NOVEL POLYNUCLEOTIDES ENCODING A HUMAN FKRP PROTEIN

20210338837 · 2021-11-04

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention concerns synthetic polynucleotides encoding a human fukutin-related protein (FKRP) wherein said polynucleotides contain at least a mutation avoiding supplementary transcript(s) generated from frameshift start codon(s). Said polynucleotides are useful, especially for treating a pathology linked to a FKRP deficiency or induced by a defect in α-dystroglycan (α-DG) glycosylation, such as LGMD2I.

    Claims

    1. A synthetic polynucleotide encoding a human fukutin-related protein (FKRP) consisting of or comprising the sequence SEQ ID NO: 1, having at least a mutation avoiding supplementary transcript(s) generated from frameshift start codon(s), wherein the polynucleotide has at least one start codon mutated, said start codon being located at position 819 of sequence SEQ ID NO: 2.

    2. The polynucleotide according to claim 1, wherein the polynucleotide has 3 start codons mutated, said start codons being located at position 429, 819 and 1431 of sequence SEQ ID NO: 2.

    3. The polynucleotide according to claim 2, wherein the polynucleotide comprises the sequence SEQ ID NO: 4, or a sequence having at least 90% identity to SEQ ID NO: 4.

    4. The polynucleotide according to claim 1, wherein the polynucleotide has 4 start codons mutated, said start codons being located at position 429, 545, 819 and 1431 of sequence SEQ ID NO: 2.

    5. The polynucleotide according to claim 4, wherein the polynucleotide comprises the sequence SEQ ID NO: 6, or a sequence having at least 90% identity to SEQ ID NO: 6.

    6. A vector comprising a polynucleotide according to claim 1.

    7. The vector according to claim 6, wherein the vector is an adeno-associated viral (AAV) vector.

    8. The vector according to claim 7, wherein the AAV vector is of serotype 9.

    9. The vector according to claim 6, wherein the vector comprises the sequence SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 21 or a sequence having at least 90% identity thereto.

    10. A cell comprising the polynucleotide of claim 1.

    11. A transgenic non-human animal comprising the polynucleotide of claim 1.

    12. (canceled)

    13. A pharmaceutical composition comprising the polynucleotide of claim 1 and a pharmaceutically acceptable carrier.

    14. A method of treating a pathology linked to human fukutin-related protein (FKRP) deficiency or induced by a defect in α-dystroglycan (α-DG) glycosylation, the method comprising administering the pharmaceutical composition of claim 13 to a subject in need thereof.

    15. The method according to claim 14, wherein the pathology is selected in the group consisting of: Limb-Girdle Muscular Dystrophy type 2I (LGMD2I), Congenital Muscular Dystrophy type 1C (MDC1C), Walker-Warburg Syndrome (WWS) and Muscle-Eye-Brain disease (MEB).

    16. The method of claim 14, wherein the pathology is LGMD2I.

    17. The polynucleotide according to claim 2, wherein the polynucleotide comprises the sequence as set forth in SEQ ID NO: 7 or SEQ ID NO: 8.

    18. The polynucleotide according to claim 4, wherein the polynucleotide comprises the sequence as set forth in SEQ ID NO: 5 or SEQ ID NO: 3.

    19. The vector according to claim 7, wherein the AAV vector is serotype 2, 8, or 9.

    20. The vector according to claim 7, wherein the AAV vector is serotype 2/9.

    Description

    EXPERIMENTAL EXAMPLES

    [0142] The invention is further described in detail by reference to the following experimental examples and the attached figures. These examples are provided for purposes of illustration only, and are not intended to be limiting.

