METHOD FOR THE MONITORING OF MODIFIED NUCLEASES INDUCED-GENE EDITING EVENTS BY MOLECULAR COMBING

20210340576 · 2021-11-04

Assignee

Inventors

Cpc classification

International classification

Abstract

Methods for detecting and characterizing large genomic rearrangements induced by modified nucleases at high resolution and for quantifying the frequency of the large genomic or gene rearrangements induced by modified nucleases using Molecular Combing.

Claims

1. A method for detecting, characterizing, quantifying, or determining the efficiency of, a gene or genome editing procedure or event comprising: editing a target nucleic acid(s) in a gene or genome and detecting or quantifying at least one genetic modification, deletion, duplication, amplification, translocation, insertion or inversion in the edited target nucleic acid using molecular combing.

2. The method of claim 1, wherein the editing comprises non-homologous end-joining (NHEJ) in a double strand break in the target nucleic acid(s).

3. The method of claim 1, wherein the editing comprises homologous recombination in the target nucleic acid(s) comprising at least one of allelic homologous recombination, gene conversion, non-allelic homologous recombination (NAHR), break-induced replication (BIR), or single strand annealing (SSA).

4. The method of claim 1, wherein the editing procedure comprises activating endogenous cellular repair machinery and contacting the target nucleic acid with a zinc finger nuclease.

5. The method of claim 1, wherein the editing comprises activation of endogenous cellular repair machinery and contacting the target nucleic acid(s) with at least one TALEN (Transcription activator-like effector nuclease).

6. The method of claim 1, wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with at least one meganuclease.

7. The method of claim 1, wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with at least one meganuclease of the LAGLIDADG (SEQ. ID NO: 1) family.

8. The method of claim 1, wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with at least one I-CreI or I-SceI meganuclease.

9. The method of claim 1, wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with a CRISPR/Cas9 system or CRISPR/Cas9 variant system.

10. The method of claim 1, wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with a type I CRISPR/Cas9 system; wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with a type II CRISPR/Cas9 system; wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with a type III CRISPR/Cas9 system; wherein the editing comprises activation of endogenous cellular repair machinery and contact of target nucleic acid(s) with a type IV CRISPR/Cas9 system; wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with a type V CRISPR/Cas9 system; or wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with a type VI CRISPR/Cas9 system.

11. The method of claim 1, wherein the editing produces a nucleic acid rearrangement that knocks out a gene.

12. The method of claim 1, wherein the editing produces a nucleic acid rearrangement that mutates the target nucleic acid(s); wherein the editing produces a nucleic acid rearrangement comprising a gene correction; wherein the editing produces a nucleic acid rearrangement comprising a deletion; wherein the editing produces a nucleic acid rearrangement comprising an insertion; wherein the editing produces a nucleic acid rearrangement comprising a duplication; wherein the editing produces a nucleic acid rearrangement comprising an amplification; wherein the editing produces a nucleic acid rearrangement comprising a translocation; or wherein the editing produces a nucleic acid rearrangement comprising an inversion.

13. The method of claim 1 that quantifies a number of nucleic acid rearrangements produced by the editing of the target nucleic acid(s).

14. The method of claim 1 that quantifies a number of nucleic acid rearrangements produced by the editing of the target nucleic acid(s) faster or with a higher degree of accuracy than a conventional quantification method selected from the group consisting of restriction site selection, PAGE-based genotyping assay, enzymatic mismatch cleavage-based assay, subcloning a target region, high-resolution melting curve (HRM) analysis, Next-Gen gene sequencing, and droplet digital PCR.

15. The method of claim 1, wherein the genome or gene editing procedure or event occurs in vivo or in a sample obtained from in vivo, optionally after treatment of a subject by gene therapy or with a polynucleotide, drug, radiation, immunological agent or other therapy.

16. The method according to claim 1, wherein said editing comprises: contacting the target nucleic acid that has been edited with an engineered nuclease or meganuclease(s), with an unedited control target sequence, and comparing said edited target nucleic acid sequence with the sequence of the unedited control target sequence.

17. The method according to claim 1, wherein a number of deletions or other unwanted or unexpected genetic events in the target nucleic acid(s) as well as a number of desired or expected edits to the target nucleic acid(s) are quantified by molecular combing.

18. The method of claim 17, wherein the editing is performed using an engineered nuclease or meganuclease.

19. The method according to claim 1, wherein said target nucleic acid(s) comprise BRCA1 genomic DNA.

20. A method for determining the efficiency, accuracy or specificity of a polynucleotide editing procedure that uses at least one modified nuclease comprising: (i) editing one or more polynucleotide(s) of interest using at least one modified nuclease, (ii) contacting the edited polynucleotide(s) with labelled polynucleotide(s) that hybridize to them and performing molecular combing of the fluorescent labeled polynucleotides, and (iii) comparing the edited polynucleotides hybridized to said labelled polynucleotides to one or more control polynucleotides, which have not been treated with the modified nuclease, hybridized to said labelled polynucleotide(s), thus determining the efficiency, accuracy or specificity of the polynucleotide editing procedure using the modified nuclease; and (iv) optionally, selecting a modified nuclease based polynucleotide editing procedure that is most accurate or efficient for correction or modification of a particular polynucleotide of interest.

21. The method according to claim 1, wherein the target nucleic acid(s) or a target polynucleotide of interest comprises BRCA1 genomic DNA.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0099] FIG. 1A. Schematic representation of the genomic structure of recombinant HSV-1 (rHSV-1) and of the different hybridization patterns that might be observed in control and I-SceI-treated rHSV-1 samples (biotin labelled-rHSV-1 probes are represented in white boxes; Alexa Fluor® 488-labelled LacZ probes are depicted in grey boxes). The overall structure of the rHSV-1 genome is shown with unique long (U.sub.L) and short (U.sub.S) regions and the TR.sub.L/TR.sub.S and IR.sub.L/IR.sub.s repeats. An expression cassette containing the cytomegalovirus (CMV) promoter and the LacZ coding sequence was inserted in the major latency-associated (LAT) genes. The I-SceI target site was cloned between the CMV promoter and the LacZ gene. The minimal requirement hybridization patterns as defined in the “Analysis of HSV-1 detected signals” section are also indicated just above the complete signal.

[0100] FIG. 1B. Several representative linear hybridization chains showing example of intact or I-SceI-digested/broken rHSV-1 DNA molecules (White: Alexa Fluor® 594-fluorescence: rHSV-1 probes; grey: Alexa Fluor® 488-fluorescence: LacZ probe).

[0101] FIG. 1C. Histogram showing the frequency of intact (white bars) and I-SceI-digested/broken (grey bars) rHSV-1 DNA molecules in both control and I-SceI-treated rHSV-1 samples.

[0102] FIG. 1D. Genomic structure of rHSV-1 (see FIG. 1A) and primer pairs used for detection of different regions of the rHSV-1 genome as precised in Table A.

[0103] FIG. 1E. Example of semi-quantitative PCR results on in vitro I-SceI-treated and control rHSV-1 DNA. The I-SceI-untreated rHSV-1 used as control (−) and the I-SceI-treated rHSV-1 samples (+) are amplified by PCR using target-specific primers as described in Table A. H.sub.2O and pCLS0126 (a viral vector with the pCMV-LacZ gene in the LAT gene) are used as negative and positive PCR control, respectively. In this example, no PCR product is observed in the negative control and a specific amplification product is detected with the positive control and with I-SceI-untreated rHSV1 whatever the primer pairs used and the dilution (except for 1:1000 which is below to the detectability limit). In contrast, for the I-SceI-treated, no amplification product was observed with both Sce1a and Sce1b primer pairs that overlap the 1-SceI target site.

[0104] FIG. 2A. Schematic representation of the BRCA1 GMC v5.2 used to evaluate the efficiency of CRISPR-Cas9 RNA-guided 6.5 kb-deletion. The complete BRCA1 GMC v5.2 covers a region of approximatively 200 kb and is composed of 16 fluorescent probes (B, a, b, c, d, e, f, g, h, I, j, k, l, m, n and R) that are labelled with different haptens as described in “Synthesis and labelling of BRCA Probes” (aminoDIG9-labelled probes are represented by black boxes, Fluo- and Biot-labelled probes are depicted by grey and white boxes, respectively). The region encoding BRCA1 (81.2 kb) is composed of 8 probes (a-h) and its 5′-upstream region is composed of 6 probes (i-n) including the BRCA1 pseudogene, ΨBRCA1 (j-k). The probes B and R located at each extremity of the BRCA1 GMC v5.2 are used as anchoring probes to demarcate the region of interest. The relative positions of the BRCA1 exons are shown above the schematic representation of the BRCA1 GMC v5.2.

[0105] FIG. 2B. CRISPR-Cas9 targeting of the BRCA1 gene. gRNA sequences were designed to bind sequences flanking the BRCA1 genomic region covered by the apparent blue b probe of the BRCA1 GMC v5.2. Grey arrows indicate the relative position of gRNA (as specified in Table B) that were designed to bind sequences flanking the BRCA1 genomic region covered by the 6.5 kb-apparent blue b probe (GRCh37/hg19 sequence: chr17: 41,205,246-41,211,745). Black arrows shows relative position of PCR primers used for the detection of the 6.5-kb deletion as indicated in Table C. Plain lines represent the region deleted region for each gRNA combination as specified in Table D and the size of the expected PCR products obtained after gene editing is indicated.

[0106] FIG. 2C. Agarose gel electrophoresis (2%) of amplification products of the CRISPR-Cas9-targeted BRCA1 region (GRCh37/hg19 sequence: chr17: 41,205,246-41,211,745) in transfected HEK293 cells (line 1-9 as specified in Table D) and in isogenic control (line 10) using the BRCA-Left-PCR-F and BRCA-Right-PCR-R (upper panel) and BRCA-Left-PCR-F and BRCA-Left-PCR-R (lower panel) primers pairs.

[0107] FIG. 2D. Examples of normal and edited BRCA1 fluorescent arrays on combed DNA extracted from HEK293 cells transfected with the Left-gRNA7+BRCA-Right-gRNA4 (upper panel), Left-gRNA7+BRCA-Right-gRNA9 (middle panel) and Left-gRNA7+BRCA-Right-gRNA12 (lower panel) gRNA pairs. Schematic representation of the normal BRCA1 fluorescent array is indicated (aminoDIG9-labelled probes are represented by black boxes, Fluo- and Biot-labelled probes are depicted by grey and white boxes, respectively).

[0108] FIG. 2E. Histogram of the distribution normal and edited BRCA1 fluorescent arrays in isogenic HEK293 cells (control) and in HEK293 cells transfected with the Left-gRNA7+BRCA-Right-gRNA4, Left-gRNA7+BRCA-Right-gRNA9 and Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs. Hybridization signals were selected and analyzed as described in the “Example 2” section. In this example, a total of hybridization signals comprising between 238 and 740 fluorescent signals per condition were identified and classified. No edited BRCA1 gene was detected in the isogenic HEK293 control cells whereas 10.5%, 11.1% and 6.5% of edited BRCA1 gene (where sequence b has been deleted) have been quantified in transfected HEK293 cells with the Left-gRNA7+BRCA-Right-gRNA4, Left-gRNA7+BRCA-Right-gRNA9 and Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs, respectively. Error bars represent 95% confidence intervals. Proportions with stars are significantly different at adjusted level alpha=0.05 (*) 0.01 (**) 0.001 (***).

[0109] FIG. 2F. Detection of other large rearrangements in the BRCA1 gene induced by the designed CRISPR-Cas9 system. Examples of a duplication/inversion in the BRCA1 gene detected in HEK293 cells transfected with the Left-gRNA7+BRCA-Right-gRNA4 gRNA pair. Schematic representation of the hybridization patterns corresponding of the potential duplication/inversion of the BRCA1 gene is indicated (aminoDIG9-labelled probes are represented by black boxes, Fluo- and Biot-labelled probes are depicted by grey and white boxes, respectively). The hatched boxes represents the region of BRCA1 GMC v5.2 that has been deleted (blue B and green a probes) in these examples. The regions of the BRCA1 GMC v5.2 that are indicated between brackets correspond to regions that have not been observed in the fluorescent arrays probably due to random breakage of DNA molecules during the Molecular Combing process. The breakpoint of the duplication/inversion is located within the sequence of the apparent blue b probe (indicated by the cross).

[0110] FIG. 2G. Histogram of the distribution rearranged BRCA1 fluorescent arrays in isogenic HEK293 cells (control) and in HEK293 cells transfected with the Left-gRNA7+BRCA-Right-gRNA4, Left-gRNA7+BRCA-Right-gRNA9 and Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs. Hybridization signals were selected and analyzed as described in the “Example 2” section. In this example, a total of hybridization signals comprising between 238 and 740 fluorescent signals per condition were identified and classified. 0.9%, 3.8%, 2.5% and 1.6% of rearranged BRCA1 gene have been quantified in isogenic HEK293 control cells and in transfected HEK293 cells with the Left-gRNA7+BRCA-Right-gRNA4, Left-gRNA7+BRCA-Right-gRNA9 and Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs, respectively. Error bars represent 95% confidence intervals. Proportions with stars are significantly different at adjusted level alpha=0.05 (*) 0.01 (**) 0.001 (***).

[0111] FIG. 3A. Histogram of the distribution of deletion events in the BRCA1 gene measured by ddPCR in HEK293 cells transfected with the BRCA-Left-gRNA7+BRCA-Right-gRNA4, the BRCA-Left-gRNA7+BRCA-Right-gRNA9 and the BRCA-Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs. The genomic DNAs extracted from isogenic (control) or transfected HEK293 cells were analyzed in triplicates or quadruplicates as described in the “Example 2” section. Because of threshold choice during ddPCR analysis, few deletion events were artefactual detected in isogenic HEK293 cells (control). The mean value of these events was subtracted from the count of deletions observed in transfected cells. A total number of events (normal alleles plus deletions) between 1592 and 2656 were measured for each sample. 14.3%, 12.0% and 7.9% of edited BRCA1 gene (6.5 kb deletion) have been quantified in HEK293 cells transfected with the BRCA-Left-gRNA7+BRCA-Right-gRNA4, the BRCA-Left-gRNA7+BRCA-Right-gRNA9 and the BRCA-Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs, respectively. Error bars represent standard deviations.

[0112] FIG. 3B. Histogram of the distribution of deletion events in the BRCA1 gene measured by targeted-NGS in isogenic HEK293 cells (control) and in HEK293 cells transfected with the BRCA-Left-gRNA7+BRCA-Right-gRNA4, the BRCA-Left-gRNA7+BRCA-Right-gRNA9 and the BRCA-Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs. The genomic DNAs extracted from isogenic (control) or transfected HEK293 cells were analyzed in duplicates as described in the “Example 2” section. A total number of events (normal alleles, deletions and rearrangements) between 1394 and 2086 were measured for each sample. One deletion event was detected in the isogenic HEK293 control cells whereas 1.3%, 1.3% and 1.0% of edited BRCA1 gene have been quantified in HEK293 cells transfected with the BRCA-Left-gRNA7+BRCA-Right-gRNA4, the BRCA-Left-gRNA7+BRCA-Right-gRNA9 and the BRCA-Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs, respectively. Results are presented as the mean of duplicated experiments.

[0113] FIG. 3C. Histogram of the distribution of rearranged BRCA1 gene measured by targeted-NGS in isogenic HEK293 cells (control) and in HEK293 cells transfected with the BRCA-Left-gRNA7+BRCA-Right-gRNA4, the BRCA-Left-gRNA7+BRCA-Right-gRNA9 and the BRCA-Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs. The genomic DNAs extracted from isogenic (control) or transfected HEK293 cells were analyzed in duplicates as described in the “Example 2” section. A total number of events (normal alleles, deletions and rearrangements) between 1394 and 2086 were measured for each sample. No rearranged BRCA1 gene was detected in the isogenic HEK293 control cells whereas 2.6%, 2% and 1.1% of rearranged BRCA1 gene have been quantified in HEK293 cells transfected with the BRCA-Left-gRNA7+BRCA-Right-gRNA4, the BRCA-Left-gRNA7+BRCA-Right-gRNA9 and the BRCA-Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs, respectively. Results are presented as the mean of duplicated experiments.

DETAILED DESCRIPTION OF THE INVENTION

[0114] As explained above, the Molecular Combing based methods of the invention do not require pre-analytical steps and thus avoid the introduction of bias attributable to these pre-analytical steps and permit the detection of both expected gene editing events as well as rare or unexpected gene editing events as shown below in the Examples and in FIGS. 2D-2G. The gene or genome editing genome may involve a complete gene or genome or a fragment of gene or genome. These events can be detected in a single assay that directly inspects and counts each molecule without the bias introduced by pre-analytical steps. The surprising advantages of a method that combines molecular combing with genome or gene editing using CRISPR have not been previously recognized.

[0115] The present invention provides a new method for quality control of editing procedures using modified nucleases using Molecular Combing. The method comprises at least two, preferably at least three steps characterized by, first, the modification of the polynucleotide(s) of interest by a modified nuclease, second the detection, the characterization and the quantification of the modified polynucleotide(s) by molecular combing comprising selected fluorescent polynucleotides and optionally, third, the comparison with one or more control samples, which have not been treated with the modified nuclease, to determine the efficacy and/or the specificity associated with the modified nuclease. Optionally, the modified polynucleotide(s) which have been detected during the molecular combing process allow selection of the most accurate and efficient modified nuclease for therapeutic applications, such as gene correction and gene modification. The method may also, optionally, comprise the use of at least one modified nuclease or multiple modified nucleases depending on the targeted region(s) in a polynucleotide of interest, such as a portion of the genome or a target gene.

