SYNTHETIC ARCHAEAL DIETHER LIPIDS

Abstract

Disclosed are new synthetic compounds that includes a lipid diether to which a sugar group is grafted via a PEG spacer, and to now liposomes including at least one of the compounds. In particular, new synthetic compounds of general formula (I) and to new liposomes including at least one of the compounds is disclosed, as well as new liposomes for use as vectors and/or adjuvants, especially for use in vaccines.

Claims

1-15. are (canceled)

16. A compound of formula I: ##STR00057## wherein: a is an integer from 1 to 9; b is an integer from 1 to 3; c is an integer from 1 to 130; R.sub.1, R.sub.1 ′ and R.sub.1″ are identical or different, each one independently representing an H, or a group of the type: ##STR00058## ##STR00059## ##STR00060## wherein R.sub.2 and R.sub.2 ′ are identical or different, each one independently representing an H or a sugar residue chosen from the list comprising mannose, glucose, fucose, oligomannoses comprising from 2 to 10 mannose units, glycans terminated with a mannose, glycans terminated with a fucose, Lewis-A trisaccharide 3′-sulfate, Lewis-B trisaccharide (Le.sup.b), Lewis-X trisaccharide (Le.sup.x), tri-N-acetylglucosamine (tri-GlcNAc), PIMs (phosphatidylinositol mannosides), in particular PIM.sub.1 to PIM.sub.6 (phosphatidylinositol mono- to hexa-mannoside), Man9GlcNAc2 oligosaccharide, N-linked oligosaccharides rich in mannose, α-fucose-1-4GlcNAc oligosaccharide, lacto-N-fucopentaose III oligosaccharide containing the Le.sup.x trisaccharide, GlcNAc2 Man 3 oligosaccharide, Man 4 oligosaccharides, Manα1-3(Manα1-6)Manα1 oligosaccharide, lipoarabinomannans (LAMs), mannosylated lipoarabinomannans (ManLAMs); d is an integer from 0 to 5; with the condition that at least one of the R.sub.2 and R.sub.2 ′ groups is different from H and that R.sub.2 is different from H when R.sub.2 ′ is absent; with the condition that at least one of the R.sub.1, R.sub.1 ′ and R.sub.1 ″ groups is different from H.

17. The compound according to claim 16 of formula I: ##STR00061## wherein: a is an integer from 1 to 9; b is an integer from 1 to 3; c is an integer from 1 to 130; R.sub.1, R.sub.1 ′ and R.sub.1″ are identical or different, each one independently representing an H or the group: ##STR00062## ##STR00063## ##STR00064## wherein d is an integer from 0 to 5; wherein R.sub.2 and R.sub.2 ′ are identical or different, each one independently representing mannose, glucose, fucose, or oligomannoses comprising from 2 to 10 mannose units; with the condition that at least one of the R.sub.1, R.sub.1 ′ and R.sub.1 ″ groups is different from H.

18. The compound according to claim 16 of formula I: ##STR00065## wherein: a is an integer from 1 to 9; b is an integer from 1 to 3; c is an integer from 1 to 130; R.sub.1, R.sub.1 ′ and R.sub.1′′ are identical or different, each one independently representing an H or the group: ##STR00066## ##STR00067## ##STR00068## wherein d is an integer from 0 to 5; wherein R.sub.2 and R.sub.2 ′ represent the group: ##STR00069## with the condition that at least one of the R.sub.1, R.sub.1 ′ and R.sub.1′′ groups is different from H.

19. The compound according to claim 16 of formula II: wherein: c is an integer from 1 to 130; d is an integer from 1 to 5.

20. The compound according to claim 16 of formula II: wherein: c is 5; d is 2.

21. A liposome comprising a compound of formula I: ##STR00070## wherein: a is an integer from 1 to 9; b is an integer from 1 to 3; c is an integer from 1 to 130; R.sub.1, R.sub.1 ′ and R.sub.1′′ are identical or different, each one independently representing an H, or a group of the type: ##STR00071## ##STR00072## ##STR00073## wherein R.sub.2 and R.sub.2′ are identical or different, each one independently representing an H or a sugar residue chosen from the list comprising mannose, glucose, fucose, oligomannoses comprising from 2 to 10 mannose units, glycans terminated with a mannose, glycans terminated with a fucose, Lewis-A trisaccharide 3′-sulfate, Lewis-B trisaccharide (Le.sup.b), Lewis-X trisaccharide (Le.sup.x), tri-N-acetylglucosamine (tri-GlcNAc), PIMs (phosphatidylinositol mannosides), in particular to PIM.sub.6 (phosphatidylinositol mono- to hexa-mannoside), Man9GlcNAc2 oligosaccharide, N-linked oligosaccharides rich in mannose, α-fucose-1-4GlcNAc oligosaccharide, lacto-N-fucopentaose III oligosaccharide containing the Le.sup.x trisaccharide, GlcNAc2 Man 3 oligosaccharide, Man 4 oligosaccharides, Manα1-3(Manα1-6)Manα1 oligosaccharide, lipoarabinomannans (LAMs), mannosylated lipoarabinomannans (ManLAMs); d is an integer from 0 to 5; with the condition that at least one of the and R.sub.2 ′ groups is different from H and that R.sub.2 is different from H when R.sub.2′ is absent; with the condition that at least one of the R.sub.1, R.sub.1′ and R.sub.1″ groups is different from H, wherein said compound is in proportions ranging from about 1% to about 15% in mole percent with respect to the total number of moles of lipids.

22. The liposome according to claim 21, wherein said compound is of formula II: wherein: c is 5; d is 2.

23. The liposome according to claim 21, further comprising at least one molecule of interest.

24. The liposome according to claim 21, further comprising at least one molecule of interest, wherein said molecule of interest is able to induce an immune response.

25. The liposome according to claim 21, further comprising at least one molecule of interest, wherein said molecule of interest is a nucleic acid.

26. The liposome according to claim 21, further comprising at least one molecule of interest, wherein said molecule of interest is a cancer-associated antigen selected from the group consisting of: CAP-1, CD 4/m, cell surface proteins of the claudin family CLAUDIN-6, CLAUDIN-18.2 and CLAUDIN-12, c-myc, CT, GnT-V, HAGE, HAST-2, LAGE, NF1, NY-BR-1, proteinase 3, SAGE, SCGB3A2, SCP1, SCP2, SCP3, SSX, SURVrVin, TPI/m, TPTE, CDK4 (cyclin-dependent kinase 4), plS1″1′4′3, p53, AFP, β-catenin, caspase 8, mutated version of p21Ras, Bcr-abl chimera, MUM-I MUM-2, MUM-3, ELF2M, HSP70-2M, HST-2, KIAA0205, RAGE, myosin/m, 707-AP, CDC27/m, ETV6/AML, TEL/Amll, Dekcain, LDLR/FUT, Pml-RARaTEL/AMLI, NY-ESO-I, members of the MAGE family (Melanoma-associated antigen) MAGE-Al, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-10, MAGE-A11, MAGE-12, MAGE-B, MAGE-C, BAGE, DAM-6, DAM-10, members of the GAGE family (G antigen) GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, GAGE-8, NA-88A, CAG-3, RCC-associated antigen G250, oncoproteins E6 and E7 derived from HPV (human papilloma virus), Epstein Barr virus antigens EBNA2-6, LMP-I, LMP-2, gp77, gp100, MART-1/Melan-A, tyrosinase, TRP-I and TRP-2 (tyrosinase-related protein), TRP-2-INT2, PSA, PSM, MClR, ART4, CAMEL, CEA, CypB, HER2/neu, hTERT, hTRT, iCE, Mucl, Muc2, FRAME RU1, RU2, SART-I, SART-2, SART-3, WT and WT1; or is a nucleic acid encoding said cancer-associated antigen.

27. The compound according to claim 16, being a vaccine adjuvant.

28. The liposome according to claim 21, being a vaccine adjuvant.

29. The liposome according to claim 21, being a vaccine.

30. The liposome according to claim 21, being a cancer vaccine.

31. The compound according to claim 16, wherein said compound is comprised within a pharmaceutical composition containing at least one pharmaceutically acceptable excipient.

32. The liposome according to claim 21, wherein said liposome is comprised within a pharmaceutical composition containing at least one pharmaceutically acceptable excipient.

33. A method for vaccinating a subject in need thereof comprising administering to the subject the liposome according to claim 21.