    [0143] FIG. 1: Scheme of the plasmids used in this study:

    [0144] A/pAAV-hDesmin-hFKRPwt

    [0145] B/pAAV-hDesmin-hFKRP-OPTmin

    [0146] C/pAAV-hDesmin-hFKRP-OPTcomp

    [0147] FIG. 2: Injection of C57BI6 mice without (PBS) or with AAV9 comprising different forms of the human FKRP (hFKRP) transgene: hFKRP-wt (coding sequence SEQ ID NO: 2), hFKRP-OPTmin (coding sequence SEQ ID NO: 3) and hFKRP-OPTcomp (coding sequence SEQ ID NO: 4) at 2 different doses (3E9 vg/TA and 1.5E10 vg/TA):

    [0148] A/Evaluation of the FKRP expression by western-blotting

    [0149] B/Quantification of the FKRP protein after normalization with GADPH

    [0150] C/Quantification of the FKRP protein after normalization with GADPH: administration of FKRP wt (SEQ ID NO: 2), FKRP-OPTcomp (SEQ ID NO: 4), FKRP-06 (SEQ ID NO: 20), FKRP-OPT-07 (SEQ ID NO: 5), FKRP-OPT-08 (SEQ ID NO: 6), FKRP-OPT-10 (SEQ ID NO: 7), and FKRP-OPT-11 (SEQ ID NO: 8), at the dose of 3E9 vg/TA.

    [0151] FIG. 3: In vivo evaluation of FKRP-OPTcomp (SEQ ID NO: 4) after administration to HSA-FKRPdel mice (a FKRP-deficient mouse model) at 2 different doses (3E9 vg/TA and 1.5E10 vg/TA):

    [0152] A/Centronucleation index in the TA muscle

    [0153] B/Force of TA in situ

    [0154] C/Results of an Escape Test.

    MATERIALS AND METHODS

    [0155] Design of the Novel Human FKRP Sequences:

    [0156] The human FKRP coding sequence SEQ ID NO: 2 has been modified according to the following rules: [0157] introduction of mutations suppressing the sense and antisense frameshift ATG present in the coding region, at positions 429 (antisense; phase +1), 546 (sense; phase +1), 819 (antisense; phase +1) and/or 1431 (antisense; phase +1); [0158] possibly following the codon frequency table as e.g. disclosed in Sharp et al.

    [0159] (1988); [0160] without generation of new Open-Reading-Frame (ORF); [0161] possibly replacing CG motives to avoid CpG islets formation; [0162] possibly decreasing GC %; [0163] possibly modifying the stem-loop present at position 553-559 of SEQ ID NO: 2.

    [0164] All the resulting designed sequences (SEQ ID NO: 3 to 8 shown in Table 1 below) encode a FKRP protein having sequence SEQ ID NO: 1, corresponding to the human native FKRP sequence.

    [0165] Plasmids and AAV Vectors:

    [0166] The coding sequence of the human Fkrp gene (SEQ ID NO: 2) was synthesized using classical gene synthesis service methodology, and inserted into a plasmid (pUC57) containing AAV2 ITRs, the human desmin promoter, the HBB2 intron followed by Kozak sequence, and the HBB2 polyA (Hemoglobin subunit β2 polyadenylation signal).

    [0167] The resulting plasmid, shown in FIG. 1A, is called pAAV-hDesmin-hFKRPwt. The sequence of the insert including the ITR sequences is shown in SEQ ID NO: 9.

    [0168] Plasmids pAAV-hDesmin-hFKRP-OPTmin (FIG. 1B) and pAAV-hDesmin-hFKRP-OPTcomp (FIG. 1C), whose insert sequence is shown in SEQ ID NO: 10 and 11 respectively, have been obtained by replacing the coding sequence of the native human FKRP protein (SEQ ID NO: 2) by the modified sequences SEQ ID NO: 3 and 4, respectively. The other plasmids FKRP-06, FKRP-OPT-07, FKRP-OPT-08, FKRP-OPT-10 and FKRP-OPT-11 have been obtained in a similar way by replacing SEQ ID NO: 2 by sequence SEQ ID NO: 20, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

    [0169] Adenovirus free rAAV2/9 viral preparations were generated by packaging AAV2-ITR recombinant genomes in AAV9 capsids, using a three plasmids transfection protocol as previously described (Bartoli et al., 2006). Briefly, HEK293 cells were cotransfected with pAAV-hDesmin-hFKRPwt (or pAAV-hDesmin-hFKRP-OPTmin or pAAV-hDesmin-hFKRP-OPTcomp), a RepCap plasmid (pAAV2.9, Dr J. Wilson, UPenn) and an adenoviral helper plasmid (pXX6; Apparailly et al., 2005) at a ratio of 1:1:2. Crude viral lysate was harvested at 60 hr post-transfection and lysed by freeze-and-thaw cycles. The viral lysate was purified through two rounds of CsCl ultracentrifugation followed by dialysis. Viral genomes were quantified by a TaqMan real-time PCR assay using primers and probes corresponding to the HBB2 polyA of the AAV vector genome. The primer pairs and TaqMan probes used for amplification were:

    TABLE-US-00001 Forward: (SEQ ID NO: 17) CCAGGCGAGGAGAAACCA Reverse: (SEQ ID NO: 18) CTTGACTCCACTCAGTTCTCTTGCT; and Probe: (SEQ ID NO: 19) CTCGCCGTAAAACATGGAAGGAACACTTC.

    [0170] Western-Blotting

    [0171] Cell pellets and muscle tissues were mechanically homogenized in RIPA lysis buffer (Thermo Fisher Scientific, Waltham, Mass., USA), complemented with Complete protease inhibitor cocktail EDTA-free (Roche, Bale, Switzerland). Nucleic acids contained in the samples were degradated by incubation 15 minutes at 37° C. with benzonase (Sigma, St. Louis, Mo., USA).

    [0172] Proteins were separated using precast polyacrylamide gel (4-15%, BioRad, Hercules, Calif., USA) and then transferred to nitrocellulose membrane.

    [0173] Rabbit polyclonal antibody against FKRP has been previously described (Gicquel et al., 2017). Nitrocellulose membranes were probed with antibodies against FKRP (1:100) and GAPDH (Santa Cruz Biotechnologies, Dallas, Tex., USA, 1:200) for normalization, for 2 hours at room temperature.

    [0174] Finally, membranes were incubated with IRDye® for detection by the Odyssey infrared-scanner (LI-COR Biosciences, Lincoln, Nebr., USA).

    [0175] Animals and Injections

    [0176] One month-old mice were used. All animals of this study were handled according to the European guidelines for the human care and use of experimental animals, and all procedures on animals were approved by Genopole's ethics committee.

    [0177] For the evaluation of gene transfer efficiency, male C57Bl6 mice were injected intramuscularly into the TA (Tibialis Anterior) muscle with a volume of 25 μL, at two different doses: 3 E9 vg/TA and 1.5 E10 vg/TA. As a negative control, mice were injected with the buffer used for the AAV formulation, i.e. PBS. Mice were euthanized after 1 month and the injected muscles were dissected out and frozen in isopentane cooled in liquid nitrogen.

    [0178] For in vivo functional tests, AAV9-FKRP containing FKRP-OPTcomp sequence (SEQ ID NO: 4) was administrated by intravenous injection to HSA-FKRPdel mice, a FKRP-deficient mouse model, at 2 doses: 2.5 E12 vg/kg and 1 E13 vg/kg. After 3 months, the animals were submitted to different functional tests.

    [0179] In Vivo Evaluation

    [0180] Escape Test:

    [0181] The global strength of mice is evaluated by the escape test (Carlson and Makiejus, 1990). Briefly, mice are placed on a platform facing the entrance of a 30 cm-long tube. A cuff wrapped around the tail is connected to a fixed force transducer and the mice are induced to escape within the tube in the direction opposite from the force transducer by a gentle pinching of the tail. A short peak of force is induced by this flight forward and the average of the five highest force peaks normalized by body weight are analyzed.

    [0182] Material Used:

    [0183] Force transducer ADInstrument MLT1030 serial 810.

    [0184] Software ADinstrument Labchart7.

    [0185] Force of TA In Situ:

    [0186] Skeletal muscle function is evaluated by the measure of muscle contraction in situ, as previously described (Vignaud et al., 2005). Animals are anesthetized by intra-peritoneal injection of Ketamine (100 mg/kg) and Xylazine (10 mg/kg) and supplemental doses are administered as required to maintain deep anaesthesia. The knee and foot are fixed with clamps and stainless steel pins. The TA muscle is exposed and the distal tendon is cut and attached to a force transducer (Aurora Scientific, Dublin, Ireland). The sciatic nerves are proximally crushed and distally stimulated by a bipolar silver electrode using supra-maximal square wave pulses of 0.1 ms duration. Absolute maximal forces are determined at optimal length (length at which maximal tetanic tension is observed). The specific maximal force is calculated by normalizing the total muscle force with the muscle mass.

