RNAi agent of claim 1, wherein at least one nucleotide of the alpha-ENaC RNAi agent is a modified nucleotide or includes a modified internucleoside linkage.
4. The RNAi agent of claim 1, wherein all or substantially all of the nucleotides are modified nucleotides.
5. The RNAi agent of claim 3, wherein the modified nucleotide is selected from the group consisting of: 2′-O-methyl nucleotide, 2′-fluoro nucleotide, 2′-deoxy nucleotide, 2′,3′-seco nucleotide mimic, locked nucleotide, 2′-F-arabino nucleotide, 2′-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2′-O-methyl nucleotide, inverted 2′-deoxy nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate deoxyribonucleotide, and 3′-O-methyl nucleotide.
6. The RNAi agent of claim 4, wherein all or substantially all of the nucleotides are modified with either 2′-O-methyl nucleotides or 2′-fluoro nucleotides.
7. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences of SEQ ID NOS: 2, 6, 10, 99, 100, 101, 103, 120-125, 132-135, 137, 143, 144, 145, 146, or 147.
8. The RNAi agent of claim 1, wherein the sense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 153, 154, 156, 167, 168, 169, 176-179, 182, 183, 188-195, 197, 201, 206-208, 210, 211, 213-217, 223, or 295.
9. The RNAi agent of claim 1, wherein the RNAi agent is linked to a targeting ligand.
10. The RNAi agent of claim 9, wherein the targeting ligand comprises an integrin targeting ligand.
11. The RNAi agent of claim 10, wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand.
12. The RNAi agent of claim 9, wherein the targeting ligand is conjugated to the sense strand.
13. The RNAi agent of claim 12, wherein the targeting ligand is conjugated to the 5′ terminal end of the sense strand.
14. The RNAi agent of claim 1, wherein the sense strand is between 21 and 30 nucleotides in length, and the antisense strand is between 21 and 30 nucleotides in length.
15. The RNAi agent of claim 14, wherein the sense strand and the antisense strand are each between 21 and 27 nucleotides in length.
16. The RNAi agent of claim 15, wherein the sense strand and the antisense strand are each between 21 and 24 nucleotides in length.
17. The RNAi agent of claim 16, wherein the sense strand and the antisense strand are each 21 nucleotides in length.
18. The RNAi agent of claim 17, wherein the RNAi agent has two blunt ends.
19. The RNAi agent of claim 1, wherein the sense strand comprises one or two terminal caps.
20. The RNAi agent of claim 19, wherein the sense strand comprises one or two inverted abasic residues.
21. The RNAi agent of claim 1, wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the structure of any one of duplexes of AD04019 (SEQ ID NOs: 99/153), AD04020 (SEQ ID NOs: 99/154), AD04021 (SEQ ID NOs: 100/154), AD04022 (SEQ ID NOs: 6/154), AD05515 (SEQ ID NOs: 6/190), AD05625 (SEQ ID NOs: 6/156), AD05773 (SEQ ID NOs:6/215), AD04023 (SEQ ID NOs: 101/154), AD04025 (SEQ ID NOs: 103/154), AD04978 (SEQ ID NOs: 120/169), AD04835 (SEQ ID NOs: 121/156), AD04858 (SEQ ID NOs: 121/154), AD05345 (SEQ ID NOs: 121/176), AD04859 (SEQ ID NOs: 122/167), AD05160 (SEQ ID NOs: 122/169), AD04976 (SEQ ID NOs: 123/169), AD04977 (SEQ ID NOs: 124/169), AD04979 (SEQ ID NOs: 125/169), AD04980 (SEQ ID NOs: 125/168), AD5161 (SEQ ID NOs: 132/169), AD05162 (SEQ ID NOs: 133/169), or AD05163 (SEQ ID NOs: 134/169).
22. A composition comprising the RNAi agent of claim 1, wherein the composition comprises a pharmaceutically acceptable excipient.
23. The composition of claim 22, further comprising a second RNAi agent for inhibiting the expression of alpha-ENaC.
24. The composition of claim 23, further comprising one or more additional therapeutics.
25. The composition of claim 24, wherein the composition is formulated for administration by inhalation.
26. The composition of claim 25, wherein the composition is delivered by a metered-dose inhaler, jet nebulizer, vibrating mesh nebulizer, or soft mist inhaler.
27. A method for inhibiting expression of an alpha-ENaC gene in a cell, the method comprising introducing into a cell an effective amount of an RNAi agent of claim 1.
28. The method of claim 27, wherein the cell is within a subject.
29. The method of claim 28, wherein the subject is a human subject.
30. The method of claim 28, wherein the alpha-ENaC gene expression is inhibited by at least about 30%.
31. A method for inhibiting expression of an alpha-ENaC gene in a cell, the method comprising introducing into a cell an effective amount of the composition of claim 22.
32. The method of claim 31, wherein the cell is within a subject.
33. The method of claim 32, wherein the subject is a human subject.
34. The method of claim 31, wherein the alpha-ENaC gene expression is inhibited by at least about 30%.
35. A method of treating one or more symptoms or diseases associated with enhanced or elevated ENaC activity levels, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of claim 22.
36. The method of claim 35, wherein the disease is a respiratory disease.
37. The method of claim 36, wherein the respiratory disease is cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infections, primary ciliary dyskinesia, or lung carcinoma cystic fibrosis.
38. The method of claim 35, wherein the disease is an ocular disease.
39. The method of claim 32, wherein the RNAi agent is administered at a dose of about 0.001 mg/kg to about 0.500 mg/kg of body weight.
40. The method of claim 39, wherein the RNAi agent is administered in two or more doses.
41. The method of claim 35, wherein the RNAi agent is administered at a dose of about 0.001 mg/kg to about 0.500 mg/kg of body weight.
42. The method of claim 41, wherein the RNAi agent is administered in two or more doses.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13) The following abbreviations are used in
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
DETAILED DESCRIPTION
(25) RNAi Agents
(26) Described herein are RNAi agents for inhibiting expression of the alpha-ENaC (i.e., SCNN1A) gene (referred to herein as alpha-ENaC RNAi agents or alpha-ENaC RNAi triggers). Each alpha-ENaC RNAi agent comprises a sense strand and an antisense strand. The sense strand and the antisense strand each can be 16 to 30 nucleotides in length. In some embodiments, the sense and antisense strands each can be 17 to 26 nucleotides in length. The sense and antisense strands can be either the same length or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 17 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 17-21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length while the antisense strand is about 23 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21 nucleotides in length. In some embodiments, the RNAi agent sense and antisense strands are each independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, a double stranded. RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides.
(27) In some embodiments, the region of perfect, substantial, or partial complementarily between the sense strand and the antisense strand is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5′ end of the antisense strand (e.g., this region may be separated from the 5′ end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly, substantially, or partially complementary).
(28) The sense strand and antisense strand each contain a core stretch (also referred to herein as a “core sequence” or a “core stretch sequence”)) that is 16 to 23 nucleotides in length. An antisense strand core stretch is 100% (perfectly) complementary or at least 85% (substantially) complementary to a nucleotide sequence (sometimes referred to, e.g., as a target sequence) present in the alpha-ENaC target. A sense strand core stretch is 100% (perfectly) complementary or at least 85% (substantially) complementary to a core stretch in the antisense strand, and thus the sense strand core stretch is typically perfectly identical or at least 85% identical to a nucleotide sequence (target sequence) present in the alpha-ENaC mRNA target. A sense strand core stretch can be the same length as a corresponding antisense core stretch or it can be a different length. In some embodiments, the antisense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
(29) Examples of nucleotide sequences used in forming alpha-ENaC RNAi agents are provided in Tables 2, 3, and 4. Examples of RNAi agent duplexes, that include the sense strand and antisense strand nucleotide sequences in Tables 2, 3, and 4, are shown in Table 5.
(30) The alpha-ENaC RNAi agent sense and antisense strands anneal to form a duplex. A sense strand and an antisense strand of an alpha-ENaC RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of an alpha-ENaC RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% base paired or 100% base paired.)
(31) In some embodiments, the antisense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2 or Table 4.
(32) The sense strand and/or the antisense strand can optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3′ end, the 5′ end, or both the 3′ and 5′ ends of the core stretch sequences. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sequence in the alpha-ENaC mRNA. The sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in the alpha-ENaC mRNA. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sense strand's additional nucleotides, if present.
(33) As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5′ and/or 3′ end of the sense strand core stretch sequence and/or antisense strand core stretch sequence. The extension nucleotides on a sense strand may or may not be complementary to nucleotides, either core stretch sequence nucleotides or extension nucleotides, in the corresponding antisense strand. Conversely, the extension nucleotides on an antisense strand may or may not be complementary to nucleotides, either core stretch nucleotides or extension nucleotides, in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain 3′ and 5′ extensions. In some embodiments, one or more of the 3′ extension nucleotides of one strand base pairs with one or more 5′ extension nucleotides of the other strand. In other embodiments, one or more of 3′ extension nucleotides of one strand do not base pair with one or more 5′ extension nucleotides of the other strand. In some embodiments, an alpha-ENaC RNAi agent has an antisense strand having a 3′ extension and a sense strand having a 5′ extension. In some embodiments, the extension nucleotide(s) are unpaired and form an overhang. As used herein, an “overhang” refers to a stretch of one or more unpaired nucleotides located at a terminal end of either the sense strand or the antisense strand that does not form part of the hybridized or duplexed portion of an RNAi agent disclosed herein.
(34) In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an alpha-ENaC RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides that are complementary to the corresponding alpha-ENaC mRNA sequence.
(35) In some embodiments, the 3′ end of the antisense strand can include additional abasic residues (Ab). An “abasic residue” or “abasic site” is a nucleotide or nucleoside that lacks a nucleobase at the 1′ position of the sugar moiety. (See, e.g., U.S. Pat. No. 5,998,203). In some embodiments, Ab or AbAb can be added to the 3′ end of the antisense strand. In some embodiments, abasic residue(s) can be added as inverted abasic residues (invAb) (see Table 6). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). In some embodiments, the sense strand or the antisense strand may include a “terminal cap,” which as used herein is a non-nucleotide compound or other moiety that can be incorporated at one or more termini of a strand of an RNAi agent disclosed herein, and can provide the RNAi agent, in some instances, with certain beneficial properties, such as, for example, protection against exonuclease degradation. Terminal caps are generally known in the art, and include inverted abasic residues, as well as carbon chains such as a terminal C3, C6, or C12 group. In some embodiments, a terminal cap is present at either the 5′ terminal end, the 3′ terminal end, or both the 5′ and 3′ terminal ends of the sense strand.
(36) In some embodiments, an alpha-ENaC RNAi agent comprises a sense strand having a 3′ extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides that correspond to nucleotides in the alpha-ENaC mRNA sequence. In some embodiments, the 3′ sense strand extension includes or consists of one of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5′ to 3′).
(37) In some embodiments, the 3′ end of the sense strand may include additional abasic residues. In some embodiments, UUAb, UAb, or Ab are added to the 3′ end of the sense strand.
(38) In some embodiments, one or more inverted abasic residues (invAb) are added to the 3′ end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near the terminal end or terminal ends of the sense strand of an RNAi agent allows for enhanced activity or other desired properties of an RNAi agent.
(39) In some embodiments, an alpha-ENaC RNAi agent comprises a sense strand having a 5′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides that correspond to nucleotides in the alpha-ENaC mRNA sequence. In some embodiments, the sense strand 5′ extension is one of the following sequences, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed 5′ to 3′). A sense strand can have a 3′ extension and/or a 5′ extension.
(40) In some embodiments, the 5′ end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, one or more inverted abasic residues (invAb) are added to the 5′ end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent. In some embodiments, an abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.
(41) In some embodiments, the 3′ end of the antisense strand core stretch sequence, or the 3′ end of the antisense strand sequence, may include an inverted abasic residue (invAb (see Table 6)).
(42) Examples of sequences used in forming alpha-ENaC RNAi agents are provided in Tables 2, 3, and 4. In some embodiments, an alpha-ENaC RNAi agent antisense strand includes a sequence of any of the sequences in Tables 2 or 3. In some embodiments, an alpha-ENaC RNAi agent antisense strand includes the sequence of nucleotides (from 5′ end 3′ end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24, of any of the sequences in Table 2 or Table 3. In certain embodiments, an alpha-ENaC RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3. In some embodiments, an alpha-ENaC RNAi agent sense strand includes the sequence of any of the sequences in Tables 2 or 4. In some embodiments, an alpha-ENaC RNAi agent sense strand includes the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 3-20, 3-21, 3-22, 3-23, 3-24, 4-21, 4-22, 4-23, 4-24, 5-22, 5-23, or 5-24, of any of the sequences in Tables 2 or 4. In certain embodiments, an alpha-ENaC RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4.
(43) In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a “blunt end” refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair).
(44) In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a frayed end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein, a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands from a pair (i.e., do not form an overhang) but are not complementary (i.e. form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent form an overhang. The unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3′ or 5′ overhangs. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5′ overhang end, a blunt end and a 3′ overhang end, a frayed end and a 5′ overhang end, a frayed end and a 3′ overhang end, two 5′ overhang ends, two 3′ overhang ends, a 5′ overhang end and a 3′ overhang end, two frayed ends, or two blunt ends. Typically, when present, overhangs are located at the 3′ terminal ends of the sense strand, the antisense strand, or both the sense strand and the antisense strand.
(45) Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can preserve activity of the compound in cells while at the same time increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans upon administering of the polynucleotide or oligonucleotide construct.
(46) In some embodiments, an alpha-ENaC RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, an alpha-ENaC RNAi agent is prepared as a sodium salt. Such forms that are well known in the art are within the scope of the inventions disclosed herein.
(47) Modified Nucleotides
(48) In some embodiments, an alpha-ENaC RNAi agent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2′-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides can include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (represented herein as Ab), 2′-modified nucleotides, 3′ to 3′ linkages (inverted) nucleotides (represented herein as invdN, invN, invn), modified nucleobase-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2′,3′-seco nucleotide mimics (unlocked nucleobase analogues, represented herein as N.sub.UNA or NUNA), locked nucleotides (represented herein as N.sub.LNA or NLNA), 3′-O-methoxy (2′ internucleoside linked) nucleotides (represented herein as 3′-OMen), 2′-F-Arabino nucleotides (represented herein as NfANA or Nf.sub.ANA), 5′-Me, 2′-fluoro nucleotide (represented herein as 5Me-Nf), morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (represented herein as vpdN), vinyl phosphonate containing nucleotides, and cyclopropyl phosphonate containing nucleotides (cPrpN). 2′-modified nucleotides (i.e., a nucleotide with a group other than a hydroxyl group at the 2′ position of the five-membered sugar ring) include, but are not limited to, 2′-O-methyl nucleotides (represented herein as a lower case letter ‘n’ in a nucleotide sequence), 2′-deoxy-2′-fluoro nucleotides (also referred to herein as 2′-fluoro nucleotide, and represented herein as NO, 2′-deoxy nucleotides (represented herein as dN), 2′-methoxyethyl (2′-O-2-methoxylethyl) nucleotides (also referred to herein as 2′-MOE, and represented herein as NM), 2′-amino nucleotides, and 2′-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification can be incorporated in a single alpha-ENaC RNAi agent or even in a single nucleotide thereof. The alpha-ENaC RNAi agent sense strands and antisense strands can be synthesized and/or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.
(49) Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.
(50) In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides (i.e., unmodified). As used herein, a sense strand wherein substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being unmodified ribonucleotides. As used herein, an antisense sense strand wherein substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being unmodified ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent is an unmodified ribonucleotide.
(51) Modified Internucleoside Linkages
(52) In some embodiments, one or more nucleotides of an alpha-ENaC RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lower case “s”), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3′-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3′-amino phosphoramidate, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of boranophosphates, or boranophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. In some embodiments, a modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter-sugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH.sub.2 components.