[0116] The present invention is also directed to an alternative method that detects, in a biological sample of a patient treated with the selected modified nuclease, the genetic modifications induced by a selected modified nuclease in order to follow the treatment efficacy and safety. In this embodiment, the method comprises the following steps: first, the modification of the polynucleotide of interest by a modified nuclease and then by detecting, characterizing and quantifying the modified polynucleotide(s) by molecular combing, comprising selected fluorescent polynucleotides. In this embodiment, a comparison between the samples before and after the use of the selected modified nuclease may optionally be made, thus allowing a more accurate determination of the treatment efficacy and safety. Optionally, this method may comprise the use of multiple modified nucleases depending on the targeted genomic regions to be corrected or modified, such as target polynucleotide regions involved in polygenic diseases.

[0117] Genome or gene editing of particular genetic diseases or disorders that may be detected, characterized, or quantified according to the invention include, but are not limited to Achondroplasia, Alpha-1 Antitrypsin Deficiency, Antiphospholipid Syndrome, Autism, Autosomal Dominant Polycystic Kidney Disease, Breast cancer, Charcot-Marie-Tooth, Colon cancer, Cri du chat, Crohn's Disease, Cystic fibrosis, Dercum Disease, Down Syndrome, Duane Syndrome, Duchenne Muscular Dystrophy, Factor V Leiden Thrombophilia, Familial Hypercholesterolemia, Facio-Scapulo-Humeral Dystrophy (FSHD), Familial Mediterranean Fever, Fragile X Syndrome, Gaucher Disease, Hemochromatosis, Hemophilia, Holoprosencephaly, Huntington's disease, Klinefelter syndrome, Leber Congenital Amaurosis, Marfan syndrome, Myotonic Dystrophy, Neurofibromatosis, Noonan Syndrome, Osteogenesis Imperfecta, Parkinson's disease, Phenylketonuria, Poland Anomaly, Porphyria, Progeria, Prostate Cancer, Retinitis Pigmentosa, Severe Combined Immunodeficiency (SCID), Sickle cell disease, Skin Cancer, Spinal Muscular Atrophy, Tay-Sachs, Thalassemia, Trimethylaminuria, Turner Syndrome, Velocardiofacial Syndrome, WAGR Syndrome, and Wilson Disease.

[0118] The method of the invention may be employed to detect, characterize, assess or quantify genome or gene editing events in a polynucleotide, genome, exon, intron, or gene of choice. Specific kinds of genes include, but are not limited to prokaryotic or eukaryotic genes or genomes, yeast or fungal genomes or genes, plant or algae genes, invertebrate or vertebrate genes, genes from fish, amphibians, reptiles, birds including chickens, turkeys and ducks, mammalian genes including those of domesticated animals, such as horses, cattle, cows, goats, sheep, llamas, camels, or pigs.

[0119] Such genes include any of the following a mammalian β globin gene (HBB), a gamma globin gene (HBG1), a B-cell lymphoma/leukemia 11A (BCL11A) gene, a Kruppel-like factor 1 (KLF1) gene, a CCR5 gene, a CXCR4 gene, a PPP1R12C (AAVS1) gene, an hypoxanthine phosphoribosyltransferase (HPRT) gene, an albumin gene, a Factor VIII gene, a Factor IX gene, a Leucine-rich repeat kinase 2 (LRRK2) gene, a Huntingtin (Htt) gene, a rhodopsin (RHO) gene, a Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene, a surfactant protein B gene (SFTPB), a T-cell receptor alpha (TRAC) gene, a T-cell receptor beta (TRBC) gene, a programmed cell death 1 (PD1) gene, a Cytotoxic T-Lymphocyte Antigen 4 (CTLA-4) gene, an human leukocyte antigen (HLA) A gene, an HLA B gene, an HLA C gene, an HLA-DPA gene, an HLA-DQ gene, an HLA-DRA gene, a LMP7 gene, a Transporter associated with Antigen Processing (TAP) 1 gene, a TAP2 gene, a tapasin gene (TAPBP), a class II major histocompatibility complex transactivator (CIITA) gene, a dystrophin gene (DMD), a glucocorticoid receptor gene (GR), an IL2RG gene, a centrosomal protein of 290 kDa (CEP290), Double homeobox 4 (DUX4) and an RFX5 gene. Such genes also include a plant FAD2 gene, a plant FAD3 gene, a plant ZP15 gene, a plant KASII gene, a plant MDH gene, and a plant EPSPS gene.

[0120] Accordingly the invention is directed to a method for detecting, characterizing, quantifying or determining the efficiency of a gene or genome editing procedure or event comprising a step of Molecular Combing which is carried out as a step of stretching nucleic acid, extracted from any source to be assessed (from virus, bacteria to human through plants . . . ) to provide immobilized nucleic acids in linear and parallel strands (aligned nucleic acids). Molecular Combing is thus preferably performed with a controlled stretching factor (such as a meniscus as disclosed hereafter) formed on an appropriate surface (e.g., surface-treated glass slides). After stretching, it is possible to hybridize sequence-specific probes detectable for example by fluorescence microscopy (Lebofsky, Heilig et al. 2006). Thus, a particular nucleic acid sequence may be directly visualized on a single molecule level. The length of the fluorescent signals and/or their number, and/or their spacing on the slide provides a direct reading of the size and relative spacing of the probes.

[0121] Molecular combing is accordingly a technique enabling the direct visualization of individual nucleic acid molecules

[0122] Representative for the purpose of the invention, but not limited, methods of Molecular Combing are described by reference to Bensimon, et al., U.S. Pat. No. 6,303,296. These include a process for aligning a nucleic acid on a surface S of a support, wherein the process comprises (a) providing a support having a surface S; (b) contacting the surface S with the nucleic acid; (c) anchoring the nucleic acid to the surface S; (d) contacting the surface S with a first solvent A; (e) contacting the first solvent A with a medium B to form an A/B interface, wherein said medium B is a gas or a second solvent; (f) forming a triple line S/A/B (meniscus) resulting from the contact between the first solvent A, the surface S, and the medium B; and (g) moving the meniscus to align the nucleic acid on the surface.

[0123] In this molecular combing process according to or based on the elements and steps described by U.S. Pat. No. 6,303,296, the movement of the meniscus may be achieved by evaporation of the solvent A, which may constitute water or another aqueous medium which may contain surfactants. In this process movement of the meniscus may be achieved by movement of the A/B interface relative to the surface S, wherein S, A and B form a triple line S/A/B constituting the meniscus between the surface S, the solvent A and a medium B which may be a gas (in general air) or another solvent, one example is a water/air meniscus. In this process the surface S may be removed from the solvent A or the solvent A is removed from the surface S in order to move the meniscus. The surface, S, in this process may comprise an organic polymer, an inorganic polymer, a metal, a metal oxide, a sulfide, a semiconductor element, or a combination thereof, for example, it may comprise glass, surface-oxidized silicon, gold, graphite, molybdenum sulfide, or mica. A support useful in this process may comprise a plate, a bead, a fiber, or a particle. In some embodiments, the solvent A is placed between the support of surface S and a second support. Anchoring of nucleic acid(s) in the process may occur via a physicochemical interaction. In some embodiments, the surface S of the support comprises an exposed reactive group having an affinity for the nucleic acid or a molecule with biological activity capable of recognizing the nucleic acid, in other embodiments the surface comprises vinyl, amine, carboxyl, aldehyde, or hydroxyl groups.

[0124] The surface S of the support may comprise a substantially monomolecular layer of an organic compound having at least: (a) an attachment group having an affinity for the support; and (b) an exposed group having no or little affinity for the support and the attachment group under attachment conditions, but having an affinity for the nucleic acid or the molecule with biological activity. Anchoring of nucleic acid(s) to the surface may comprise (a) contacting the nucleic acid with the exposed reactive group; (b) adsorbing the nucleic acid to the exposed reactive group at predetermined pH values or ionic content, or by applying an electric voltage, wherein the pH conditions are between a pH resulting in a state of complete adsorption and a pH resulting in an absence of adsorption.

[0125] An exposed reactive group may be an ethylenic double bond or an amine group, such as a vinyl or amine group. In some embodiments, adsorption of the nucleic acid may occur at an end of the nucleic acid, the exposed reactive group may be an ethylenic double bond, and the pH is less than 8, preferably between 5 and 6. In another embodiment, the adsorption of the nucleic acid occurs at an end of the nucleic acid, the surface is a polylysine or a silane group, and the exposed group is an amine group. In another embodiment, the adsorption of the nucleic acid occurs at an end of the nucleic acid, the exposed reactive group is an amine group, and the pH is between 9 and 10.

[0126] The molecular combing process according to or based on the elements and steps described by U.S. Pat. No. 6,303,296, may be used to detect a nucleic acid in a sample. Such a nucleic acid detection process may comprise (a) providing a support having a surface S; (b) contacting the surface S with a nucleic acid; (c) anchoring the nucleic acid to the surface S; (d) contacting the surface S with a first solvent A; (e) contacting the first solvent A with a medium B, to form an A/B interface, wherein said medium B is a gas or a second solvent; (f) forming a triple line S/A/B (meniscus) resulting from the contact between the first solvent A, the surface S, and the medium B; (g) moving the meniscus to align the nucleic acid on the surface; and (h) detecting, either directly or indirectly, the aligned nucleic acid.

[0127] In certain embodiments of the molecular combing processes described by or based on those described by U.S. Pat. No. 6,303,296, the nucleic acid has a sequence complementary to a second nucleic acid sequence in a sample; a molecule with biological activity is biotin, avidin, streptavidin, derivatives thereof, or an antigen-antibody system; the surface exhibits low fluorescence and the nucleic acid is detected, either directly or indirectly, using a fluorescent reagent; the detection is performed using beads; the detection is performed using optical or near field microscopy; or the process may further comprise binding a second molecule to the nucleic acid attached to the surface S, and disrupting nonspecific binding.

[0128] Other embodiments of the processes disclosed by U.S. Pat. No. 6,303,296 include a process for detecting a nucleic acid in a sample, wherein the process comprises: (a) providing a support having a surface S; (b) anchoring a second nucleic acid to the surface S; (c) contacting the surface S with a sample A, the sample A comprising a nucleic acid that binds to the second nucleic acid anchored to the surface in a first solvent; (d) binding the nucleic acid in the sample to the anchored nucleic acid; (e) contacting the sample A with a medium B to form an A/B interface, wherein said medium B is a gas or a second solvent; (f) forming a triple line S/A/B (meniscus) resulting from the contact between the sample A, the surface S, and the medium B; (g) moving the meniscus to align the bound nucleic acids on the surface; and (h) detecting, either directly or indirectly, the aligned nucleic acids.

[0129] In the molecular combing processes described by or based on those in U.S. Pat. No. 6,303,296, the method of detecting can be ELISA or FISH; or the nucleic acid in the sample is the product of an enzymatic amplification.

[0130] The molecular combing procedures described by or based on those described by U.S. Pat. No. 6,303,296, may be used to map genomes or genes that have been modified or repaired, for example, by (a) providing a support having a surface S; (b) contacting the surface S with a nucleic acid to be mapped; (c) anchoring the nucleic acid to the surface S; (d) aligning the anchored nucleic acid on the surface as described above; (e) hybridizing a second nucleic acid of known sequence to the first nucleic acid; and (f) detecting the hybridization between the first nucleic acid and the second nucleic acid. In such processes, the first or the second nucleic acid may comprise genomic DNA; the position and/or the size of the second nucleic acid, which is bound to the first nucleic acid, can be measured; step (d) may comprise stretching the anchored nucleic acid; and the presence or absence of hybridization provides a diagnosis of a pathology or an indication that a genetic modification has been made or a genetic correction made.

[0131] Other representative, but not limiting, molecular combing procedures are described by reference to Lebofsky, et al., in WO2008028931, which is incorporated by reference. These methods include a method of detection of the presence of at least one domain of interest on a macromolecule to test, wherein said method comprises the following steps: a) determining beforehand at least two target regions on the domain of interest, designing and obtaining corresponding labeled probes of each target region, named set of probe of the domain of interest, the position of these probes one compared to the others being chosen and forming the specific signature of said domain of interest on the macromolecule to test; b) after spreading of the macromolecule to test on which the probes obtained in step a) are bound, detection of the position one compared to the others of the probes bound on the linearized macromolecule, the detection of the signature of a domain of interest indicating the presence of said domain of interest on the macromolecule to test, and conversely the absence of detection of signature or part of signature of a domain of interest indicating the absence of said domain or part of said domain of interest on the macromolecule to test. The method described above, can be used for determination of the presence of at least two domains of interest and also comprise in step a) determining beforehand at least three target regions on each of the domains of interest. In this method the signature of a domain of interest may result from the succession of spacing between consecutive probes; the position of the domain of interest can be used as reference to locate a chemical or a biochemical reaction; the position of the domain of interest may be used to establish a physical map in the macromolecule encompassing the target region; the domain of interest may consist in a succession of different labelled probes; or some of the probe of the target region may also be part of the signature of at least one other the domain of interest located near on the macromolecule. In this method, all the probes may be labeled with the same label; the probes may be labeled with at least two different labels; the signature of a domain of interest may result of the succession of labels. In this method, the macromolecule may be a nucleic acid, particularly DNA, more particularly double strand DNA; the probes used may be oligonucleotides of at least 1 kb, the spreading of the macromolecule may take place by linearization which may occur before or after binding of the probes on the macromolecules. Linearization of the macromolecule can be made by molecular combing or Fiber Fish. In some embodiments, the binding of at least three probes corresponding to a domain of interest on the macromolecule forms a sequence of at least two spaces chosen between a group of at least two different spaces (for example “short” and “large”), said group being identical for each domain of interest may take place; and the set of probes may comprise in addition two probes (probe 1 or probe 2), each probe capable of binding on a different extremity of the domain of interest, the reading of the signal of one of said probe 1 or probe 2 associated with its consecutive probe in the domain of interest, named “extremity probe couple of start or end” allowing to obtain an information of start or end of reading. In some embodiments, information of start of reading results of the reading of the spacing between the two consecutives probes of the extremity probe couple of start; information of end of reading results of the reading of the spacing between the two consecutives probes of the extremity probe couple of end; or information of start of reading results of the reading of the spacing between the two consecutives probes of the extremity probe couple of start and the information of end of reading results of the reading of the spacing between the two consecutives probes of the extremity probe couple of end, said spacing being different for the extremity probe couple of start and the extremity probe couple of end in order to differentiate information of start and end. In other embodiments of this method, the probes are labeled with fluorescent label or a radioactive label. In some embodiments, the signature comprises a space between the first and the second probe in a set of probes, the space being different from all other spaces in the signature and the space can be used to obtain information about the start of the signature; or the signature comprises a space between the next to last and the last probe in a set of probes, the space being different from all other spaces in the signature and the space can be used to obtain information about the end of the signature.

[0132] Specific, but not limited, embodiments of the invention include:

[0133] Embodiment 1. A method for detecting, characterizing, quantifying, or determining the efficiency of a gene or genome editing procedure or event comprising performing a genome or gene editing method on target nucleic acid(s) and detecting genetic modifications such as deletion, duplication, amplification, translocation, insertion or inversion using molecular combing or quantifying the efficiency of the genome or gene editing method using molecular combing. The methods described herein may also be used for detecting, characterizing, quantifying, or determining the efficiency of modification or edits or made to other polynucleotides, for example, to segments of a genome outside of a coding or genetic sequence.

[0134] Embodiment 2. The method of embodiment 1, wherein the gene or genome editing procedure comprises non-homologous end-joining (NHEJ).

[0135] Embodiment 3. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure comprises homologous recombination comprising at least one of allelic homologous recombination, gene conversion, non-allelic homologous recombination (NAHR), break-induced replication (BIR), single strand annealing (SSA), or other homologous recombination method.

[0136] Embodiment 4. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure comprises activation of endogenous cellular repair machinery and contact of target nucleic acid(s) with a zinc finger nuclease.

[0137] Embodiment 5. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure comprises activation of endogenous cellular repair machinery and contact of target nucleic acid(s) with at least one TALEN (Transcription activator-like effector nuclease).

[0138] Embodiment 6. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure comprises activation of endogenous cellular repair machinery and contact of target nucleic acid(s) with at least one meganuclease. Embodiment 7. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure comprises activation of endogenous cellular repair machinery and contact of target nucleic acid(s) with at least one meganuclease of the LAGLIDADG (SEQ. ID NO: 1) family.

[0139] LAGLIDADG (SEQ. ID NO: 1):

[0140] Every polypeptide has 1 or 2 LAGLIDADG (SEQ. ID NO: 1) motifs. The sequence LAGLIDADG (SEQ. ID NO: 1) is a conserved sequence of amino acids where each letter is a code that identifies a specific residue. This sequence is directly involved in the DNA cutting process. Those enzymes that have only one motif work as homodimers, creating a saddle that interacts with the major groove of each DNA half-site. The LAGLIDADG (SEQ. ID NO: 1) motifs contribute amino acid residues to both the protein-protein interface between protein domains or subunits, and to the enzyme's active sites. Enzymes that possess two motifs in a single protein chain act as monomers, creating the saddle in a similar way; see Jurica M S, Monnat R J, Stoddard B L (October 1998). “DNA recognition and cleavage by the LAGLIDADG (SEQ. ID NO: 1) homing endonuclease I-CreI”, Mol. Cell. 2 (4): 469-76 which is incorporated by reference.