    [0187] Material Used:

    [0188] Apparatus Aurora Scientific.

    [0189] Sensor 305C 5N Cambridge Technology Model 6650 n° X11271243Y.

    [0190] Software ASI 610A Dynamic muscle Control.

    [0191] Centronucleation Index:

    [0192] Injected mice were sacrificed soon after the functional tests. Skeletal muscles were sampled and frozen in cooled isopentane. Transverse cryosections were stained with Hematoxylin-Phloxine-Saffron (HPS) and were used for centronucleated fibers numeration. The number of centronucleated fibers was reported to the slice area to obtain the centronucleation index.

    [0193] Results:

    [0194] I/Design of Novel Human FKRP Sequences:

    [0195] In order to evaluate the impact of modifications in the FKRP coding sequence, a series of sequences encoding the human FKRP protein of sequence SEQ ID NO: 1, derived from the sequence SEQ ID NO: 2, have been designed and synthetized. The main features of said sequences are summarized in Table 1:

    TABLE-US-00002 TABLE 1 Characteristics of the modified sequences encoding the human FKRP protein Stem-loop at Base at position Name Sequence position 553-559 FKRP wt SEQ ID NO: 2 429: C Preserved 546: T 819: C 1431: C FKRP-OPTmin SEQ ID NO: 3 429: G Preserved 546: C 819: A 1431: G FKRP-OPTcomp SEQ ID NO: 4 429: G Modified 546: T 819: G 1431: G FKRP-OPT-07 SEQ ID NO: 5 429: G Preserved 546: C 819: A 1431: G FKRP-OPT-08 SEQ ID NO: 6 429: G Preserved 546: C 819: A 1431: G FKRP-OPT-10 SEQ ID NO: 7 429: G Modified 546: T 819: G 1431: G FKRP-OPT-11 SEQ ID NO: 8 429: A Modified 546: T 819: G 1431: G FKRP-06 SEQ ID NO: 20 429: A Modified (WO2016/138387) 546: C 819: C 1431: G

    [0196] II/Evaluation of the Constructs In Vivo:

    [0197] FIG. 2A shows the results obtained by western-blot on FKRP expression after gene transfer. The FKRP protein expressed from the different constructs (wt and optimized) has the expected size (58 kDa). Moreover, the modified FKRP transgenes allow a higher expression of the FKRP protein in comparison with the wild type sequence. The intensity of the obtained bands was quantified and normalized by the GAPDH normalizer. The quantification indicates a 5 fold increase for hFKRP-OPTcomp compared to FKRP wt (FIG. 2B).

    [0198] The same experiments were repeated with the different FKRP sequences shown in table 1, including the sequence disclosed in WO2016/138387 (SEQ ID NO: 1 in said document; SEQ ID NO: 20 in the present application). As illustrated in FIG. 2C, the sequence disclosed in WO2016/138387 (noted FKRP-06) does not allow reaching the level of transgene expression observed with the constructs according to the invention. Among the newly tested sequences, FKRP-08 is the best candidate but they generally lead to a level of transgene expression higher than the native sequence.

    [0199] III/Functional Evaluation of the Constructs:

    [0200] The best candidate, i.e. FKRP-OPTcomp (SEQ ID NO: 4), has been tested for its in vivo efficiency in a FKRP-deficient mouse model.

    [0201] The data of FIG. 3A reveal a reduction of centronucleation in treated animals. Moreover, the in situ measurement of the force of the tibialis anterior (TA) muscle (FIG. 3B) and of the global strength evaluated by the escape test (FIG. 3C) reveal an improvement of the muscle function in treated animals.

    CONCLUSIONS

    [0202] The present study shows that sequence optimization of the human FKRP transgene allows an improved level of FKRP expression after intramuscular injection of AAV vectors harboring said transgenes in mice. This increase is of therapeutic and clinical interest since it ameliorates the efficacy of the treatment and/or allows decreasing the injected doses of the therapeutic product.