34. The method according to claim 33, wherein said method is for vaccination against cancer.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0265] FIG. 1 is a set of graphs showing the binding of the bare lipopolyplexes LPR, LPR-MN or LPR-triMN to cells expressing lectin receptors: (A) cellules 293T expressing or not the receptor DC-SIGN; (B) human monocyte-derived dendritic cells (MoDCs); (C) human blood mononuclear cells (PBMCs); (D) human dendritic cells isolated from the blood (panDCs).

[0266] FIG. 2 is a set of graphs showing the binding of the lipopolyplexes LPR-MN, diether LPR-MN or LPR-triMN to cells expressing lectin receptors: (A) murine dendritic cells DC 2.4; (B) murine spleen cells; (C) human monocyte-derived dendritic cells (MoDCs).

[0267] FIG. 3A is a set of graphs showing the expression of the activation marker CD80 by MoDCs FITC- or FITC+ dendritic cells after incubation in the presence of increasing concentrations of lipopolyplexes LPR-MN or LPR-triMN. The FITC- cells did not capture the lipopolyplexes, the FITC+ cells captured the lipopolyplexes.

[0268] FIG. 3B is a histogram showing the expression of the activation markers HLA-DR and CD83 by MoDCs cells that have been incubated in the presence of 2.5 .Math.g/ml of LPR-MN or LPR-triMN.

[0269] FIG. 4A is a graph showing the expression of the GFP by dendritic cells MoDCs incubated at t0 with lipopolyplexes LPR-MN containing mRNA of the GFP then at t6h with LPS (positive control) or LPR-MN or LPR-triMN liposomes containing RNA control single strand PolyU (ssPolyU).

[0270] FIG. 4B is a graph showing the expression of the activation marker CD80 by dendritic cells MoDCs incubated at t0 with LPR-MN containing mRNA of the GFP then at t6h with LPS (positive control) or LPR-MN or LPR-triMN containing RNA control single strand PolyU (ssPolyU).

[0271] FIG. 4C is a histogram showing the expression of the activation markers CD80, CD83 and HLA-DR by dendritic cells MoDCs incubated in a first step with LPR-MN containing mRNA of the GFP for 6 h then in a second step with LPS (positive control) or LPR-MN or LPR-triMN containing RNA control single strand PolyU (ssPolyU) for 12 h hours.

[0272] FIG. 5A is a set of photographs showing the two injection sites (indicated by arrows) on the back of mice having received 24 h (1) and 48 h (2) beforehand an injection of PBS, of LPR-MN lipopolyplexes or of LPR-triMN lipopolyplexes.

[0273] FIG. 5B is a set of photographs showing the microscopic analysis after haematoxylin-eosin marking of a section of 10 .Math.m of skin on the injection site (point 48 h) and of the inguinal lymph node draining the injection sites of mice having received 24 h (1) and 48 h (2) beforehand an injection of PBS, of LPR-MN or of LPR-triMN.

[0274] FIG. 6 is a set of photographs showing the analysis via fluorescence microscopy of popliteal lymph nodes taken from mice having received 6 h beforehand an injection of PBS, of LPR-MN or of LPR-triMN marked with rhodamine. The marker CD169 (anti-CD169-APC) makes it possible to view the resident macrophages of the lymph node subcapsular sinus. The LPR can be viewed thanks to a marking with rhodamine. The rhodamine signal co-located with the signal CD169 is indicated by asterisks (*). The rhodamine signal located on the cells with extended branches that do not express CD169 (probably dendritic cells) is indicated by arrow.

[0275] FIG. 7 is a set of graphs showing: (A) the absolute value (number) and (B) the relative percentage of dendritic cells; and within these total dendritic cells, (C) the percentage of activated dendritic cells (Ly6C+ cells) and (D) of inflammatory dendritic cells (LY6G+ cells) present in the lymph nodes draining the injection site taken from mice having received 24 h beforehand an injection of PBS, of bare LPR, of bare diether LPR, of LPR-MN, or of LPR-triMN.

[0276] FIG. 8 is a set of histograms showing the percentage of CD4+ (A) and CD8+ (B) lymphocytes expressing interferon-y after a sensitisation by dendritic cells having incorporated the indicated lipopolyplexes containing mRNA of oncoprotein E7 (bare LPR, LPR-MN or LPR-triMN) followed by a stimulation by dendritic cells loaded beforehand with peptides E7. As a control, the mRNA is replaced with an RNA single strand PolyU (ssPolyU).

[0277] FIG. 9 is a set of graphs showing: (A) the secretion of interferon-y by isolated lymphocytes of the spleen of mice vaccinated with LPR-triMN-E7/E7-DC-LAMP administered by different paths (IV: intravenous, SC: subcutaneous, ID: intradermal); (B) the secretion of interferon-y by isolated lymphocytes of the spleen of mice vaccinated at day 0 and day 2 with an injection of PBS, or of different LPR (bare LPR, bare diether LPR, LPR-MN, LPR-triMN) containing mRNA of oncoprotein E7.

[0278] FIG. 10A is a set of graphs showing the volume of the tumour developed by mice which were injected with 50,000 cells of the syngeneic tumoural line TC-1 and which were then vaccinated with PBS, LPR-MN-ssPolyU, LPR-MN-E7/E7-DC-LAMP, LPR-triMN-ssPolyU or LPR-triMN-E7/E7-DC-LAMP. Each curve corresponds to the volume of the tumour developed by one mouse. The arrows indicated the days on which the mice were vaccinated (D7 and D9).

[0279] FIG. 10B is a graph showing the survival rate of these mice.

[0280] FIG. 11 is a set of graphs showing the volume of the tumour developed by mice which were injected with B16F0 tumour cells expressing MART1 (A) or EG7 tumour cells expressing OVA (B) and which were then vaccinated with PBS, LPR-triMN-ssPolyU or LPR-triMN containing mRNA of MART1 or OVA, respectively. NS: no statistically significant difference (i.e. p > 0.05), * p < 0.05, ** p < 0.01.

EXAMPLES

[0281] This invention shall be understood better when reading the following examples that non-limitingly illustrate the invention.

Example 1: Synthesis of a Tri-mannosylated Lipid of the Invention

Material and Methods

Nuclear Magnetic Resonance (NMR)

[0282] Fourier-transform spectrometers BRUKER ARX 400 and BRUKER Avance 400 (400.13 MHz for the proton, 100.61 MHz for the carbon, ENSCR).

[0283] The chemical shifts are expressed in parts per million (ppm) with respect to the chemical shift of the deuterated solvent used as a reference. The multiplicity of signals is shown by using the following abbreviations: s, singlet; d, doublet; t, triplet; q, quadruplet; m, multiplet or massive that cannot be analysed. The coupling constants (J) are expressed in Hertz (Hz). The spectrometric data 13C is determined using fully decoupled spectra and heteronuclear 2D correlated spectra.

Mass Spectrometry

[0284] High resolution mass spectrometry MS/MS ZabSpec TOF Micromass (Centre Regional de Mesures Physiques de l′Ouest, Université de Rennes 1).

[0285] The ionisation mode used is positive electrospray (ESI+-MS). The ion acceleration voltage is 4 kV and the temperature of the source is equal to 60° C. (mode of introduction by infusion). The compounds are dissolved beforehand in methanol or in dimethylsulfoxide.

Abbreviations

[0286] AcOEt: ethyl acetate; [0287] DIEA: N,N′-diisopropylethylamine; [0288] Eb: boiling temperature; [0289] EP: petroleum ether; [0290] And: ethyl; [0291] EtOH: ethanol; [0292] HRMS: high resolution mass spectrometry; [0293] Me: methyl; [0294] MeOH: methanol; [0295] ppm: parts per million; [0296] NMR: nuclear magnetic resonance; [0297] TBTU: tetrafluoroborate of O-(benzotriazol-1-yl)-1,1,3,3-tetramethyluronium; [0298] TEMPO: 2,2,6,6-tetramethylpiperidine-1-oxyl; [0299] THF: tetrahydrofurane.