(53) In some embodiments, a sense strand of an alpha-ENaC RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, an antisense strand of an alpha-ENaC RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, a sense strand of an alpha-ENaC RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, an antisense strand of an alpha-ENaC RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate linkages.
(54) In some embodiments, an alpha-ENaC RNAi agent sense strand contains at least two phosphorothioate internucleoside linkages. In some embodiments, the at least two phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 3′ end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5′ end of the sense strand, and another phosphorothioate linkage is at the 3′ end of the sense strand. In some embodiments, the at least two phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5′ end of the sense strand. In some embodiments, an alpha-ENaC RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 5′ end of the antisense strand and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5′ end. In some embodiments, an alpha-ENaC RNAi agent contains at least two phosphorothioate internucleoside linkages in the sense strand and three or four phosphorothioate internucleoside linkages in the antisense strand.
(55) In some embodiments, an alpha-ENaC RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2′-modified nucleoside is combined with modified internucleoside linkage.
(56) Alpha-ENaC RNAi Agents
(57) In some embodiments, the alpha-ENaC RNAi agents disclosed herein target an alpha-ENaC gene at or near the positions of the alpha-ENaC sequence shown in Table 1. In some embodiments, the antisense strand of an alpha-ENaC RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to a target alpha-ENaC 19-mer sequence disclosed in Table 1.
(58) TABLE-US-00010 TABLE 1 Alpha-ENaC 19-mer mRNA Target Sequences (taken from homo sapiens sodium channel epithelial 1 alpha subunit (SCNN1A), transcript variant 1, GenBank NM_001038.5 (SEQ ID NO: 1)) alpha-ENaC 19-mer Corresponding Target Sequences Positions on SEQ SEQ ID No. (5′ .fwdarw. 3′) ID NO: 1 11 UGUGCAACCAGAACAAAUC 972-990 12 GUGCAACCAGAACAAAUCG 973-991 13 GCAGAGCAGAAUGACUUCA 1289-1307 14 AGAGCAGAAUGACUUCAUU 1291-1309 15 CUACCAGACAUACUCAUCA 1000-1018 16 UCUACCAGACAUACUCAUC 999-1017 17 CUUUGACCUGUACAAAUAC 763-781 18 UGGAAGGACUGGAAGAUCG 944-962 19 GGAAGGACUGGAAGAUCGG 945-963 20 CUGUGCCUACAUCUUCUAU 1579-1597
(59) In some embodiments, an alpha-ENaC RNAi agent includes an antisense strand wherein position 19 of the antisense strand (5′.fwdarw.3′) is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an alpha-ENaC agent includes an antisense strand wherein position 1 of the antisense strand (5′.fwdarw.3′) is capable of forming a base pair with position 19 of a 19-mer target sequence disclosed in Table 1.
(60) In some embodiments, an alpha-ENaC agent includes an antisense strand wherein position 2 of the antisense strand (5′.fwdarw.3′) is capable of forming a base pair with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an alpha-ENaC agent includes an antisense strand wherein positions 2 through 18 of the antisense strand (5′.fwdarw.3′) are capable of forming base pairs with each of the respective complementary bases located at positions 18 through 2 of the 19-mer target sequence disclosed in Table 1.
(61) For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) can be perfectly complementary to the alpha-ENaC gene, or can be non-complementary to the alpha-ENaC gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) is a U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) forms an A:U or U:A base pair with the sense strand.
(62) In some embodiments, an alpha-ENaC RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, an alpha-ENaC RNAi sense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2 or Table 4.
(63) In some embodiments, an alpha-ENaC RNAi agent is comprised of (i) an antisense strand comprising the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Table 4.
(64) In some embodiments, the alpha-ENaC RNAi agents include core 19-mer nucleotide sequences shown in the following Table 2.
(65) TABLE-US-00011 TABLE 2 Alpha-ENaC RNAi Agent Antisense Strand and Sense Strand Core Stretch Base Sequences (N = any nucleobase) Antisense Strand Base Sequence Sense Strand Base Sequence (5′ .fwdarw. 3′) (5′ .fwdarw. 3′) Corresponding (Shown as an Unmodified (Shown as an Unmodified Positions on SEQ ID NO: Nucleotide Sequence) SEQ ID NO: Nucleotide Sequence) SEQ ID NO: 1 21 UAUUUGUUCUGGUUGCACA 60 UGUGCAACCAGAACAAAUA 972-990 22 AAUUUGUUCUGGUUGCACA 61 UGUGCAACCAGAACAAAUU 972-990 23 GAUUUGUUCUGGUUGCACA 62 UGUGCAACCAGAACAAAUC 972-990 24 NAUUUGUUCUGGUUGCACA 63 UGUGCAACCAGAACAAAUN 972-990 25 NAUUUGUUCUGGUUGCACN 64 NGUGCAACCAGAACAAAUN 972-990 26 AAUGAAGUCAUUCUGCUCU 65 AGAGCAGAAUGACUUCAUU 1291-1309 27 UAUGAAGUCAUUCUGCUCU 66 AGAGCAGAAUGACUUCAUA 1291-1309 28 NAUGAAGUCAUUCUGCUCU 67 AGAGCAGAAUGACUUCAUN 1291-1309 29 NAUGAAGUCAUUCUGCUCN 68 NGAGCAGAAUGACUUCAUN 1291-1309 30 UGAUGAGUAUGUCUGGUAG 69 CUACCAGACAUACUCAUCA 1000-1018 31 NGAUGAGUAUGUCUGGUAG 70 CUACCAGACAUACUCAUCN 1000-1018 32 NGAUGAGUAUGUCUGGUAN 71 NUACCAGACAUACUCAUCN 1000-1018 33 GAUGAGUAUGUCUGGUAGA 72 UCUACCAGACAUACUCAUC 999-1017 34 UAUGAGUAUGUCUGGUAGA 73 UCUACCAGACAUACUCAUA 999-1017 35 NAUGAGUAUGUCUGGUAGA 74 UCUACCAGACAUACUCAUN 999-1017 36 NAUGAGUAUGUCUGGUAGN 75 NCUACCAGACAUACUCAUN 999-1017 37 CGAUUUGUUCUGGUUGCAC 76 GUGCAACCAGAACAAAUCG 973-991 38 UGAUUUGUUCUGGUUGCAC 77 GUGCAACCAGAACAAAUCA 973-991 39 NGAUUUGUUCUGGUUGCAC 78 GUGCAACCAGAACAAAUCN 973-991 40 NGAUUUGUUCUGGUUGCAN 79 NUGCAACCAGAACAAAUCN 973-991 41 GUAUUUGUACAGGUCAAAG 80 CUUUGACCUGUACAAAUAC 763-781 42 UUAUUUGUACAGGUCAAAG 81 CUUUGACCUGUACAAAUAA 763-781 43 NUAUUUGUACAGGUCAAAG 82 CUUUGACCUGUACAAAUAN 763-781 44 NUAUUUGUACAGGUCAAAN 83 NUUUGACCUGUACAAAUAN 763-781 45 CGAUCUUCCAGUCCUUCCA 84 UGGAAGGACUGGAAGAUCG 944-962 46 UGAUCUUCCAGUCCUUCCA 85 UGGAAGGACUGGAAGAUCA 944-962 47 NGAUCUUCCAGUCCUUCCA 86 UGGAAGGACUGGAAGAUCN 944-962 48 NGAUCUUCCAGUCCUUCCN 87 NGGAAGGACUGGAAGAUCN 944-962 49 CCGAUCUUCCAGUCCUUCC 88 GGAAGGACUGGAAGAUCGG 945-963 50 UCGAUCUUCCAGUCCUUCC 89 GGAAGGACUGGAAGAUCGA 945-963 51 NCGAUCUUCCAGUCCUUCC 90 GGAAGGACUGGAAGAUCGN 945-963 52 NCGAUCUUCCAGUCCUUCN 91 NGAAGGACUGGAAGAUCGN 945-963 53 UGAAGUCAUUCUGCUCUGC 92 GCAGAGCAGAAUGACUUCA 1289-1307 54 NGAAGUCAUUCUGCUCUGC 93 GCAGAGCAGAAUGACUUCN 1289-1307 55 NGAAGUCAUUCUGCUCUGN 94 NCAGAGCAGAAUGACUUCN 1289-1307 56 AUAGAAGAUGUAGGCACAG 95 CUGUGCCUACAUCUUCUAU 1579-1597 57 UUAGAAGAUGUAGGCACAG 96 CUGUGCCUACAUCUUCUAA 1579-1597 58 NUAGAAGAUGUAGGCACAG 97 CUGUGCCUACAUCUUCUAN 1579-1597 59 NUAGAAGAUGUAGGCACAN 98 NUGUGCCUACAUCUUCUAN 1579-1597
(66) The alpha-ENaC RNAi agent sense strands and antisense strands that comprise or consist of the nucleotide sequences in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the alpha-ENaC RNAi agents having the sense and antisense strand sequences that comprise or consist of any of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.
(67) In some embodiments, the antisense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.
(68) As used herein, each N listed in a sequence disclosed in Table 2 may be independently selected from any and all nucleobases (including those found on both modified and unmodified nucleotides). In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is different from the N nucleotide at the corresponding position on the other strand.
(69) Certain modified alpha-ENaC RNAi agent sense and antisense strands are provided in Table 3 and Table 4. Modified alpha-ENaC RNAi agent antisense strands, as well as their underlying unmodified nucleobase sequences, are provided in Table 3. Modified alpha-ENaC RNAi agent sense strands, as well as their underlying unmodified nucleobase sequences, are provided in Table 4. In forming alpha-ENaC RNAi agents, each of the nucleotides in each of the underlying base sequences listed in Tables 3 and 4, as well as in Table 2, above, can be a modified nucleotide.
(70) The alpha-ENaC RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
(71) In some embodiments, an alpha-ENaC RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3.
(72) In some embodiments, an alpha-ENaC RNAi agent comprises or consists of a duplex having the nucleobase sequences of the sense strand and the antisense strand of any of the sequences in Table 2, Table 3, or Table 4.
(73) Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Table 4.
(74) As used in Tables 3 and 4, the following notations are used to indicate modified nucleotides, targeting groups, and linking groups: A=adenosine-3′-phosphate C=cytidine-3′-phosphate G=guanosine-3′-phosphate U=uridine-3′-phosphate I=inosine-3′-phosphate a=2′-O-methyladenosine-3′-phosphate as =2′-O-methyladenosine-3′-phosphorothioate c=2′-O-methylcytidine-3′-phosphate cs=2′-O-methylcytidine-3′-phosphorothioate g=2′-O-methylguanosine-3′-phosphate gs=2′-O-methylguanosine-3′-phosphorothioate i=2′-O-methylinosine-3′-phosphate is=2′-O-methylinosine-3′-phosphorothioate t=2′-O-methyl-5-methyluridine-3′-phosphate ts=2′-O-methyl-5-methyluridine-3′-phosphorothioate u=2′-O-methyluridine-3′-phosphate us=2′-O-methyluridine-3′-phosphorothioate Nf=any 2′-fluoro modified nucleotide Af=2′-fluoroadenosine-3′-phosphate Afs=2′-fluoroadenosine-3′-phosporothioate Cf=2′-fluorocytidine-3′-phosphate Cfs=2′-fluorocytidine-3′-phosphorothioate Gf=2′-fluoroguanosine-3′-phosphate Gfs=2′-fluoroguanosine-3′-phosphorothioate Tf=2′-fluoro-5′-methyluridine-3′-phosphate Tfs=2′-fluoro-5′-methyluridine-3′-phosphorothioate Uf=2′-fluorouridine-3′-phosphate Ufs=2′-fluorouridine-3′-phosphorothioate dN=any 2′-deoxyribonucleotide dT=2′-deoxythymidine-3′-phosphate N.sub.UNA=2′,3′-seco nucleotide mimics (unlocked nucleobase analogs)-3′-Phosphate N.sub.UNAS=2′,3′-seco nucleotide mimics (unlocked nucleobase analogs)-3′-Phosphorothioate A.sub.UNA=2′,3′-seco-adenosine-3′-phosphate A.sub.UNAS=2′,3′-seco-adenosine-3′-phosphorothioate C.sub.UNA=2′,3′-seco-cytidine-3′-phosphate C.sub.UNAS=2′,3′-seco-cytidine-3′-phosphorothioate G.sub.UNA=2′,3′-seco-guanosine-3′-phosphate G.sub.UNAS=2′,3′-seco-guanosine-3′-phosphorothioate U.sub.UNA=2′,3′-seco-uridine-3′-phosphate U.sub.UNAS=2′,3′-seco-uridine-3′-phosphorothioate a_2N=see Table 7 a_2Ns=see Table 7 pu_2N=see Table 7 pu_2Ns=see Table 7 D2us=see Table 7 Npu=see Table 7 Nus=see Table 7 N.sub.LNA=locked nucleotide Nf.sub.ANA=2′-F-Arabino nucleotide NM=2′-O-(2-methoxyethyl) nucleotide AM=2′-O-(2-methoxyethyl)adenosine-3′-phosphate AMs=2′-O-(2-methoxyethyl)adenosine-3′-phosphorothioate TM=2′-O-(2-methoxyethyl)thymidine-3′-phosphate TMs=2′-O-(2-methoxyethyl)thymidine-3′-phosphorothioate R=ribitol (invdN)=any inverted deoxyribonucleotide (3′-3′ linked nucleotide) (invAb)=inverted (3′-3′ linked) abasic deoxyribonucleotide-5′-phosphate, see Table 7 (invAb)s=inverted (3′-3′ linked) abasic deoxyribonucleotide-5′-phosphorothioate, see Table 7 (invn)=any inverted 2′-OMe nucleotide (3′-3′ linked nucleotide) s=phosphorothioate linkage vpdN=vinyl phosphonate deoxyribonucleotide (5Me-Nf)=5′-Me, 2′-fluoro nucleotide cPrp=cyclopropyl phosphonate, see Table 7 epTcPr=see Table 7 epTM=see Table 7 spus=see Table 7 (Chol-TEG)=see Table 7 (TEG-Biotin)=see Table 7 (PEG-C3-SS)=see Table 7 (Alk-SS-C6)=see Table 7 (C6-SS-Alk)=see Table 7 (C6-SS-C6)=see Table 7 (6-SS-6)=see Table 7 (C6-SS-Alk-Me)=see Table 7 (NH2-C6)=see Table 7 (TriAlk #)=see Table 7 (TriAlk #)s=see Table 7
(75) As the person of ordinary skill in the art would readily understand, unless otherwise indicated by the sequence (such as, for example, by a phosphorothioate linkage “s”), when present in an oligonucleotide, the nucleotide monomers are mutually linked by 5′-3′-phosphodiester bonds. Further, the person of ordinary skill in the art would readily understand that the terminal nucleotide at the 3′ end of a given oligonucleotide sequence would typically have a hydroxyl (—OH) group at the respective 3′ position of the given monomer instead of a phosphate moiety ex vivo. Moreover, as the person of ordinary skill would readily understand and appreciate, while the phosphorothioate chemical structures depicted herein typically show the anion on the sulfur atom, the inventions disclosed herein encompass all phosphorothioate tautomers and/or diastereomers (e.g., where the sulfur atom has a double-bond and the anion is on an oxygen atom). Unless expressly indicated otherwise herein, such understandings of the person of ordinary skill in the art are used when describing the alpha-ENaC RNAi agents and compositions of alpha-ENaC RNAi agents disclosed herein.
(76) Certain examples of targeting groups and linking groups used with the alpha-ENaC RNAi agents disclosed herein are included in the chemical structures provided below in Table 6. Each sense strand and/or antisense strand can have any targeting groups or linking groups listed herein, as well as other targeting or linking groups, conjugated to the 5′ and/or 3′ end of the sequence.