[0141] Embodiment 8. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure comprises activation of endogenous cellular repair machinery and contact of target nucleic acid(s) with at least one meganuclease selected from HNH, His-Cys box, GIY-YIG, PD-(D/E)xk and Vsr-like families. Meganucleases described by the embodiments above are described by Belfort M, Roberts R J (September 1995). “Homing endonucleases: keeping the house in order”. Nucleic Acids Res. 25 (17): 3379-88, which is incorporated by reference, describes several structural motifs. Such nucleases may be used for genome, gene and polynucleotide editing steps.

[0142] GIY-YIG:

[0143] These have only one GIY-YIG motif, in the N-terminal region, that interacts with the DNA in the cutting site. The prototypic enzyme of this family is I-TevI which acts as a monomer. Separate structural studies have been reported of the DNA-binding and catalytic domains of I-TevI, the former bound to its DNA target and the latter in the absence of DNA, see Van Roey, P.; Fox, K M; et al. (July 2001). “Intertwined structure of the DNA-binding domain of intron endonuclease I-TevI with its substrate”. EMBO J. 20 (14): 3631-3637 and Van Roey, P.; Kowalski, Joseph C.; et al. (July 2002). “Catalytic domain structure and hypothesis for function of GIY-YIG intron endonuclease I-TevI”. Nature Structural Biology. 9 (11): 806-811, which are incorporated by reference.

[0144] His-Cys Box:

[0145] These enzymes possess a region of 30 amino acids that includes 5 conserved residues: two histidines and three cysteines. They co-ordinate the metal cation needed for catalysis. I-PpoI is the best characterized enzyme of this family and acts as a homodimer. Its structure was reported in 1998, see Flick, K.; et al. (July 1998). “DNA binding and cleavage by the nuclear intron-encoded homing endonuclease I-PpoI”. Nature. 394 (6688): 96-101, which is incorporated by reference.

[0146] H-N-H:

[0147] These have a consensus sequence of approximately 30 amino acids. It includes two pairs of conserved histidines and one asparagine that create a zinc finger domain. I-HmuI is the best characterized enzyme of this family, and acts as a monomer. Its structure was reported in 2004, see Shen, B. W.; et al. (September 2004). “DNA binding and cleavage by the HNH homing endonuclease I-HmuI”. J. Mol. Biol. 342 (1): 43-56, which is incorporated by reference.

[0148] PD-(D/E)xK:

[0149] These enzymes contain a canonical nuclease catalytic domain typically found in type II restriction endonucleases. The best characterized enzyme in this family, I-Ssp6803I, acts as a tetramer. Its structure was reported in 2007, see Zhao, L.; et al. (May 2007). “The restriction fold turns to the dark side: a bacterial homing endonuclease with a PD-(D/E)-XK motif”. EMBO Journal. 26 (9): 2432-2442, which is incorporated by reference.

[0150] Vsr-Like:

[0151] These enzymes were discovered in the Global Ocean Sampling Metagenomic Database and first described in 2009. The term ‘Vsr-like’ refers to the presence of a C-terminal nuclease domain that displays recognizable homology to bacterial Very Short Patch Repair (Vsr) endonucleases, see Dassa, B.; et al. (March 2009). “Fractured genes: a novel genomic arrangement involving new split inteins and a new homing endonuclease family”. Nucleic Acids Research. 37 (8): 2560-2573, which is incorporated by reference.

[0152] Embodiment 9. The method of embodiment 1, wherein the gene or genome editing procedure comprises activation of endogenous cellular repair machinery and contact of target nucleic acid(s) with at least one I-CreI or I-SceI meganuclease.

[0153] Embodiment 10. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure comprises activation of endogenous cellular repair machinery and contact of target nucleic acid(s) with a CRISPR/Cas9 system or CRISPR/Cas9 variant system.

[0154] Embodiment 11. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure comprises activation of endogenous cellular repair machinery and contact of target nucleic acid(s) with a type I CRISPR/Cas9 system.

[0155] Embodiment 12. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure comprises activation of endogenous cellular repair machinery and contact of target nucleic acid(s) with a type II CRISPR/Cas9 system.

[0156] Embodiment 13. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure comprises activation of endogenous cellular repair machinery and contact of target nucleic acid(s) with a type III CRISPR/Cas9 system.

[0157] Embodiment 14. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure comprises activation of endogenous cellular repair machinery and contact of target nucleic acid(s) with a type IV CRISPR/Cas9 system.

[0158] Embodiment 15. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure comprises activation of endogenous cellular repair machinery and contact of target nucleic acid(s) with a type V CRISPR/Cas9 system.

[0159] Embodiment 16. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure comprises activation of endogenous cellular repair machinery and contact of target nucleic acid(s) with a type VI CRISPR/Cas9 system.

[0160] Embodiment 17. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure produces a nucleic acid rearrangement comprising a gene knockout.

[0161] Embodiment 18. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure produces a nucleic acid rearrangement comprising a mutation other than a single nucleotide variation.

[0162] Embodiment 19. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure produces a nucleic acid rearrangement comprising a correction. Such a correction may comprise a correction to a coding sequence, a correction in a genetic sequence outside of the coding region or a correction outside of a gene region.

[0163] Embodiment 20. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure produces a nucleic acid rearrangement comprising a deletion. Such a deletion may comprise a deletion to a coding sequence, a deletion in a genetic sequence outside of the coding region or a deletion outside of a gene region.

[0164] Embodiment 21. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure produces a nucleic acid rearrangement comprising an insertion. Such an insertion may comprise an insertion into a coding sequence, an insertion into a genetic sequence outside of the coding region or an insertion outside of a gene region.

[0165] Embodiment 22. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure produces a nucleic acid rearrangement comprising a duplication. Such a duplication may comprise a duplication to a coding sequence, a duplication in a genetic sequence outside of the coding region or a duplication outside of a gene region.

[0166] Embodiment 23. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure produces a nucleic acid rearrangement comprising an amplification. Such an amplification may comprise an amplification to a coding sequence, an amplification in a genetic sequence outside of the coding region or an amplification outside of a gene region.

[0167] Embodiment 24. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure produces a nucleic acid rearrangement comprising a translocation. Such a translocation may comprise a translocation to a coding sequence, a translocation in a genetic sequence outside of the coding region or a translocation outside of a gene region.

[0168] Embodiment 25. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the gene or genome editing procedure produces a nucleic acid rearrangement comprising an inversion. Such an inversion may comprise an inversion to a coding sequence, an inversion in a genetic sequence outside of the coding region or an inversion outside of a gene region.

[0169] Embodiment 26. The method of embodiment 1 or any one or more of the preceding embodiments that detects or quantifies a nucleic acid rearrangement or the lack of a nucleic acid rearrangement or off-target events with at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100%, accuracy or efficiency.

[0170] Embodiment 27. The method of any of the preceding embodiments that detects or quantifies a nucleic acid rearrangement or the lack of a nucleic acid rearrangement or off-target events with at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100% or more accuracy or efficiency (where 100% indicates double the accuracy or efficiency of a comparative conventional method) than at least one conventional method of restriction site selection, PAGE-based genotyping method, enzymatic mismatch cleavage-based assays, subcloning a target region, subcloning of the targeted region, high-resolution melting curve (HRM) analysis, next gene sequencing, or droplet digital PCR or any other conventional methods that detect or quantify rearrangements.

[0171] Embodiment 28. The method of embodiment 1 or any one or more of the preceding embodiments, wherein the genome or gene editing procedure or event occurs in vivo or in a sample obtained from in vivo, optionally after treatment of a subject with a polynucleotide, drug, radiation, immunological agent or other therapy.

[0172] Embodiment 29. The method of embodiment 1 or any one or more of the preceding embodiments, further comprising detecting a polynucleotide comprising a genomic or gene rearrangement, deletion, duplication, amplification, translocation, insertion or inversion or selecting a sample comprising said polynucleotide.

[0173] Embodiment 30. A rearranged or edited polynucleotide selected or otherwise identified or validated by the method of embodiment 1 or any one or more of the preceding embodiments.

[0174] Embodiment 31. The rearranged or edited polynucleotide of embodiment 30 that is cDNA or DNA.

[0175] Embodiment 32. Use of a polynucleotide, drug, radiation, immunological agent or other therapeutic agent in combination with one or more genome or gene editing or molecular combing agents described by embodiment 1 or any one or more of the preceding embodiments for treatment of the human or animal body, for example, by genetic surgery or therapy, and/or for diagnosis thereof.

[0176] Embodiment 33. A method for controlling quality of a polynucleotide, genome or gene editing procedure that uses at least one modified nuclease comprising: [0177] (i) editing one or more polynucleotide(s) of interest using at least one modified nuclease, [0178] (ii) detecting, characterizing or quantifying the edited polynucleotide(s) by contacting them with fluorescent polynucleotide(s) that hybridize to them and performing molecular combing, and [0179] (iii) comparing the edited polynucleotides hybridized to said fluorescent polynucleotides of interest to one or more control polynucleotides, which have not been treated with the modified nuclease, hybridized to said fluorescent polynucleotide(s), thus determining the efficiency, accuracy or specificity of the polynucleotide editing procedure using the modified nuclease; [0180] (iv) optionally, selecting a modified nuclease based polynucleotide, genome or gene editing procedure that is most accurate or efficient for correction or modification of a particular polynucleotide, gene or genome or for a therapeutic application. The editing procedure may be performed with any of the modified nucleases described herein or two or more of such nucleases, for example, when different parts of a polynucleotide, gene or genome are to be modified. This procedure may be performed using molecular combing methods known in the art or those described herein.

[0181] Embodiment 34. The method according to embodiment 1 or one or more of the preceding embodiments, wherein said performing a genome or gene editing method comprises:

[0182] a first step of contacting the modified nucleic acid sequence with the corresponding labeled standard reference genetic sequence of interest, said genetic modifications, deletions or replacement in the genomic DNA having been operated with an engineered nuclease or meganuclease,

[0183] a second step of comparing said modified nucleic acid sequence with the corresponding standard reference nucleic acid sequence of interest.

[0184] Embodiment 35. A method according to embodiment 1 or one or more of the preceding embodiments comprising a step of quantification of the number of deletions events or of unwanted genetic events or of unexpected rearrangements occurred and simultaneously the identification of the genetic modifications or of the deletion in the targeted region of the modified genome.

[0185] Embodiment 36. A method according to embodiment 1 or one or more of the preceding embodiments comprising:

[0186] a first step a step of quantification of the number of deletions events or of unwanted genetic events or of unexpected rearrangements occurred and said step being followed by a second step allowing the identification of the deletion and then the quantification of unexpected rearrangements or unwanted genetic events in the targeted region or sequence of the modified genome wherein the said modifications are operated by engineered nucleases or mega nucleases,

[0187] or optionally followed by a second step allowing the identification of the deletion and then the quantification of unexpected rearrangements or unwanted genetic events in the targeted region or sequence of the modified genome wherein the said modifications are operated by engineered nucleases or mega nucleases.

[0188] Embodiment 37. The method according to embodiment 1 or one or more of the preceding embodiments, wherein the modified nucleic acid is genomic DNA or a recombinant or synthetic DNA hybridizing under stringent conditions with the reference or normal wild type of DNA.

[0189] Embodiment 38. The method according to Embodiment 1 or one or more of the preceding embodiments, wherein said detecting or quantifying DNA modifications comprises the quantifying the number of deletions events in the BRCA1 genomic DNA and identifying the said genetic modifications in the targeted cellular genomic DNA.

[0190] Embodiment 39. A method for detecting, characterizing, quantifying, or determining the efficiency of, a gene or genome editing procedure or event comprising:

[0191] editing a target nucleic acid(s) in a gene or genome and

[0192] detecting or quantifying at least one genetic modification, deletion, duplication, amplification, translocation, insertion or inversion in the edited target nucleic acid using molecular combing.

[0193] Embodiment 40. The method of embodiment 39, wherein the editing comprises non-homologous end-joining (NHEJ) in a double strand break in the target nucleic acid(s).

[0194] Embodiment 41. The method of embodiment 39 or of any one or more of the preceding embodiments, wherein the editing comprises homologous recombination in the target nucleic acid(s) comprising at least one of allelic homologous recombination, gene conversion, non-allelic homologous recombination (NAHR), break-induced replication (BIR), or single strand annealing (SSA).

[0195] Embodiment 42. The method of embodiment 39 or of any one or more of the preceding embodiments, wherein the editing procedure comprises activating endogenous cellular repair machinery and contacting the target nucleic acid with a zinc finger nuclease.

[0196] Embodiment 43. The method of embodiment 39 or of any one or more of the preceding embodiments, wherein the editing comprises activation of endogenous cellular repair machinery and contacting the target nucleic acid(s) with at least one TALEN (Transcription activator-like effector nuclease).

[0197] Embodiment 44. The method of embodiment 39 or of any one or more of the preceding embodiments, wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with at least one meganuclease.

[0198] Embodiment 45. The method of embodiment 39 or of any one or more of the preceding embodiments, wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with at least one meganuclease of the LAGLIDADG (SEQ. ID NO: 1) family.

[0199] Embodiment 46. The method of embodiment 39 or of any one or more of the preceding embodiments, wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with at least one I-CreI or I-SceI meganuclease.

[0200] Embodiment 47. The method of embodiment 39 or of any one or more of the preceding embodiments, wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with a CRISPR/Cas9 system or CRISPR/Cas9 variant system.

[0201] Embodiment 48. The method of embodiment 39 or of any one or more of the preceding embodiments,

[0202] wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with a type I CRISPR/Cas9 system;

[0203] wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with a type II CRISPR/Cas9 system;

[0204] wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with a type III CRISPR/Cas9 system;

[0205] wherein the editing comprises activation of endogenous cellular repair machinery and contact of target nucleic acid(s) with a type IV CRISPR/Cas9 system;

[0206] wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with a type V CRISPR/Cas9 system; or

[0207] wherein the editing comprises activating endogenous cellular repair machinery and contacting the target nucleic acid(s) with a type VI CRISPR/Cas9 system.

[0208] Embodiment 49. The method of embodiment 39 or of any one or more of the preceding embodiments, wherein the editing produces a nucleic acid rearrangement that knocks out a gene.

[0209] Embodiment 50. The method of embodiment 39 or of any one or more of the preceding embodiments,

[0210] wherein the editing produces a nucleic acid rearrangement that mutates the target nucleic acid(s);

[0211] wherein the editing produces a nucleic acid rearrangement comprising a gene correction;

[0212] wherein the editing produces a nucleic acid rearrangement comprising a deletion;

[0213] wherein the editing produces a nucleic acid rearrangement comprising an insertion;

[0214] wherein the editing produces a nucleic acid rearrangement comprising a duplication;

[0215] wherein the editing produces a nucleic acid rearrangement comprising an amplification;

[0216] wherein the editing produces a nucleic acid rearrangement comprising a translocation; or

[0217] wherein the editing produces a nucleic acid rearrangement comprising an inversion.

[0218] Embodiment 51. The method of embodiment 39 or of any one or more of the preceding embodiments that quantifies a number of the nucleic acid rearrangements produced by the editing of the target nucleic acid(s).

[0219] Embodiment 52. The method of embodiment 39 or of any one or more of the preceding embodiments that quantifies a number of the nucleic acid rearrangements produced by the editing of the target nucleic acid(s) faster or with a higher degree of accuracy than a conventional quantification method selected from the group consisting of restriction site selection, PAGE-based genotyping assay, enzymatic mismatch cleavage-based assay, subcloning a target region, high-resolution melting curve (HRM) analysis, Next-Gen gene sequencing, and droplet digital PCR.

[0220] Embodiment 53. The method of embodiment 39 or of any one or more of the preceding embodiments, wherein the editing occurs in vivo or ex vivo, optionally after treatment of a subject with a polynucleotide, drug, radiation, immunological agent or other therapy.

[0221] Embodiment 54. The method according to embodiment 39 or any one or more of the preceding embodiments, wherein said editing comprises:

[0222] contacting the target nucleic acid that has been edited with an engineered nuclease or meganuclease(s) with an unedited control target sequence, and

[0223] comparing said edited target nucleic acid sequence with the sequence of the unedited control target sequence.

[0224] Embodiment 55. The method according to embodiment 39 or any one or more of the preceding embodiments, wherein a number of deletions or other unwanted or unexpected genetic events in the target nucleic acid(s) as well as the number of desired edits to the target nucleic acid(s) are quantified by molecular combing.

[0225] Embodiment 56. The method of embodiment 54, wherein the editing is performed using an engineered nuclease or meganuclease

[0226] Embodiment 57. The method according to embodiment 39 or of any one or more of the preceding embodiments, wherein said target nucleic acid(s) comprise BRCA1 genomic DNA.

[0227] Embodiment 58. The method of embodiment 39 or of any one or more of the preceding embodiments, wherein the genome or gene editing procedure or event occurs in vivo or in a sample obtained from in vivo, optionally after treatment of a subject by gene therapy or with a polynucleotide, drug, radiation, immunological agent or other therapy.