Synthesis of Carboxylic Acid Tri-Mannosylated Ligand (Comprising an Oligo(Propylene Glycol)N Spacer Where N = 2)

[0300]

Step 1: Benzylation of the Pentaerythritol Triallyl Ether

[0301] To a suspension of sodium hydride NaH (2.6 g, 90 mmol) in anhydrous DMF (100 mL), is added drop-by-drop the commercial pentaerythritol allyl ether (7.70 g; 300 mmol) purified beforehand by chromatography column on silica gel (eluent cyclohexane/ethyl acetate: 9/1, v/v). The medium is stirred 2 hours at 0° C. then benzyl bromide (7.7 g, 450 mmol) is added drop-by-drop at this temperature. The medium is left under stirring at ambient temperature for 17 hours then MeOH (6 mL) is added drop-by-drop at 0° C. The solvents are evaporated in the vacuum rotary evaporator then the vane pump. The yellowish residue is taken up in dichloromethane then is washed with water and by an aqueous solution saturated with NaCl. The organic phase is dried on MgSO4 and vacuum concentrated. The crude product is purified by chromatography on a column of silica gel (eluent: EP/AcOEt): 9/1, v/v) in order to provide the benzyl derivative (10.45 g) in the form of a colourless oil with a quantitative yield.

##STR00042##

NMR .sup.1H (CDCl3, 400 MHz) δ (ppm):

[0302] 3.50 (6H, s, H3), 3.56 (2H, s, H2), 3.95 (6H, dt, J = 5.3, 1.5 Hz, H4), 4.65 (2H, s, H1), 5.12 (3H, dq, J = 10.4, 1.7 Hz, H6a), 5.24 (3H, dq, J = 17.2, 1.7 Hz, H6b), 5.87 (3H, m, H5), 7.24-7.35 (7H, m, Har).

Step 2: Hydroboration-oxidation

[0303] The triallyl compound (10 g, 28.8 mmol) is dissolved in 50 mL of anhydrous dioxane. The 9-BBN (0.5 M in THF) (519 mL, 0.259 mol) is added to the reaction medium cooled beforehand to 0° C. and the mixture is stirred for 24 hours at ambient temperature. The sodium hydroxide 3 M (577 mL, 75 eq.) and the hydrogen peroxide 10 M (115 mL 1.15 mol) are added at 0° C. to the reaction medium and the mixture is stirred 12 hours at ambient temperature. The mixture is extracted 3 times with AcOEt then the organic phase is dried on MgSO4, filtered, concentrated under reduced pressure and purified by chromatography on silica gel (eluent AcOEt/EP/MeOH: 10/5/1) in order to give 9.57 g of triol in the form of a colourless oil with a yield of 83%.

##STR00043##

NMR .sup.1H (CDCl3, 400 MHz) δ (ppm):

[0304] 1.75 (6H, p, J = 5.5, 5.3 Hz, H5), 3.28 (3H, s.large, OH), 3.42 (6H, s, H3), 3.44 (2H, s, H2), 3.56 (6H, t, J = 5.5 Hz, H4), 3.70 (6H, t, J = 5.3 Hz, H6), 4.62 (2H, s, H1), 7.24-7.35 (7H, m, Har).

Step 3: Allylation of the Triol

[0305] The triol (7.8 g, 19.4 mmol) is dissolved in 100 mL of anhydrous DMF and is added drop-by-drop to the reaction medium containing potassium hydride (3.9 g, 97 mmol) in the DMF cooled beforehand to 0° C. The mixture is stirred 10 minutes at 0° C. before introducing drop-by-drop the allyl bromide (8.35 mL, 97 mmol). The stirring is prolonged 24 hours at ambient temperature and the excess potassium hydride is hydrolysed with 100 mL of distilled water. The reaction medium is extracted 3 times with diethyl ether then the organic phase is washed with a saturated aqueous solution of NaCl, dried on MgSO4, filtered, concentrated under reduced pressure and purified by chromatography on silica gel (eluent EP/AcOEt: 85/15) in order to give 8.63 g of the triallyl product in the form of a colourless oil with a yield of 78%.

##STR00044##

NMR .sup.1H (CDCl3, 400 MHz) δ (ppm):

[0306] 1.81 (6H, q, J = 6.4 Hz, H5), 3.40 (6H, s, H3), 3.44-3.50 (14 H, m, H2, H4, H6), 3.95 (6H, ddd, J = 5.7, 1.5, H7), 4.48 (2H, s, H1), 5.15 (3H, ddd, J = 10.3, 3.3, 1.5 Hz, H9b), 5.26 (3H, ddd, J = 17.3, 3.5, 1.5 Hz, H9a), 5.90 (3H, ddt, J = 10.3, 6.8, 5.7 Hz, H8), 7.24-7.35 (7H, m, Har).

Step 4: Hydroboration-oxidation

[0307] To a solution of the triallyl (7.9 g, 15 mmol) dissolved in 50 mL of anhydrous dioxane is added at 0° C. the 9-BBN (0.5 M in THF) (272 mL, 0.136 mol) and the mixture is stirred for 24 hours at ambient temperature. The sodium hydroxide 3 M (500 mL, 1.5 mol) and the aqueous hydrogen peroxide 35% (60 mL, 0.6 mol) are added at 0° C. to the reaction medium and the mixture is stirred 12 hours at ambient temperature. The mixture is extracted 3 times with AcOEt, dried on MgSO4, filtered, concentrated under reduced pressure and purified by chromatography on silica gel (eluent AcOEt/EP/MeOH: 10/5/1) in order to give 8.51 g of triol in the form of a colourless oil with a yield of 99%.

##STR00045##

NMR .sup.1H (CDCl3, 400 MHz) δ (ppm):

[0308] 1.79 (12 H, p, J = 5.7 Hz, H8, H5), 2.62 (3H, s.large, OH), 3.42 (6H, s, H3), 3.49-3.43 (14 H, m, H2, H4, H6), 3.55 (6H, t, J = 5.7 Hz, H7), 3.73 (6H, t, J = 5.4 Hz, H9), 4.64 (2H, s, H1), 7.24-7.35 (7H, m, Har).

Step 5: Glycosylation of the Triol

[0309] To a solution of trichloroacetimidate (10 g, 13.4 mmol) and of triol (1.03 g, 1.79 mmol) solubilised in 125 mL of anhydrous CH.sub.2Cl.sub.2 is added the solution at 5% in the CH2Cl2 of TMSOTf (640 .Math.L, 0.179 mmol) and the mixture is stirred 12 hours at ambient temperature. After having added 2 g of sodium bicarbonate to the reaction, the reaction medium is filtered, the precipitate is rinsed several times with CH.sub.2Cl.sub.2 and the filtrate is vacuum concentrated. The residue is purified by chromatography on silica gel (eluent EP/AcOEt: 6/4) in order to give 3.44 g of tri-mannosylated product in the form of a light yellow powder with a yield of 82%.

##STR00046##

NMR .sup.1H (CDCl3, 400 MHz) δ (ppm):

[0310] 1.77-1.84 (6H, m, J = 6.4 Hz, H5), 1.91-2.00 (6H, m, H8), 3.41-3.57 (26 H, m, H2, H3, H4, H6, H7), 3.57-3.68 (3H, m, H9b), 3.90-3.96 (3H, m, H9a), 4.40-4.50 (3H, m, H5′), 4.46-4.50 (5H, m, H1, H6b′), 5.08 (3H, d, J = 2.0 Hz, H1′), 5.70 (3H, dd, J = 3.2, 1.8 Hz, H2′), 5.91 (3H, dd, J = 10.1, 3.3 Hz, H3′), 6.11 (3H, t, J+10.1 Hz, H4′), 7.24-8.11 (65 H, m, Har).

Step 6: Debenzylation - Oxidation

[0311] To a solution of benzyl ether (3.44 g, 1.49 mmol) dissolved in 30 mL of a mixture CH.sub.2Cl.sub.2/MeOH (4/1) is added at ambient temperature the Pd/C (340 mg, 10% by weight). The reaction medium is stirred under a hydrogen atmosphere one night at ambient temperature. The medium is diluted with CH.sub.2Cl.sub.2, filtered on celite then vacuum concentrated. The compound is then purified by chromatography on silica gel (eluent Cyclohexane/AcOEt: 6/4) in order to give 2.61 g of alcohol in the form of a white powder with a yield of 79%.

##STR00047##

NMR .sup.1H (CDCl3, 400 MHz) δ (ppm):

[0312] 1.81 (6H, p, J = 6.4 Hz, H5), 1.93 (6H, p, J = 6.4 Hz, H8), 3.04 (1H, t, J = 6.1 Hz, OH), 3.43 (6H, s, H3), 3.47 (6H, t, J = 6.3 Hz, H6), 3.50 (6H, t, J = 6.5 Hz, H4), 3.55 (6H, m, H7), 3.68 (5H, m, H9a, H2), 3.91 (3H, dt, J = 9.7, 6.4 Hz, H9b), 4.39-4.43 (3H, m, H5′), 4.47 (3H, dd, J = 12.0, 4.2 Hz, H6a′), 4.68 (3H, dd, J = 12.0, 2.4 Hz, H6b′), 5.07 (3H, d, J = 1.7 Hz, H1′), 5.69 (3H, dd, J = 3.3, 1.7 Hz, H2′), 5.91 (3H, dd, J = 10.1, 3.3 Hz, H3′), 6.11 (3H, t, J = 10.1 Hz, H4′), 7.23-7.41 (20H, m, Har meta), 7.41-7.58 (20H, m, Har para), 7.82-8.08 (20H, m, Har ortho).