(77) TABLE-US-00012 TABLE 3 Alpha-ENaC RNAi Agent Antisense Strand Sequences SEQ Underlying Base Sequence (5′ .fwdarw. 3′) SEQ AS Strand ID (Shown as an Unmodified Nucleotide ID ID Modified Antisense Strand (5′ .fwdarw. 3′) NO. Sequence) NO. AM04730-AS usAfsusuuGfuUfcUfgGfuUfgCfaCfaGfcusg 99 UAUUUGUUCUGGUUGCACAGCUG 224 AM05080-AS usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfcusg 100 UAUUUGUUCUGGUUGCACAGCUG 224 AM05081-AS usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc 6 UAUUUGUUCUGGUUGCACAGC 7 AM05082-AS usAfsusUfuGfuUfcUfgGfuUfgCfaCfagsc 101 UAUUUGUUCUGGUUGCACAGC 7 AM05083-AS usAfsusUfuGfuUfcUfgGfuUfgCfaCfausu 102 UAUUUGUUCUGGUUGCACAUU 226 AM05084-AS vpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc 103 UAUUUGUUCUGGUUGCACAGC 7 AM05085-AS asAfsusUfuGfuUfcUfgGfuUfgCfaCfagsc 104 AAUUUGUUCUGGUUGCACAGC 227 AM05772-AS usAfsusGfaAfgUfcAfuUfcUfgCfuCfuGfsc 105 UAUGAAGUCAUUCUGCUCUGC 228 AM05773-AS usGfsasUfgAfgUfaUfgUfcUfgGfuAfgAfsa 106 UGAUGAGUAUGUCUGGUAGAA 229 AM05774-AS usGfsasUfuUfgUfuCfuGfgUfuGfcAfcAfsg 107 UGAUUUGUUCUGGUUGCACAG 230 AM05775-AS usAfsusGfaGfuAfuGfuCfuGfgUfaGfaAfsg 108 UAUGAGUAUGUCUGGUAGAAG 231 AM05776-AS usUfsasUfuUfgUfaCfaGfgUfcAfaAfgAfsg 109 UUAUUUGUACAGGUCAAAGAG 232 AM05777-AS usAfsusGfaAfgUfCfAfuUfcUfgCfuCfuGfsc 110 UAUGAAGUCAUUCUGCUCUGC 228 AM05778-AS usGfsasUfgAfgUfAfUfgUfcUfgGfuAfgAfsa 111 UGAUGAGUAUGUCUGGUAGAA 229 AM05779-AS usGfsasUfuUfgUfUfCfuGfgUfuGfcAfcAfsg 112 UGAUUUGUUCUGGUUGCACAG 230 AM05780-AS usAfsusGfaGfuAfUfGfuCfuGfgUfaGfaAfsg 113 UAUGAGUAUGUCUGGUAGAAG 231 AM05781-AS usUfsasUfuUfgUfAfCfaGfgUfcAfaAfgAfsg 114 UUAUUUGUACAGGUCAAAGAG 232 AM05782-AS usAfsusGfaAfgUfCfAfuUfcUfgCfuCfuusu 115 UAUGAAGUCAUUCUGCUCUUU 233 AM05783-AS usGfsasUfgAfgUfAfUfgUfcUfgGfuAfgusu 116 UGAUGAGUAUGUCUGGUAGUU 234 AM05784-AS usGfsasUfuUfgUfUfCfuGfgUfuGfcAfcusu 117 UGAUUUGUUCUGGUUGCACUU 235 AM05785-AS usAfsusGfaGfuAfUfGfuCfuGfgUfaGfausu 118 UAUGAGUAUGUCUGGUAGAUU 236 AM05786-AS usUfsasUfuUfgUfAfCfaGfgUfcAfaAfgusu 119 UUAUUUGUACAGGUCAAAGUU 237 AM05916-AS cPrpusAfuUfuGfuUfcUfgGfuUfgCfaCfaGfsc 120 UAUUUGUUCUGGUUGCACAGC 7 AM05917-AS cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc 121 UAUUUGUUCUGGUUGCACAGC 7 AM06240-AS cPrpuAfuUfuGfuUfcUfgGfuUfgCfaCfaGfc 122 UAUUUGUUCUGGUUGCACAGC 7 AM06460-AS cPrpuAfuUfuGfuUfcUfgGfuUfgCfaCfaGfc(invAb) 123 UAUUUGUUCUGGUUGCACAGC 7 AM06461-AS cPrpuAfuUfuGfuUfcUfgGfuUfgCfaCfaGfsc 124 UAUUUGUUCUGGUUGCACAGC 7 AM06462-AS cPrpusAfsuUfuGfuUfcUfgGfuUfgCfaCfaGfsc 125 UAUUUGUUCUGGUUGCACAGC 7 AM06691-AS usGfsasUfcUfuCfcAfgUfcCfuUfcCfaGfsu 126 UGAUCUUCCAGUCCUUCCAGU 238 AM06693-AS usCfsgsAfuCfuUfcCfaGfuCfcUfuCfcAfsg 127 UCGAUCUUCCAGUCCUUCCAG 239 AM06695-AS usGfsasAfgUfcAfuUfcUfgCfuCfuGfcGfsc 128 UGAAGUCAUUCUGCUCUGCGC 240 AM06697-AS asUfsasGfaAfgAfuGfuAfgGfcAfcAfgCfsc 129 AUAGAAGAUGUAGGCACAGCC 241 AM06699-AS usAfsusCfgUfgAfcAfgAfgGfgAfgAfcUfsc 130 UAUCGUGACAGAGGGAGACUC 242 AM06701-AS usUfsgsAfcCfaUfcGfuGfaCfaGfaGfgGfsa 131 UUGACCAUCGUGACAGAGGGA 243 AM06765-AS cPrpuAfuUfuGfuUfcUfgGfuUfgCfaCfaG.sub.UNAC.sub.UNA 132 UAUUUGUUCUGGUUGCACAGC 7 AM06766-AS cPrpuAfuUfuGfuUfcUfgGfuUfgCfaCfaGfC.sub.UNAU.sub.UNA 133 UAUUUGUUCUGGUUGCACAGCU 244 AM06767-AS cPrpuAfuUfuGfuUfcUfgGfuUfgCfaCfaGfcU.sub.UNAU.sub.UNA 134 UAUUUGUUCUGGUUGCACAGCUU 245 AM07066-AS cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg 10 UAUUUGUUCUGGUUGCACAGG 3 AM07170-AS cPrpusAfsusUfuGfU.sub.UNAUfcUfgGfuUfgCfaCfaGfsg 135 UAUUUGUUCUGGUUGCACAGG 3 AM07174-AS cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsu 136 UAUUUGUUCUGGUUGCACAGU 247 AM07200-AS usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg 2 UAUUUGUUCUGGUUGCACAGG 3 AM07204-AS usAfsusUfuGfU.sub.UNAUfcUfgGfuUfgCfaCfaGfsg 137 UAUUUGUUCUGGUUGCACAGG 3 AM07206-AS usAfsusUfuGfuUfcUfgGfuUfgCfaCfgGfsg 138 UAUUUGUUCUGGUUGCACGGG 248 AM07208-AS usAfsusUfuGfuUfcUfgGfuUfgCfaCfgGfsu 139 UAUUUGUUCUGGUUGCACGGU 249 AM07333-AS usAfsusUfuGfuUfcUfgGfuUfgCfaCfcGfsu 140 UAUUUGUUCUGGUUGCACCGU 250 AM07335-AS usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsu 141 UAUUUGUUCUGGUUGCACAGU 247 AM07340-AS usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsa 142 UAUUUGUUCUGGUUGCACAGA 251 AM07409-AS pusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg 143 UAUUUGUUCUGGUUGCACAGG 3 AM07410-AS D2usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg 144 UAUUUGUUCUGGUUGCACAGG 3 AM07411-AS spusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg 145 UAUUUGUUCUGGUUGCACAGG 3 AM07412-AS epusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg 146 UAUUUGUUCUGGUUGCACAGG 3 AM07484-AS U.sub.UNAsAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg 147 UAUUUGUUCUGGUUGCACAGG 3 AM07485-AS isAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg 148 IAUUUGUUCUGGUUGCACAGG 252 AM07496-AS usAfsusUfuguucugGfuUfgCfaCfaGfsu 149 UAUUUGUUCUGGUUGCACAGU 247 AM07497-AS usAfsusUfuguucUfgGfuUfgcaCfaGfsu 150 UAUUUGUUCUGGUUGCACAGU 247 AM07605-AS TMsAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc 151 TAUUUGUUCUGGUUGCACAGC 253 AM07669-AS asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu 152 AGAAGUCAUUCUGCUCUGCUU 254
(78) TABLE-US-00013 TABLE 4 Alpha-ENaC Agent Sense Strand Sequences Underlying Base Sequence SEQ (5′ .fwdarw. 3′) SEQ ID (Shown as an Unmodified ID Strand ID Modified Sense Strand (5′ .fwdarw. 3′) NO. Nucleotide Sequence) NO. AM05073-SS gscugugCfaAfcCfaGfaacaaauas(invAb) 153 GCUGUGCAACCAGAACAAAUA 255 AM05074-SS gscugugcaAfCfCfagaacaaauas(invAb) 154 GCUGUGCAACCAGAACAAAUA 255 AM05075-SS asaugugcaAfCfCfagaacaaauas(invAb) 295 AAUGUGCAACCAGAACAAAUA 296 AM05077-SS gscugugcaAfCfCfagaacaaauus(invAb) 155 GCUGUGCAACCAGAACAAAUU 256 AM05487-SS (NH2-C6)sgscugugcaAfCfCfagaacaaauas(invAb) 156 GCUGUGCAACCAGAACAAAUA 255 AM05787-SS gscagagcaGfAfAfugacuucauas(invAb) 157 GCAGAGCAGAAUGACUUCAUA 257 AM05788-SS usucuaccaGfAfCfauacucaucas(invAb) 158 UUCUACCAGACAUACUCAUCA 258 AM05789-SS csugugcaaCfCfAfgaacaaaucas(invAb) 159 CUGUGCAACCAGAACAAAUCA 259 AM05790-SS csuucuaccAfGfAfcauacucauas(invAb) 160 CUUCUACCAGACAUACUCAUA 260 AM05791-SS csucuuugaCfCfUfguacaaauaas(invAb) 161 CUCUUUGACCUGUACAAAUAA 261 AM05792-SS (invAb)AfgAfgCfaGfAfAfuGfaCfuUfcauausu(invAb) 162 AGAGCAGAAUGACUUCAUAUU 262 AM05793-SS (invAb)CfuAfcCfaGfAfCfaUfaCfuCfaucausu(invAb) 163 CUACCAGACAUACUCAUCAUU 263 AM05794-SS (invAb)GfuGfcAfaCfCfAfgAfaCfaAfaucausu(invAb) 164 GUGCAACCAGAACAAAUCAUU 264 AM05795-SS (invAb)UfcUfaCfcAfGfAfcAfuAfcUfcauausu(invAb) 165 UCUACCAGACAUACUCAUAUU 265 AM05796-SS (invAb)CfuUfuGfaCfCfUfgUfaCfaAfauaausu(invAb) 166 CUUUGACCUGUACAAAUAAUU 266 AM06162-SS (invAb)gcugugcaAfCfCfagaacaaaua(invAb) 167 GCUGUGCAACCAGAACAAAUA 255 AM06246-SS gcugugcaAfCfCfagaacaaau(invdA) 168 GCUGUGCAACCAGAACAAAUA 255 AM06459-SS gcugugcaAfCfCfagaacaaaua(invAb) 169 GCUGUGCAACCAGAACAAAUA 255 AM06690-SS (NH2-C6)sascuggaagGfAfCfuggaagaucas(invAb) 170 ACUGGAAGGACUGGAAGAUCA 267 AM06692-SS (NH2-C6)scsuggaaggAfCfUfggaagaucgas(invAb) 171 CUGGAAGGACUGGAAGAUCGA 268 AM06694-SS (NH2-C6)sgscgcagagCfAfGfaaugacuucas(invAb) 172 GCGCAGAGCAGAAUGACUUCA 269 AM06696-SS (NH2-C6)sgsgcugugcCfUfAfcaucuucuaus(invAb) 173 GGCUGUGCCUACAUCUUCUAU 270 AM06698-SS (NH2-C6)sgsagucuccCfUfCfugucacgauas(invAb) 174 GAGUCUCCCUCUGUCACGAUA 271 AM06700-SS (NH2-C6)suscccucugUfCfAfcgauggucaas(invAb) 175 UCCCUCUGUCACGAUGGUCAA 272 AM07064-SS (NH2-C6)gscugugcaAfCfCfagaacaaauas(invAb) 176 GCUGUGCAACCAGAACAAAUA 255 AM07065-SS (NH2-C6)scscugugcaAfCfCfagaacaaauas(invAb) 177 CCUGUGCAACCAGAACAAAUA 273 AM07067-SS (NH2-C6)cscugugcaAfCfCfagaacaaauas(invAb) 178 CCUGUGCAACCAGAACAAAUA 273 AM07169-SS (NH2-C6)scscugugcaAfCfCfaGaacaaauas(invAb) 179 CCUGUGCAACCAGAACAAAUA 273 AM07171-SS (NH2-C6)scscugugcaAfCfCfaiaacaaauas(invAb) 180 CCUGUGCAACCAIAACAAAUA 274 AM07172-SS (NH2-C6)scscugugcaAfCfCfagaacaa_2Nauas(invAb) 181 CCUGUGCAACCAGAACA(A.sup.2n)AUA 275 AM07173-SS (NH2-C6)sascugugcaAfCfCfagaacaaauas(invAb) 182 ACUGUGCAACCAGAACAAAUA 276 AM07201-SS (NH2-C6)cscugugcaAfCfCfaGaacaaauas(invAb) 183 CCUGUGCAACCAGAACAAAUA 273 AM07202-SS (NH2-C6)cscugugcaAfCfCfaiaacaaauas(invAb) 184 CCUGUGCAACCAIAACAAAUA 274 AM07203-SS (NH2-C6)cscugugcaAfCfUfagaacaaauas(invAb) 185 CCUGUGCAACUAGAACAAAUA 277 AM07205-SS (NH2-C6)csccgugcaAfCfCfagaacaaauas(invAb) 186 CCCGUGCAACCAGAACAAAUA 278 AM07207-SS (NH2-C6)asccgugcaAfCfCfagaacaaauas(invAb) 187 ACCGUGCAACCAGAACAAAUA 279 AM07217-SS (NH2-C6)cscugugcaAfCfCfagaacaaauas(invAb)s 188 CCUGUGCAACCAGAACAAAUA 273 (C6-SS-C6) AM07218-SS (NH2-C6)cscugugcaAfCfCfagaacaaauas(invAb) 189 CCUGUGCAACCAGAACAAAUA 273 (C6-SS-C6) AM07276-SS (TriAlk1)sgscugugcaAfCfCfagaacaaauas(invAb) 190 GCUGUGCAACCAGAACAAAUA 255 AM07280-SS (NH2-C6)cscugugcaAfCfCfagaacaaauas(invAb)s 191 CCUGUGCAACCAGAACAAAUA 273 (6-SS-6) AM07281-SS (NH2-C6)cscugugcaAfCfCfagaacaaauas(invAb)(6-SS-6) 192 CCUGUGCAACCAGAACAAAUA 273 AM07329-SS (TriAlk1)cscugugcaAfCfCfagaacaaauas(invAb) 193 CCUGUGCAACCAGAACAAAUA 273 AM07330-SS (TriAlk2)cscugugcaAfCfCfagaacaaauas(invAb) 194 CCUGUGCAACCAGAACAAAUA 273 AM07331-SS (TriAlk3)cscugugcaAfCfCfagaacaaauas(invAb) 195 CCUGUGCAACCAGAACAAAUA 273 AM07332-SS (NH2-C6)ascggugcaAfCfCfagaacaaauas(invAb) 196 ACGGUGCAACCAGAACAAAUA 280 AM07334-SS (NH2-C6)ascugugcaAfCfCfagaacaaauas(invAb) 197 ACUGUGCAACCAGAACAAAUA 276 AM07336-SS (NH2-C6)ascugugcaAfCfCfagaacaaa_2Nuas(invAb) 198 ACUGUGCAACCAGAACAA(A.sup.2n)UA 281 AM07337-SS (NH2-C6)ascugugcaAfCfCfagaacaa_2Nauas(invAb) 199 ACUGUGCAACCAGAACA(A.sup.2n)AUA 282 AM07338-SS (NH2-C6)ascugugcaAfCfCfagaaca_2Naauas(invAb) 200 ACUGUGCAACCAGAAC(A.sup.2n)AAUA 283 AM07339-SS (NH2-C6)uscugugcaAfCfCfagaacaaauas(invAb) 201 UCUGUGCAACCAGAACAAAUA 284 AM07341-SS (NH2-C6)cscugugcaAfCfCfagaacaa_2Nauas(invAb) 202 CCUGUGCAACCAGAACA(A.sup.2n)AUA 285 AM07342-SS (NH2-C6)cscugugcaAfCfCfaGaacaa_2Nauas(invAb) 203 CCUGUGCAACCAGAACA(A.sup.2n)AUA 275 AM07343-SS (NH2-C6)cscugugcaAfCfCfagaacaaa_2Nuas(invAb) 204 CCUGUGCAACCAGAACAA(A.sup.2n)UA 286 AM07344-SS (NH2-C6)cscugugcaAfCfCfagaaca_2Naauas(invAb) 205 CCUGUGCAACCAGAAC(A.sup.2n)AAUA 287 AM07400-SS (TriAlk4)cscugugcaAfCfCfagaacaaauas(invAb) 206 CCUGUGCAACCAGAACAAAUA 273 AM07401-SS (TriAlk5)cscugugcaAfCfCfagaacaaauas(invAb) 207 CCUGUGCAACCAGAACAAAUA 273 AM07402-SS (TriAlk6)cscugugcaAfCfCfagaacaaauas(invAb) 208 CCUGUGCAACCAGAACAAAUA 273 AM07486-SS (NH2-C6)cscugugcaAfCfCfagaacaaaucs(invAb) 209 CCUGUGCAACCAGAACAAAUC 288 AM07495-SS (NH2-C6)ascUfgUfgCfaAfCfCfagaacaaauas(invAb) 210 ACUGUGCAACCAGAACAAAUA 276 AM07498-SS (NH2-C6)ascUfgUfgCfaAfcCfaGfaacaaauas(invAb) 211 ACUGUGCAACCAGAACAAAUA 276 AM07499-SS (NH2-C6)ascUfgUfgCfaAfCfCfagaacaa_2Nauas(invAb) 212 ACUGUGCAACCAGAACA(A.sup.2n)AUA 282 AM07594-SS (TriAlk7)cscugugcaAfCfCfagaacaaauas(invAb) 213 CCUGUGCAACCAGAACAAAUA 273 AM07595-SS (TriAlk8)cscugugcaAfCfCfagaacaaauas(invAb) 214 CCUGUGCAACCAGAACAAAUA 273 AM07606-SS (NH2-C6)sgscugugcaAfCfCfagaacaaauas(invAb) 215 GCUGUGCAACCAGAACAAAUA 255 (C6-SS-C6)(invAb) AM07611-SS (TriAlk9)cscugugcaAfCfCfagaacaaauas(invAb) 216 CCUGUGCAACCAGAACAAAUA 273 AM07612-SS (TriAlk10)cscugugcaAfCfCfagaacaaauas(invAb) 217 CCUGUGCAACCAGAACAAAUA 273 AM07665-SS (NH2-C6)ascuggaagGfAfCfuggaagaucas(invAb) 218 ACUGGAAGGACUGGAAGAUCA 267 AM07666-SS (NH2-C6)scsugugcaaCfCfAfgaacaaaucas(invAb) 219 CUGUGCAACCAGAACAAAUCA 259 AM07667-SS (NH2-C6)csugugcaaCfCfAfgaacaaaucas(invAb) 220 CUGUGCAACCAGAACAAAUCA 259 AM07668-SS (NH2-C6)sgscagagCfAfGfaaugacuucuuus(invAb) 221 GCAGAGCAGAAUGACUUCUUU 289 AM07670-SS (NH2-C6)gscagagCfAfGfaaugacuucuuus(invAb) 222 GCAGAGCAGAAUGACUUCUUU 289 AM07807-SS (TriAlk14)cscugugcaAfCfCfagaacaaauas(invAb) 223 CCUGUGCAACCAGAACAAAUA 273 (A.sup.2N) = 2-aminoadenine nucleotide