[0228] Embodiment 59. A method for determining the efficiency, accuracy or specificity of a polynucleotide editing procedure that uses at least one modified nuclease comprising: [0229] (i) editing one or more polynucleotide(s) of interest using at least one modified nuclease, [0230] (ii) contacting the edited polynucleotide(s) with labelled polynucleotide(s) that hybridize to them and performing molecular combing of the fluorescent labeled polynucleotides, and [0231] (iii) comparing the edited polynucleotides hybridized to said labelled polynucleotides to one or more control polynucleotides, which have not been treated with the modified nuclease, hybridized to said labelled polynucleotide(s), thus determining the efficiency, accuracy or specificity of the polynucleotide editing procedure using the modified nuclease; and [0232] (iv) optionally, selecting a modified nuclease based polynucleotide editing procedure that is most accurate or efficient for correction or modification of a particular polynucleotide of interest.

[0233] Embodiment 60. The method according to any one of Embodiments 1 or 29 or 59, wherein target nucleic acid(s) or the target polynucleotide of interest comprises BRCA1 genomic DNA.

[0234] Embodiment 61. A method according to any one of Embodiments 1 to 60 that comprises the following steps: [0235] (a) preparing embedded DNA material from the assessed sample comprising genome or genetic material, such as embedded DNA agarose plugs; [0236] (b) extracting the embedded DNA material recovered from step (a) to recover DNA and performing Molecular Combing on the extracted DNA by stretching DNA and recovering immobilized linear and parallel strands of nucleic acid; wherein the extraction step optionally encompass a step of digesting the embedded DNA material with proteinase; [0237] (c) on combed DNA, hybridizing labelled probes wherein said probes are specific for the detection of the gene or genome editing events [0238] (d) detecting combed DNA hybridized with probes [0239] (e) detecting and/or quantitating the editing events by discriminating between intact DNA molecules and edited DNA molecules, [0240] wherein before step (a) and/or between steps (a) and (b) a step of treating the assessed sample or the genome or the genetic material of said sample with editing procedure, in particular with a meganuclease is performed and optionally, [0241] wherein a control sample is treated with steps (a) to (e) but does not undergo the editing procedure, for comparison with the assessed sample.

[0242] The following Examples illustrate particular non-limited embodiments or aspects of the invention or support therefore.

EXAMPLES

Example 1—Detection of Genome Editing Events Induced by Meganucleases

[0243] Preparation of Embedded DNA Plugs from Viral Particles

[0244] Agarose plugs containing the recombinant HSV-1 (rHSV-1) (Grosse, Huot et al. 2011) were prepared with modified procedure as described in Mahiet et al. (Mahiet, Ergani et al. 2012) and in WO 2011/132078 (EP 2 561 104 B1). Briefly, rHSV-1 particles were resuspended in 1×PBS at a concentration of 5.Math.10.sup.6 viral particles/mL, and mixed thoroughly at a 1:1 ratio with a 1.2% w/v solution of low-melting point agarose (Nusieve GTG, ref. 50081, Cambrex) prepared in PBS, at 50° C. 904, of the viral particles/agarose mix was poured in a plug-forming well (BioRad, ref. 170-3713) and left to cool at least 30 min at 4° C. Embedded recombinant viral particles were lysed in 0.1% SDS—0.5M EDTA (pH8.0) solution at 50° C. for 30 minutes. After three washing steps in 0.5M EDTA (pH 8.0) buffer of 10 minutes at room temperature, plugs were digested by overnight incubation at 50° C. with 2 mg/mL Proteinase K (Eurobio code GEXPRK01, France) in 250 μL digestion buffer (0.5M EDTA (pH8.0).

[0245] In Vitro I-SceI-Induced Double Strand Breaks

[0246] First, agarose plugs of embedded DNA from recombinant viral particles are incubated in 100 μl 1× Tango Buffer without Mg-Acetate (New England Biolabs) diluted in TE 10:1 with 20 u of I-SceI for 2 h on ice. H.sub.2O replaced I-SceI in the untreated-ISceI samples used as negative control. Then, Mg-Acetate is added to a final concentration of 10 μM to allow I-SceI activity starting and incubated for 2 h at 37° C. After three washing steps in TEN 10:20:100 of 30 minutes at room temperature, plugs were again digested by overnight incubation at 50° C. with 2 mg/mL Proteinase K (Eurobio code GEXPRK01, France) in 250 μL digestion buffer (0.5M EDTA (pH8.0).

[0247] DNA Extraction and Molecular Combing

[0248] Agarose plugs of embedded DNA from I-SceI-untreated and I-SceI-treated rHSV-1 were treated for combing DNA as previously described (Schurra and Bensimon 2009). Briefly, plugs were first washed 3 times in 15 ml TE 10:1 for 30 min and then melted at 68° C. in a IVIES 0.5 M (pH 5.5) solution for 20 min, and 1.5 units of beta-agarase (New England Biolabs, ref. M0392S, MA, USA) was added and left to incubate for up to 16 h at 42° C. The DNA solution was then poured in a Teflon reservoir and Molecular Combing was performed using the Molecular Combing System (Genomic Vision S.A., Paris, France) and Molecular Combing coverslips (20 mm×20 mm, Genomic Vision S.A., Paris, France). The combed surfaces were dried for 4 hours at 60° C.

[0249] Labelling of HSV-1 Probes

[0250] The 41 HSV-1 probes and the LacZ probe (containing the I-SceI site) are as described in Mahiet et al. (Mahiet, Ergani et al. 2012) and in WO 2011/132078 (EP 2 561 104 B1). Briefly, the labelling of the probes was performed using conventional random priming protocols. For the HSV-1 probes, the BioPrime® DNA kit (Invitrogen, code: 18094-011, CA, USA) was used with biotin-11-dCTP according to the manufacturer's instructions, except the labelling reaction was allowed to proceed overnight. For efficient labelling, the HSV-1 probes were gathered into groups of 3 to 5 (200 ng of each plasmid). The LacZ probe (200 ng) was labelled with Alexa Fluor® 488-7-OBEA-dCTP. For this labelling, the dNTP mix from the kit was replaced by the mix containing of 40 μM of each dATP, dTTP and dGTP, 20 μM of dCTP and 20 μM of Alexa Fluor 488-7-OBEA-dCTP (ThermoFischer Scientific, ref: C21555). The reaction products were visualized on an agarose gel to verify the synthesis of DNA.

[0251] Hybridization of HSV-1 Probes on Combed Viral DNA and Detection

[0252] Subsequent steps were also performed essentially as previously described in Schurra and Bensimon (Schurra and Bensimon 2009). Briefly, a mix of labelled probes (250 ng of each probe) were ethanol-precipitated together with 10 μg herring sperm DNA and 2.5 μg Human Cot-1 DNA (Invitrogen, ref. 15279-011, CA, USA), resuspended in 20 μL of hybridization buffer (50% formamide, 2×SSC, 0.5% SDS, 0.5% Sarkosyl, 10 mM NaCl, 30% Block-aid (Invitrogen, ref. B-10710, CA, USA). The probe solution and probes were heat-denatured together on the Hybridizer (Dako, ref. 52451) at 90° C. for 5 min and hybridization was left to proceed on the Hybridizer overnight at 37° C. Slides were washed 3 times in 50 formamide, 2×SSC and 3 times in 2×SSC solutions, for 5 min at room temperature. After the last washing steps, the hybridized coverslips were gradually dehydrated in 70%, 90% and 100% ethanol solution and air dried. Detection of labelled probes was carried out using two or three layers of antibodies in a 1:25 dilution. Biotin-11-dCTP-labelled probes were revealed with an Alexa Fluor® 594 conjugated-streptavidin (Invitrogen), as first layer, followed by an incubation with a biotinylated goat anti-streptavidin antibody (Vector Laboratories) and then of an Alexa Fluor® 594 coupled-streptavidin. Alexa Fluor® 488-7-OBEA-dCTP labelled LacZ probe was consecutively revealed with an Alexa Fluor® 488-conjugated polyclonal rabbit antibody (Invitrogen), then a polyclonal Alexa Fluor® 488-conjugated goat anti-Rabbit antibody (Invitrogen) as final layer. For each layer, 20 μL of the antibody solution was added on the slide and covered with a combed coverslip and the slide was incubated in humid atmosphere at 37° C. for 20 min. The slides were washed 3 times in a 2×SSC, 1% Tween20 solution for 3 min at room temperature between each layer and after the last layer. After the last washing steps, all glass cover slips were dehydrated in ethanol and air dried.

[0253] Analysis of HSV-1 Detected Signals

[0254] Hybridized-combed DNA from recombinant viral particles were scanned without any mounting medium using an inverted automated epifluorescence microscope, equipped with a 40× objective (ImageXpress Micro, Molecular Devices, USA) and the signals can be detected visually or automatically by an in house software (Gvlab 0.4.2). For quantification of the digestion efficiency, all fluorescent signal arrays with an intact LacZ probe, e.g. an Alexa Fluor 488 fluorescent signal is flanked by Alexa Fluor® 594 signals, are considered as intact rHSV-1 molecules (% ND) whereas the fluorescent signal array with an interrupted LacZ probes, e.g. Alexa Fluor 488 fluorescent signal flanked by a Alexa Fluor® 594 signal at only one of its extremities, are thought to be either rHSV-1 molecules with I-SceI-induced DBS or molecules that have been randomly sheared during the experimental process (% D). The basal level of sheared DNA molecules is evaluated in the control condition in which no I-SceI enzyme was added. In these conditions, the global digestion efficiency is calculated as follows:

[00001] Global digestion efficiency = % Dsample - % Dcontrol % NDcontrol × 100

[0255] Semi-Quantitative PCR

[0256] After Molecular Combing, the DNA solution is transferred in a dialysis tube and the dialysis is performed against 3 liters of TE 10:1 at 4° C. overnight. The semi-quantitative PCR is performed using serial dilution of the DNA solution (1:1 to 1:1000) as template with the different primer pairs (25 μmol each) as described in Table A and the Expand™ High Fidelity PCR System according to the manufacturer's instructions (Roche Diagnostics). The amplification products were visualized on a 2% agarose gel to verify the size of DNA. Since the Sce-1a and Sce-1b primer pairs flanked the I-SceI site, no amplification product is obtained in case of I-SceI-induced DBS whereas the Sce-2 and Sce-3 primer pairs are used as positive control since reaction products are obtained from both intact and I-SceI-induced DBS rHSV-1 DNA molecules.

TABLE-US-00001 TABLE A Primers sequences used for the amplification of rHSV-1 region by PCR. Product Primer Name Sequence (5′−>3′) Size Sce-1a_For GAA TCC CAG TCC GTC CGA TA 138 pb (SEQ. ID NO: 2) Sce-1_Rev CGA CGG GAT CTA TCA TCG TT (SEQ. ID NO: 3) Sce-1b_For TCC GTC CGA TAT TAC CCT GT 129 pb (SEQ. ID NO: 4) Sce-1_Rev CGA CGG GAT CTA TCA TCG TT (SEQ. ID NO: 5) Sce-2_For GCT CGG ATC CAC TAG TCC AG 122 pb (SEQ. ID NO: 6) Sce-2_Rev GTG CTG CAA GGC GAT TAA GT (SEQ. ID NO: 7) Sce-3_For CAC CAA AAT CAA CGG GAC TT 136 pb (SEQ. ID NO: 8) Sce-3_Rev AGC CAG TAA GCA GTG GGT TC (SEQ ID NO: 9

[0257] Detection and Quantification of 1-SceI Meganuclease-Induced DBS in rHSV-1 DNA Molecules

[0258] The inventors applied Molecular Combing to uniformly stretch rHSV-1 DNA that has been treated by I-SceI meganuclease in the agarose plugs and hybridized the resulting combed rHSV-1 DNA with labelled adjacent and overlapping DNA probes (FIG. 1A; HSV-1: Alexa Fluor® 594-fluorescence; LacZ: Alexa Fluor® 488-fluorescence) to discriminate between intact rHSV-1DNA molecules and rHSV-1 molecules with ISce-I-induced DBS. 3 independent experiments consisting of a pair of agarose plugs with embedded rHSV-1 DNA that are treated or not by I-SceI meganuclease as described in the “In vitro I-SceI-induced double strand breaks” section. Immunofluorescence microscopy (FIG. 1B) exhibit between 929 and 1473 multicolor linear patterns per conditions (Table B) that fulfilled the criteria for evaluation (see “Analysis of HSV-1 detected signals” section). Classification of the signals between intact rHSV-1 signals and signals with I-SceI-induced DBS showed that the I-SceI activity is almost complete with a mean activity above 90% (Table B and FIG. 1C). To confirm the I-SceI activity observed by Molecular Combing, we conducted a semi-quantitative PCR analysis with different primer pairs as described in Table A and showed in FIG. 1D using control and I-SceI-treated DNA as template. The different PCR tubes are set up such that they either vary in the amount of DNA template (1:1 to 1:1000 serial dilution of control or treated rHSV-1 DNA). This is because PCR amplification, though theoretically logarithmic, is not so at low or high number of amplification cycles. The logarithmic or exponential amplification usually occurs only during the middle cycles, and this depends on the concentration of target template. Comparison can therefore be done only during this phase. After amplification, same volume of reaction products are electrophoresed on a 2% agarose gel. Images of stained PCR products are then obtained and analyzed by visual comparison (FIG. 1E). Absence of PCR products with Sce-1a and Sce-1b primers pairs mean that the I-SceI meganuclease introduced DSB in the rHSV-1 DNA whereas the presence of a PCR product with these primers pairs notified absence or undetectable I-SceI activity. Sce-2 and Sce-3 primer pairs are used as positive control to exclude the degradation of the rHSV-1 DNA thus a PCR product should be observed whatever the conditions (I-SceI-treated or control rHSV-1). As expected, no PCR products were obtained with the negative control (H.sub.2O) whereas a PCR product is amplified with the positive control (pCLS0126) whatever the primer pairs. For each pair of primers, a PCR product is amplified from the rHSV-1 DNA that has not been treated with the I-SceI meganuclease. For the I-SceI-treated samples, a band corresponding to a PCR product with the primer pairs Sce-1a and 1b is observed in non-diluted DNA sample (1:1) but with a weaker intensity compared to the PCR product amplified with the Sce2 and Sce3 primers pairs. In diluted samples (1:10 to 1:100), the amplification product with the primer pairs Sce-1a and 1b is undetectable whereas a PCR product is still observed for the Sce2 and Sce3 primers pairs. These results confirm that the activity of I-SceI meganuclease is almost complete thus confirming the data obtained by Molecular Combing analysis.

[0259] These results show that the Molecular Combing techniques of the invention are powerful methods for the detection of meganuclease-induced DSB events at the level of the unique molecule and to quantify its activity efficacy.

TABLE-US-00002 TABLE B Data obtained from 3 independent experiments. Number of signals Experi- I-SceI- I-SceI ment Conditions Intact induced DBS Total efficacy 1 Control 822 651 1473 89.71% I-SceI-treated 65 1067 1132 2 Control 886 394 1280 94.71% I-SceI-treated 34 895 929 3 Control 989 417 1406 93.47% I-SceI-treated 59 1225 1284 Mean ± SD 92.63% ± 2.6

Example 2—Detection of Genome Editing Events Induced by CRISPR-Cas9 RNA Guided Nucleases

[0260] BRCA Gene Editing in HEK293 Cells

[0261] HEK293 cell lines were cultivated in complete DMEM media (DMEM high glucose+10% FBS+/Pen/Strep antibiotics) at 37° C. in 5% CO.sub.2 atmosphere. Cells were maintained by splitting every 4-5 days at a ratio of 1:10.

[0262] To create a 6.5 kb deletion in the BRCA gene in HEK293 cells, gRNA pairs were designed (see Table C) and cloned in the pSpCas9(BB)-2A-Puro (PX459) vector (ALSTEM, CA, USA). 3×10.sup.5 cells were transfected with 1 μg of each BRCA-Left-gRNA and BRCA-Right-gRNA using 6W of NanoFect transfection reagent. Transfection with the different combinations of BRCA-Left-gRNA and BRCA-Right-gRNA was performed. An isogenic cell culture, e.g. HEK293 cells not transfected with the gRNA vectors, was also used as negative control. After 4 days, transfected cells were harvested and the genomic DNA was extracted using Genomic DNA extraction kit (Avegene).

TABLE-US-00003 TABLE C gRNA sequence for BRCA targeting SEQ gRNA Name Sequence (5′−>3′) ID NO: PAM BRCA-Left-gRNA1 GGGGTGCGGTTTATTCATAC 10 AGG BRCA-Left-gRNA4 CCTGAGGCGGGTGGATCATG 11 AGG BRCA-Left-gRNA7 ATTCATACAGGTAGTGAGAG 12 TGG BRCA-Right-gRNA4 CCACACCACCAATTACCACA 13 AGG BRCA-Right-gRNA9 ATGGGAGAAGGTCATAGATG 14 AGG BRCA-Right-gRNA12 GTGGAGGCAGAGATTACACA 15 AGG

[0263] PCR Characterization of the Transfected Cell Pool

[0264] The genomic DNA was subsequently used for PCR to amplify the targeted BRCA region using the Phusion® High-Fidelity DNA polymerase and the primers pairs described in Table D. 2% agarose gel to verify the size of DNA. Since the BRCA-Left-PCR-F and BRCA-Left-PCR-R primer pair is used as positive control, amplification reaction is not affected by the CRISPR-Cas9-induced BRCA deletion. For BRCA-Left-PCR-F and BRCA-Right-PCR-R primer pair that flanked the targeted BRCA site, the expected 7224 bp-amplification product cannot be amplified in the isogenic control since the PCR extension time is only 30 s whereas a shorter PCR products (between 490 and 651 bp depending on the gRNA combination, see table E) is obtained in samples with the expected editing events in the BRCA1 gene.

