GLUCOAMYLASE TLGA15 AND GENE AND APPLICATION THEREOF

Abstract

The present invention relates to the field of genetic engineering, particularly to a glucoamylase TIGal5, gene and application thereof. Said glucoamylase comprises the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:2 and has the excellent enzymic properties, which can be applied to feed, food, and medicine industries, can be industrially produce with the genetic engineering technics.

Claims

1. A glucoamylase which has the optimum temperature of 65° C. and the optimum pH of 5.0, is thermostable, and comprises the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, or the amino acid sequence having 90% to 99% identity to that of SEQ ID NO:1 or SEQ ID NO: 2.

2. A gene encoding the glucoamylase of claim 1.

3. The gene according to claim 2 comprising a nucleotide sequence of SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5, or a nucleotide sequence having 90% to 99% identity to that of SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5.

4. A DNA construct comprising the gene of claim 2.

5. The DNA construct according to claim 4 wherein said gene comprises a nucleotide sequence of SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5 or a nucleotide sequence having 90% to 99% identity to that of SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5.

6. A recombinant strain comprising the gene of claim 2.

7. The recombinant strain according to claim 6 wherein said gene comprises a nucleotide sequence of SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5 or a nucleotide sequence having 90% to 99% identity to that of SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5.

8. A method for producing the glucoamylase of claim 1, comprising the steps of transforming an isolated host cell with a DNA construct comprising a polynucleotide which comprises a nucleotide sequence encoding said glucoamylase of claim 1 to obtain a recombinant host cell; cultivating the recombinant host cell to produce the glucoamylase; and recovering the glucoamylase.

9. The method according to claim 8 wherein said gene comprises a nucleotide sequence of SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5 or a nucleotide sequence having 90% to 99% identity to that of SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5.

10. A use of the glucoamylase of claim 1.

Description

BRIEF DESCRIPTIONS OF THE DRAWINGS

[0026] FIG. 1 shows optimum pH values for the recombinant glucoamylase;

[0027] FIG. 2 shows pH stabilities for the recombinant glucoamylase;

[0028] FIG. 3 shows optimum temperature for the recombinant glucoamylase;

[0029] FIG. 4 shows thermostability for the recombinant glucoamylase.

EMBODIMENT

[0030] Test Materials and Reagents

[0031] 1. Strains and vectors: Pichia pastoris strain GS115; and vector pPIC9.

[0032] 2. Medium:

[0033] (1) Enzyme production medium (IL) 30 g/L of bran, 30 g/L of corncob powder, 30 g/L of soybean meal, 5 g/L of barley dextran, 5 g/L of (NH.sub.4)SO.sub.4, 1 g/L of KH.sub.2PO.sub.4, 0.5 g/L of MgSO.sub.4.7H.sub.2O, 0.01 g/L of FeSO.sub.4.7H.sub.2O, 0.2 g/L of CaCl.sub.2 which were dissolved in 1 L of deionized water, and sterilized for 20 min at 121° C. and 15 pounds.

[0034] (2) E. coli. LB medium: 1% of peptone, 0.5% of yeast extract, and 1% of NaCl, natural pH.

[0035] (3) YPD medium: 2% of glucose, 1% of yeast extract, and 2% of peptone

[0036] (4) BMGY medium: 1% of yeast extract; 2% of peptone; 1.34% of YNB, 0.000049% of Biotin; and 0.5% of glycerol (V/V).

[0037] (5) BMMY medium: 1% of yeast extract; 2% of peptone 1.34% of YNB, 0.000049% of Biotin; and 0.5% of methanol (V/V).

Example 1 Cloning Glucoamylase Gene Tlga15

[0038] 1. Genomic DNA was isolated from Talaromyces leycettanus JCM 12802 and performed PCR reaction with the primers as list in table 1 using the parameters of 95° C. for 5 min, 30 circles of 94° C. for 30 sec, 50° C. for 30 sec, and 72° C. for 2 min, and 72° C. for 10 min, obtain a polynucleotide fragment in length of about 1800 bp which was recovered and confirmed to comprise the nucleotide sequence of SEQ ID NO: 1 by sequencing.

TABLE-US-00006 TABLE 1 Primers Length Primer SEQUENCE (5′---3′) (bp) 15F GGGGAATTCGCACCACATCCCA 34 CGGAACTTCTCC 15R TATGCGGCCGCCTACCTCCAAC 40 TATCATTCACCGTCGCAG

[0039] 2. Obtaining the cDNA sequence encoding the glucoamylase

[0040] The total RNA was isolated from Talaromyces leycettanus JCM 12802 and one chain of total cDNA was obtained with Oligo (dT).sub.20 and the reverse transcriptase, which was performed PCR with the primers 15F and 15R as list in the table 1 followed by being recovered and sequenced to obtain the cDNA sequence of glucoamylase.

[0041] And, the obtained cDNA sequence comprised four introns and oligonucleotide sequence encoding the signal peptide comprising 20 amino acids at N-terminal by Blasing, and conformed to be a novel glucoamylase gene from Talaromyces leycettanus 12802.