(79) The alpha-ENaC RNAi agents disclosed herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
(80) In some embodiments, the antisense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3. In some embodiments, the sense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4.
(81) In some embodiments, an alpha-ENaC RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, an alpha-ENaC RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2 or Table 3. In certain embodiments, an alpha-ENaC RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3.
(82) In some embodiments, an alpha-ENaC RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, an alpha-ENaC RNAi agent sense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24, of any of the sequences in Table 2 or Table 4. In certain embodiments, an alpha-ENaC RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3.
(83) For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) can be perfectly complementary to the alpha-ENaC gene, or can be non-complementary to the alpha-ENaC gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) is a U, A, or dT (or a modified version of U, A or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) forms an A:U or U:A base pair with the sense strand.
(84) In some embodiments, an alpha-ENaC RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, an alpha-ENaC RNAi sense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Table 4.
(85) In some embodiments, an alpha-ENaC RNAi agent includes (i) an antisense strand comprising the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Table 4.
(86) A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3 provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the alpha-ENaC RNAi agent has a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, and an antisense strand consisting of the modified sequence of any of the modified sequences in Table 3. Certain representative sequence pairings are exemplified by the Duplex ID Nos. shown in Table 5.
(87) In some embodiments, an alpha-ENaC RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the Duplex ID Nos. presented herein. In some embodiments, an alpha-ENaC RNAi agent consists of any of the Duplex ID Nos. presented herein. In some embodiments, an alpha-ENaC RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an alpha-ENaC RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group, linking group, and/or other non-nucleotide group wherein the targeting group, linking group, and/or other non-nucleotide group is covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, an alpha-ENaC RNAi agent includes the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an alpha-ENaC RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group, linking group, and/or other non-nucleotide group, wherein the targeting group, linking group, and/or other non-nucleotide group is covalently linked to the sense strand or the antisense strand.
(88) In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises a targeting group. In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises one or more αvβ6 integrin targeting ligands.
(89) In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises a targeting group that is an integrin targeting ligand. In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises one or more αvβ6 integrin targeting ligands or clusters of αvβ6 integrin targeting ligands (e.g., a tridentate αvβ6 integrin targeting ligand).
(90) In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 5.
(91) In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 5, and further comprises an integrin targeting ligand.
(92) In some embodiments, an alpha-ENaC RNAi agent comprises, consists of, or consists essentially of any of the duplexes of Table 5.
(93) TABLE-US-00014 TABLE 5 Alpha-ENaC RNAi Agent Duplexes with Corresponding Sense and Antisense Strand ID Numbers Duplex ID Antisense Strand ID Sense Strand ID AD04019 AM04730-AS AM05073-SS AD04020 AM04730-AS AM05074-SS AD04021 AM05080-AS AM05074-SS AD04022 AM05081-AS AM05074-SS AD04023 AM05082-AS AM05074-SS AD04024 AM05083-AS AM05075-SS AD04025 AM05084-AS AM05074-SS AD04026 AM05085-AS AM05077-SS AD04526 AM05772-AS AM05787-SS AD04527 AM05773-AS AM05788-SS AD04528 AM05774-AS AM05789-SS AD04529 AM05775-AS AM05790-SS AD04530 AM05776-AS AM05791-SS AD04531 AM05777-AS AM05792-SS AD04532 AM05778-AS AM05793-SS AD04533 AM05779-AS AM05794-SS AD04534 AM05780-AS AM05795-SS AD04535 AM05781-AS AM05796-SS AD04536 AM05782-AS AM05792-SS AD04537 AM05783-AS AM05793-SS AD04538 AM05784-AS AM05794-SS AD04539 AM05785-AS AM05795-SS AD04540 AM05786-AS AM05796-SS AD04835 AM05917-AS AM05487-SS AD04858 AM05917-AS AM05074-SS AD04859 AM06240-AS AM06162-SS AD04976 AM06460-AS AM06459-SS AD04977 AM06461-AS AM06459-SS AD04978 AM05916-AS AM06459-SS AD04979 AM06462-AS AM06459-SS AD04980 AM06462-AS AM06246-SS AD05116 AM06691-AS AM06690-SS AD05117 AM06693-AS AM06692-SS AD05118 AM06695-AS AM06694-SS AD05119 AM06697-AS AM06696-SS AD05120 AM06699-AS AM06698-SS AD05121 AM06701-AS AM06700-SS AD05160 AM06240-AS AM06459-SS AD05161 AM06765-AS AM06459-SS AD05162 AM06766-AS AM06459-SS AD05163 AM06767-AS AM06459-SS AD05345 AM05917-AS AM07064-SS AD05346 AM07066-AS AM07065-SS AD05347 AM07066-AS AM07067-SS AD05426 AM07066-AS AM07169-SS AD05427 AM07170-AS AM07065-SS AD05428 AM07066-AS AM07171-SS AD05429 AM07066-AS AM07172-SS AD05430 AM07174-AS AM07173-SS AD05453 AM07200-AS AM07067-SS AD05454 AM07200-AS AM07201-SS AD05455 AM07200-AS AM07202-SS AD05456 AM07200-AS AM07203-SS AD05457 AM07204-AS AM07067-SS AD05458 AM07206-AS AM07205-SS AD05459 AM07208-AS AM07207-SS AD05471 AM07066-AS AM07217-SS AD05472 AM07066-AS AM07218-SS AD05473 AM07200-AS AM07217-SS AD05474 AM07200-AS AM07218-SS AD05515 AM05081-AS AM07276-SS AD05548 AM07200-AS AM07280-SS AD05549 AM07200-AS AM07281-SS AD05558 AM07200-AS AM07329-SS AD05559 AM07200-AS AM07330-SS AD05560 AM07200-AS AM07331-SS AD05561 AM07333-AS AM07332-SS AD05562 AM07335-AS AM07334-SS AD05563 AM07335-AS AM07336-SS AD05564 AM07335-AS AM07337-SS AD05565 AM07335-AS AM07338-SS AD05566 AM07340-AS AM07339-SS AD05567 AM07200-AS AM07341-SS AD05568 AM07200-AS AM07172-SS AD05569 AM07200-AS AM07342-SS AD05570 AM07200-AS AM07343-SS AD05571 AM07200-AS AM07344-SS AD05611 AM07200-AS AM07400-SS AD05612 AM07200-AS AM07401-SS AD05613 AM07200-AS AM07402-SS AD05618 AM07409-AS AM07067-SS AD05619 AM07410-AS AM07067-SS AD05622 AM07411-AS AM07067-SS AD05623 AM07412-AS AM07067-SS AD05625 AM05081-AS AM05487-SS AD05671 AM07484-AS AM07067-SS AD05672 AM07485-AS AM07067-SS AD05673 AM07485-AS AM07486-SS AD05683 AM07174-AS AM07334-SS AD05684 AM07335-AS AM07495-SS AD05685 AM07496-AS AM07495-SS AD05686 AM07497-AS AM07334-SS AD05687 AM07496-AS AM07498-SS AD05688 AM07174-AS AM07337-SS AD05689 AM07335-AS AM07499-SS AD05690 AM07496-AS AM07499-SS AD05691 AM07497-AS AM07337-SS AD05757 AM07200-AS AM07594-SS AD05758 AM07200-AS AM07595-SS AD05772 AM07605-AS AM05487-SS AD05773 AM05081-AS AM07606-SS AD05778 AM07200-AS AM07611-SS AD05779 AM07200-AS AM07612-SS AD05829 AM06691-AS AM07665-SS AD05830 AM05774-AS AM07666-SS AD05831 AM05774-AS AM07667-SS AD05832 AM07669-AS AM07668-SS AD05833 AM07669-AS AM07670-SS AD05924 AM07200-AS AM07807-SS
(94) In some embodiments, an alpha-ENaC RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. The RNAi agents described herein, upon delivery to a cell expressing an alpha-ENaC gene, inhibit or knockdown expression of one or more alpha-ENaC genes in vivo and/or in vitro.
(95) Targeting Groups, Linking Groups, Pharmacokinetic (PK) Modulators, and Delivery Vehicles
(96) In some embodiments, an alpha-ENaC RNAi agent contains or is conjugated to one or more non-nucleotide groups including, but not limited to, a targeting group, a linking group, a pharmacokinetic (PK) modulator, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery, or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 6. The non-nucleotide group can be covalently linked to the 3′ and/or 5′ end of either the sense strand and/or the antisense strand. In some embodiments, an alpha-ENaC RNAi agent contains a non-nucleotide group linked to the 3′ and/or 5′ end of the sense strand. In some embodiments, a non-nucleotide group is linked to the 5′ end of an alpha-ENaC RNAi agent sense strand. A non-nucleotide group can be linked directly or indirectly to the RNAi agent via a linker/linking group. In some embodiments, a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.
(97) In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent.
(98) Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell-specific (including, in some cases, organ specific) distribution and cell-specific (or organ specific) uptake of the conjugate or RNAi agent. A targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency for the target to which it is directed. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecule, cell receptor ligands, hapten, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules. In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and/or ribitol (abasic ribose) residues, which in some instances can serve as linkers. In some embodiments, a targeting group comprises an integrin targeting ligand.
(99) The alpha-ENaC RNAi agents described herein can be synthesized having a reactive group, such as an amino group (also referred to herein as an amine), at the 5′-terminus and/or the 3′-terminus. The reactive group can be used subsequently to attach a targeting moiety using methods typical in the art.
(100) For example, in some embodiments, the alpha-ENaC RNAi agents disclosed herein are synthesized having an NH2-C6 group at the 5′-terminus of the sense strand of the RNAi agent. The terminal amino group subsequently can be reacted to form a conjugate with, for example, a group that includes an αvβ6 integrin targeting ligand. In some embodiments, the alpha-ENaC RNAi agents disclosed herein are synthesized having one or more alkyne groups at the 5′-terminus of the sense strand of the RNAi agent. The terminal alkyne group(s) can subsequently be reacted to form a conjugate with, for example, a group that includes an αvβ6 integrin targeting ligand.
(101) In some embodiments, a targeting group comprises an integrin targeting ligand. In some embodiments, an integrin targeting ligand is an αvβ6 integrin targeting ligand. The use of an αvβ6 integrin targeting ligand facilitates cell-specific targeting to cells having αvβ6 on its respective surface, and binding of the integrin targeting ligand can facilitate entry of the therapeutic agent, such as an RNAi agent, to which it is linked, into cells such as epithelial cells, including pulmonary epithelial cells and renal epithelial cells. Integrin targeting ligands can be monomeric or monovalent (e.g., having a single integrin targeting moiety) or multimeric or multivalent (e.g., having multiple integrin targeting moieties). The targeting group can be attached to the 3′ and/or 5′ end of the RNAi oligonucleotide using methods known in the art. The preparation of targeting groups, such as αvβ6 integrin targeting ligands, is described, for example, in International Patent Application Publication No. WO 2018/085415 and in U.S. Provisional Patent Application Nos. 62/580,398 and 62/646,739, the contents of each of which are incorporated herein in its entirety.