TABLE-US-00004 TABLE D PCR primers and Tm value Primer Name Sequence (5′−>3′) Tm (° C.) BRCA-Left- TGGCTTCAAAGAGACTGCGA 66.2 PCR-F (SEQ ID NO: 16) BRCA-Left- TGTCAGCATTTGGCTCCACT PCR-R (SEQ. ID NO: 17) BRCA-Left- TGGCTTCAAAGAGACTGCGA 66.2 PCR-F (SEQ. ID NO: 18) BRCA-Right- GGCCAGTGTAGCTGGAGTAATTTG PCR-R (SEQ. ID NO: 19)

TABLE-US-00005 TABLE E gRNA combinations and their expected PCR size Conditions gRNA pairs PCR size (bp) 1 BRCA-Left-gRNA1 + BRCA-Right- 651 gRNA4 7 BRCA-Left-gRNA1 + BRCA-Right- 596 gRNA9 8 BRCA-Left-gRNA1 + BRCA-Right- 572 gRNA12 4 BRCA-Left-gRNA4 + BRCA-Right- 569 gRNA4 9 BRCA-Left-gRNA4 + BRCA-Right- 514 gRNA9 5 BRCA-Left-gRNA4 + BRCA-Right- 490 gRNA12 6 BRCA-Left-gRNA7 + BRCA-Right- 639 gRNA4 3 BRCA-Left-gRNA7 + BRCA-Right- 584 gRNA9 2 BRCA-Left-gRNA7 + BRCA-Right- 560 gRNA12 10 Isogenic cells 7224

[0265] Preparation of Embedded DNA Plugs from HEK293 Cells Culture

[0266] Agarose plugs with embedded DNA from isogenic or transfected HEK293 cells are prepared as described in Schurra and Bensimon (Schurra and Bensimon 2009). Briefly, cells were resuspended in 1×PBS at a concentration of 10.sup.7 cells/mL mixed thoroughly at a 1:1 ratio with a 1.2% w/v solution of low-melting point agarose (Nusieve GTG, ref. 50081, Cambrex) prepared in 1×PBS at 50° C. 90 μL of the cell/agarose mix was poured in a plug-forming well (BioRad, ref. 170-3713) and left to cool down at least 30 min at 4° C. Agarose plugs were incubated overnight at 50° C. in 250 μL of a 0.5M EDTA (pH 8), 1% Sarkosyl, 250 μg/mL proteinase K (Eurobio, code: GEXPRK01, France) solution, then washed twice in a Tris 10 mM, EDTA 1 mM solution for 30 in at room temperature.

[0267] Final Extraction of DNA and Molecular Combing

[0268] Plugs of embedded DNA from HEK293 control and transfected cells were treated for combing DNA as previously described (Schurra and Bensimon 2009). Briefly, plugs were melted at 68° C. in a MES 0.5 M (pH 5.5) solution for 20 min, and 1.5 units of beta-agarase (New England Biolabs, ref. M0392S, MA, USA) was added and left to incubate for up to 16 h at 42° C. The DNA solution was then poured in a Disposable DNA reservoir (Genomic Vision S.A., Paris, France) and Molecular Combing was performed using the Molecular Combing System (Genomic Vision S.A., Paris, France) and CombiCoverslips® (20 mm×20 mm, Genomic Vision S.A., Paris, France). The combed surfaces were dried for 4 hours at 60° C.

[0269] Synthesis and Labelling of BRCA Probes

[0270] The coordinates of the probes relative to the human GRCh37/hg19 sequence (chr17:41,176,611-41,372,447) are listed in table F. Probe size ranges from 3059 to 9551 bp in this example.

TABLE-US-00006 TABLE F BRCA probes Probe ID Chr Start End Size a1 chr17 41176611 41185451 8840 a2 chr17 41185523 41194231 8708 S1 chr17 41195903 41203180 7277 SEx21 chr17 41205246 41211745 6499 S2 chr17 41215259 41223260 8001 S3Big chr17 41226181 41234768 8587 S4 chr17 41242909 41251961 9052 S5 chr17 41256140 41262844 6704 S6 chr17 41264546 41269110 4564 Synt1 chr17 41269785 41274269 4484 S7 chr17 41275398 41278706 3308 S8 chr17 41286084 41293383 7299 S9 chr17 41299811 41305857 6046 b2 chr17 41330367 41338479 8112 b3 chr17 41338628 41348179 9551 S10 chr17 41363153 41372447 9294 Synt1b chr17 41306593 41310952 4359 S7b1 chr17 41319666 41323534 3868 S11_2 chr17 41311309 41316264 4955 S12_2 chr17 41316540 41319599 3059

[0271] Except for the Synt1b, S7b_1, S11_2 and S12_2 probes, all probes were previously described in Cheeseman et al. (Cheeseman, Rouleau et al. 2012) and in WO2014/140788(A1). The Synt1b, S7b_1, S11_2 and S12_2 probes were produced by long-range PCR using LR Taq DNA polymerase (Roche, kit code: 11681842001) using the primers listed in table G and the Bacterial Artificial Chromosome (BAC) RP11-831F13 (Invitrogen) as template DNA. PCR products were ligated in the pCR-XL-TOPO® vector using the TOPO® XL PCR cloning Kit (Invitrogen, France, code K455010). The two extremities of each probe were sequenced for verification purpose.

TABLE-US-00007 TABLE G PCR primer pairs used for BRCA probes cloning Probe Primer Name Name Sequence (5′−>3′) Synt1b Synt1b_For TTTAGAAAATACATCACCCCAGTTCC (SEQ. ID NO: 20) Synt1b_Rev TTGAAATACCACCTTTTCATTTCCAGA (SEQ. ID NO: 21) S7b_1 S7b_For GGAGGCAGAAATTGGGCATA (SEQ. ID NO: 22) S7b_Rev TTCTGACCCACAGACTCTCCA (SEQ. ID NO: 23) S11_2 S11_For CTCGATTCAAAAACAAAATGTGGCC (SEQ. ID NO: 24) S11_Rev ATGCCGTAGTTGGTCCAACG (SEQ. ID NO: 25) S12_2 S12_For AAAAACTCTACATCAGGGGACA (SEQ. ID NO: 26) S12_Rev AAAGAAAGAAAAAGTAAAAACTAAAGG (SEQ. ID NO: 27)

[0272] For labelling, the BRCA probes are grouped according to the incorporated hapten: probes a1+a2 (apparent B probe), SEx21 (apparent b probe), S3Big (apparent d probe), S8 (apparent I probe), S9 (apparent j probe) and b2 (apparent n probe) are jointly labelled with 3-Amino-3-Deoxydigoxigenin-9-dCTP (AminoDIG-9-dCTP); probes S1 (apparent a probe), S5 (apparent f probe), S7 (apparent h probe), S7b+12_2 (apparent 1 probe) and b3 (apparent m probe) are jointly labelled with Fluorescein-12-dUTP (Fluo-dUTP); probes S2 (apparent c probe), S4 (apparent e probe), S6+Synt1 (apparent g probe), Synt1b+S11_2 (apparent k probe) and S10 (apparent R probe) are jointly labelled with biotin-11-dCTP (Biot-dCTP). 200 ng of each BRCA probe group were labelled using conventional random priming protocols with the BioPrime® DNA kit (Invitrogen, code: 18094-011, CA, USA) according to the manufacturer's instructions except the dNTP mix from the kit was replaced by the mix specified in Table H and the labelling reaction was allowed to proceed overnight. After labelling, labelled product is purified with PureLink® PCR Purification Kit (ThermoFischer Scientific; Code K310001) according to the manufacturer's instructions.

TABLE-US-00008 TABLE H dNTP mix used for BRCA probe labelling Non-modified dNTPs (Invitrogen, Labelling ref. 10297-018) Hapten-coupled dNTP Fluo-dUTP dATP, dCTP, Fluorescein-12-dUTP 20 μM dGTP 40 μM (Sigma Aldrich, code each dTTP 20 μM 000000011373242910) AminoDIG- dATP, dTTP, 3-Amino-3- 9-dCTP dGTP 40 μM Deoxydigoxigenin-9-dCTP each dCTP 20 μM 20 μM (Perkin Elmer, code NEL562001EA) Biot-dCTP dATP, dTTP, Biotin-11-dCTP dGTP 40 μM 20 μM Perkin Elmer, each dCTP 20 μM code NEL538001EA)

[0273] Hybridization of BRCA1 GMC on Combed Genomic DNA and Detection

[0274] Subsequent steps were also performed essentially as previously described in Schurra and Bensimon, 2009 (Schurra and Bensimon 2009). Briefly, a mix of labelled probes (250 ng of each probe) were ethanol-precipitated together with 10 μg herring sperm DNA and 2.5 μg Human Cot-1 DNA (Invitrogen, ref. 15279-011, CA, USA), resuspended in 20 μL of hybridization buffer (50% formamide, 2×SSC, 0.5% SDS, 0.5% Sarkosyl, 10 mM NaCl, 30% Block-aid (Invitrogen, ref. B-10710, CA, USA). The probe solution and probes were heat-denatured together on the Hybridizer (Dako, ref. S2451) at 90° C. for 5 min and hybridization was left to proceed on the Hybridizer overnight at 37° C. Slides were washed 3 times in 60° C. pre-warmed 2×SSC solution for 5 min at room temperature. After the last washing steps, the hybridized coverslips were gradually dehydrated in 70%, 90% and 100% ethanol solution and air dried. For detection, 20 μL of the antibody solution diluted in Block-Aid® was added on the slide and covered with a combed coverslip and the slide was incubated in humid atmosphere at 37° C. for 20 min. Detection of the BRCA GMC was carried out using a Alexa Fluor® 647-coupled mouse monoclonal anti-digoxygenin (Jackson Immunoresearch, code 200-162-037) antibody in a 1:25 dilution for AminoDIG9-dCTP-labelled probes, a Cy3-coupled mouse monoclonal anti-Fluorescein (Jackson Immunoresearch, code 200-602-156) antibody in a 1:25 dilution for Fluo-dUTP-labelled probes and an BV480-coupled streptavidin (BD Biosciences, code 564876) in a 1:25 dilution for Biot-dCTP-labelled probes. The slides were then washed 3 times in a 2×SSC, 1% Tween20 solution for 3 min at room temperature and all glass coverslips were dehydrated in ethanol and air dried.

[0275] Analysis of BRCA Detected Signals

[0276] Hybridized-combed DNA from isogenic and transfected HEK293 cells preparation were scanned without any mounting medium using an inverted automated epifluorescence microscope, equipped with a 40× objective (FiberVision®, Genomic Vision S.A., Paris, France) and the signals were analyzed by an in house software (FiberStudio® BRCA, Genomic Vision S.A., Paris, France). For quantification of CRISPR-Cas9 gRNA-guided BRCA1 deletion, all fluorescent array signals composed of a least 3 probes and containing the apparent probe a and probe c are taking into account. The fluorescent signals where the apparent blue probe b is present between apparent probe a and c (normal allele; % ND) or absent (6.5 kb deletion; % D) are counted in both isogenic (iso) and transfected (trans) HEK293 cells. In these conditions, the global CRISPR/Cas9 RNA guided system efficiency is calculated as follows:

[00002] Efficacy ( % ) = % Dtrans - % Diso % NDiso × 100

[0277] All fluorescent arrays that do not correspond to either the normal BRCA1 GMC v5.2 or the edited BRCA1 (without the sequence of the apparent blue b probe) are considered as rearranged BRCA1 signals. The frequency of rearranged BRCA1 signal is calculated as follows:

[00003] Frequency ( % ) = N rearranged BRCA 1 N total BRCA 1 × 100

[0278] Statistical analysis of data was performed a Two-sample test of proportions using normal approximation, using Benjamini-Hochberg adjustment for multiple testing.

[0279] Detection and Quantification of Gene Editing Events in BRCA1 Mediated by CRISPR-Cas9

[0280] The inventors have applied Molecular Combing on DNA extracted from HEK293 cells that has been transfected with gRNA pairs targeting the 3′ region of the BRCA1 gene (GRCh37/hg19 sequence: chr17: 41,176,611-41,372,447) as indicated in FIG. 2B and Table C and hybridized with the BRCA1 GMC (FIG. 2A).

[0281] To detect the presence of the 6-5 kb BRCA1 deletion induced by the CRISPR-Cas9 in the pool of transfected HEK cells, a PCR analysis with different primer pairs as described in Table D and showed in FIG. 2B using control and transfected HEH293 DNA as template. After amplification, reaction products are electrophoresed on a 2% agarose gel. Images of stained PCR products are then obtained and analyzed by visual comparison (FIG. 2C). An amplification product with the BRCA-Left-PCR-F and BRCA-Left-PCR-R primer pair used as positive control is observed in all DNA samples. For BRCA-Left-PCR-F and BRCA-Right-PCR-R primer pair that flanked the targeted BRCA site, the expected 7224 bp-amplification product is not amplified in the isogenic control since the PCR extension time is only 30 s whereas a shorter PCR products (between 490 and 651 bp depending on the gRNA combination, see table E) is obtained in samples with the expected editing events in the BRCA1 gene. These results indicate that the expected CRISPR-Cas9-mediated gene events are present in an undefined proportion of cells in the transfected HEK293 cells pool.

[0282] To visualize and quantify the BRCA1 6.5 kb-deletion induced by the CRIPSR-Cas9 system, the labelled BRCA1 specific probes were hybridized on combed DNA extracts from isogenic HEK293 cells (control) and in HEK293 cells transfected with the Left-gRNA7+BRCA-Right-gRNA4, Left-gRNA7+BRCA-Right-gRNA9 and Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs. Immuno-fluorescence microscopy (FIG. 2D; aminoDIG9-labelled probes are represented by black boxes, Fluo- and Biot-labelled probes are depicted by grey and white boxes, respectively) exhibit between 238 and 740 multicolor linear patterns per conditions (Table I) that fulfilled the criteria for evaluation (see “Analysis of BRCA detected signals” section). No edited BRCA1 gene was detected in the isogenic HEK293 control cells whereas 10.5%, 11.1% and 6.5% of edited BRCA1 gene (where sequence b has been deleted) have been quantified in transfected HEK293 cells with the Left-gRNA7+BRCA-Right-gRNA4, Left-gRNA7+BRCA-Right-gRNA9 and Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs, respectively (FIG. 2E). Statistical analysis showed that the observed proportion of gene editing events in transfected HEK293 cells is significant compared to the isogenic HEK293 control cells. It also showed that the Left-gRNA7+BRCA-Right-gRNA4 and Left-gRNA7+BRCA-Right-gRNA9 combinations exhibited a significant higher efficiency than Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs.

[0283] The inventors have found that the Molecular Combing techniques of the invention are powerful methods for the detection of CRISPR-Cas9-induced gene editing events at the level of the unique molecule and to quantify its activity efficacy.

[0284] Detection and Quantification of Rearranged BRCA1 Gene Mediated by CRISPR-Cas9

[0285] The inventors detected fluorescent arrays (FIG. 2F; aminoDIG9-labelled probes are represented by black boxes, Fluo- and Biot-labelled probes are depicted by grey and white boxes, respectively) that do not correspond to the normal BRCA1 GMC v5.2 or to the edited BRCA1 form, e.g., with the deleted sequence corresponding to the apparent blue b probe, that probably arise from recombination induced by the CRISPR-Cas9 activity in transfected HEK293 cells with the gRNA pairs.

[0286] The labelled BRCA1 specific probes were hybridized on combed DNA extracts from isogenic HEK293 cells (control) and in HEK293 cells transfected with the Left-gRNA7+BRCA-Right-gRNA4, Left-gRNA7+BRCA-Right-gRNA9 and Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs to evaluate the proportion of the non-canonical structures in the BRCA1 gene. A total of hybridization signals comprising between 238 and 740 fluorescent signals per condition were identified and classified. 0.9% of rearranged BRCA1 gene have been quantified in isogenic HK293 control cells whereas 3.8%, 2.5% and 1.6% of rearranged BRCA1 gene is detected in transfected HEK293 cells with the Left-gRNA7+BRCA-Right-gRNA4, Left-gRNA7+BRCA-Right-gRNA9 and Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs, respectively (FIG. 2G and Table I). The increased frequency of rearranged BRCA1 gene in HEK293 cells transfected with the different gRNA pairs tested suggests that the designed CRISPR-Cas9 may induced other large rearrangements in BRCA1 than the expected ones, e.g., deletion of the sequence corresponding to the apparent blue b probe. Statistical analysis showed that the observed proportion of rearranged BRCA1 gene in transfected HEK293 cells with Left-gRNA7+BRCA-Right-gRNA9 and Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs is not statistically different than the isogenic HEK293 control cells whereas this proportion is significantly higher for the Left-gRNA7+BRCA-Right-gRNA4 combination indicating that this last gRNA pairs is less specific than the two others (FIG. 2G).

[0287] Molecular Combing enables the visualization and the quantification of unexpected rearranged BRCA1 gene induced by CRISPR-Cas9 and by their infinity of combination of barcode possible is a powerful method to analyze and quantify them.