    REFERENCES

    [0203] Apparailly, F., Khoury, M., Vervoordeldonk, M. J., Adriaansen, J., Gicquel, E., Perez, N., Riviere, C., Louis-Plence, P., Noel, D., Danos, O. et al. (2005) Adeno-associated virus pseudotype 5 vector improves gene transfer in arthritic joints. Hum. Gene Ther., 16, 426-434. [0204] Bartoli, M., Poupiot, J., Goyenvalle, A., Perez, N., Garcia, L., Danos, O. and Richard, I. (2006) Noninvasive monitoring of therapeutic gene transfer in animal models of muscular dystrophies. Gene Ther., 13, 20-28. [0205] Beedle, A. M., Turner, A. J., Saito, Y., Lueck, J. D., Foltz, S. J., Fortunato, M. J., Nienaber, P. M. and Campbell, K. P. (2012) Mouse fukutin deletion impairs dystroglycan processing and recapitulates muscular dystrophy. J. Clin. Invest., 122, 3330-3342. [0206] Beltran-Valero de Bernabe, D., Voit, T., Longman, C., Steinbrecher, A., Straub, V., Yuva, Y., Herrmann, R., Sperner, J., Korenke, C., Diesen, C. et al. (2004) Mutations in the FKRP gene can cause muscle-eye-brain disease and Walker-Warburg syndrome. J. Med. Genet., 41, e61. [0207] Breton, C. and Imberty, A. (1999) Structure/function studies of glycosyltransferases. Curr. Opin. Struct. Biol., 9, 563-571. [0208] Brockington, M., Blake, D. J., Prandini, P., Brown, S. C., Torelli, S., Benson, M. A., Ponting, C. P., Estournet, B., Romero, N. B., Mercuri, E. et al. (2001) Mutations in the fukutin-related protein gene (FKRP) cause a form of congenital muscular dystrophy with secondary laminin alpha2 deficiency and abnormal glycosylation of alpha-dystroglycan. Am. J. Hum. Genet., 69, 1198-1209. [0209] Gicquel et al. (2017) Hum Mol Genet, doi: 10.1093/hmg/ddx066. [0210] Kanagawa, M., Kobayashi, K., Tajiri, M., Manya, H., Kuga, A., Yamaguchi, Y., Akasaka-Manya, K., Furukawa, J. I., Mizuno, M., Kawakami, H. et al. (2016) Identification of a Post-translational Modification with Ribitol-Phosphate and Its Defect in Muscular Dystrophy. Cell reports, in press. [0211] Mercuri, E., Brockington, M., Straub, V., Quijano-Roy, S., Yuva, Y., Herrmann, R., Brown, S. C., Torelli, S., Dubowitz, V., Blake, D. J. et al. (2003) Phenotypic spectrum associated with mutations in the fukutin-related protein gene. Ann. Neurol., 53, 537-542. [0212] Muller, T., Krasnianski, M., Witthaut, R., Deschauer, M. and Zierz, S. (2005) Dilated cardiomyopathy may be an early sign of the C826A Fukutin-related protein mutation. Neuromuscul. Disord., 15, 372-376. [0213] Rohr, U. P., Wulf, M. A., Stahn, S., Steidl, U., Haas, R. and Kronenwett, R. (2002) Fast to and reliable titration of recombinant adeno-associated virus type-2 using quantitative real-time PCR. J. Virol. Methods, 106, 81-88. [0214] Sharp, P. M., Cowe E., Higgins D. G., Shields D. C, Wolfe K. H, Wright F (1988) Codon usage patterns in Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Drosophila melanogaster and Homo sapiens; a review of the considerable within-species diversity. Nucleic Acids Res., 16(17):8207-11. [0215] Sveen, M. L., Schwartz, M. and Vissing, J. (2006) High prevalence and phenotype-genotype correlations of limb girdle muscular dystrophy type 2I in Denmark. Ann. Neurol., 59, 808-815. [0216] Toromanoff et al. (2008), Molecular Therapy 16(7):1291-99. [0217] Wahbi, K., Meune, C., Hamouda el, H., Stojkovic, T., Laforet, P., Becane, H. M., Eymard, B. and Duboc, D. (2008) Cardiac assessment of limb-girdle muscular dystrophy 2I patients: an echography, Holter ECG and magnetic resonance imaging study. Neuromuscul. Disord., 18, 650-655. [0218] Zheng Fan et al. (2012), Molecular Therapy 20(2), 456-461.