(102) Embodiments of the present disclosure include pharmaceutical compositions for delivering an alpha-ENaC RNAi agent to a pulmonary epithelial cell in vivo. Such pharmaceutical compositions can include, for example, an alpha-ENaC RNAi agent conjugated to a targeting group that comprises an integrin targeting ligand. In some embodiments, the integrin targeting ligand is comprised of an αvβ6 integrin ligand.
(103) In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linkage of the agent to a targeting group, pharmacokinetic modulator, delivery polymer, or delivery vehicle. The linking group can be linked to the 3′ and/or the 5′ end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5′ or 3′ end of an RNAi agent sense strand. In some embodiments, a linking group is conjugated to the 5′ end of an RNAi agent sense strand. Examples of linking groups, include, but are not limited to: Alk-SMPT-C6, Alk-SS-C6, DBCO-TEG, Me-Alk-SS-C6, and C6-SS-Alk-Me, reactive groups such a primary amines and alkynes, alkyl groups, abasic residues/nucleotides, amino acids, tri-alkyne functionalized groups, ribitol, and/or PEG groups.
(104) A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group, pharmacokinetic modulator, or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage can optionally include a spacer that increases the distance between the two joined atoms. A spacer may further add flexibility and/or length to the linkage. Spacers include, but are not be limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description.
(105) In some embodiments, targeting groups are linked to the alpha-ENaC RNAi agents without the use of an additional linker. In some embodiments, the targeting group is designed having a linker readily present to facilitate the linkage to an alpha-ENaC RNAi agent. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents can be linked to their respective targeting groups using the same linkers. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents are linked to their respective targeting groups using different linkers.
(106) Any of the alpha-ENaC RNAi agent nucleotide sequences listed in Tables 2, 3, and 4, whether modified or unmodified, can contain 3′ and/or 5′ targeting group(s), linking group(s), and/or pharmacokinetic modulator(s). Any of the alpha-ENaC RNAi agent sequences listed in Tables 3 and 4, or are otherwise described herein, which contain a 3′ or 5′ targeting group, linking group, or pharmacokinetic modulator can alternatively contain no 3′ or 5′ targeting group, linking group, or pharmacokinetic modulator, or can contain a different 3′ or 5′ targeting group, linking group, or pharmacokinetic modulator including, but not limited to, those depicted in Table 6. Any of the alpha-ENaC RNAi agent duplexes listed in Table 5, whether modified or unmodified, can further comprise a targeting group or linking group, including, but not limited to, those depicted in Table 6, and the targeting group or linking group can be attached to the 3′ or 5′ terminus of either the sense strand or the antisense strand of the alpha-ENaC RNAi agent duplex.
(107) Examples of certain targeting groups and linking groups are provided in Table 6.
(108) TABLE-US-00015 TABLE 6 Structures Representing Various Modified Nucleotides, Targeting Groups, and Linking Groups
(109) Alternatively, other linking groups known in the art may be used.
(110) In some embodiments, a delivery vehicle may be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of the RNAi agent to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine.
(111) In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example WO 2000/053722, WO 2008/022309, WO 2011/104169, and WO 2012/083185, WO 2013/032829, WO 2013/158141, each of which is incorporated herein by reference), or other delivery systems available in the art.
(112) Pharmaceutical Compositions and Formulations
(113) The alpha-ENaC RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as “medicaments”). In some embodiments, pharmaceutical compositions include at least one alpha-ENaC RNAi agent. These pharmaceutical compositions are particularly useful in the inhibition of the expression of alpha-ENaC mRNA in a target cell, a group of cells, a tissue, or an organism. The pharmaceutical compositions can be used to treat a subject having a disease, disorder, or condition that would benefit from reduction in the level of the target mRNA, or inhibition in expression of the target gene. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease or disorder that would benefit from reduction of the level of the target mRNA or an inhibition in expression the target gene. In one embodiment, the method includes administering an alpha-ENaC RNAi agent linked to a targeting ligand as described herein, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and/or delivery polymers) are added to the pharmaceutical compositions that include an alpha-ENaC RNAi agent, thereby forming a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.
(114) The pharmaceutical compositions that include an alpha-ENaC RNAi agent and methods disclosed herein decrease the level of the target mRNA in a cell, group of cells, group of cells, tissue, organ, or subject, including by administering to the subject a therapeutically effective amount of a herein described alpha-ENaC RNAi agent, thereby inhibiting the expression of alpha-ENaC mRNA in the subject. In some embodiments, the subject has been previously identified or diagnosed as having a disease or disorder that is mediated at least in part by ENaC expression. In some embodiments, the subject has been previously identified or diagnosed as having enhanced. ENaC activity in one or more cells or tissues. In some embodiments, the subject has been previously diagnosed with having one or more respiratory diseases such as cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infections, primary ciliary dyskinesia, and lung carcinoma cystic fibrosis. In some embodiments, the subject has been previously diagnosed with having one or more ocular diseases such as dry eye. In some embodiments, the subject has been suffering from symptoms associated with one or more respiratory diseases that is associated with or caused by enhanced ENaC activity.
(115) In some embodiments, the described pharmaceutical compositions including an alpha-ENaC RNAi agent are used for treating or managing clinical presentations in a subject that would benefit from the inhibition of expression of ENaC. In some embodiments, a therapeutically or prophylactically effective amount of one or more of pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed alpha-ENaC RNAi agents can be used to decrease the number, severity, and/or frequency of symptoms of a disease in a subject.
(116) The described pharmaceutical compositions that include an alpha-ENaC RNAi agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from reduction or inhibition in expression of alpha-ENaC mRNA. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions that include an alpha-ENaC RNAi agent thereby treating the symptom. In other embodiments, the subject is administered a prophylactically effective amount of one or more alpha-ENaC RNAi agents, thereby preventing or inhibiting the at least one symptom.
(117) The route of administration is the path by which an alpha-ENaC RNAi agent is brought into contact with the body. In general, methods of administering drugs, oligonucleotides, and nucleic acids, for treatment of a mammal are well known in the art and can be applied to administration of the compositions described herein. The alpha-ENaC RNAi agents disclosed herein can be administered via any suitable route in a preparation appropriately tailored to the particular route. Thus, in some embodiments, the herein described pharmaceutical compositions are administered via inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration administration. In some embodiments, the pharmaceutical compositions can be administered by injection, for example, intravenously, intramuscularly, intracutaneously, subcutaneously, intraarticularly, or intraperitoneally, or topically.
(118) The pharmaceutical compositions including an alpha-ENaC RNAi agent described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery technologies known in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration, (e.g., direct injection, implantation, or topical administering), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the compositions are administered via inhalation, intranasal administration, oropharyngeal aspiration administration, or intratracheal administration. For example, in some embodiments, it is desired that the alpha-ENaC RNAi agents described herein inhibit the expression of an alpha-ENaC gene in the pulmonary epithelium, for which administration via inhalation (e.g., by an inhaler device, such as a metered-dose inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler) is particularly suitable and advantageous.
(119) In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.
(120) As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the Active Pharmaceutical Ingredient (API, therapeutic product, e.g., alpha-ENaC RNAi agent) that are intentionally included in the drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients can act to a) aid in processing of the drug delivery system during manufacture, b) protect, support or enhance stability, bioavailability or patient acceptability of the API, c) assist in product identification, and/or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.
(121) Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti-foaming agents, anti-oxidants, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water-repelling agents, and wetting agents.
(122) Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
(123) Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
(124) Formulations suitable for intra-articular administration can be in the form of a sterile aqueous preparation of the drug that can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems can also be used to present the drug for both intra-articular and ophthalmic administration.
(125) Formulations suitable for inhalation administration can be prepared by incorporating the active compound in the desired amount in an appropriate solvent, followed by sterile filtration. In general, formulations for inhalation administration are sterile solutions at physiological pH and have low viscosity (<5 cP). Salts may be added to the formulation to balance tonicity. In some cases, surfactants or co-solvents can be added to increase active compound solubility and improve aerosol characteristics. In some cases, excipients can be added to control viscosity in order to ensure size and distribution of nebulized droplets.
(126) The active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
(127) The alpha-ENaC RNAi agents can be formulated in compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
(128) A pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: anti-pruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamine, diphenhydramine, etc.). It is also envisioned that cells, tissues, or isolated organs that express or comprise the herein defined RNAi agents may be used as “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeutically effective amount,” or simply “effective amount” refers to that amount of an RNAi agent to produce a pharmacological, therapeutic, or preventive result.
(129) In some embodiments, the methods disclosed herein further comprise the step of administering a second therapeutic or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic is another alpha-ENaC RNAi agent (e.g., an alpha-ENaC RNAi agent that targets a different sequence within the alpha-ENaC target). In other embodiments, the second therapeutic can be a small molecule drug, an antibody, an antibody fragment, and/or an aptamer.
(130) Generally, an effective amount of an alpha-ENaC RNAi agent disclosed herein will be in the range of from about 0.0001 to about 20 mg/kg of body weight/day, e.g., from about 0.001 to about 3 mg/kg of body weight/day. In some embodiments, an effective amount of an alpha-ENaC RNAi agent will be in the range of from about 0.001 to about 0.500 mg/kg of body weight per dose. In some embodiments, an effective amount of an alpha-ENaC RNAi agent will be in the range of from about 0.001 to about 0.100 mg/kg of body weight per dose. In some embodiments, an effective amount of an alpha-ENaC RNAi agent will be in the range of from about 0.001 to about 0.050 mg/kg of body weight per dose. The amount administered will also likely depend on such variables as the overall health status of the patient, the relative biological efficacy of the compound delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Also, it is to be understood that the initial dosage administered can be increased beyond the above upper level to rapidly achieve the desired blood-level or tissue level, or the initial dosage can be smaller than the optimum.
(131) For treatment of disease or for formation of a medicament or composition for treatment of a disease, the pharmaceutical compositions described herein including an alpha-ENaC RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment including, but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, peptide, and/or an aptamer.
(132) The described alpha-ENaC RNAi agents, when added to pharmaceutically acceptable excipients or adjuvants, can be packaged into kits, containers, packs, or dispensers. The pharmaceutical compositions described herein can be packaged in dry powder or aerosol inhalers, other metered-dose inhalers, nebulizers, pre-filled syringes, or vials.
(133) Methods of Treatment and Inhibition of Expression
(134) The alpha-ENaC RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) that would benefit from a reduction and/or inhibition in expression of alpha-ENaC mRNA.
(135) In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) having a disease or disorder for which the subject would benefit from reduction in ENaC channel activity, including but not limited to, for example, cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infections, primary ciliary dyskinesia, and/or lung carcinoma cystic fibrosis and/or dry eye. Treatment of a subject can include therapeutic and/or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more alpha-ENaC RNAi agents described herein. The subject can be a human, patient, or human patient. The subject may be an adult, adolescent, child, or infant. Administration of a pharmaceutical composition described herein can be to a human being or animal.
(136) Increased ENaC activity is known to promote airway surface liquid dehydration and impair mucociliary clearance. In some embodiments, the described alpha-ENaC RNAi agents are used to treat at least one symptom mediated at least in part by ENaC activity levels, in a subject. The subject is administered a therapeutically effective amount of any one or more of the described alpha-ENaC RNAi agents. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described RNAi agents, thereby treating the subject by preventing or inhibiting the at least one symptom.
(137) In certain embodiments, the present disclosure provides methods for treatment of diseases, disorders, conditions, or pathological states mediated at least in part by alpha-ENaC gene expression, in a patient in need thereof, wherein the methods include administering to the patient any of the alpha-ENaC RNAi agents described herein.
(138) In some embodiments, the alpha-ENaC RNAi agents are used to treat or manage a clinical presentation or pathological state in a subject, wherein the clinical presentation or pathological state is mediated at least in part by ENaC expression. The subject is administered a therapeutically effective amount of one or more of the alpha-ENaC RNAi agents or alpha-ENaC RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering a composition comprising an alpha-ENaC RNAi agent described herein to a subject to be treated.
(139) In some embodiments, the gene expression level and/or mRNA level of an alpha-ENaC gene in certain epithelial cells of subject to whom a described alpha-ENaC RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%, relative to the subject prior to being administered the alpha-ENaC RNAi agent or to a subject not receiving the alpha-ENaC RNAi agent. In some embodiments, the ENaC levels or ENaC channel activity levels in certain epithelial cells of a subject to whom a described alpha-ENaC RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%, relative to the subject prior to being administered the alpha-ENaC RNAi agent or to a subject not receiving the alpha-ENaC RNAi agent. The gene expression level, protein level, and/or mRNA level in the subject may be reduced in a cell, group of cells, and/or tissue of the subject. In some embodiments, the alpha-ENaC mRNA levels in certain epithelial cells subject to whom a described alpha-ENaC RNAi agent has been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being administered the alpha-ENaC RNAi agent or to a subject not receiving the alpha-ENaC RNAi agent. In some embodiments, the level of the ENaC heterotrimeric protein complex in certain epithelial cells in a subject to whom a described alpha-ENaC RNAi agent has been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being administered the alpha-ENaC RNAi agent or to a subject not receiving the alpha-ENaC RNAi agent. The ENaC level in the subject may be reduced in a cell, group of cells, tissue, blood, and/or other fluid of the subject. For example, in some embodiments, the level of alpha-ENaC mRNA and/or ENaC heterotrimeric protein complex in pulmonary epithelial cells of a subject to whom a described alpha-ENaC RNAi agent has been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being administered the alpha-ENaC RNAi agent or to a subject not receiving the alpha-ENaC RNAi agent. In some embodiments, the level of alpha-ENaC mRNA and/or ENaC heterotrimeric protein complex and/or ENaC channel activity levels in a subset of pulmonary epithelial cells, such as airway epithelial cells, of a subject to whom a described alpha-ENaC RNAi agent has been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being administered the alpha-ENaC RNAi agent or to a subject not receiving the alpha-ENaC RNAi agent.
(140) A reduction in gene expression, mRNA, and protein levels can be assessed by any methods known in the art. Reduction or decrease in alpha-ENaC mRNA level, ENaC channel activity level, and/or ENaC heterotrimeric protein complex levels, are collectively referred to herein as a reduction or decrease in alpha-ENaC or inhibiting or reducing the expression of the alpha-ENaC gene. The Examples set forth herein illustrate known methods for assessing inhibition of alpha-ENaC gene expression.
(141) Cells, Tissues, Organs, and Non-Human Organisms
(142) Cells, tissues, organs, and non-human organisms that include at least one of the alpha-ENaC RNAi agents described herein are contemplated. The cell, tissue, organ, or non-human organism is made by delivering the RNAi agent to the cell, tissue, organ, or non-human organism.
(143) The above provided embodiments and items are now illustrated with the following, non-limiting examples.
EXAMPLES
Example 1. Synthesis of Alpha-ENaC RNAi Agents
(144) The Alpha-ENaC RNAi agent duplexes shown in Table 5 were synthesized in accordance with the following:
(145) A. Synthesis.