TABLE-US-00009 TABLE I Summary of data. Number of BRCA1 signals Frequencies (%) Conditions normal edited LR total normal edited LR HEK293 isogenic 442 0 4 446 99.1 0.0 0.9 control BRCA-Left- 204 25 9 238 85.7 10.5 3.8 gRNA7 + BRCA- Right-gRNA4 BRCA-Left- 381 49 11 441 86.4 11.1 2.5 gRNA7 + BRCA- Right-gRNA9 BRCA-Left- 680 48 12 740 91.9 6.5 1.6 gRNA7 + BRCA- Right-gRNA12

Example 3—Detection and Quantification of Potential Off-Target Sites Induced by CRISPR-Cas9 RNA-Guided Nucleases

[0288] To identify potential off-target sites that might be generated by the different combinations of gRNA used to create a 6.5 kb deletion in the BRCA gene as described in Example 2, the inventors used the Cas-OFFinder (available online: http://_www.rgenome.net/cas-offinder/) that is an algorithm that quickly searches for possible off-target sites of Cas9 nucleases guided by gRNA. This CRIPSR recognition tool searches the entire genome for off-targeting and supports up to 10 mismatches and 7 different PAM types. In this example, the potential Off-target sites generated by the Cas9 from Streptococcus pyogenes with the 5′-NRG-3′ (R=A or G) sequence as PAM type in human GRCh37/hg19 sequence were identified with 2 mismatches at maximum. The results are shown in Table J.

TABLE-US-00010 TABLE J Examples of potential Off-targets generated by the designed BRCA1 gRNA. Abbreviations: Chr: Chromosome; Dir: Direction; Mis: Mismatches. gRNA crRNA DNA target sequence Bulge combination gRNA name sequence (5′−>3′) sequence (5′−>3′) Chr. Position Dir. Mis. Size 5 BRCA-Left- ATTCATACAGGTAGTGAGAGN AaTCATACAGGTAGTGAcA  3 166539742 + 2 0 gRNA7 RG GAAG (SEQ. ID NO: 28) (SEQ. ID NO: 29) ATTCATACAGGTAGTGAGAGN ATTCAgACAGGTAGaGAGA 19  15530936 + 2 0 RG GGAG (SEQ. NO: 28) (SEQ. ID NO: 30) ATTCATACAGGTAGTGAGAGN ATTCATACAGGTAcTGtGA 15  33022743 + 2 0 RG GAAG (SEQ. NO: 28) (SEQ. ID NO: 31) BRCA-Right- CCACACCACCAATTACCACAN CCACACCACCAATTACCAC − − − − gRNA4 RG AAGG (SEQ. ID NO: 32) (SEQ. ID NO: 33) 3 BRCA-Left- AATCATACAGGTAGTGAGAGN AaTCATACAGGTAGTGAcA  3 166539742 + 2 0 gRNA7 RG GAAG (SEQ. ID NO: 34) (SEQ. ID NO: 35) AATCATACAGGTAGTGAGAGN ATTCAgACAGGTAGaGAGA 19  15530396 + 2 0 RG GGAG (SEQ. ID NO: 34) (SEQ. ID NO: 36) AATCATACAGGTAGTGAGAGN ATTCATACAGGTAcTGtGA 15  33022743 + 2 0 RG GAAG (SEQ. ID NO: 34) (SEQ. ID NO: 37) BRCA-Right- ATGGGAGAAGGTCATAGATGN ATGGaAGAAGGTaATAGAT 11  62891640 + 2 0 gRNA9 RG GAGG (SEQ. ID NO: 38) (SEQ. ID NO: 39) 2 BRCA-Left- ATTCATACAGGTAGTGAGAGN AaTCATACAGGTAGTGAcA  3 166539742 + 2 0 gRNA7 RG GAAG (SEQ. ID NO: 40) (SEQ. ID NO: 41) ATTCATACAGGTAGTGAGAGN ATTCAgACAGGTAGaGAGA 19  15530936 + 2 0 RG GGAG (SEQ. ID NO: 40) (SEQ. ID NO: 42) ATTCATACAGGTAGTGAGAGN ATTCATACAGGTAcTGtGA 15  33022743 + 2 0 RG GAAG (SEQ. ID NO: 40) (SEQ. ID NO: 43) BRCA-Right- GTGGAGGCAGAGATTACACAN GTGGAGGCAGAGgcTACAC 16    569309 + 2 0 gRNA12 RG ATGG (SEQ. ID NO: 44) (SEQ. ID NO: 45) GTGGAGGCAGAGATTACACAN GTGaAGGCAGAGgTTACAC  1 883225944 − 2 0 RG AGGG (SEQ. ID NO: 44) (SEQ. ID NO: 46) GTGGAGGCAGAGATTACACAN GTtGAGGCAGtGATTACAC 19  32828962 + 2 0 RG ATGG (SEQ. ID NO: 44) (SEQ. ID NO: 47) GTGGAGGCAGAGATTACACAN GaGtAGGCAGAGATTACAC 10  36169278 − 2 0 RG AGGG (SEQ. ID NO: 44) (SEQ. ID NO: 48) GTGGAGGCAGAGATTACACAN ATGGAGtCAGAGATTACAC 10  66905349 − 2 0 RG AAAG (SEQ. ID NO: 44) (SEQ. ID NO: 49) GTGGAGGCAGAGATTACACAN GTGGAGGCAGAGATTAgAg 10 128209385 − 2 0 RG AGGG (SEQ. ID NO: 44) (SEQ. ID NO: 50)

[0289] In a manner to analogous to the detection of large rearrangements in the BRCA1 gene induced by the CRISPR Cas9 system in Example 2 (FIGS. 2F and 2G), specific and unique GMCs are specially designed to cover each potential Off-target sites that have been identified. Molecular combing is performed using these specially designed probes to detect the different fluorescent arrays in cells treated with the CRISPR-Cas9 and isogenic cells used as control. The fluorescent arrays that do not correspond to the designed GMCs correspond to large rearrangements. By compared the control and treated cells, the frequency of these genomic events associated with the activity of the designed CRISPR-Cas9 system is determined.

[0290] ddPCR Characterization of the Transfected Cell Pools

[0291] The genomic DNA from isogenic or transfected HEK293 cells was subsequently used for a characterization of the targeted BRCA region with the QX200 Droplet Digital PCR (ddPCR™) System (Bio-Rad). The absolute quantification of the deletion events in the transfected versus the isogenic cells was performed with the ddPCR EvaGreen-based assay. The instrument control and the data analysis were carried out using the QuantaSoft™ Software (version 1.7). For each experimental point, 10 ng of genomic DNA were used in a final PCR reaction volume of 20 μl. The cycling conditions were 5 min at 95° C., and 35 cycles of 95° C. for 30 s, 65° C. for 1 min, followed by 5 min at 4° C. and a final denaturation step at 98° C. for 5 min (Eppendorf Nexus Gradient master cycler). The sequences and the Tm values of the two pairs of primers used in the PCR experiments (BRCA-Left-PCR-F/BRCA-Left-PCR-R and BRCA-Left-PCR-F/BRCA-Right-PCR-R; final concentration, 150 nM each) are described in Table D.

[0292] PCRs were analyzed with a QX200 droplet reader. The genomic DNAs prepared from HEK293 cells transfected with the BRCA-Left-gRNA7+BRCA-Right-gRNA4 and the BRCA-Left-gRNA7+BRCA-Right-gRNA9 gRNA pairs were analyzed in quadruplicates. DNAs extracted from the isogenic HEK293 cells (control) and from cells transfected with the BRCA-Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs were analyzed in triplicates. For each sample, the number of copies of normal (N) and edited alleles (6.5 kb deletion; D) in both isogenic (iso) and transfected (trans) HEK293 cells are presented in Table K. Because of arbitrary threshold choices some PCR events are counted as deletions in isogenic controls. Thus, for each gRNA pair the CRISPR/Cas9 RNA guided system efficacy is calculated as follows:

[00004] Efficacy ( % ) = [ mean ( D trans D trans + N trans ) - mean ( D iso D iso + N iso ) ] × 100

14.3±1.8%, 12.0±0.5% and 7.9±1.1% of edited BRCA1 gene (6.5 kb deletion) have been quantified in HEK293 cells transfected with the BRCA-Left-gRNA7+BRCA-Right-gRNA4, the BRCA-Left-gRNA7+BRCA-Right-gRNA9 and the BRCA-Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs, respectively (FIG. 3A). These values are close to those calculated with the Molecular Combing technique but are systematically higher and present a lower standard deviation (FIG. 2E). The differences are probably due to the greater numbers of events analyzed by ddPCR (on average a total of 2059 events per sample was measured with ddPCR versus 466 with Molecular Combing). On the other hand, as PCR primers are located on both side of the expected deletion and close to the cutting sites, only bona fide deletion events are quantified by the ddPCR approach. To be detected and quantified, rearrangement events such as duplications and inversions, would necessitate the design of specific primers. In any case and in contrast to the Molecular Combing approach, the ddPCR technique would not be able to provide an exhaustive characterization and quantification of the unwanted events owing to an analysis centered on a narrow region around the cutting sites.

TABLE-US-00011 TABLE K Summary of data. Number of BRCA1 Frequencies events (%) Conditions Normal Edited Total Normal Edited HEK293 isogenic 1932 10.8 1942.8 99.4 0.6 control 1988 17.4 2005.4 99.1 0.9 1942 28.4 1970.4 98.6 1.4 BRCA-Left- 1848 340 2188 84.5 15.5 gRNA7 + BRCA- 2202 332 2534 86.9 13.1 Right-gRNA4 2190 466 2656 82.5 17.5 2226 388 2614 85.2 14.8 BRCA-Left- 1450 224 1674 86.6 13.4 gRNA7 + BRCA- 1428 224 1652 86.4 13.6 Right-gRNA9 1442 206 1648 87.5 12.5 1392 200 1592 87.4 12.6 BRCA-Left- 1896 194 2090 90.7 9.3 gRNA7 + BRCA- 1774 190 1964 90.3 9.7 Right-gRNA12 1878 154 2032 92.4 7.6

[0293] Characterization of the Transfected Pools of Cells by Targeted Next-Generation Sequencing (NGS)

[0294] Genomic DNAs from isogenic or transfected HEK293 cells were also used for targeted resequencing of the whole BRCA1 gene by NGS. One to 3 μg of each genomic DNA sample was mechanically fragmented with a Covaris focused-ultrasonicator (fragments median size: 200 bp). 100 ng of this fragmented DNA were end-labeled with 8 bases specific Illumina barcodes. Barcoded DNA fragments were then PCR amplified and a selective capture of the BRCA1 gene was performed on 750 ng of the PCR libraries using home-made biotinylated probes. The probes were designed to cover a 207 kb region on chromosome 17 containing the BRCA1 gene. The limits of the region are Chr17: 41,172,482-41,379,594 according to the GRCh37/hg19 assembly of the human reference genome. Single strand DNA molecules of the barcoded libraries, complementary to the biotinylated probes, were captured on streptavidin coated magnetic beads and subsequently amplified by PCR to generate a final pool of post capture libraries. Two independent post capture libraries were generated for each DNA sample extracted from isogenic or transfected HEK293 cells, respectively.

[0295] Post capture libraries were sequenced with the Illumina paired-end technology on a HiSeq2500 sequencing system. After demultiplexing, the FASTQ sequences files were aligned to the GRCh37/hg19 assembly of the human reference genome using the Burrows-Wheeler Aligner (Li, H. (2012) “Exploring single-sample SNP and INDEL calling with whole-genome de novo assembly.” Bioinformatics 28 (14): 1838-1844). The mean depth of coverage obtained for each sample was ≥2000×, with ≥100% of the targeted bases covered at least 100×.

[0296] For the quantification of deletions and unwanted events, only reads covering the chromosome 17: 41,205,189 location (corresponding to the breaking site targeted by the BRCA-Left-gRNA7 RNA guide and common to all three pairs of gRNA) and displaying a template >6000 bp were selected with the Sambamba tool. From these new BAM files a paired-end clustering analysis was carried out. For deletions, only the FR pairs (first read in forward orientation, second read in reverse orientation) were counted. FF and RR pairs, and RF pairs were considered, for the quantification of inversions and duplication events, respectively. For each sample, the number of copies of normal (N), deleted (Del), Inverted (Inv) and duplicated (Dup) alleles in both isogenic (iso) and transfected (trans) HEK293 cells are presented in Table L. The CRISPR/Cas9 RNA guided system efficiency is calculated as follows:

[00005] Efficacy ( % ) = mean ( Del Total of events ) × 100

The frequency of rearranged BRCA1 alleles is calculated as follows:

[00006] Frequency ( % ) = mean ( Inv + Dup Total of events ) × 100

[0297] The deletions frequencies, as measured by NGS, are 1.3%, 1.3% and 1% in HEK293 cells transfected with the BRCA-Left-gRNA7+BRCA-Right-gRNA4, the BRCA-Left-gRNA7+BRCA-Right-gRNA9 and the BRCA-Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs, respectively (FIG. 3. B). These values are about ten times lower than those calculated with the Molecular Combing and the ddPCR approaches (FIG. 3B and FIG. 2E). This discrepancy might be due to an experimental bias during the targeted capture of the BRCA1 gene with oligonucleotides biotinylated probes and streptavidin-coated magnetic beads. Actually, the efficiency of the specific capture of the BRCA1 sequences is not known. Furthermore, the two mandatory PCR steps of the targeted NGS protocol are probably a source of errors too.

[0298] In contrast to results obtained for deletions, the frequencies of rearrangements in HEK293 cells transfected with the BRCA-Left-gRNA7+BRCA-Right-gRNA4, the BRCA-Left-gRNA7+BRCA-Right-gRNA9 and the BRCA-Left-gRNA7+BRCA-Right-gRNA12 gRNA pairs are in the same order of magnitude as those calculated with the Molecular Combing technique: 2.6%, 2% and 1.1% versus 3.8%, 2.5% and 1.6%, respectively (FIG. 3C and FIG. 2G).

[0299] Compared to the two tested alternative approaches (absolute quantification by ddPCR and targeted next-generation sequencing) the Molecular Combing technique is unique in that it enables a reliable and rapid detection and quantification of deletions induced by engineered nucleases in the BRCA1 gene, as well as unwanted large rearrangements. This advantage is notably due to the possibility to visualize and analyze a large genomic region around the sites targeted by programmable nucleases. On the other hand, the major advantage of the Molecular Combing technique is the absence of amplification steps in the course of the protocol, amplifications which are potential sources of statistical errors. This unbiased method, by analyzing long and unique DNA molecules, allows the selection and the validation of the engineered cells presenting the expected editing events and the rejection of cells harboring unwanted rearrangements.

TABLE-US-00012 TABLE L Summary of data. Number of BRCA1 events Deletion Inversion Duplication conditions Normal (FR) (FF and RR) (RF) Total HEK293 2085 1 0 0 2086 isogenic control 1988 0 0 0 1988 BRCA-Left- 1332 18 39 5 1394 gRNA7 + BRCA- 1537 20 30 4 1591 Right-gRNA4 BRCA-Left- 1695 20 29 7 1751 gRNA7 + BRCA- 1814 26 28 8 1876 Right-gRNA9 BRCA-Left- 1615 17 19 1 1652 gRNA7 + BRCA- 1621 15 13 4 1653 Right-gRNA12

[0300] Stringent Conditions of Hybridization of Probes Covering the BRCA1 Gene in the Molecular Combing Approach.

[0301] The procedures for the synthesis and the labelling of the probes covering the BRCA1 locus are precisely described in the “Synthesis and labelling of BRCA1 probes” section of the Example 2 paragraph.

[0302] The next section—“Hybridization of BRCA1 GMC on combed genomic DNA and detection”—deals with the hybridization of the probes and the detection of the region of interest. As mentioned, the high stringency of the hybridizations conditions is provided by both the salinity of the hybridization buffer, the presence of ionic surfactants and the use of formamide (50% formamide, 2×SSC, 0.5% SDS, 0.5% Sarkosyl, 10 mM NaCl, 30% Block-aid (Invitrogen, ref. B-10710, CA, USA). In addition, the specificity of the DNA probes is strengthened by the use of herring sperm DNA which reduces non-specific binding to the surface of the cover-slip. Furthermore, the Human Cot-1 DNA limits the unspecific hybridization of the probes synthesized by random-priming to the repetitive elements scattered through the genome. Finally, after the hybridization step, the coverslips are washed three times at 60° C. for 5 min in 2×SSC to eliminate non-specific binding. All that experimental conditions contribute to the high stringency of the hybridizations carried out on combed DNA fibers.

[0303] Detecting and Quantifying Unexpected or Unwanted Rearrangements or Genetic Events.

[0304] The labelled Genomic Morse Code sequences, as defined as a general technology in the present invention, are designed to cover the genomic region and/or the gene to be edited by the engineered nucleases or the mega-nucleases. In the case of the BRCA1 gene engineering, the total length of the probes constituting the GMC is equal to 132,567 bases (see FIGS. 2A. and 2B. and Table F.) and far exceeds the 82.1 kb of the gene. Preferentially, one of the probes constituting the GMC covers the region to be edited. This is notably the case in the BRCA1 experiments where the b probe approximately corresponds to the 6.5 kb deletion induced by the CRISPR-cas9 system (see FIGS. 2A. and 2B.). The detection of the deletion (6.5 kb) and the measure of the nucleases efficiency are carried out by comparing the profile of the GMC in the engineered cells to the reference profile in the isogenic (control) non-transfected cells. In a word, the b probe of the BRCA1 GMC is detectable in the control cells and absent in the cells correctly edited by the engineered nucleases. By extension, any GMC profile not corresponding to those expected either in the isogenic (control) or the edited (deletion) cells is the signature of an unwanted event. Such a rearrangement is presented in FIG. 2F. This inversion/duplication event can be due to only one cut instead of two (the two sgRNA pairs did not work simultaneously) and to an homologous recombination at the probe b level.