[0313] NMR .sup.13C (CDC13, 100 MHz) δ (ppm):

[0314] 29.69 (C8), 29.95 (C5), 44.81 (C3a), 62.84 (C6′), 65.56 (C9), 66.05 (C2), 66.94 (C4′), 67.37 (C7), 68.11 (C4), 68.67 (C6), 68.78 (C5′), 70.14 (C3′), 70.53 (C2′), 71.46 (C3), 97.61 (C1′), 128.28 (CHar meta), 128.42 (CHar meta), 128.56 (CHar meta), 128.99 (Cqar), 129.09 (Cqar), 129.35 (Cqar), 129.72 (CHar ortho), 129.78 (CHar ortho), 129.83 (CHar ortho), 129.87 (Cqar), 133.03 (CHar para), 133.14 (CHar para), 133.41 (CHar para), 165.39 (COPh), 165.44 (COPh), 165.49 (COPh), 166.13 (COPh).

[0315] To a solution of alcohol (614 mg, 0.275 mmol) dissolved in 10 mL of AcOEt, are added 56 .Math.L of an aqueous solution of KBr 0.5 M (0.028 mmol), the TEMPO (15 mg, 0.096 mmol), then at 0° C., 1.2 mL of NaOCl (0.84 mmol). After 3 hours at ambient temperature, the reaction is stopped and acidified with an aqueous solution of HCl at 5% (up to pH = 3), then 560 .Math.L of NaO.sub.2Cl (1.68 mmol) are added. The reaction medium is stirred for one night at ambient temperature (yellow colouration) then it is extracted three times with the AcOEt. The organic phase is washed with a saturated solution of NaCl, dried on MgSO4, filtered then vacuum concentrated in order to give 614 mg of carboxylic acid in the form of a white powder with a yield of 99%.

##STR00048##

NMR .sup.1H (CDCl3, 400 MHz) δ (ppm):

[0316] 1.83 (6H, p, J =, H5), 1.96 (6H, p, J = 6.2 Hz, H8), 3.51 (6H, t, J = 6.3 Hz, H6), 3.53 (6H, t, J = 6.1 Hz, H4), 3.56 (6H, m, H7), 3.64 (6H, s, H3), 3.66 (3H, td, J = 9.7, 6.4 Hz, H9b), 3.94 (3H, td, J = 9.7, 6.4 Hz, H9a), 4.47-4.41 (3H, m, H5′), 4.49 (3H. dd. J = 12.0. 4.2 Hz, H6b), 4.71 (3H, dd, J = 12.0, 2.4 Hz. H6a), 5.10 (3H, d, J = 1.7 Hz, H1′), 5.70 (3H, dd, J = 3.3, 1.7 Hz, H2′), 5.92 (3H, dd, J = 10.1, 3.3 Hz, H3′), 6.13 (3H, t, J = 10.0 Hz, H4′), 7.59-7.24 (36 H, m, Har), 8.11-7.82 (24 H, m, Har).

[0317] NMR .sup.13C (CDCl3, 100 MH.sub.z) δ (ppm):

[0318] 29.60 (C8), 29.77 (C5), 52.86 (C3a), 60.34 (C2) 62.79 (C6′), 65.46 (C9), 66.85 (C4′), 67.31 (C7), 67.87 (C6), 68.59 (C4), 68.73 (C5′), 69.07 (C3), 70.13 (C3′), 70.49 (C2′), 97.55 (C1′), 128.24 (CHar), 128.38 (CHar), 128.52 (CHar), 128.92 (Cqar), 129.00 (Cqar), 129.27 (Cqar), 129.68 (CHar), 129.73 (CHar), 129.78 (CHar), 133.02 (CHar), 133.12 (CHar), 133.37 (CHar), 133.39 (CHar), 165.39 (COPh), 165.42 (COPh), 165.50 (COPh), 166.15 (COPh), 173.45 (COOH).

Synthesis of the Tri-Mannosylated Lipid From Carboxylic Acid Diether and Carboxylic Acid Tri-Mannosylated Ligand (Oligo(Propylene Glycol)N Spacer Where N = 2 and a Polyethylene Glycol Spacer (PEG)M Where M = 5)

[0319]

Step 7: Introduction of the PEG Chain on the Carboxylic Acid Diether Lipid

[0320] To a mixture of the diether lipidcarboxylic acid (291 mg, 0.831 mmol) and TBTU (347 mg, 1.08 mmol) in anhydrous CH.sub.2Cl.sub.2 (15 mL), is added under an argon atmosphere the DIEA (188 .Math.L, 1.08 mmol). The mixture is stirred at ambient temperature for 20 minutes under a nitrogen atmosphere. A solution of N3-PEG350-NH.sub.2 (291 mg, 0.831 mmol) in anhydrous CH.sub.2Cl.sub.2 (5 mL) is added under a nitrogen atmosphere. The reaction medium is stirred at ambient temperature for 12 hours under a nitrogen atmosphere. An aqueous solution of hydrochloric acid 1N is added and the organic phase (pH = 1) is washed with water. The organic phases are grouped together, dried (MgSO.sub.4), filtered and concentrated under reduced pressure. The residue is purified by chromatography on silica gel (eluent CH.sub.2Cl.sub.2/MeOH: 98/2) in order to isolate the azide coupling product (700 mg, 89%) in the form of a colourless oil.

##STR00049##

NMR .sup.1H (CDCl3, 400 MHz) δ (ppm):

[0321] 0.83-0.87 (m, 18H, 6 CH.sub.3), 1.04-1.78 (m, 52H, 24 CH.sub.2, 4 CH), 3.37-3.40 (m, 2H, H-f), 3.41-3.50 (m, 4H, H-a, H-4), 3.53-3.57 (m, 4H, H-b, H-5), 3.58-3.69 (m, 23H, PEG, H-e, H-3α), 3.75-3.78 (m, 1H, H-3β), 3.88-3.90 (dd, J = 2.51, 5.92 Hz, 1H, H-2), 7.02-7.05 (m, 1H, NHCO).

[0322] NMR .sup.13C (CDCl3, 100 MHz) δ (ppm):

[0323] 14.10 (CH.sub.3), 19.58, 19.65, 19.72 (3 CH.sub.3), 22.60, 22.69 (2 CH.sub.3), 22.66, 24.36, 24.47, 24.78, 26.03 (5 CH.sub.2), 27.94, 29.84, 32.76, 32.78 (4 CH), 29.34, 29.46, 29.52, 29.63, 29.68, 31.89, 37.26, 37.36, 37.39, 37.45, 37.50, 39.32 (19 CH.sub.2), 38.67 (C-a), 50.63 (C-f), 69.72 (C-5), 69.83 (C-b), 70.3-70.7 (C-PEG, C-e), 71.47 (C-3), 71.68 (C-4), 80.48 (C-2), 170.57 (C-1).

Step 8: Reduction of the Azide Function

[0324] To a solution of azide (212 mg, 0.224 mmol) in a THF/H.sub.2O mixture (25 mL, 1/1) is added the triphenylphosphine (88 mg, 0.337 mmol) by portion. The mixture is stirred at ambient temperature for 18 h. After concentration under reduced pressure, the residue is purified on silica gel chromatography (CH.sub.2Cl.sub.2/MeOH: 9/1) in order to isolate the amine (164 mg, 80%) in the form of a light yellow oil.

##STR00050##

NMR .sup.1H (CDCl3, 400 MHz) δ (ppm):

[0325] 0.82-0.88 (m, 18H, 6 CH.sub.3), 0.99-1.69 (m, 52H, 24 CH.sub.2, 4 CH), 3.16-3.18 (m, 2H, H-f), 3.39-3.49 (m, 4H, H-a, H-4), 3.54-3.57 (m, 4H, H-b, H-5), 3.59-3.70 (m, 18H, PEG), 3.72-3.75 (m, 3H, H-c, H-3α), 3.76-3.77 (m, 1H, H-3β), 3.87-3.90 (m, 3H, H-2, H-e), 7.04-7.06 (m, 1H, NHCO).