(146) The sense and antisense strands of the alpha-ENaC RNAi agents were synthesized according to phosphoramidite technology on solid phase used in oligonucleotide synthesis. Depending on the scale, a MerMade96E® (Bioautomation), a MerMade12® (Bioautomation), or an OP Pilot 100 (GE Healthcare) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, Pa., USA). All RNA and 2′-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, Wis., USA). Specifically, the 2′-O-methyl phosphoramidites that were used included the following: (5′-O-dimethoxytrityl-N.sup.6-(benzoyl)-2′-O-methyl-adenosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5′-O-dimethoxy-trityl-N.sup.4-(acetyl)-2′-O-methyl-cytidine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, (5′-O-dimethoxytrityl-N.sup.2-(isobutyryl)-2′-O-methyl-guanosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5′-O-dimethoxytrityl-2′-O-methyl-uridine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2′-deoxy-2′-fluoro-phosphoramidites carried the same protecting groups as the 2′-O-methyl RNA amidites. 5′-dimethoxytrityl-2′-O-methyl-inosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from Glen Research (Virginia). The inverted abasic (3′-O-dimethoxytrityl-2′-deoxyribose-5′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from ChemGenes (Wilmington, Mass., USA). The following UNA phosphoramidites were used: 5′-(4,4′-Dimethoxytrityl)-N6-(benzoyl)-2′,3′-seco-adenosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5′-(4,4′-Dimethoxytrityl)-N-acetyl-2′,3′-seco-cytosine, 2′-benzoyl-3 ‘-[(2-cyanoethyl)-(N,N-diiso-propyl)]-phosphoramidite, 5’-(4,4′-Dimethoxytrityl)-N-isobutyryl-2′,3′-seco-guanosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5′-(4,4′-Dimethoxy-trityl)-2′,3′-seco-uridine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diiso-propyl)]-phosphoramidite. TFA aminolink phosphoramidites were also commercially purchased (ThermoFisher).
(147) Tri-alkyne-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 minutes (RNA), 90 seconds (2′ OMe), and 60 seconds (2′ F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, Mass., USA) in anhydrous acetonitrile was employed.
(148) Alternatively, tri-alkyne moieties were introduced post-synthetically (see section E, below). For this route, the sense strand was functionalized with a 5′ and/or 3′ terminal nucleotide containing a primary amine. TFA aminolink phosphoramidite was dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 minutes (RNA), 90 seconds (2′ OMe), and 60 seconds (2′ F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, Mass., USA) in anhydrous acetonitrile was employed.
(149) B. Cleavage and Deprotection of Support Hound Oligomer.
(150) After finalization of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt. 9/0 methylamine in water and 28% to 31% ammonium hydroxide solution (Aldrich) for 1.5 hours at 30° C. The solution was evaporated and the solid residue was reconstituted in water (see below).
(151) C. Purification.
(152) Crude oligomers were purified by anionic exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and Shimadzu LC-8 system. Buffer A was 20 mM Iris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC using a GE Healthcare XK 16/40 column packed with Sephadex G-25 fine with a running buffer of 100 mM ammonium bicarbonate, pH 6.7 and 20% Acetonitrile or filtered water. Alternatively, pooled fractions were desalted and exchanged into an appropriate buffer or solvent system via tangential flow filtration.
(153) D. Annealing.
(154) Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1×PBS (Phosphate-Buffered Saline, 1×, Corning, Cellgro) to form the RNAi agents. Some RNAi agents were lyophilized and stored at −15 to −25° C. Duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in 1×PBS. The solution absorbance at 260 nm was then multiplied by a conversion factor and the dilution factor to determine the duplex concentration. Unless otherwise stated, the conversion factor used was 0.037 mg/(mL.Math.cm).
(155) E. Conjugation of Tri-Alkyne Linker.
(156) Either prior to or after annealing, the 5′ or 3′ amine functionalized sense strand is conjugated to a tri-alkyne linker. An example tri-alkyne linker structure that can be used in forming the constructs disclosed herein is as follows:
(157) ##STR00059##
The following describes the conjugation of tri-alkyne linker to the annealed duplex: Amine-functionalized duplex was dissolved in 90% DMSO/10% H.sub.2O, at ˜50-70 mg/mL. 40 equivalents triethylamine was added, followed by 3 equivalents tri-alkyne-PNP. Once complete, the conjugate was precipitated twice in a solvent system of 1× phosphate buffered saline/acetonitrile (1:14 ratio), and dried.
F. Conjugation of Targeting Ligands.
(158) Either prior to or after annealing, the 5′ or 3′ tridentate alkyne functionalized sense strand is conjugated to targeting ligands. The following example describes the conjugation of targeting ligands to the annealed duplex: Stock solutions of 0.5M Tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 0.5M of Cu(II) sulfate pentahydrate (Cu(II)SO4.5H2O) and 2M solution of sodium ascorbate were prepared in deionized water. A 75 mg/mL solution in DMSO of targeting ligand was made. In a 1.5 mL centrifuge tube containing tri-alkyne functionalized duplex (3 mg, 75 μL, 40 mg/mL in deionized water, ˜15,000 g/mol), 25 μL of 1M Hepes pH 8.5 buffer is added. After vortexing, 35 μL of DMSO was added and the solution is vortexed. Targeting ligand was added to the reaction (6 equivalents/duplex, 2 equivalents/alkyne, ˜15 μL) and the solution is vortexed. Using pH paper, pH was checked and confirmed to be pH˜8. In a separate 1.5 mL centrifuge tube, 50 μL of 0.5M THPTA was mixed with 10 uL of 0.5M Cu(II)SO.sub.4.5H.sub.2O, vortexed, and incubated at room temp for 5 min. After 5 min, THPTA/Cu solution (7.2 μL, 6 equivalents 5:1 THPTA:Cu) was added to the reaction vial, and vortexed. Immediately afterwards, 2M ascorbate (5 μL, 50 equivalents per duplex, 16.7 per alkyne) was added to the reaction vial and vortexed. Once the reaction was complete (typically complete in 0.5-1 h), the reaction was immediately purified by non-denaturing anion exchange chromatography.
Example 2. In Vivo Intratracheal Administration of Alpha-ENaC RNAi Agents in Mice
(159) To assess the activity of alpha-ENaC RNAi agents in vivo, male ICR mice were administered 50 microliters via a microsprayer device (Penn Century, Philadelphia, Pa.) suitable for intratracheal (IT) administration on study days 1 and 2, of either isotonic saline vehicle for use as a control, or 5 mg/kg of one of the following alpha-ENaC RNAi agents without conjugate ligand (i.e., “naked RNAi agent”) formulated in isotonic saline: AD04019, AD04020, AD04021, AD04022, AD04023, AD04024, AD04025, or AD04026. (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(160) Either 4 or 5 mice were dosed per group. Mice were sacrificed (sac) on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(161)
Example 3. In Vivo Intratracheal Administration of Alpha-ENaC RNAi Agents in Mice
(162) On study days 1 and 2, male ICR mice were administered 50 microliters via a microsprayer device (Penn Century, Philadelphia, Pa.) suitable for intratracheal (IT) administration, of either isotonic saline vehicle to use as a control, or 3 mg/kg of an alpha-ENaC RNAi agent (i.e., either AD04025 or AD04858 (see, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example)), formulated in isotonic saline. Either 4 or 5 mice were dosed per group. Mice were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1 Å) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(163)
Example 4. In Vivo Intratracheal Administration of Alpha-ENaC RNAi Agents with and without Conjugation to Epithelial Cell Targeting Ligands in Rats
(164) On study days 1 and 2, male Sprague Dawley rats were administered 200 microliters via a microsprayer device (Penn Century, Philadelphia, Pa.) suitable for intratracheal (IT) administration, of either 0.5 mg/kg, 1.5 mg/kg, or 5 mg/kg of an alpha-ENaC RNAi agent formulated in isotonic saline. Five (5) rats were dosed per group. Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(165)
Example 5. In Vivo Oropharyngeal Aspiration Administration of Alpha-ENaC RNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rats
(166) On study day 1, male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, according to the following dosing groups recited in Table 7:
(167) TABLE-US-00016 TABLE 7 Dosing Groups of Rats in Example 5 Group RNAi Agent and Dose Dosing Regimen 1 Isotonic saline (no RNAi agent) Single OP dose on day 1 2 0.5 mg/kg of AD05347 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 3 0.5 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 4 0.5 mg/kg of AD05454 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 5 0.5 mg/kg of AD05455 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 6 0.5 mg/kg of AD05456 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 7 0.5 mg/kg of AD05457 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline.
(168) (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(169) The tridentate small molecule αvβ6 epithelial cell targeting ligand referred to as Tri-SM2 in Groups 2 through 7 has the structure represented in
(170) Five (5) rats were dosed per group (n=5). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1 Å) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(171) TABLE-US-00017 TABLE 8 Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 5 Average Relative rENaC mRNA Expression (n = 5 for Low High Group ID each group) (error) (error) Group 1 (isotonic saline) 1.000 0.161 0.192 Group 2 (0.5 mg/kg AD05347) 0.411 0.039 0.042 Group 3 (0.5 mg/kg AD05453) 0.678 0.092 0.106 Group 4 (0.5 mg/kg AD05454) 0.728 0.127 0.154 Group 5 (0.5 mg/kg AD05455) 0.663 0.075 0.084 Group 6 (0.5 mg/kg AD05456) 0.633 0.101 0.120 Group 7 (0.5 mg/kg AD05457) 0.726 0.174 0.228
(172) As shown in Table 8 above, each of the alpha-ENaC RNAi agents showed a reduction in mRNA expression in rats compared to control. For example, AD05347, which includes a cyclopropyl-phosphonate group located at the 5′ terminal end of the antisense strand, had an average reduction of approximately 59% (0.411) of mRNA compared to the control group.
(173) Further, each of the other alpha-ENaC RNAi agents showed a reduction of at least approximately 27% of rENaC mRNA compared to control.
Example 6. In Vivo Intratracheal Administration of Alpha-ENaC RNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rats
(174) On study day 1, male Sprague Dawley rats were administered 200 microliters via a microsprayer device (Penn Century, Philadelphia, Pa.) suitable for intratracheal (IT) administration, of either isotonic saline vehicle for use as a control, or one of the following alpha-ENaC RNAi agents according to the following dosing groups recited in Table 9:
(175) TABLE-US-00018 TABLE 9 Dosing Groups of Rats in Example 6 Group RNAi Agent and Dose Dosing Regimen 1 Isotonic saline (no RNAi agent) Single IT dose on day 1 2 1.5 mg/kg of AD04835 conjugated to a tridentate small Single IT dose molecule αvβ6 epithelial cell targeting ligand (Tri-SM1) at the on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 3 1.5 mg/kg of AD04835 conjugated to a tridentate small Single IT dose molecule αvβ6 epithelial cell targeting ligand (Tri-SM1) on day 1 further including a cysteine-PEG2 linkage at the 5′ terminal end of the sense strand, formulated in isotonic saline. 4 1.5 mg/kg of AD05346 conjugated to a tridentate small Single IT dose molecule αvβ6 epithelial cell targeting ligand (Tri-SM1) at the on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 5 1.5 mg/kg of AD05345 conjugated to a tridentate small Single IT dose molecule αvβ6 epithelial cell targeting ligand (Tri-SM1) at the on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 6 1.5 mg/kg of AD05347 conjugated to a tridentate small Single IT dose molecule αvβ6 epithelial cell targeting ligand (Tri-SM1) at the on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 7 1.5 mg/kg of AD04835 conjugated to a monodentate peptide- Single IT dose based αvβ6 epithelial cell targeting ligand which further on day 1 included a PEG20 linker, followed by a peptide linker (PheCitPhePro (SEQ ID NO: 290)), a 20 kilodalton (KDa) PEG group, and a cysteine linker, which was then conjugated at the 5′ terminal end of the sense strand, formulated in isotonic saline.
(176) (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(177) The tridentate small molecule αvβ6 epithelial cell targeting ligand referred to as Tri-SM1 in Groups 2, 5, and 6, has the structure represented in
(178) ##STR00060##
(179) Five (5) rats were dosed in each of Groups 1, 2, 3, 4, 5, and 7 (n=5), and four (4) rats were dosed in Group 6. Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(180) TABLE-US-00019 TABLE 10 Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 6 Average Relative rENaC mRNA Low High Group ID Expression (error) (error) Group 1 (isotonic saline) 1.000 0.082 0.089 Group 2 (1.5 mg/kg AD04835-Tri-SM1) 0.453 0.098 0.126 Group 3 (1.5 mg/kg AD04835-PEG.sub.2-Cys-Tri-SM1) 0.365 0.076 0.095 Group 4 (1.5 mg/kg AD07065-PEG.sub.2-Cys-Tri-SM1) 0.412 0.136 0.204 Group 5 (1.5 mg/kg AD05345-Tri-SM1) 0.404 0.097 0.128 Group 6 (1.5 mg/kg AD05347-Tri-SM1) 0.311 0.048 0.057 Group 7 (1.5 mg/kg AD05453-Cys-PEG20 kDa- 0.354 0.078 0.101 peptide linker-PEG.sub.20-Tri-peptide ligand)
(181) As shown in Table 10 above, each of the alpha-ENaC RNAi agents showed a reduction in mRNA expression in rats compared to control. In addition, the use of a tridentate small molecule αvβ6 epithelial cell targeting ligand shows comparable reduction in mRNA expression when compared to a peptide-based αvβ6 epithelial cell targeting ligand that further included a 20 kDa PEG PK modifier.
Example 7. In Vivo Oropharyngeal Aspiration Administration of Alpha-ENaC RNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rats
(182) On study day 1, male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, according to the following dosing groups recited in Table 11:
(183) TABLE-US-00020 TABLE 11 Dosing Groups of Rats in Example 7 Group RNAi Agent and Dose Dosing Regimen 1 Isotonic saline (no RNAi agent) Single OP dose on day 1 2 0.5 mg/kg of AD05347 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 3 0.5 mg/kg of AD05458 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 4 0.5 mg/kg of AD05459 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 5 0.5 mg/kg of AD05562 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 6 0.5 mg/kg of AD05563 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 7 0.5 mg/kg of AD05564 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) that dose on day 1 further includes a cysteine linking group at the 5′ terminal end of the sense strand, formulated in isotonic saline. 8 0.5 mg/kg of AD05565 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 9 0.5 mg/kg of AD05567 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 10 0.5 mg/kg of AD05570 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline.
(184) (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(185) The tridentate small molecule αvβ6 epithelial cell targeting ligand referred to as Tri-SM2 in each of Groups 2-6 and 8-10, has the structure represented in
(186) Four (4) rats were dosed in Groups 1, 2, 3, 4, 5, 6, 7, and 9 (n=4), and three (3) rats were dosed in Groups 8 and 10 (n=3). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(187) TABLE-US-00021 TABLE 12 Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 7 Number Average Relative of rats rENaC mRNA Low High Group ID (n=) Expression (error) (error) Group 1 (isotonic saline) 4 1.000 0.041 0.043 Group 2 (0.5 mg/kg AD05347) 4 0.457 0.088 0.109 Group 3 (0.5 mg/kg AD05458) 4 0.708 0.055 0.059 Group 4 (0.5 mg/kg AD05459) 4 0.753 0.174 0.227 Group 5 (0.5 mg/kg AD05562) 4 0.608 0.056 0.062 Group 6 (0.5 mg/kg AD05563) 4 0.621 0.048 0.053 Group 7 (0.5 mg/kg AD05564) 4 0.569 0.095 0.114 Group 8 (0.5 mg/kg AD05565) 3 0.627 0.066 0.073 Group 9 (0.5 mg/kg AD05567) 4 0.638 0.087 0.100 Group 10 (0.5 mg/kg AD05570) 3 0.645 0.123 0.151
(188) As shown in Table 12 above, each of the alpha-ENaC RNAi agents showed a reduction in mRNA expression in rats compared to control. For example, AD05347 showed approximately a 54% reduction (0.457) in average rENaC mRNA expression compared to control.