Terminology

[0305] Terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0306] The headings (such as “Background” and “Summary”) and sub-headings used herein are intended only for general organization of topics within the present invention, and are not intended to limit the disclosure of the present invention or any aspect thereof. In particular, subject matter disclosed in the “Background” may include novel technology and may not constitute a recitation of prior art. Subject matter disclosed in the “Summary” is not an exhaustive or complete disclosure of the entire scope of the technology or any embodiments thereof. Classification or discussion of a material within a section of this specification as having a particular utility is made for convenience, and no inference should be drawn that the material must necessarily or solely function in accordance with its classification herein when it is used in any given composition.

[0307] As used herein, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0308] It will be further understood that the terms “comprises” and/or “comprising,” when used in this specification, specify the presence of stated features, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, steps, operations, elements, components, and/or groups thereof.

[0309] As used herein, the term “and/or” includes any and all combinations of one or more of the associated listed items and may be abbreviated as “/”.

[0310] Links are disabled by deletion of http: or by insertion of a space or underlined space before www. In some instances, the text available via the link on the “last accessed” date may be incorporated by reference.

[0311] As used herein in the specification and claims, including as used in the examples and unless otherwise expressly specified, all numbers may be read as if prefaced by the word “substantially”, “about” or “approximately,” even if the term does not expressly appear. The phrase “about” or “approximately” may be used when describing magnitude and/or position to indicate that the value and/or position described is within a reasonable expected range of values and/or positions. For example, a numeric value may have a value that is +/−0.1% of the stated value (or range of values), +/−1% of the stated value (or range of values), +/−2% of the stated value (or range of values), +/−5% of the stated value (or range of values), +/−10% of the stated value (or range of values), +/−15% of the stated value (or range of values), +/−20% of the stated value (or range of values), etc. Any numerical range recited herein is intended to include all subranges or intermediate values subsumed therein.

[0312] Disclosure of values and ranges of values for specific parameters (such as temperatures, molecular weights, weight percentages, etc.) are not exclusive of other values and ranges of values useful herein. It is envisioned that two or more specific exemplified values for a given parameter may define endpoints for a range of values that may be claimed for the parameter. For example, if Parameter X is exemplified herein to have value A and also exemplified to have value Z, it is envisioned that parameter X may have a range of values from about A to about Z. Similarly, it is envisioned that disclosure of two or more ranges of values for a parameter (whether such ranges are nested, overlapping or distinct) subsume all possible combination of ranges for the value that might be claimed using endpoints of the disclosed ranges. For example, if parameter X is exemplified herein to have values in the range of 1-10 it also describes subranges for Parameter X including 1-9, 1-8, 1-7, 2-9, 2-8, 2-7, 3-9, 3-8, 3-7, 2-8, 3-7, 4-6, or 7-10, 8-10 or 9-10 as mere examples. A range encompasses its endpoints as well as values inside of an endpoint, for example, the range 0-5 includes 0, >0, 1, 2, 3, 4, <5 and 5.

[0313] As used herein, the words “preferred” and “preferably” refer to embodiments of the technology that afford certain benefits, under certain circumstances. However, other embodiments may also be preferred, under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful, and is not intended to exclude other embodiments from the scope of the technology. As referred to herein, all compositional percentages are by weight of the total composition, unless otherwise specified. As used herein, the word “include,” and its variants, is intended to be non-limiting, such that recitation of items in a list is not to the exclusion of other like items that may also be useful in the materials, compositions, devices, and methods of this technology. Similarly, the terms “can” and “may” and their variants are intended to be non-limiting, such that recitation that an embodiment can or may comprise certain elements or features does not exclude other embodiments of the present invention that do not contain those elements or features.

[0314] Although the terms “first” and “second” may be used herein to describe various features/elements (including steps), these features/elements should not be limited by these terms, unless the context indicates otherwise. These terms may be used to distinguish one feature/element from another feature/element. Thus, a first feature/element discussed below could be termed a second feature/element, and similarly, a second feature/element discussed below could be termed a first feature/element without departing from the teachings of the present invention.

[0315] When a feature or element is herein referred to as being “on” another feature or element, it can be directly on the other feature or element or intervening features and/or elements may also be present. In contrast, when a feature or element is referred to as being “directly on” another feature or element, there are no intervening features or elements present. It will also be understood that, when a feature or element is referred to as being “connected”, “attached” or “coupled” to another feature or element, it can be directly connected, attached or coupled to the other feature or element or intervening features or elements may be present. In contrast, when a feature or element is referred to as being “directly connected”, “directly attached” or “directly coupled” to another feature or element, there are no intervening features or elements present. Although described or shown with respect to one embodiment, the features and elements so described or shown can apply to other embodiments. It will also be appreciated by those of skill in the art that references to a structure or feature that is disposed “adjacent” another feature may have portions that overlap or underlie the adjacent feature.

[0316] The description and specific examples, while indicating embodiments of the technology, are intended for purposes of illustration only and are not intended to limit the scope of the technology. Moreover, recitation of multiple embodiments having stated features is not intended to exclude other embodiments having additional features, or other embodiments incorporating different combinations of the stated features. Specific examples are provided for illustrative purposes of how to make and use the compositions and methods of this technology and, unless explicitly stated otherwise, are not intended to be a representation that given embodiments of this technology have, or have not, been made or tested.

[0317] All publications and patent applications mentioned in this specification are herein incorporated by reference in their entirety to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference, especially referenced is disclosure appearing in the same sentence, paragraph, page or section of the specification in which the incorporation by reference appears.

[0318] The citation of references herein does not constitute an admission that those references are prior art or have any relevance to the patentability of the technology disclosed herein. Any discussion of the content of references cited is intended merely to provide a general summary of assertions made by the authors of the references, and does not constitute an admission as to the accuracy of the content of such references.