[0326] NMR .sup.13C (CDCl3, 100 MHz) δ (ppm):

[0327] 14.10 (CH.sub.3), 19.58, 19.65, 19.72 (3 CH.sub.3), 22.61, 22.71 (2 CH.sub.3), 22.66, 24.34, 24.45, 24.76, 26.00 (5 CH.sub.2), 27.95, 29.77, 29.85, 32.79 (4 CH), 29.32, 29.45, 29.54, 20.61, 29.66, 31.88, 37.23, 37.34, 37.37, 37.43, 39.31 (19 CH.sub.2), 38.70 (C-a), 40.45 (C-f), 66.89 (C-e), 69.72-70.53 (C-PEG, C-5, C-b), 71.45 (C-3), 71.70 (C-4), 80.47 (C-2), 170.63 (C-1).

Step 9: Coupling Between the Carboxylic Acid Tri-mannosylated Ligand and the Amine lipid

[0328] To a mixture of the carboxylic acid tri-mannosylated ligand (575 mg, 0.257 mmol) and of TBTU (124 mg, 0.386 mmol) in anhydrous CH.sub.2Cl.sub.2 (70 mL), is added under an argon atmosphere the DIEA (112 .Math.L, 0.643 mmol). The mixture is stirred at ambient temperature for 20 minutes under a nitrogen atmosphere. A solution of the amide lipid (335 mg, 0.365 mmol) in anhydrous CH.sub.2Cl.sub.2 (50 mL) is added under a nitrogen atmosphere. The reaction medium is stirred at ambient temperature for 12 hours under a nitrogen atmosphere. An aqueous solution of hydrochloric acid 1N is added (pH = 1) and the organic phase is washed with water. The organic phases are grouped together, dried (MgSO.sub.4), filtered and concentrated under reduced pressure. The residue is purified by chromatography on silica gel (eluent Cyclohexane/AcOEt: 1:1 + 2% MeOH) in order to isolate the azide coupling product (500 mg, 62%) in the form of a translucent solid.

[0329] NMR .sup.1H (CDCl3, 400 MHz) δ (ppm):

[0330] 0.83-0.89 (m, 21H, CH.sub.3), 1-1.59 (m, 68H, alkyl chains), 1.79-1.86 (6H, q, H5), 1.93-1.99 (6H, q, H8), 3.40-3.68 (65H, m, H3, H4, H6, H7, H9b, Hia, Hj, Hl, HPEG), 3.75-3.78 (m, 1H, Ch)3.88-3.95(4H, m, H9a, Hib), 4.40-4.44 (3H, m, H5′), 4.48 (3H, dd, J = 4.1, 12.0 Hz, H6b′), 4.69 (3H, dd, J = 2.1, 12.1 Hz, H6a′), 5.09 (3H, d, J = 1.8 Hz, H1′), 5.69 (3H, dd, J = 1.6, 3.4 Hz, H2′), 5.91 (3H, dd, J = 3.2, 10.3 Hz, H3′), 6.11 (3H, t, J = 10.3 Hz, H4′), 7.24-8.11 (60H, m, Har).

[0331] NMR .sup.13C (CDCl3, 100 MHz) δ (ppm):

[0332] 14.12, 19.62, 19.68, 19.75, 22.63, 22.69 (CH.sub.3), 22.72-29.56 (CH.sub.2), 29.65 (C8), 29.70 (C5), 29.74, 29.84( C5), 29.91, 31.10, 31.43, 31.63, 31.92, 32.80, 53.03 (C3a), 60.40 (C2), 62.85 (C6′), 65.53 (C9), 66.91 (C4′), 67.36 (C7), 67.92 (C6), 68.61 (C4), 68.78 (C5′), 68.95 (C3), 70.15 (C3′), 70.55 (C2′), 80.53 (Ch), 97.64 (C1′), 128.30 (CHar), 128.44 (CHar), 128.57 (CHar), 129.00 (Cqar), 129.10 (Cqar), 129.35 (Cqar), 129.73 (CHar), 129.79 (CHar), 129.84 (CHar), 129.88 (CHar), 133.05 (CHar), 133.16 (CHar), 133.43 (COPh), 165.4 (COPh), 165.50 (COPh), 166.14 (COPh), 170.69 (CONH).

Step 10: Synthesis of the Tri-mannosylated Lipid by Deprotection of the Hydroxyls of The mannose moieties

[0333] To a solution of the tri-mannosylated lipid in benzoylated form (435 mg, 0.139 mmol) in a CH.sub.2Cl.sub.2/MeOH mixture (100 mL, 1/1) is added a solution of MeONa in the methanol (5.3 M, 48.8 .Math.L, 0.258 mmol) freshly prepared. The reaction medium is stirred for one night at ambient temperature. The mixture is neutralised thanks to the adding of Amberlite IR-120 H+ resin and the resin is filtered on cotton. After evaporation of the solvents under reduced pressure, a viscous light grey yellowish product is isolated (255 mg, 97%) corresponding to the target tri-mannosylated lipid. NMR .sup.1H (MeOD+CDCl3, 70/30, 400 MHz) δ (ppm):

[0334] 0.84-0.89 (m, 21H, CH3), 1.04-1.56 (m, 68H, alkyl chains), 1.79-1.84 (12H, m, H5, H8), 3.31-3.88 (88 H, m, H3, H4, H6, H7, H9, Hi, Hj, Hl, Ch, H3′, H4′, H5′, H6′, HPEG), 4.74 (3H, s, H1′), 7.55 (NH, s).

[0335] NMR .sup.13C (MeOD+CDCl3, 70/30, 100 MHz) δ (ppm):

[0336] 13.66, 19.26, 19.30, 19.33, 19.37, 19.40, 19.44, 22.22, 22.31, 22.50, 24.24, 24.31, 24.65, 25.92, 27.83, 29.21, 29.32, 29.39; 29.48, 29.50, 29.53, 29.64, 29.68, 29.72, 31.27, 31.78, 32.62, 32.64, 32.67, 36.59, 36.65, 36.72, 37.13, 37.23, 37.25, 37.30, 37.36, 37.39, 38.67, 38.95, 39.25, 52.25, 61.45, 64.22, 67.06, 67.52, 67.69, 68.41, 69.43, 69.48, 69.53, 69.61, 70.09, 70.11, 70.23, 70.33, 70.35, 70.37, 70.70, 71.11, 71.15, 71.33, 71.65, 72.56, 80.34, 80.29, 100.08 (C1′), 171.49 (CONH), 173.69 (CONH).

[0337] HRMS.sub.C194H1182N2O34: [M+Na]+: m/z theoretical = 1906.24662, measured = 1906.2448

Example 2: Preparation of Liposomes and of Lipopolyplexes (LPR) According to the Invention Comprising Tri-Mannosylated Lipids (LPR-triMN)

Lipids Used for the Preparation of the Various Liposomes

[0338] lipid KLN25 (O,O-dioleyl-N-[3N-(Nmethylimidazoliumbromide)propylene] phosphoramidate) of formula: described by Mével et al. (Mével et al., (2008) Synthesis and Transfection Activity of New Cationic Phosphoramidate Lipids: High efficiency of an Imidazolium derivative. ChemBioChem. 9, 1462-1471); [0339] lipid MM27 (O,O-dioleyl(-N-(histamine)phosphoramidate) of formula: described by Mevel et al., (Mével et al., (2008) Novel neutral imidazole-lipophosphoramides for transfection assays. Chem. Comm. 21:3124-3126); [0340] 1-O-carboxyl-2-O-Phytanyl-3-O-hexadecane-sn-glycerol (diether lipid having a carboxylic acid function) of formula: [0341] mono-mannosylated lipid (β-D-mannopyranosyl-N-dodecylhexadecanamide) of formula: described by Perche et al., (Perche et al., (2011) Selective gene delivery in dendritic cells with Mannosylated and Histidylated Lipopolyplexes. J Drug Targeting. 19: 315-325); [0342] lipid marked with fluorescein (Lip-Flu) of formula: described by Berchel et al., (Berchel et al., (2011) Modular Construction of Fluorescent Lipophosphoramidates by Click Chemistry. Eur. J. Org. Chem 31: 6294-6303); [0343] lipid marked with rhodamine (Lip-Rho) of formula: described by Berchel et al., (Berchel et al., (2011) Modular Construction of Fluorescent Lipophosphoramidates by Click Chemistry. Eur. J. Org. Chem 31: 6294-6303).