Example 8. In Vivo Oropharyngeal Aspiration Administration of Alpha-ENaC RNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rats
(189) On study day 1, male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, according to the following dosing groups recited in Table 13:
(190) TABLE-US-00022 TABLE 13 Dosing Groups of Rats in Example 8 Group RNAi Agent and Dose Dosing Regimen 1 Isotonic saline (no RNAi agent) Single OP dose on day 1 2 0.5 mg/kg of AD05347 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 3 0.5 mg/kg of AD05347 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 4 0.5 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM2) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 5 0.5 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM9) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 6 0.5 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 7 0.5 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM8) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 8 0.5 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 9 0.5 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM10) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 10 0.5 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM11) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 11 0.5 mg/kg of AD05453 conjugated to a tridentate peptide- Single OP based αvβ6 epithelial cell targeting ligand at the 5′ terminal end dose on day 1 of the sense strand, formulated in isotonic saline.
(191) (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(192) The tridentate small molecule αvβ6 epithelial cell targeting ligand referred to as Tri-SM2 in Group 2 and Group 4 has the structure represented in
(193) Four (4) rats were dosed in each Group (n=4). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1 Å) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(194) TABLE-US-00023 TABLE 14 Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 8 Average Relative rENaC mRNA Low High Group ID Expression (error) (error) Group 1 (isotonic saline) 1.000 0.162 0.193 Group 2 (0.5 mg/kg AD05347-Tri-SM2) 0.469 0.101 0.129 Group 3 (0.5 mg/kg AD05347-Tri-SM6.1) 0.358 0.078 0.100 Group 4 (0.5 mg/kg AD05453-Tri-SM2) 0.562 0.086 0.102 Group 5 (0.5 mg/kg AD05453-Tri-SM9) 0.620 0.168 0.230 Group 6 (0.5 mg/kg AD05453-Tri-SM6) 0.559 0.099 0.120 Group 7 (0.5 mg/kg AD05453-Tri-SM8) 0.691 0.072 0.081 Group 8 (0.5 mg/kg AD05453-Tri-SM6.1) 0.454 0.055 0.063 Group 9 (0.5 mg/kg AD05453-Tri-SM10) 0.454 0.080 0.097 Group 10 (0.5 mg/kg AD05453-Tri-SM11) 0.577 0.113 0.140 Group 11 (0.5 mg/kg AD05453-tridentate 0.558 0.057 0.064 peptide ligand)
(195) As shown in Table 14 above, each of the alpha-ENaC RNAi agents showed a reduction in mRNA expression in rats compared to control. For example, AD05347-Tri-SM6.1 (Group 3) showed approximately a 64% reduction (0.358) in average rENaC mRNA expression compared to control, and AD05453-Tri-SM6.1 (Group 8) showed approximately a 55% reduction (0.454) in average rENaC mRNA expression compared to control. Further, Groups 8 and 9 achieved approximately 55% reduction (0.454) in average rENaC mRNA expression without the use of a 5′ terminal cyclopropyl-phosphonate modification on the antisense strand, and showed a comparable inhibitory effect to Group 2, which had approximately 53% reduction (0.469) in average rENaC mRNA expression with 5′ antisense cyclopropyl-phosphonate modification. Moreover, as observed in groups 4, 6, 8, 9, and 10, tridentate small molecule αvβ6 epithelial cell targeting ligands were comparable or in some instances numerically superior to Group 11 (e.g., Groups 8 and 9 that included Tri-SM6.1 and Tri-SM10), which utilized a tridentate peptide-based αvβ6 epithelial cell targeting ligand known to have affinity for integrin αvβ6 (See International Patent Application Publication No. WO 2018/085415 at
Example 9. In Vivo Oropharyngeal Aspiration Administration of Alpha-ENaC RNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rats
(196) On study day 1, male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, which included the following dosing groups recited in Table 15:
(197) TABLE-US-00024 TABLE 15 Dosing Groups of Rats in Example 9 Group RNAi Agent and Dose Dosing Regimen 1 Isotonic saline (no RNAi agent) Single OP dose on day 1 2 0.5 mg/kg of AD05453 without any targeting ligand (i.e., Single OP “naked RNAi agent”), formulated in isotonic saline dose on day 1 3 0.5 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 4 0.5 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM7) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 5 0.5 mg/kg of AD05618 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 6 0.5 mg/kg of AD05562 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 7 0.5 mg/kg of AD05564 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline. 8 0.5 mg/kg of AD05567 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline.
(198) (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(199) The tridentate small molecule αvβ6 epithelial cell targeting ligand referred to as Tri-SM6.1 in Groups 3 and 5-8 has the structure represented in
(200) Four (4) rats were dosed in each Group (n=4). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1 Å) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(201) TABLE-US-00025 TABLE 16 Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 9 Average Relative rENaC mRNA Low High Group ID Expression (error) (error) Group 1 (isotonic saline) 1.00 0.180 0.219 Group 2 (0.5 mg/kg AD05453) 0.713 0.139 0.173 Group 3 (0.5 mg/kg AD05453-Tri-SM6.1) 0.562 0.082 0.096 Group 4 (0.5 mg/kg AD05453-Tri-SM7) 0.768 0.059 0.064 Group 5 (0.5 mg/kg AD05618-Tri-SM6.1) 0.524 0.074 0.086 Group 6 (0.5 mg/kg AD05562-Tri-SM6.1) 0.784 0.07 0.077 Group 7 (0.5 mg/kg AD05564-Tri-SM6.1) 0.921 0.104 0.117 Group 8 (0.5 mg/kg AD05567-Tri-SM6.1) 0.707 0.084 0.096
(202) As shown in Table 16 above, each of the alpha-ENaC RNAi agents showed a reduction in mRNA expression in rats compared to control. Further, when administered naked, AD05453 showed only approximately 29% inhibition (0.713), while when conjugated to Tri-SM6.1 integrin targeting ligand it showed a 44% reduction (0.562) in average rENaC mRNA expression.
Example 10. In Vivo Oropharyngeal Aspiration Administration of Alpha-ENaC RNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rats
(203) On study day 1, male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, which included the following dosing groups recited in Table 17:
(204) TABLE-US-00026 TABLE 17 Dosing Groups of Rats in Example 10 Group RNAi Agent and Dose Dosing Regimen 1 Isotonic saline (no RNAi agent) Single OP dose on day 1 2 0.5 mg/kg of AD05347 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 3 0.5 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 4 0.5 mg/kg of AD05671 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 5 0.5 mg/kg of AD05672 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 6 0.5 mg/kg of AD05673 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 7 0.5 mg/kg of AD05558 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 8 0.5 mg/kg of AD05560 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 9 0.5 mg/kg of AD05611 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 10 0.5 mg/kg of AD05613 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline.
(205) (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(206) The tridentate small molecule αvβ6 epithelial cell targeting ligand referred to as Tri-SM6.1 in Groups 2-10 has the structure represented in
(207) Four (4) rats were dosed in each Group (n=4). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1 Å) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(208) TABLE-US-00027 TABLE 18 Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 10 Average Relative rENaC mRNA Low High Group ID Expression (error) (error) Group 1 (isotonic saline) 1.000 0.084 0.092 Group 2 (0.5 mg/kg AD05347-Tri-SM6.1) 0.375 0.128 0.194 Group 3 (0.5 mg/kg AD05453-Tri-SM6.1) 0.597 0.163 0.224 Group 4 (0.5 mg/kg AD05671-Tri-SM6.1) 0.663 0.062 0.068 Group 5 (0.5 mg/kg AD05672-Tri-SM6.1) 0.808 0.114 0.133 Group 6 (0.5 mg/kg AD05673-Tri-SM6.1) 0.623 0.100 0.119 Group 7 (0.5 mg/kg AD05558-Tri-SM6.1) 0.533 0.043 0.047 Group 8 (0.5 mg/kg AD05560-Tri-SM6.1) 0.647 0.122 0.150 Group 9 (0.5 mg/kg AD05611-Tri-SM6.1) 0.477 0.067 0.078 Group 10 (0.5 mg/kg AD05613-Tri-SM6.1) 0.640 0.165 0.223
(209) As shown in Table 18 above, each of the alpha-ENaC RNAi agents showed a reduction in mRNA expression in rats compared to control.
Example 11. In Vivo Oropharyngeal Aspiration Administration of Alpha-ENaC RNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rats
(210) On study day 1, male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, which included the following dosing groups recited in Table 19:
(211) TABLE-US-00028 TABLE 19 Dosing Groups of Rats in Example 11 Group RNAi Agent and Dose Dosing Regimen 1 Isotonic saline (no RNAi agent) Single OP dose on day 1 2 0.5 mg/kg of AD05347 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 3 0.5 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 4 0.5 mg/kg of AD05618 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 5 0.5 mg/kg of AD05619 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 6 0.5 mg/kg of AD05622 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 7 0.5 mg/kg of AD05623 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline.
(212) (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(213) The tridentate small molecule αvβ6 epithelial cell targeting ligand referred to as Tri-SM6.1 in Groups 2-7 has the structure represented in
(214) Five (5) rats were dosed in each Group (n=5). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(215) TABLE-US-00029 TABLE 20 Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 11 Average Relative rENaC mRNA Low High Group ID Expression (error) (error) Group 1 (isotonic saline) 1.000 0.195 0.242 Group 2 (0.5 mg/kg AD05347-Tri-SM6.1) 0.383 0.041 0.046 Group 3 (0.5 mg/kg AD05453-Tri-SM6.1) 0.489 0.168 0.257 Group 4 (0.5 mg/kg AD05618-Tri-SM6.1) 0.770 0.185 0.244 Group 5 (0.5 mg/kg AD05619-Tri-SM6.1) 0.719 0.080 0.090 Group 6 (0.5 mg/kg AD05622-Tri-SM6.1) 0.564 0.168 0.239 Group 7 (0.5 mg/kg AD05623-Tri-SM6.1) 0.575 0.115 0.144
(216) As shown in Table 20 above, each of the alpha-ENaC RNAi agents showed a reduction in mRNA expression in rats compared to control.
Example 12. In Vivo Oropharyngeal Aspiration Administration of Alpha-ENaC RNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rats
(217) On study day 1, male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, according to the following dosing groups recited in Table 21:
(218) TABLE-US-00030 TABLE 21 Dosing Groups of Rats in Example 12 Group RNAi Agent and Dose Dosing Regimen 1 Isotonic saline (no RNAi agent) Single OP dose on day 1 2 0.5 mg/kg of AD05347 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 3 0.5 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 4 0.5 mg/kg of AD05683 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 5 0.5 mg/kg of AD05684 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 6 0.5 mg/kg of AD05685 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 7 0.5 mg/kg of AD05686 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 8 0.5 mg/kg of AD05687 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 9 0.5 mg/kg of AD05564 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 10 0.5 mg/kg of AD05688 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 11 0.5 mg/kg of AD05689 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 12 0.5 mg/kg of AD05690 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 13 0.5 mg/kg of AD05691 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline.
(219) (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(220) The tridentate small molecule αvβ6 epithelial cell targeting ligand referred to as Tri-SM6.1 in Groups 2-13 has the structure represented in
(221) Four (4) rats were dosed in each Group (n=4). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1 Å) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(222) TABLE-US-00031 TABLE 22 Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 12 Average Relative rENaC mRNA Low High Group ID Expression (error) (error) Group 1 (isotonic saline) 1.000 0.157 0.186 Group 2 (0.5 mg/kg AD05347-Tri-SM6.1) 0.534 0.066 0.075 Group 3 (0.5 mg/kg AD05453-Tri-SM6.1) 0.573 0.086 0.101 Group 4 (0.5 mg/kg AD05683-Tri-SM6.1) 0.547 0.052 0.057 Group 5 (0.5 mg/kg AD05684-Tri-SM6.1) 0.755 0.158 0.200 Group 6 (0.5 mg/kg AD05685-Tri-SM6.1) 0.609 0.077 0.089 Group 7 (0.5 mg/kg AD05686-Tri-SM6.1) 0.591 0.077 0.089 Group 8 (0.5 mg/kg AD05687-Tri-SM6.1) 0.624 0.099 0.118 Group 9 (0.5 mg/kg AD05564-Tri-SM6.1) 0.787 0.172 0.221 Group 10 (0.5 mg/kg AD05688-Tri-SM6.1) 0.563 0.072 0.082 Group 11 (0.5 mg/kg AD05689-Tri-SM6.1) 0.693 0.136 0.169 Group 12 (0.5 mg/kg AD05590-Tri-SM6.1) 0.651 0.159 0.211 Group 13 (0.5 mg/kg AD05691-Tri-SM6.1) 0.870 0.132 0.155
(223) As shown in Table 22 above, each of the alpha-ENaC RNAi agents showed a reduction in mRNA expression in rats compared to control.
Example 13. Dose Ranging Study of Oropharyngeal Aspiration Administration of Alpha-ENaC RNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rats
(224) On study day 1, male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, according to the following dosing groups recited in Table 23:
(225) TABLE-US-00032 TABLE 23 Dosing Groups of Rats in Example 13 Group RNAi Agent and Dose Dosing Regimen 1 Isotonic saline (no RNAi agent) Single OP dose on day 1 2 0.0625 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 3 0.125 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 4 0.25 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 5 0.5 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 6 0.75 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 7 1.0 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) at dose on day 1 the 5′ terminal end of the sense strand, formulated in isotonic saline. 8 3.0 mg/kg of AD05453 conjugated to a tridentate small Single OP molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1at the dose on day 1 5′ terminal end of the sense strand, formulated in isotonic saline.
(226) (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(227) The tridentate small molecule αvβ6 epithelial cell targeting ligand referred to as Tri-SM6.1 in Groups 2-8 has the structure represented in
(228) Six (6) rats were dosed in each of Groups 1, 2, 3, 4, 7, and 8 (n=5). Four rats were dosed in Groups 5 and 6 (n=4). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1 Å) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(229) TABLE-US-00033 TABLE 24 Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 13 Average Relative rENaC mRNA Low High Group ID Expression (error) (error) Group 1 (isotonic saline) 1.000 0.111 0.125 Group 2 (0.0625 mg/kg AD05453-Tri-SM6.1) 0.695 0.083 0.095 Group 3 (0.125 mg/kg AD05453-Tri-SM6.1) 0.747 0.139 0.171 Group 4 (0.25 mg/kg AD05453-Tri-SM6.1) 0.631 0.080 0.092 Group 5 (0.5 mg/kg AD05453-Tri-SM6.1) 0.492 0.034 0.037 Group 6 (0.75 mg/kg AD05453-Tri-SM6.1) 0.485 0.113 0.147 Group 7 (1.0 mg/kg AD05453-Tri-SM6.1) 0.433 0.077 0.094 Group 8 (3.0 mg/kg AD05453-Tri-SM6.1) 0.324 0.052 0.062
(230) (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(231) As shown in Table 24 above, alpha-ENaC RNAi agent AD05453 showed a reduction in mRNA expression in rats compared to control at each of the dosage levels administered.
Example 14. In Vivo Intratracheal Administration of Alpha-ENaC RNAi Agents in Mice
(232) On study days 1 and 2, male ICR mice were administered 50 microliters via a microsprayer device (Penn Century, Philadelphia, Pa.) of either isotonic saline vehicle for use as a control, or 5 mg/kg of one of the following alpha-ENaC RNAi agents without a conjugate ligand (i.e., “naked RNAi agent”), formulated in isotonic saline: AD04025, AD04526, AD04527, AD04528, AD04529, AD04530, AD04531, AD04536, or AD04537. 4 mice were dosed per group (n=4). Mice were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(233) TABLE-US-00034 TABLE 25 Average Relative mENaC mRNA Expression at Sacrifice (Day 9) in Example 14 Average Relative mENaC mRNA Low High Group ID Expression (error) (error) Group 1 (isotonic saline) 1.000 0.117 0.132 Group 2 (0.5 mg/kg AD04025) 0.451 0.097 0.123 Group 3 (0.5 mg/kg AD04526) 0.585 0.108 0.132 Group 4 (0.5 mg/kg AD04527) 0.403 0.101 0.134 Group 5 (0.5 mg/kg AD04528) 0.498 0.117 0.153 Group 6 (0.5 mg/kg AD04529) 0.480 0.042 0.047 Group 7 (0.5 mg/kg AD04530) 0.670 0.006 0.006 Group 8 (0.5 mg/kg AD04531) 0.662 0.103 0.122 Group 9 (0.5 mg/kg AD04536) 0.746 0.101 0.117 Group 10 (0.5 mg/kg AD04537) 0.409 0.021 0.022
(234) (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(235) As shown in Table 25 above, each of the alpha-ENaC RNAi agents showed a reduction in mRNA expression in rats compared to control.