SCIENTIFIC PUBLICATIONS

[0319] Aach, J., P. Mali, et al. (2014). “CasFinder: Flexible algorithm for identifying specific Cas9 targets in genomes.” bioRxiv. [0320] Abudayyeh, O. O., J. S. Gootenberg, et al. (2016). “C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector.” Science 353(6299): aaf5573. [0321] Allers, T. and M. Lichten (2001). “Differential timing and control of noncrossover and crossover recombination during meiosis.” Cell 106(1): 47-57. [0322] Allers, T. and M. Lichten (2001). “Intermediates of yeast meiotic recombination contain heteroduplex DNA.” Mol Cell 8(1): 225-231. [0323] Arnould, S., C. Perez, et al. (2007). “Engineered I-CreI derivatives cleaving sequences from the human XPC gene can induce highly efficient gene correction in mammalian cells.” J Mol Biol 371(1): 49-65. [0324] Aronin, N. and M. DiFiglia (2014). “Huntingtin-lowering strategies in Huntington's disease: antisense oligonucleotides, small RNAs, and gene editing.” Mov Disord 29(11): 1455-1461. [0325] Bae, S., J. Park, et al. (2014). “Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases.” Bioinformatics 30(10): 1473-1475. [0326] Bailis, J. M., D. D. Luche, et al. (2008). “Minichromosome maintenance proteins interact with checkpoint and recombination proteins to promote s-phase genome stability.” Mol Cell Biol 28(5): 1724-1738. [0327] Baker, M. (2012). “Gene-editing nucleases.” Nat Methods 9(1): 23-26. [0328] Barrangou, R., C. Fremaux, et al. (2007). “CRISPR provides acquired resistance against viruses in prokaryotes.” Science 315(5819): 1709-1712. [0329] Baum, C., U. Modlich, et al. (2011). “Concise review: managing genotoxicity in the therapeutic modification of stem cells.” Stem Cells 29(10): 1479-1484. [0330] Beisel, C. L., A. A. Gomaa, et al. (2014). “A CRISPR design for next-generation antimicrobials.” Genome Biol 15(11): 516. [0331] Belfort, M. and R. J. Roberts (1997). “Homing endonucleases: keeping the house in order.” Nucleic Acids Res 25(17): 3379-3388. [0332] Bell, C. C., G. W. Magor, et al. (2014). “A high-throughput screening strategy for detecting CRISPR-Cas9 induced mutations using next-generation sequencing.” BMC Genomics 15: 1002. [0333] Bhattacharyya, A. and D. M. Lilley (1989). “Single base mismatches in DNA. Long- and short-range structure probed by analysis of axis trajectory and local chemical reactivity.” J Mol Biol 209(4): 583-597. [0334] Bibikova, M., D. Carroll, et al. (2001). “Stimulation of homologous recombination through targeted cleavage by chimeric nucleases.” Mol Cell Biol 21(1): 289-297. [0335] Bibikova, M., M. Golic, et al. (2002). “Targeted chromosomal cleavage and mutagenesis in Drosophila using zinc-finger nucleases.” Genetics 161(3): 1169-1175. [0336] Boch, J., H. Scholze, et al. (2009). “Breaking the code of DNA binding specificity of TAL-type III effectors.” Science 326(5959): 1509-1512. [0337] Caburet, S., C. Conti, et al. (2005). “Human ribosomal RNA gene arrays display a broad range of palindromic structures.” Genome Res 15(8): 1079-1085. [0338] Canver, M. C., D. E. Bauer, et al. (2014). “Characterization of genomic deletion efficiency mediated by clustered regularly interspaced palindromic repeats (CRISPR)/Cas9 nuclease system in mammalian cells.” J Biol Chem 289(31): 21312-21324. [0339] Chapman, J. R., M. R. Taylor, et al. (2012). “Playing the end game: DNA double-strand break repair pathway choice.” Mol Cell 47(4): 497-510. [0340] Cheeseman, K., J. Ropars, et al. (2014). “Multiple recent horizontal transfers of a large genomic region in cheese making fungi.” Nat Commun 5: 2876. [0341] Cheeseman, K., E. Rouleau, et al. (2012). “A diagnostic genetic test for the physical mapping of germline rearrangements in the susceptibility breast cancer genes BRCA1 and BRCA2.” Hum Mutat 33(6): 998-1009. [0342] Chen, B. and B. Huang (2014). “Imaging genomic elements in living cells using CRISPR/Cas9.” Methods Enzymol 546: 337-354. [0343] Chevalier, B. S. and B. L. Stoddard (2001). “Homing endonucleases: structural and functional insight into the catalysts of intron/intein mobility.” Nucleic Acids Res 29(18): 3757-3774. [0344] Cho, S. W., S. Kim, et al. (2013). “Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease.” Nat Biotechnol 31(3): 230-232. [0345] Choulika, A., A. Perrin, et al. (1995). “Induction of homologous recombination in mammalian chromosomes by using the I-SceI system of Saccharomyces cerevisiae.” Mol Cell Biol 15(4): 1968-1973. [0346] Christian, M., T. Cermak, et al. (2010). “Targeting DNA double-strand breaks with TAL effector nucleases.” Genetics 186(2): 757-761. [0347] Chylinski, K., K. S. Makarova, et al. (2014). “Classification and evolution of type II CRISPR-Cas systems.” Nucleic Acids Res 42(10): 6091-6105. [0348] Cicalese, M. P. and A. Aiuti (2015). “Clinical applications of gene therapy for primary immunodeficiencies.” Hum Gene Ther 26(4): 210-219. [0349] Cohen-Tannoudji, M., S. Robine, et al. (1998). “I-SceI-induced gene replacement at a natural locus in embryonic stem cells.” Mol Cell Biol 18(3): 1444-1448. [0350] Cong, L., F. A. Ran, et al. (2013). “Multiplex genome engineering using CRISPR/Cas systems.” Science 339(6121): 819-823. [0351] Conti, C., J. Herrick, et al. (2007). “Unscheduled DNA replication origin activation at inserted HPV 18 sequences in a HPV-18/MYC amplicon.” Genes Chromosomes Cancer 46(8): 724-734. [0352] Cradick, T. J., E. J. Fine, et al. (2013). “CRISPR/Cas9 systems targeting beta-globin and CCR5 genes have substantial off-target activity.” Nucleic Acids Res 41(20): 9584-9592. [0353] D'Agostino, Y., A. Locascio, et al. (2016). “A Rapid and Cheap Methodology for CRISPR/Cas9 Zebrafish Mutant Screening.” Mol Biotechnol 58(1): 73-78. [0354] Daboussi, F., S. Courbet, et al. (2008). “A homologous recombination defect affects replication-fork progression in mammalian cells.” J Cell Sci 121(Pt 2): 162-166. [0355] Deltcheva, E., K. Chylinski, et al. (2011). “CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III.” Nature 471(7340): 602-607. [0356] Dong, D., K. Ren, et al. (2016). “The crystal structure of Cpf1 in complex with CRISPR RNA.” Nature 532(7600): 522-526. [0357] Dorn, E. S., P. D. Chastain, 2nd, et al. (2009). “Analysis of re-replication from deregulated origin licensing by DNA fiber spreading.” Nucleic Acids Res 37(1): 60-69. [0358] Doyon, Y., J. M. McCammon, et al. (2008). “Heritable targeted gene disruption in zebrafish using designed zinc-finger nucleases.” Nat Biotechnol 26(6): 702-708. [0359] Dupuy, A., J. Valton, et al. (2013). “Targeted gene therapy of xeroderma pigmentosum cells using meganuclease and TALEN.” PLoS One 8(11): e78678. [0360] Fonfara, I., H. Richter, et al. (2016). “The CRISPR-associated DNA-cleaving enzyme Cpf1 also processes precursor CRISPR RNA.” Nature 532(7600): 517-521. [0361] Fu, Y., J. A. Foden, et al. (2013). “High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.” Nat Biotechnol 31(9): 822-826. [0362] Gabriel, R., A. Lombardo, et al. (2011). “An unbiased genome-wide analysis of zinc-finger nuclease specificity.” Nat Biotechnol 29(9): 816-823. [0363] Gad, S., A. Aurias, et al. (2001). “Color bar coding the BRCA1 gene on combed DNA: a useful strategy for detecting large gene rearrangements.” Genes Chromosomes Cancer 31(1): 75-84. [0364] Gad, S., I. Bieche, et al. (2003). “Characterisation of a 161 kb deletion extending from the NBR1 to the BRCA1 genes in a French breast-ovarian cancer family.” Hum Mutat 21(6): 654. [0365] Gad, S., V. Caux-Moncoutier, et al. (2002). “Significant contribution of large BRCA1 gene rearrangements in 120 French breast and ovarian cancer families.” Oncogene 21(44): 6841-6847. [0366] Gad, S., M. Klinger, et al. (2002). “Bar code screening on combed DNA for large rearrangements of the BRCA1 and BRCA2 genes in French breast cancer families.” J Med Genet 39(11): 817-821. [0367] Gasiunas, G., R. Barrangou, et al. (2012). “Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria.” Proc Natl Acad Sci USA 109(39): E2579-2586. [0368] Grizot, S., J. Smith, et al. (2009). “Efficient targeting of a SCID gene by an engineered single-chain homing endonuclease.” Nucleic Acids Res 37(16): 5405-5419. [0369] Grosse, S., N. Huot, et al. (2011). “Meganuclease-mediated Inhibition of HSV1 Infection in Cultured Cells.” Mol Ther 19(4): 694-702. [0370] Gu, W. G. (2015). “Genome editing-based HIV therapies.” Trends Biotechnol 33(3): 172-179. [0371] Guell, M., L. Yang, et al. (2014). “Genome editing assessment using CRISPR Genome Analyzer (CRISPR-GA).” Bioinformatics 30(20): 2968-2970. [0372] Gueroui, Z., C. Place, et al. (2002). “Observation by fluorescence microscopy of transcription on single combed DNA.” Proc Natl Acad Sci USA 99(9): 6005-6010. [0373] Guschin, D. Y., A. J. Waite, et al. (2010). “A rapid and general assay for monitoring endogenous gene modification.” Methods Mol Biol 649: 247-256. [0374] Hale, C. R., S. Majumdar, et al. (2012). “Essential features and rational design of CRISPR RNAs that function with the Cas RAMP module complex to cleave RNAs.” Mol Cell 45(3): 292-302. [0375] Hale, C. R., P. Zhao, et al. (2009). “RNA-guided RNA cleavage by a CRISPR RNA-Cas protein complex.” Cell 139(5): 945-956. [0376] Hastings, P. J., J. R. Lupski, et al. (2009). “Mechanisms of change in gene copy number.” Nat Rev Genet 10(8): 551-564. [0377] Heigwer, F., G. Kerr, et al. (2014). “E-CRISP: fast CRISPR target site identification.” Nat Methods 11(2): 122-123. [0378] Hendel, A., E. J. Kildebeck, et al. (2014). “Quantifying genome-editing outcomes at endogenous loci with SMRT sequencing.” Cell Rep 7(1): 293-305. [0379] Herrick, J. and A. Bensimon (1999). “Single molecule analysis of DNA replication.” Biochimie 81(8-9): 859-871. [0380] Herrick, J., C. Conti, et al. (2005). “Genomic organization of amplified MYC genes suggests distinct mechanisms of amplification in tumorigenesis.” Cancer Res 65(4): 1174-1179. [0381] Herrick, J., S. Jun, et al. (2002). “Kinetic model of DNA replication in eukaryotic organisms.” J Mol Biol 320(4): 741-750. [0382] Herrick, J., X. Michalet, et al. (2000). “Quantifying single gene copy number by measuring fluorescent probe lengths on combed genomic DNA.” Proc Natl Acad Sci USA 97(1): 222-227. [0383] Herrick, J., P. Stanislawski, et al. (2000). “Replication fork density increases during DNA synthesis in X. laevis egg extracts.” J Mol Biol 300(5): 1133-1142. [0384] Hindson, C. M., J. R. Chevillet, et al. (2013). “Absolute quantification by droplet digital PCR versus analog real-time PCR.” Nat Methods 10(10): 1003-1005. [0385] Hirano, H., J. S. Gootenberg, et al. (2016). “Structure and Engineering of Francisella novicida Cas9.” Cell 164(5): 950-961. [0386] Hsu, P. D., D. A. Scott, et al. (2013). “DNA targeting specificity of RNA-guided Cas9 nucleases.” Nat Biotechnol 31(9): 827-832. [0387] Huang, P., A. Xiao, et al. (2011). “Heritable gene targeting in zebrafish using customized TALENs.” Nat Biotechnol 29(8): 699-700. [0388] Iyer, V., B. Shen, et al. (2015). “Off-target mutations are rare in Cas9-modified mice.” Nat Methods 12(6): 479. [0389] Jinek, M., K. Chylinski, et al. (2012). “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.” Science 337(6096): 816-821. [0390] Jo, Y. I., H. Kim, et al. (2015). “Recent developments and clinical studies utilizing engineered zinc finger nuclease technology.” Cell Mol Life Sci 72(20): 3819-3830. [0391] Jun, S., J. Herrick, et al. (2004). “Persistence length of chromatin determines origin spacing in Xenopus early-embryo DNA replication: quantitative comparisons between theory and experiment.” Cell Cycle 3(2): 223-229. [0392] Kim, Y. G., J. Cha, et al. (1996). “Hybrid restriction enzymes: zinc finger fusions to Fok I cleavage domain.” Proc Natl Acad Sci USA 93(3): 1156-1160. [0393] Kim, Y. G. and S. Chandrasegaran (1994). “Chimeric restriction endonuclease.” Proc Natl Acad Sci USA 91(3): 883-887. [0394] Kuscu, C., S. Arslan, et al. (2014). “Genome-wide analysis reveals characteristics of off-target sites bound by the Cas9 endonuclease.” Nat Biotechnol 32(7): 677-683. [0395] Lebofsky, R. and A. Bensimon (2003). “Single DNA molecule analysis: applications of molecular combing.” Brief Funct Genomic Proteomic 1(4): 385-396. [0396] Lebofsky, R. and A. Bensimon (2005). “DNA replication origin plasticity and perturbed fork progression in human inverted repeats.” Mol Cell Biol 25(15): 6789-6797. [0397] Lebofsky, R., R. Heilig, et al. (2006). “DNA replication origin interference increases the spacing between initiation events in human cells.” Mol Biol Cell 17(12): 5337-5345. [0398] Lee, H. J., J. Kweon, et al. (2012). “Targeted chromosomal duplications and inversions in the human genome using zinc finger nucleases.” Genome Res 22(3): 539-548. [0399] Li, H. (2012) “Exploring single-sample SNP and INDEL calling with whole-genome de novo assembly.” Bioinformatics 28(14): 1838-1844 [0400] Li, L., L. P. Wu, et al. (1992). “Functional domains in Fok I restriction endonuclease.” Proc Natl Acad Sci USA 89(10): 4275-4279. [0401] Lieber, M. R. (2010). “The mechanism of double-strand DNA break repair by the nonhomologous DNA end-joining pathway.” Annu Rev Biochem 79: 181-211. [0402] Lieber, M. R. and T. E. Wilson (2010). “SnapShot: Nonhomologous DNA end joining (NHEJ).” Cell 142(3): 496-496 e491. [0403] Llorente, B., C. E. Smith, et al. (2008). “Break-induced replication: what is it and what is it for?” Cell Cycle 7(7): 859-864. [0404] Maeder, M. L. and C. A. Gersbach (2016). “Genome-editing Technologies for Gene and Cell Therapy.” Mol Ther 24(3): 430-446. [0405] Maeder, M. L., S. J. Linder, et al. (2013). “CRISPR RNA-guided activation of endogenous human genes.” Nat Methods 10(10): 977-979. [0406] Mahiet, C., A. Ergani, et al. (2012). “Structural variability of the herpes simplex virus 1 genome in vitro and in vivo.” J Virol 86(16): 8592-8601. [0407] Makarova, K. S., Y. I. Wolf, et al. (2015). “An updated evolutionary classification of CRISPR-Cas systems.” Nat Rev Microbiol 13(11): 722-736. [0408] Mali, P., J. Aach, et al. (2013). “CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering.” Nat Biotechnol 31(9): 833-838. [0409] Mali, P., L. Yang, et al. (2013). “RNA-guided human genome engineering via Cas9.” Science 339(6121): 823-826. [0410] Maresca, M., V. G. Lin, et al. (2013). “Obligate ligation-gated recombination (ObLiGaRe): custom-designed nuclease-mediated targeted integration through nonhomologous end joining.” Genome Res 23(3): 539-546. [0411] Marraffini, L. A. and E. J. Sontheimer (2010). “Self versus non-self discrimination during CRISPR RNA-directed immunity.” Nature 463(7280): 568-571. [0412] Mashal, R. D., J. Koontz, et al. (1995). “Detection of mutations by cleavage of DNA heteroduplexes with bacteriophage resolvases.” Nat Genet 9(2): 177-183. [0413] McEachern, M. J. and J. E. Haber (2006). “Break-induced replication and recombinational telomere elongation in yeast.” Annu Rev Biochem 75: 111-135. [0414] McMahon, M. A., M. Randar, et al. (2012). “Gene editing: not just for translation anymore.” Nat Methods 9(1): 28-31. [0415] Merkert, S. and U. Martin (2016). “Targeted genome engineering using designer nucleases: State of the art and practical guidance for application in human pluripotent stem cells.” Stem Cell Res 16(2): 377-386. [0416] Michalet, X., R. Ekong, et al. (1997). “Dynamic molecular combing: stretching the whole human genome for high-resolution studies.” Science 277(5331): 1518-1523. [0417] Miller, J. C., S. Tan, et al. (2011). “A TALE nuclease architecture for efficient genome editing.” Nat Biotechnol 29(2): 143-148. [0418] Mock, U., I. Hauber, et al. (2016). “Digital PCR to assess gene-editing frequencies (GEF-dPCR) mediated by designer nucleases.” Nat Protoc 11(3): 598-615. [0419] Moehle, E. A., J. M. Rock, et al. (2007). “Targeted gene addition into a specified location in the human genome using designed zinc finger nucleases.” Proc Natl Acad Sci USA 104(9): 3055-3060. [0420] Moscou, M. J. and A. J. Bogdanove (2009). “A simple cipher governs DNA recognition by TAL effectors.” Science 326(5959): 1501. [0421] Mussolino, C., J. Alzubi, et al. (2014). “TALENs facilitate targeted genome editing in human cells with high specificity and low cytotoxicity.” Nucleic Acids Res 42(10): 6762-6773. [0422] Nguyen, K., P. Walrafen, et al. (2011). “Molecular combing reveals allelic combinations in facioscapulohumeral dystrophy.” Ann Neurol 70(4): 627-633. [0423] Oliveros, J. C., M. Franch, et al. (2016). “Breaking-Cas-interactive design of guide RNAs for CRISPR-Cas experiments for ENSEMBL genomes.” Nucleic Acids Res 44(W1): W267-271. [0424] Osborn, M. J., B. R. Webber, et al. (2016). “Evaluation of TCR Gene Editing Achieved by TALENs, CRISPR/Cas9, and megaTAL Nucleases.” Mol Ther 24(3): 570-581. [0425] Ousterout, D. G., P. Perez-Pinera, et al. (2013). “Reading frame correction by targeted genome editing restores dystrophin expression in cells from Duchenne muscular dystrophy patients.” Mol Ther 21(9): 1718-1726. [0426] Paques, F. and J. E. Haber (1999). “Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae.” Microbiol Mol Biol Rev 63(2): 349-404. [0427] Pasero, P., A. Bensimon, et al. (2002). “Single-molecule analysis reveals clustering and epigenetic regulation of replication origins at the yeast rDNA locus.” Genes Dev 16(19): 2479-2484. [0428] Patel, P. K., B. Arcangioli, et al. (2006). “DNA replication origins fire stochastically in fission yeast.” Mol Biol Cell 17(1): 308-316. [0429] Pattanayak, V., S. Lin, et al. (2013). “High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity.” Nat Biotechnol 31(9): 839-843. [0430] Pattanayak, V., C. L. Ramirez, et al. (2011). “Revealing off-target cleavage specificities of zinc-finger nucleases by in vitro selection.” Nat Methods 8(9): 765-770. [0431] Payen, C., R. Koszul, et al. (2008). “Segmental duplications arise from Pol32-dependent repair of broken forks through two alternative replication-based mechanisms.” PLoS Genet 4(9): e1000175. [0432] Perez, E. E., J. Wang, et al. (2008). “Establishment of HIV-1 resistance in CD4+ T cells by genome editing using zinc-finger nucleases.” Nat Biotechnol 26(7): 808-816. [0433] Pinheiro, L. B., V. A. Coleman, et al. (2012). “Evaluation of a droplet digital polymerase chain reaction format for DNA copy number quantification.” Anal Chem 84(2): 1003-1011. [0434] Porter, S. N., L. C. Baker, et al. (2014). “Lentiviral and targeted cellular barcoding reveals ongoing clonal dynamics of cell lines in vitro and in vivo.” Genome Biol 15(5): R75. [0435] Porteus, M. H. and D. Baltimore (2003). “Chimeric nucleases stimulate gene targeting in human cells.” Science 300(5620): 763. [0436] Pruett-Miller, S. M., J. P. Connelly, et al. (2008). “Comparison of zinc finger nucleases for use in gene targeting in mammalian cells.” Mol Ther 16(4): 707-717. [0437] Puchta, H. (2005). “The repair of double-strand breaks in plants: mechanisms and consequences for genome evolution.” J Exp Bot 56(409): 1-14. [0438] Qiu, P., H. Shandilya, et al. (2004). “Mutation detection using Surveyor nuclease.” Biotechniques 36(4): 702-707. [0439] Ran, F. A., L. Cong, et al. (2015). “In vivo genome editing using Staphylococcus aureus Cas9.” Nature 520(7546): 186-191. [0440] Ran, F. A., P. D. Hsu, et al. (2013). “Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity.” Cell 154(6): 1380-1389. [0441] Rao, V. A., C. Conti, et al. (2007). “Endogenous gamma-H2AX-ATM-Chk2 checkpoint activation in Bloom's syndrome helicase deficient cells is related to DNA replication arrested forks.” Mol Cancer Res 5(7): 713-724. [0442] Redondo, P., J. Prieto, et al. (2008). “Molecular basis of xeroderma pigmentosum group C DNA recognition by engineered meganucleases.” Nature 456(7218): 107-111. [0443] Rouet, P., F. Smih, et al. (1994). “Expression of a site-specific endonuclease stimulates homologous recombination in mammalian cells.” Proc Natl Acad Sci USA 91(13): 6064-6068. [0444] Sampson, T. R., S. D. Saroj, et al. (2013). “A CRISPR/Cas system mediates bacterial innate immune evasion and virulence.” Nature 497(7448): 254-257. [0445] Schmid-Burgk, J. L., T. Schmidt, et al. (2014). “OutKnocker: a web tool for rapid and simple genotyping of designer nuclease edited cell lines.” Genome Res 24(10): 1719-1723. [0446] Schurra, C. and A. Bensimon (2009). “Combing genomic DNA for structural and functional studies.” Methods Mol Biol 464: 71-90. [0447] Shendure, J. and H. Ji (2008). “Next-generation DNA sequencing.” Nat Biotechnol 26(10): 1135-1145. [0448] Shinkuma, S., Z. Guo, et al. (2016). “Site-specific genome editing for correction of induced pluripotent stem cells derived from dominant dystrophic epidermolysis bullosa.” Proc Natl Acad Sci USA. [0449] Smih, F., P. Rouet, et al. (1995). “Double-strand breaks at the target locus stimulate gene targeting in embryonic stem cells.” Nucleic Acids Res 23(24): 5012-5019. [0450] Smith, C., A. Gore, et al. (2014). “Whole-genome sequencing analysis reveals high specificity of CRISPR/Cas9 and TALEN-based genome editing in human iPSCs.” Cell Stem Cell 15(1): 12-13. [0451] Sollu, C., K. Pars, et al. (2010). “Autonomous zinc-finger nuclease pairs for targeted chromosomal deletion.” Nucleic Acids Res 38(22): 8269-8276. [0452] Sugawara, N., G. Ira, et al. (2000). “DNA length dependence of the single-strand annealing pathway and the role of Saccharomyces cerevisiae RAD59 in double-strand break repair.” Mol Cell Biol 20(14): 5300-5309. [0453] Szostak, J. W., T. L. Orr-Weaver, et al. (1983). “The double-strand-break repair model for recombination.” Cell 33(1): 25-35. [0454] Takata, M., M. S. Sasaki, et al. (1998). “Homologous recombination and non-homologous end-joining pathways of DNA double-strand break repair have overlapping roles in the maintenance of chromosomal integrity in vertebrate cells.” EMBO J 17(18): 5497-5508. [0455] Taylor, G. R. and J. Deeble (1999). “Enzymatic methods for mutation scanning.” Genet Anal 14(5-6): 181-186. [0456] Tessereau, C., M. Buisson, et al. (2013). “Direct visualization of the highly polymorphic RNU2 locus in proximity to the BRCA1 gene.” PLoS One 8(10): e76054. [0457] Tessereau, C., M. Leone, et al. (2015). “Occurrence of a non deleterious gene conversion event in the BRCA1 gene.” Genes Chromosomes Cancer 54(10): 646-652. [0458] Tessereau, C., Y. Lesecque, et al. (2014). “Estimation of the RNU2 macrosatellite mutation rate by BRCA1 mutation tracing.” Nucleic Acids Res 42(14): 9121-9130. [0459] Thomas, H. R., S. M. Percival, et al. (2014). “High-throughput genome editing and phenotyping facilitated by high resolution melting curve analysis.” PLoS One 9(12): e114632. [0460] Tones, R., M. C. Martin, et al. (2014). “Engineering human tumour-associated chromosomal translocations with the RNA-guided CRISPR-Cas9 system.” Nat Commun 5: 3964. [0461] Triques, K., E. Piednoir, et al. (2008). “Mutation detection using ENDO1: application to disease diagnostics in humans and TILLING and Eco-TILLING in plants.” BMC Mol Biol 9: 42. [0462] Tsai, S. Q., Z. Zheng, et al. (2015). “GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases.” Nat Biotechnol 33(2): 187-197. [0463] Vasale, J., F. Boyar, et al. (2015). “Molecular combing compared to Southern blot for measuring D4Z4 contractions in FSHD.” Neuromuscul Disord 25(12): 945-951. [0464] Vasileva, E. A., O. U. Shuvalov, et al. (2015). “Genome-editing tools for stem cell biology.” Cell Death Dis 6: e1831. [0465] Veres, A., B. S. Gosis, et al. (2014). “Low incidence of off-target mutations in individual CRISPR-Cas9 and TALEN targeted human stem cell clones detected by whole-genome sequencing.” Cell Stem Cell 15(1): 27-30. [0466] Villarreal, D. D., K. Lee, et al. (2012). “Microhomology directs diverse DNA break repair pathways and chromosomal translocations.” PLoS Genet 8(11): e1003026. [0467] Vogelstein, B. and K. W. Kinzler (1999). “Digital PCR.” Proc Natl Acad Sci USA 96(16): 9236-9241. [0468] Vouillot, L., A. Thelie, et al. (2015). “Comparison of T7E1 and surveyor mismatch cleavage assays to detect mutations triggered by engineered nucleases.” G3 (Bethesda) 5(3): 407-415. [0469] Wagner, R., P. Debbie, et al. (1995). “Mutation detection using immobilized mismatch binding protein (MutS).” Nucleic Acids Res 23(19): 3944-3948. [0470] Wang, X., Y. Wang, et al. (2015). “Unbiased detection of off-target cleavage by CRISPR-Cas9 and TALENs using integrase-defective lentiviral vectors.” Nat Biotechnol 33(2): 175-178. [0471] White, M. K., W. Hu, et al. (2015). “The CRISPR/Cas9 genome editing methodology as a weapon against human viruses.” Discov Med 19(105): 255-262. [0472] Wu, X., D. A. Scott, et al. (2014). “Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells.” Nat Biotechnol 32(7): 670-676. [0473] Yamano, T., H. Nishimasu, et al. (2016). “Crystal Structure of Cpf1 in Complex with Guide RNA and Target DNA.” Cell 165(4): 949-962. [0474] Yang, L., M. Guell, et al. (2013). “Optimization of scarless human stem cell genome editing.” Nucleic Acids Res 41(19): 9049-9061. [0475] Zetsche, B., J. S. Gootenberg, et al. (2015). “Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.” Cell 163(3): 759-771. [0476] Zhang, Y., N. Heidrich, et al. (2013). “Processing-independent CRISPR RNAs limit natural transformation in Neisseria meningitidis.” Mol Cell 50(4): 488-503. [0477] Zhu, X., Y. Xu, et al. (2014). “An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system.” Sci Rep 4: 6420.