Example 2 Preparing the Recombinant Cell Comprising Glucoamylase Gene

[0042] 1. Constructing the Expression Vector and Expressing in Pichia pastoris GS115

[0043] The expression vector pPIC9-Tlga15 comprising the full-length gene encoding glucoamylase was constructed by inserting the gene at the downstream of the signal peptide of the plasmid to form the correct reading frame, followed to transform E coli cell Transl to screen the positive transformants for sequencing. The transformants with the correct sequence were used to prepare the recombinant plasmid in a large amount. The DNA of the expression vector was lined with restriction enzymes EcoR I and Not I, followed by electronically transforming Pichia pastoris strain GS115, and being cultured at 30° C. for 2 to 3 days to screen the transformants on the MD plate for expressing assays.

[0044] The recombinant expression vector comprising the gene including the signal peptide was constructed as same as above.

2. Screening the Transformants with High Glucoamylase Activity

[0045] The single colony on the MD plate was selected with a sterilized toothpick and numbered on the MD plates which were incubated at 30° C. for 1 to 2 days until the colony grown. The transformants were inoculated in a centrifuge tube containing 3 mL BMGY medium, and cultured according to their number, cultured at 30° C. and 220 RPM for 48 h followed by centrifuging at 3,000×g for 15 min to remove supernatant, and adding 1 mL BMMY medium containing 0.5%, of methanol into the centrifuge tube for induction culturing at 30° C. and 220 RPM for 48 h to collect the supernatant by centrifuging at 3,000×g for 5 min for detecting the activity. Finally, the transformant with high glucoamylase activity were screened out.

Example 3 Producing Recombinant Glucoamylase TlGA15

[0046] 1. The screened transformants with high enzyme activity were incubated into YPD medium, activated, concentrated and highly expressed on fermentation level. After induction, the supernatant was recovered by spinning at 12,000×g for 10 min to test the activity of the and performing SDS-PAGE.

[0047] 2. Purifying the recombinant glucoamylase TlGA15

[0048] The supernatant of the recombinant glucoamylase TlGA15 expressed in the shaking bottle was collected followed by being concentrated with 10 kDa membrane package while replacing the medium of the fermentation broth with low salt buffer, and further concentrated with 10 kDa ultrafiltration tube. The concentrated solution was further purified with ion exchange chromatography by loading 2.0 mL of glucoamylase TlGA15 concentrate into HiTrap Q Sepharose XL anion column pre-balanced with 20 mM Tris-HCl (pH 6.5), and eluting with NaCL in linear gradient of 0 to 1.0 mol/L, to detect enzyme activity and determine protein concentration of the eluent collected step by step.

Example 4 Measuring the Properties of the Recombinant Glucoamylase

[0049] The activity of glucoamylase was measured with DNS method including the steps of performing the enzymatic reaction at 65° C. and pH 5.0 for 30 min, wherein 1 mL of said enzymatic reaction system included 100 μL of appropriate diluted enzyme solution and 900 μL of substrate, terminating the reaction by adding 1.5 ML of DNS, boiling for 5 min, measuring the absorbance at 540 nm and calculating the enzymatic activity after cooling, wherein one unit of enzymatic activity (U) is defined as the amount of enzyme to produce 1 μmol of reducing sugar per unit time under given conditions.

1. Optimum pH Values and pH Stability for the Recombinant Glucoamylase TlGA15

[0050] The glucoamylase purified in example 3 was reacted in the buffers with the different pHs such as glycine hydrochloride series buffer of pH 1.0 to 3.0, citric acid disodium hydrogen phosphate series buffer of pH 3.0 to 9.0, and Glycine NaOH series buffer of pH 9.0 to 12.0 to determine optimum pH.

[0051] As shown in FIG. 1, the optimum pH of the glucoamylase is pH 5.0 at 65° C., and the glucoamylase maintains more than 50% of enzyme activity in range of pH3.0 to pH5.5.

[0052] Furthermore, pH stability of glucoamylase is researched by determine the enzyme activity after mixing glucoamylase solution with the buffers in different pHs and being treated at 37° C. for 60 min.

[0053] As shown in FIG. 2, glucoamylase is capable of maintaining more than 50% of enzyme activity in range of pH2.0 to pH10.0, demonstrating the excellent pH stability of the glucoamylase.

2. Optimum Temperature and Heat Stability of the Recombinant Glucoamylase TlGA15

[0054] The glucoamylase was reacted in the different temperatures from 20 to 80° C. at pH 5.0 to determine its optimum temperature. As shown in FIG. 3, the optimum temperature of glucoamylase was 65° C., and it maintained more than 70% of activity at 75° C.

[0055] The thermal stability of glucoamylase was determined by detecting the enzyme activity of the of glucoamylase at 60° C. after being treated at the different temperatures for the different time. As shown by FIG. 4, more than 79% of enzyme activity was kept after being treated at 55° C. for 60 min, 55% of enzyme activity was kept after being treated at 60° C. for 60 min, and 24% of enzyme activity was still kept after being treated even at 70° C. for 5 min, demonstrating the excellent thermostability of the glucoamylase.

3. Measuring Enzyme Kinetics and the Specific Activity of the Recombinant Glucoamylase TlGA15

[0056] The reaction rate at 65° C. was determined and the values of Km and Vmax were determined by using the double reciprocal plot wherein the glucoamylase TlGA15 was reacted with starch as substrate in different concentrations of 0.4 to 3 mmol/L in 0.1 mol/L of citric acid buffer solution at pH 5.0 at 65° C. for 5 min.

[0057] And, Km is 1.86 mg/mL, Vmax is 714 μmol/min/m and the specific activity is 542 U/m after detecting the enzyme activity of glucoamylase TlGA15 using starch as substrate at 65° C.