Example 15. In Vivo Intratracheal Administration of Alpha-ENaC RNAi Agents in Mice
(236) On study days 1 and 2, male ICR mice were administered 50 microliters via a microsprayer device (Penn Century, Philadelphia, Pa.) of either isotonic saline vehicle for use as a control, or 5 mg/kg of one of the following alpha-ENaC RNAi agents without a conjugate ligand (i.e., “naked RNAi agent”), formulated in isotonic saline: AD04025, AD04538, AD04539, AD04532, AD04533, AD04534, AD04535, or AD04540. (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(237) Four (4) mice were dosed per group (n=4). Mice were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1 Å) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(238) TABLE-US-00035 TABLE 26 Average Relative mENaC mRNA Expression at Sacrifice (Day 9) in Example 15 Average Relative mENaC mRNA Low High Group ID Expression (error) (error) Group 1 (isotonic saline) 1.000 0.081 0.088 Group 2 (0.5 mg/kg AD04025) 0.448 0.097 0.125 Group 3 (0.5 mg/kg AD04538) 0.855 0.101 0.115 Group 4 (0.5 mg/kg AD04539) 0.833 0.076 0.083 Group 5 (0.5 mg/kg AD04532) 0.581 0.127 0.162 Group 6 (0.5 mg/kg AD04533) 0.743 0.041 0.044 Group 7 (0.5 mg/kg AD04534) 1.006 0.127 0.146 Group 8 (0.5 mg/kg AD04535) 1.042 0.119 0.134 Group 9 (0.5 mg/kg AD04540) 0.982 0.111 0.125
(239) (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(240) As shown in Table 26 above, the underlying sequence of the respective alpha-ENaC RNAi agent impacts the level of ENaC gene inhibition achieved. For example, alpha-ENaC RNAi agent AD04025 includes an antisense strand sequence that is designed to target position 972 of the alpha-ENaC gene (i.e., nucleotides 1-19 of the antisense strand are designed to be at least partially complementary to the alpha-ENaC gene (SEQ ID NO:1) at positions 972-990). AD04525 achieved the highest level of inhibition of the RNAi agents tested in this Example and showed approximately 55% knockdown of gene expression (0.448) compared to control. The remaining Alpha-ENaC RNAi agents were designed to target different positions on the gene, including alpha-ENaC RNAi agents AD04538 (targeting gene position 973), AD04539 (targeting gene position 999), AD04532 (targeting gene position 1000), AD04533 (also targeting gene position 973), AD04534 (also targeting gene position 999), AD04535 (targeting gene position 1291), and AD04540 (targeting gene position 763). As shown above, an alpha-ENaC RNAi agent that is designed to target the gene at a different position can have different inhibitory activity (e.g., compare alpha-ENaC mRNA knockdown levels of AD04025 (position 972) with AD04538 (position 973) and AD04533 (position 973)).
(241) Furthermore, when comparing alpha-ENaC RNAi agents at the same position (e.g., AD04539 and AD04534), despite both sequences having underlying nucleobases designed to inhibit the gene at the same position (e.g., gene position 999), slight modifications of the underlying base sequence and/or the inclusion of different modified nucleotides can lead to at least numerically different inhibition activity.
Example 16. In Vivo Intratracheal Administration of Alpha-ENaC RNAi Agents in Rats
(242) On study days 1 and 2, male Sprague Dawley rats were administered 200 microliters via a microsprayer device (Penn Century, Philadelphia, Pa.) of either isotonic saline vehicle for use as a control, or approximately 3 mg/kg of one of the following alpha-ENaC RNAi agents without a conjugate ligand (i.e., “naked RNAi agent”), formulated in isotonic saline: AD04835, AD04022, AD05116, AD05117, AD05118, or AD05119. (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(243) Five (5) rats were dosed per group (n=5). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1 Å) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(244) TABLE-US-00036 TABLE 27 Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 16 Average Relative rENaC mRNA Low High Group ID Expression (error) (error) Group 1 (isotonic saline) 1.000 0.171 0.207 Group 2 (0.5 mg/kg AD04835) 0.281 0.043 0.050 Group 3 (0.5 mg/kg AD04022) 0.297 0.055 0.067 Group 4 (0.5 mg/kg AD05116) 0.554 0.095 0.115 Group 5 (0.5 mg/kg AD05117) 0.532 0.097 0.119 Group 6 (0.5 mg/kg AD05118) 0.300 0.034 0.038 Group 7 (0.5 mg/kg AD05119) 0.496 0.075 0.089
(245) (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(246) Table 27, above, provides additional data showing that the underlying sequence of the respective alpha-ENaC RNAi agent impacts the level of ENaC gene inhibition achieved. For example, alpha-ENaC RNAi agents AD04025 and AD04835 each include an antisense strand sequence that is designed to target position 972 of the alpha-ENaC gene (i.e., nucleotides 1-19 of the antisense strand are designed to be at least partially complementary to the alpha-ENaC gene (SEQ ID NO:1) at positions 972-990). Of the alpha-ENaC RNAi agents tested in this Example, these two RNAi agents showed the greatest level of knockdown at greater than 70%. The remaining Alpha-ENaC RNAi agents were designed to target different positions on the gene, including alpha-ENaC RNAi agents AD05116 (targeting gene position 944), AD05117 (targeting gene position 945), AD05118 (targeting gene position 1289), and AD05119 (targeting gene position 1579).
Example 17. Multiple Dose, Dose Ranging Study of Oropharyngeal Aspiration Administration of Alpha-ENaC RNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rats
(247) On study day 1, study day 2, and study day 3, male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, according to the following dosing groups recited in Table 28:
(248) TABLE-US-00037 TABLE 28 Dosing Groups of Rats in Example 17 Group RNAi Agent and Dose Dosing Regimen 1 Isotonic saline (no RNAi agent) OP dose on day 1, day 2, and day 3 (three total doses) 2 0.005 mg/kg of AD05453 conjugated to a tridentate small OP dose on day 1, molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) day 2, and day 3 at the 5′ terminal end of the sense strand, formulated in (three total doses) isotonic saline. 3 0.01 mg/kg of AD05453 conjugated to a tridentate small OP dose on day 1, molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) day 2, and day 3 at the 5′ terminal end of the sense strand, formulated in (three total doses) isotonic saline. 4 0.025 mg/kg of AD05453 conjugated to a tridentate small OP dose on day 1, molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) day 2, and day 3 at the 5′ terminal end of the sense strand, formulated in (three total doses) isotonic saline. 5 0.05 mg/kg of AD05453 conjugated to a tridentate small OP dose on day 1, molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) day 2, and day 3 at the 5′ terminal end of the sense strand, formulated in (three total doses) isotonic saline. 6 0.10 mg/kg of AD05453 conjugated to a tridentate small OP dose on day 1, molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) day 2, and day 3 at the 5′ terminal end of the sense strand, formulated in (three total doses) isotonic saline. 7 0.50 mg/kg of AD05453 conjugated to a tridentate small OP dose on day 1, molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) day 2, and day 3 at the 5′ terminal end of the sense strand, formulated in (three total doses) isotonic saline.
(249) (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example). As noted herein, the same RNAi agent-tridentate small molecule αvβ6 epithelial cell targeting ligand conjugate structure (i.e., Tri-SM6.1-AD05453) in this Example may be alternatively synthesized by using the tri-alkyne functionalized linking group (TriAlk14) as shown in AD05924, instead of post-synthetic addition to the terminal amino group, as shown in AD05453. (See also Example 1).
(250) The tridentate small molecule αvβ6 epithelial cell targeting ligand referred to as Tri-SM6.1 in Groups 2-7 has the structure represented in
(251) Seven (7) rats were dosed in each of Groups 1, 2, 3, 4, 5, and 6 (n=7), and six (6) rats were dosed in Group 7 (n=6). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(252) TABLE-US-00038 TABLE 29 Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 17 Average Relative rENaC mRNA Low High Group ID Expression (error) (error) Group 1 (isotonic saline) 1.000 0.127 0.146 Group 2 (0.005 mg/kg AD05453-Tri-SM6.1) 0.852 0.097 0.109 Group 3 (0.01 mg/kg AD05453-Tri-SM6.1) 0.663 0.103 0.121 Group 4 (0.025 mg/kg AD05453-Tri-SM6.1) 0.589 0.131 0.168 Group 5 (0.05 mg/kg AD05453-Tri-SM6.1) 0.480 0.058 0.066 Group 6 (0.10 mg/kg AD05453-Tri-SM6.1) 0.432 0.056 0.064 Group 7 (0.50 mg/kg AD05453-Tri-SM6.1) 0.279 0.034 0.039
(253) As shown in Table 29 above, alpha-ENaC RNAi agent AD05453 showed a reduction in mRNA expression in rats compared to control at each of the dosage levels administered. Further, multiple OP dose administration showed signs of further knockdown of rENaC mRNA expression compared to single dose when using the same alpha-ENaC RNAi agent (compare, e.g., Group 7 of Example 17 with Group 5 of Example 13).
Example 18. In Vivo Intratracheal Administration of Alpha-ENaC RNAi Agents in Mice and Human COPD Sputum Stability Assessment
(254) To assess and compare the activity and stability of a known prior art duplex to the RNAi agents disclosed herein, a duplex having the following modified structure, as disclosed International Patent Application Publication No: WO 2008/152131 to Novartis et al. (see Table 1C therein at ND-9201), was synthesized:
(255) TABLE-US-00039 Antisense strand sequence (5′ .fwdarw. 3′): (SEQ ID NO: 291) GAUUUGUUCUGGUUGcAcAdTsdT Sense strand sequence (5′ .fwdarw. 3′): (SEQ ID NO: 292) uGuGcAAccAGAAcAAAucdTsdT
(hereinafter referred to as ND-9201). According to WO 2008/152131, ND-9201 showed comparatively potent in vitro inhibition of alpha-ENaC gene expression.
(256) First, studies were conducted to assess alpha-ENaC inhibition activity in vivo. On study days 1 and 2, male ICR mice were administered via a microsprayer device (Penn Century, Philadelphia, Pa.) either isotonic glucose (D5W) vehicle for use as a control, or approximately 10 mg/kg of ND-9201 formulated in D5W. Mice were sacrificed on day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group. For comparison, on study days 1 and 2, male ICR mice were administered via a microsprayer device (Penn Century, Philadelphia, Pa.) either D5W vehicle for use as a control, or approximately 5 mg/kg of the RNAi agent AD04025 disclosed herein formulated in D5W. (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplex of AD04025). Mice were similarly sacrificed on day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group.
(257) For ND-9201, at 10 mg/kg dosing on days 1 and 2, approximately 25% inhibition of mENaC mRNA expression was achieved in mice in vivo.
(258) For AD04025, at only 5 mg/kg dosing on days 1 and 2, approximately 65% inhibition of mENaC mRNA expression was achieved in mice in vivo, thus showing a substantial improvement in inhibition activity over the known prior art duplex ND-9201.
(259) Additionally, stability studies were conducted with ND-9201 and AD04858 in human sputum taken from patients diagnosed with COPD (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplex of AD04858). A solution containing 50 μL of sputum and 350 μL of lysis buffer was vortexed, and 12.5 μL of either ND-9201 or AD04858 was added and briefly vortexed each hour. LCMS was conducted on the samples to determine the remaining full-length product of both the sense strand and the antisense strand of each of the molecules over time. After 6 hours, AD04858 showed improved stability, as it had approximately 20 to 30% greater full-length product present for both the sense strand and the antisense strand.
Example 19. In Vivo Study of Oropharyngeal Aspiration Administration of Alpha-ENaC RNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rats
(260) On study day 1 and study day 2, male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, which included the following dosing groups recited in Table 30:
(261) TABLE-US-00040 TABLE 30 Dosing Groups of Rats in Example 19 Group RNAi Agent and Dose Dosing Regimen 1 Isotonic saline (no RNAi agent) OP dose on day 1 and day 2 2 0.025 mg/kg of AD05625 conjugated to a tridentate small OP dose on day 1 molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) and day 2 at the 5′ terminal end of the sense strand, formulated in isotonic saline. 3 0.50 mg/kg of AD05453 conjugated to a tridentate small OP dose on day 1 molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) and day 2 at the 5′ terminal end of the sense strand, formulated in isotonic saline. 4 0.50 mg/kg of AD05829 conjugated to a tridentate small OP dose on day 1 molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) and day 2 at the 5′ terminal end of the sense strand, formulated in isotonic saline. 5 0.50 mg/kg of AD05831 conjugated to a tridentate small OP dose on day 1 molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) and day 2 at the 5′ terminal end of the sense strand, formulated in isotonic saline. 6 0.50 mg/kg of AD05833 conjugated to a tridentate small OP dose on day 1 molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1) and day 2 at the 5′ terminal end of the sense strand, formulated in isotonic saline.
(262) (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplexes used in this Example).
(263) The tridentate small molecule αvβ6 epithelial cell targeting ligand referred to as Tri-SM6.1 in Groups 2-7 has the structure represented in
(264) Four (4) rats were dosed in each Group (n=7). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (geometric mean, +/−95% confidence interval).
(265) TABLE-US-00041 TABLE 31 Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 19 Average Relative rENaC mRNA Low High Group ID Expression (error) (error) Group 1 (isotonic saline) 1.000 0.196 0.243 Group 2 (0.25 mg/kg AD05625-Tri-SM6.1) 0.663 0.107 0.127 Group 3 (0.50 mg/kg AD05453-Tri-SM6.1) 0.490 0.091 0.111 Group 4 (0.50 mg/kg AD05829-Tri-SM6.1) 0.767 0.163 0.207 Group 5 (0.50 mg/kg AD05831-Tri-SM6.1) 0.542 0.113 0.142 Group 6 (0.50 mg/kg AD05833-Tri-SM6.1) 0.599 0.025 0.026
(266) In Table 31 above, alpha-ENaC RNAi agents AD05625 and AD05453 each included an antisense strand that was designed to target the alpha-ENaC gene beginning at position 972 (see SEQ ID NO:1); AD05829 included an antisense strand that was designed to target the alpha-ENaC gene beginning at position 944; AD05831 included an antisense strand that was designed to target the alpha-ENaC gene beginning at position 973; and AD01289 included an antisense strand that was designed to target the alpha-ENaC gene beginning at position 1289. Each of the alpha-ENaC RNAi agents showed inhibition of gene expression, with RNAi agent AD05453 showing comparatively potent inhibition of alpha-ENaC.
Example 20. In Vivo Topical Ocular Administration of Alpha-ENaC RNAi Agents in Mice
(267) To evaluate the ability of alpha-ENaC RNAi agents to inhibit expression of alpha ENaC mRNA in the ocular surface epithelium, CB57Bl/6 mice (n=3/group) received twice daily topical ocular instillations of saline vehicle or 400 micrograms AD04858 (in two microliter volume) in both eyes for five days. (See, e.g., Tables 3 through 6 for chemical structure information for the chemically modified duplex of AD04858). On study day five, mice were sacrificed, samples of the conjunctival epithelium collected and total RNA isolated from tissue homogenate. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group.
(268) After five days of twice daily topical dosing of AD04858, conjunctival samples from treated mice expressed significantly less (approximately 24%) alpha ENaC mRNA than samples from vehicle treated controls
Other Embodiments
(269) It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.