Liposomes

[0344] The liposomes are prepared according to the method of hydrating a dry lipid film and dialysed against a buffer HEPES 10 mM, pH 7.4 (Pichon C, Midoux P. (2013) Mannosylated and Histidylated LPR Technology for Vaccination with Tumor Antigen mRNA. Methods Mol Biol. 969:247-74).

[0345] The compositions of liposomes used are: [0346] bare liposomes: liposomes constituted of a mixture of KLN25 and MM27 lipids at 50%-50% in mole percent with respect to the total number of moles of lipids; [0347] diether liposomes or bare diether liposomes: liposomes constituted of a mixture of KLN25, MM27 lipids and of 1-O-carboxyl-2-O-Phytanyl-3-O-hexadecane-sn-glycerol (diether lipid) at 47.5% - 47.5% - 5% respectively; [0348] mono-mannosylated liposomes (MN): liposomes constituted of a mixture of KLN25, MM27 lipids and mono-mannosylated lipid (β-D-mannopyranosyl-N-dodecylhexadecanamide) at 47.5% - 47.5% - 5% respectively; [0349] mono-mannosylated diether liposomes: liposomes constituted of a mixture of KLN25, MM27 lipids, mono-mannosylated lipid and 1-O-carboxyl-2-O-Phytanyl-3-O-hexadecane-sn-glycerol (diether lipid) at 45% - 45% - 5% - 5% respectively; [0350] tri-mannosylated liposomes (triMN): liposomes constituted of a mixture of KLN25, MM27 lipids and tri-mannosylated lipids of the invention (of which the synthesis is described in the example 1) at 47.5% - 47.5% - 5% respectively.

[0351] The compositions of the fluorescent liposomes used are: [0352] bare-Flu liposomes: liposomes constituted of a mixture of KLN25, MM27 lipids and Lip-Flu at 49.75% - 49.75% - 0.5% respectively; [0353] bare-Rho liposomes: liposomes constituted of a mixture of KLN25, MM27 lipids and Lip-Rho at 49.75% - 49.75% - 0.5% respectively; [0354] diether-Flu liposomes: liposomes constituted of a mixture of KLN25, MM27 lipids, of 1-O-carboxyl-2-O-Phytanyl-3-O-hexadecane-sn-glycerol and Lip-Flu at 47.25% - 47.25% - 5 % - 0.5% respectively; [0355] diether-Rho liposomes: liposomes constituted of a mixture of KLN25, MM27 lipids, of 1-O-carboxyl-2-O-Phytanyl-3-O-hexadecane-sn-glycerol and Lip-Rho at 47.25% - 47.25% - 5 % - 0.5% respectively; [0356] Flu mono-mannosylated liposomes: liposomes constituted of a mixture of KLN25, MM27 lipids, mono-mannosylated lipid (β-D-mannopyranosyl-N-dodecylhexadecanamide) and Lip-Flu at 47.25% - 47.25% - 5% - 0.5% respectively; [0357] Rho mono-mannosylated liposomes: liposomes constituted of a mixture of KLN25, MM27 lipids, mono-mannosylated lipid and Lip-Rho at 47.25% -47.25% - 5% - 0.5% respectively; [0358] dietherFlu mono-mannosylated liposomes: liposomes constituted of a mixture of KLN25, MM27 lipids, mono-mannosylated lipid, of 1-O-carboxyl-2-O-Phytanyl-3-O-hexadecane-sn-glycerol and Lip-Flu at 44.75% - 44.75% - 5% -5% - 0.5% respectively; [0359] diether-Rho mono-mannosylated liposomes: liposomes constituted of a mixture of KLN25, MM27 lipids, mono-mannosylated lipid, of 1-O-carboxyl-2-O-Phytanyl-3-O-hexadecane-sn-glycerol and Lip-Rho at 44.75% - 44.75% - 5% -5% - 0.5% respectively; [0360] Flu tri-mannosylated liposomes: liposomes constituted of a mixture of KLN25, MM27 lipids, tri-mannosylated lipids of the invention (of which the synthesis is described in the example 1) and Lip-Flu at 47.25% - 47.25% - 5% - 0.5% respectively; [0361] Rho tri-mannosylated liposomes: liposomes constituted of a mixture of KLN25, MM27 lipids, tri-mannosylated lipids of the invention and Lip-Rho at 47.25% -47.25% - 5% - 0.5% respectively.

Cationic Polymer

[0362] The mRNA was complexed with the partially histidinylated polylysine comprising one molecule of PEG 5 kDa (PEG-HpK) of which the synthesis is described in (Pichon C, Midoux P. (2013) Mannosylated and Histidylated LPR Technology for Vaccination with Tumor Antigen mRNA. Methods Mol Biol. 969:247-74).

Lipopolyplexes (LPR)

[0363] The various LPR are prepared according to the method described in (Pichon C, Midoux P. (2013) Mannosylated and Histidylated LPR Technology for Vaccination with Tumor Antigen mRNA. Methods Mol Biol. 969:247-74).

[0364] In particular, for an in vitro transfection, the LPR are obtained in the following way. Briefly, 15 .Math.g of PEG-HpK (in 10 .Math.L of buffer 10 mM HEPES pH 7.4) are first added to the mRNA (5 .Math.g in 25 .Math.L of buffer 10 mM HEPES pH 7.4). The whole is vortexed for 4 sec then allowed to stand for 30 min at 20° C. The LPR are then formed by adding 10 .Math.g of liposomes (5 .Math.L to 5.4 mM in 10 mM HEPES buffer, pH 7.4) by stirring the solution via back-and-forth pipetting. The solution is allowed to stand for 15 minutes at 20° C. before use. For the in vitro transfection, the solution volume is adjusted to 1 ml with the medium without serum.

[0365] For an in vivo injection, the LPR are obtained by adding beforehand 50 .Math.l (50 .Math.g) of mRNA in a 1.5 ml Eppendorf tube containing 160 .Math.l of sterile buffer HEPES 10 mM at pH 7.4 prepared in water without endonuclease. 100 .Math.l (150 .Math.g) of the solution of PEG-HpK are then added and mixed 4 seconds. After 30 min at 20° C., 50 .Math.L of liposomes (100 .Math.g in sterile buffer HEPES 10 mM at pH 7.4 prepared in water without endonuclease) are added to the polymer/mRNA complex and gently mixed by pipetting. The solution is allowed to stand for 15 min at 20° C. For the in vivo injection, the solution is adjusted to a final concentration in saccharose of 5% by adding 40 .Math.l of a solution of saccharose at 50% prepared in water without endonuclease. The mice are injected with 100 .Math.l of solution.

[0366] Unless indicated otherwise, the lipopolyplexes (called LPR) used in the experiments described contain RNA control single strand PolyU (ssPolyU).

[0367] The various LPR (bare LPR, diether LPR or bare diether LPR, LPR-MN, LPR-MN diether, LPR-triMN) are obtained by mixing the corresponding liposomes (bare liposomes, diether liposomes or bare diether liposomes, liposomes MN, liposomes MN diether, liposomes triMN) with a cationic polymer (RNA complexed with the partially histidinylated polylysine and comprising one molecule of PEG 5 kDa).

Example 3: Biological Use of the Liposomes of the Invention

Material and Methods

Cell Lines

[0368] The cell line 293T is a cell line derived from transformed human embryonic kidney cells.

[0369] The cell line 293T DC-SIGN corresponds to genetically modified cells 293T to express DC-SIGN, a type C lectin.

[0370] MoDCs cells are human monocyte-derived dendritic cells.

[0371] PBMCs cells are mononuclear cells of the blood.

[0372] PanDCs cells are human dendritic cells identified within the other cells of the peripheral blood (PBMCs).

ELISpot Interferon-y

[0373] The secretion of interferon-y by the lymphocytes T coming from the spleen (spleen cells) is analysed using the kit IFN-γ ELISpot.sup.PLUS kit (Mabtech, Sweden). Briefly the spleen cells to be analysed are incubated in an ELISpot plate in the presence of the antigen E7.sub.49-57 or of concanavalin A (positive control) or of culture medium (negative control). The interferon-y secreted is captured by antibodies attached to the plate. After an incubation of 36 h at 37° C., the plate is washed and the cells are removed. The plate is then incubated with a biotinylated antibody directed against interferon-y then with the streptavidin coupled to the alkaline phosphatase. The presence of spots corresponding to a secretion of interferon-y is detected after incubation with the reaction buffer BCIP/NBT. The spots are analysed by an ELISpot plate reader.

qRT-PCR

[0374] The total RNA were extracted from samples of skin using the ReliPrep RNA Tissue Miniprep system kit (Z6112, Promega), by following the supplier’s instructions. The RNA were then retrotranscribed in cDNA using the GoScript Reverse Transcription system kit (A5000, Promega), by following the supplier’s instructions. The quantitative PCR reactions in real time SYBR green (qRT-PCR) were carried out on the iGenSeq platform (Hôpital de la Pitié-Salpêtrière, Paris, France) with the primers described in Table 1. The results were analysed with the 1536 Lightcycler software (Roche, Basel, Switzerland) and the expression of the genes was quantified by the relative method of ΔCT, standardised by the expression of the reference genes β-actin and GAPH.

TABLE-US-00001 Primers used for the reactions of RT-qPCR Gene Primer Sequence SEQ ID NO CCR7 Sense ACTCTCCATCCACCGAATTG 1 Antisense CCTCATGTCAACCTGACTGG 2 CXCR4 Sense TCCAGAATGTGTGGTAAATTGAA 3 Antisense TCGGAATGAAGAGATTATGCAG 4 IL1β Sense AGTTGACGGACCCCAAAAG 5 Antisense AGCTGGATGCTCTCATCAGG 6 MMP9 Sense CCAGAGGTAACCCACGTCAG 7 Antisense CTTCAAGTCGAATCTCCAGACA 8 PGE2R1 Sense TGGCTTCATATTCAAGAAACCAG 9 Antisense GGTACACGCGTGACTTTCG 10 β-actin Sense AAGTCCCTCACCCTCCCAAAAG 11 Antisense AAGCAATGCTGTCACCTTCCC 12 GAPDH Sense GTATTGGGCGCCTGGTCACC 13 Antisense CGCTCCTGGAAGATGGTGATGG 14

The LPR-triMN Target Cells That Express Receptors of the Lectin Type

[0375] In a first experiment, different cell lines were incubated with different concentrations of bare lipopolyplexes (LPR), of mono-mannosylated lipopolyplexes (LPR-MN) or of tri-mannosylated lipopolyplexes (LPR-triMN). The lipopolyplexes all comprise a fluorescent lipid coupled to the fluorescein. The cell lines tested express type C lectins on their surface, able to bind the sugar residues mannose, galactose or fucose. The binding of the lipopolyplexes on these receptors is analysed by flow cytometry. The tri-mannosylated lipopolyplexes target the cells 293T DCSign (FIG. 1A), the cells MoDCs (FIG. 1B), the cells PBMCs (FIG. 1C) and the cells panDCs among the PBMCs (FIG. 1D). To a lesser degree, the mono-mannosylated lipopolyplexes (LPR-MN) are also capable to bind these cells (FIG. 1). The bare lipopolyplexes do not comprise lipids having a mannose group and do not target any of these cells regardless of the concentration of lipopolyplexes tested (FIG. 1).

[0376] In a second experiment, three different cell lines were incubated with increasing concentrations of mono-mannosylated lipopolyplexes (LPR-MN), diether mono-mannosylated lipopolyplexes (LPR-MN diether) and tri-mannosylated lipopolyplexes (LPR-triMN). FIG. 2 shows that the LPR-MN and LPR-MN diether target in an identical way the dendritic cells of a murine line, the murine spleen cells and the cells MoDCs. The LPR-triMN are bound to these three types of cellules significantly more substantially, even at a low concentration (1.25 .Math.g/ml).

[0377] The presence of tri-mannosylated lipids of the invention therefore provides the LPR-triMN lipopolyplexes the capacity to bind to the cells expressing lectin type receptors. This property is specific to the tri-mannosylated lipopolyplexes of the invention, and lipopolyplexes comprising mono-mannosylated lipids (LPR-MN) or mono-mannosylated lipids and diether lipids (diether LPR-MN) have a reduced binding capacity.

The LPR-triMN Activate the Dendritic Cells

[0378] The dendritic cells MoDCs are placed in a culture in the presence of LPS or of increasing doses of LPR-MN or LPR-triMN comprising lipids marked with fluorescein for 6h. The analysis via cytometry makes it possible to identify the fluorescent cells MoDCs that have captured the LPR. Moreover the expression of the activation markers HLA-DR, CD80 and CD83 is also measured.

[0379] The fluorescent cells MoDCs that have captured the LPR-MN do not express activation markers significantly with respect to the activation control LPS (FIGS. 3A and 3B). The fluorescent cells MoDCs that have captured the LPR-triMN express the activation markers HLA-DR, CD80 and CD83 in a dose-dependent manner (FIG. 3A) and significantly with respect to the activation control LPS (FIG. 3B).

[0380] The presence of tri-mannosylated lipids of the invention therefore provides the LPR-triMN with the intrinsic property of activating the dendritic cells to which they are bound. The activated dendritic cells expressing co-stimulation molecules such as CD80 allow in turn for the activation of the lymphocytes T CD4+ and CD8+. The LPR-triMN are therefore capable of stimulating an immune response even though they do not contain any immunogenic molecule of interest.

The LPR-triMN Have an Adjuvant Effect

[0381] In a first step, the dendritic cells MoDCs ate placed in culture in the presence of LPR-MN containing mRNA GFP for 6 h. After these 6 h, the cells MoDCs are put into contact for an additional 12 h with either LPS (positive control of activation of MoDCs), or with LPR-MN or LPR-triMN. The lipopolyplexes used for this second stimulation do not contain encoding RNA but contain RNA single strand PolyU (ssPolyU). The expression of the GFP and of the activation markers HLA-DR, CD80 and CD83 is measured by cytometry after 18 h of culture in total.

[0382] FIG. 4 shows that the first incubation of the cells MoDCs with LPR-MN induces the expression of GFP. The secondary incubation of the same cells with LPS or with LPR-triMN ssPolyU causes the level of expression of the GFP (FIG. 4A) to drop and induces the expression of the activation markers CD80 (FIG. 4B), CD83 and HLA-DR (FIG. 4C). The adding of LPR-MN does not induce the activation of the dendritic cells, the latter continue to express the GFP in a prolonged manner.

[0383] The incubation of dendritic cells with LPR-triMN ssPolyU makes it possible to induce the activation of these cells. This experiment confirms that the LPR-triMN have an adjuvant effect provided by the presence of tri-mannosylated lipids.

The LPR-triMN Have an in Vivo Adjuvant Effect

[0384] In a first experiment, mice were intradermally injected with PBS, LPR-MN or LPR-triMN. FIG. 5A shows the injection of LPR-triMN induces a local inflammatory reaction on the site of the injection. The microscopic analysis of the site of injection (FIG. 5B) shows that the of LPR-triMN induces an augmentation in the volume of the inguinal draining lymph nodes.

[0385] In addition, analyses via qRT-PCR conduced on skin samples show a significant increase in the number of transcription products of genes CCR7 and CXCR4 (results not shown). These receptors are known to play a role in the migration of dendritic cells of the skin to the lymph nodes (Förster et al., (1999) CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs. Cell 99:23-33; Kabashima et al., (2007) CXCL12-CXCR4 Engagement Is Required for Migration of Cutaneous Dendritic Cells. Am J Pathol. 171:1249-57). The results of qRT-PCR also show an increase in the transcription of genes MMP9, IL1β and PGE2R1 (results not presented), that are involved in the inflammatory response.

[0386] In a second experiment, mice were intradermally injected on the foot arch with PBS, LPR-MN or LPR-triMN comprising a lipid marked with rhodamine. The popliteal draining lymph nodes of the mice were taken 6h after injection then marked with an antibody anti-CD169 (siglec-1). The analysis via fluorescence microscopy thus makes it possible to view the location of the LPR (rhodamine signal) and of the macrophages of the subcapsular sinus (signal CD169+). FIG. 6 shows that the bare LPR, LPR-MN and LPR-triMN, can be detected in the popliteal lymph nodes, on the cortical zone where dendritic cells (not marked) are also located. A portion of the LPR-triMN can also be detected in the unmarked zones by CD169 which indicated that other cells can capture the LPR-triMN. Note that dendritic cells are found in all of the lymph node zones.

[0387] Finally in a third experiment, mice were intradermally injected on the foot arch with PBS, bare LPR, bare diether LPR, LPR-MN or LPR-triMN. The popliteal lymph nodes of the mice were taken 24 h after injection. The presence in the popliteal draining lymph nodes of dendritic cells (DCs), and more particularly of activated dendritic cells expressing the marker Ly6C (Ly6C+ cells) or Ly6G (Ly6G+ cells), was analysed by flow cytometry. FIG. 7 shows that the injection of LPR-triMN induces not only a significant increase in the number and in the percentage of dendritic cells (FIGS. 7A and 7B) but also in the percentage of activated (FIG. 7C) and inflammatory (FIG. 7D) dendritic cells among the dendritic cells contained in the draining lymph nodes of the injected mice. The number of dendritic cells, activated or not, is not significantly modified after the injection of bare LPR, of bare diether LPR or of LPR-MN with respect to the control (PBS).

[0388] All of these experiments show that the LPR-triMN comprising the tri-mannosylated lipid of the invention can induce an immune response (recruiting and activation of the dendritic cells in the lymph nodes draining the injection site) when they are injected into mice. In these experiments, the LPR-triMN contain RNA single strand PolyU (ssPolyU) and are not used as a vector for the introduction of immunogenic molecules of interest. These experiments show that the lipopolyplexes triMN have an intrinsic in vivo adjuvant effect.

The LPR-triMN Induce a Better Specific T-lymphocyte Response in Vitro in Humans

[0389] Dendritic cells MoDCs coming from HLA-A2 donors were incubated for 24 h with bare LPR, LPR-MN or LPR-triMN containing mRNA of oncoprotein E7 of the virus HPV16 (mRNA E7) or the RNA non-encoding single strand PolyU (ssPolyU). The cells MoDCs where then used to sensitise T CD3+ autologous lymphocytes in co-culture for 3 days. After 3 days of co-culture the T lymphocytes were placed in a medium enriched with IL-7 and IL-15. At D7, the sensitised T lymphocytes were put back in the presence of MoDCs that were loaded beforehand with peptides E7 restricted to HLA-A2 (allele HLA2) for 16 h. Finally the exocytosis was inhibited for 4 h before conducting an intracellular marking of interferon-γ (INF-γ) analysed by cytometry. A detection of the expression of membrane markers CD3, CD4 and CD8 was also conducted.

[0390] FIG. 8 shows that the LPR-triMN that do not contained encoding RNA induce a secretion of INF-γ in the lymphocytes CD4+ (FIG. 8A) and the lymphocytes CD8+ (FIG. 8B) slightly greater than that induced by the bare LPR. This observation confirms the intrinsic adjuvant effect of the LPR-triMN. The LPR-triMN containing mRNA E7 are capable of inducing a secretion of INF-γ in lymphocytes CD4+ (FIG. 8A) and lymphocytes CD8+ (FIG. 8B) that is significant greater than that induced by the bare LPR or LPR-MN. The LPR-MN induce only a low secretion of INF-γ, whether they contain RNA ssPolyU or mRNA E7.

[0391] This experiment therefore shows that the LPR-triMN, used as a vector for the vaccination “anti-E7”, are capable of inducing a specific “anti-T7” reaction.

The LPR-triMN Induce a Better Immune Response in Vivo

[0392] Mice vaccination experiments were conducted with lipopolyplexes containing mRNA encoding oncoprotein E7 of the virus HPV16. These mice were vaccinated with an equimolar mixture of LPR-E7 and of LPR-E7-DC-LAMP which makes it possible to obtain a better response to the vaccination (Mockey et al. (2007) mRNA-based cancer vaccine: Prevention of B16 melanoma progression and metastasis by systemic injection of MART1 mRNA histidylated lipopolyplexes. Cancer Gene Therapy 14, 802-814). Indeed DC-LAMP is a glycoprotein of the membrane of the lysosomes and of the late endosomes, which play a role in the loading of peptides on CMH-II, making it possible to actively induce responses Th1. The use of a chimeric nucleic acid sequence (by fusion of the sequence encoding E7 and of the sequence encoding DC-LAMP) makes it possible to orient E7 to the path of the CMH-II and to improve the immune response.

[0393] LPR containing RNA non-encoding single strand polyU (ssPolyU) were used as a control. The injections were conducted at D0, D7 and D15. At D21 the mice were sacrificed and their spleens were taken. The spleen cells isolated as such were incubated in the presence of peptides E7 and their secretion of INF-γ was analysed by ELISpot. Various modes of vaccination were compared. Groups of 5 mice were thus vaccinated with 21 .Math.g of LPR-triMN-ssPolyU (control) intravenously or with LPR-triMN-E7/E7-DC-LAMP: 21 .Math.g intravenously, 7 .Math.g intradermally or 7 .Math.g subcutaneously. FIG. 9A shows that the intravenous or intradermal vaccinations induce a significant antigen-specific immune response E7 in the vaccinated mice. The intradermal path seems however more effective and more advantageous as it induces an immune response of intensity that is equivalent to that induced intravenously, but after injection of 7 .Math.g of LPR compared to 21 .Math.g intravenously.

[0394] Similar experiments have been conducted to compare the effect induced by the injection of different LPR. Mice were vaccinated at D0 and D2 with PBS (control) or different LPR (bare LPR, bare diether LPR, diether LPR-MN, LPR-triMN) containing mRNA E7. At D14 the mice were sacrificed and their spleens were taken. The spleen cells isolated as such were incubated in the presence of peptides E7 and their secretion of INF-γ was analysed via ELISpot. FIG. 9B shows that the LPR-triMN induce a specific T response that is significantly greater than that induced by the diether LPR-MN. The injection of bare LPR or of LPR diether (bare diether LPR) does not induce a specific T response that is significant with respect to the control (PBS).

[0395] Furthermore, the mannosylated LPR, although positively charged, do not accumulate in the lungs (results not presented).

[0396] The LPR-triMN are therefore effective vaccination vectors for the induction of a specific T response to an antigen of interest in the vaccinated subjects.

The LPR-triMN Have a Therapeutic Vaccine Effect in a Murine Model of HPV-induced cancer

[0397] The therapeutic effect of a vaccination with LPR-E7 was evaluated in groups of 5 mice to which were administered 50,000 cells of the syngeneic tumoural line TC-1 by intradermal injection in the ectopic position (left side). These tumour cells express oncoprotein E7.

[0398] The mice then received two intradermal injections (7 days and 9 days after the inoculation of the tumour cells) of PBS (negative control) or of 7 .Math.g of: LPR-MN-ssPolyU, LPR-MN-E7/E7-DC-LAMP, LPR-triMN-ssPolyU or LPR-triMN-E7/E7-DC-LAMP.

[0399] The tumoural growth was evaluated every 2 days by measuring with a calliper, according to the formula (L×l.sup.2)/2. Animals for which the tumoural volume becomes critical (>2000 mm.sup.2) were sacrificed.

[0400] FIG. 10A shows that after 4 months, 5 of the 9 mice vaccinated with LPR-triMN-E7/E7-DC-LAMP were still alive without having developed a tumour. After 4 months, 3 of the 10 mice vaccinated with LPR-triMN-ssPolyU, do not contain encoding mRNA, are also still alive without having developed a tumour. Their survival is apparently attributable to the adjuvant effect of the LPR-triMN that can indeed stimulate the immune response of vaccinated mice. After 4 months, 3 of the 9 mice vaccinated with LPR-MN-E7/E7-DC-LAMP are still alive without having developed a tumour. The injection of PBS or of LPR-MN-ssPolyU does not have any therapeutic effect. FIG. 10B makes it possible to compare the survival of the vaccinated mice with different LPR. The use of LPR-triMN for the vaccination compared to an antigen expressed by the tumour cells has a significant therapeutic effect and prevents the formation of tumours in more than half of the mice vaccinated.

[0401] In order to confirm the benefit of LPR-triMN as a therapeutic vaccine, two other tumoural models were tested: the model with melanoma B16F0 (expressing MART1), and the lymphoma model of the cells EG7 expressing OVA. The therapeutic effect of a vaccination with LPR-triMN was evaluated in groups of 10 mice who were administered cells of the tumoural line B16F0 or EG7 by intradermal injection in the ectopic position (left side). The mice were then vaccinated on days 7 and 9 post-injection with PBS, LPR-triMN comprising an RNA ssPolyU or an LPR-triMN comprising an mRNA of MART1 or of OVA respectively.

[0402] FIG. 11 shows that only the vaccination with LPR-triMN comprising an mRNA of MART1 or of OVA makes it possible to limit the growth of the tumours.

[0403] These results show the interest of LPR-triMN for cancer vaccination.