Treatment of SMC mediated disease

Abstract

Diagnosis, treatment and prophylaxis of diseases and conditions associated with smooth muscle cell (SMC) dysfunction are provided through the inhibition of IL-11-mediated signalling.

Claims

1. A method comprising administering an agent capable of inhibiting interleukin 11 (IL-11)-mediated signalling to a subject in need thereof, wherein the subject has a disease selected from the group consisting of: vascular aneurysm, Marfan's syndrome, aortic aneurysm, Furlong's syndrome, Sphrintzen-Goldberg syndrome, Loeys-Dietz syndrome, familial thoracic aortic aneurysm syndrome, arterial tortuosity syndrome, cerebral aneurysm, vascular stenosis and restenosis, fibromuscular dysplasia (FMD), supravalvular stenosis, renal artery stenosis, plexiform lesions, telangiectasia, achalasia, dysphagia, diarrhoea, constipation, inflammatory bowel disease (IBD), bowel stricture, pyloric stenosis, coeliac disease, irritable bowel syndrome, diverticulitis, ulcerative colitis, focal and segmental glomerulosclerosis (FSGS), IgA nephropathy, Hutchinson-Gilford Progeria Syndrome (HGPS), leiomyoma, leiomyosarcoma and non-airway/non-lung-related pathology of Hermansky-Pudlak Syndrome (HPS), wherein the disease comprises cells having a TGFβ1-mediated pathological secretory smooth muscle cell (SMC) phenotype, and wherein the agent is an anti-IL-11 antibody or an antigen-binding fragment thereof, or an anti-IL-11Rα antibody or an antigen-binding fragment thereof.

2. The method according to claim 1, wherein SMCs are secretory SMCs.

3. The method according to claim 1, wherein SMCs are vascular SMCs (VSMCs).

4. A method for inhibiting the activity of smooth muscle cells (SMCs) in a subject in need thereof comprising: (a) selecting a subject who has a disease comprising cells having a TGFβ1-mediated pathological secretory smooth muscle cell (SMC) phenotype, wherein the disease is selected from the group consisting of: vascular aneurysm, Marfan's syndrome, aortic aneurysm, Furlong's syndrome, Sphrintzen-Goldberg syndrome, Loeys-Dietz syndrome, familial thoracic aortic aneurysm syndrome, arterial tortuosity syndrome, cerebral aneurysm, vascular stenosis and restenosis, fibromuscular dysplasia (FMD), supravalvular stenosis, renal artery stenosis, plexiform lesions, telangiectasia, achalasia, dysphagia, diarrhoea, constipation, inflammatory bowel disease (IBD), bowel stricture, pyloric stenosis, coeliac disease, irritable bowel syndrome, diverticulitis, ulcerative colitis, focal and segmental glomerulosclerosis (FSGS), IgA nephropathy, Hutchinson-Gilford Progeria Syndrome (HGPS), leiomyoma, leiomyosarcoma and non-airway/non-lung-related pathology of Hermansky-Pudlak Syndrome (HPS); and (b) administering an agent capable of inhibiting interleukin 11 (IL-11)-mediated signalling to the subject, wherein the agent is an anti-IL-II antibody or an antigen-binding fragment thereof, or an anti-IL-11Rα antibody or an antigen-binding fragment thereof.

5. The method according to claim 4, wherein SMCs are secretory SMCs.

6. The method according to claim 4, wherein SMCs are vascular SMCs (VSMCs).

7. The method of claim 1, wherein the SMCs express collagen I.

8. The method of claim 4, wherein the SMCs express collagen I.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) Embodiments and experiments illustrating the principles of the invention will now be discussed with reference to the accompanying figures.

(2) FIG. 1. Bar chart showing RNA-seq of human VSMCs at baseline. The bars indicate the number of reads generated per sample (n=17). Close to 20 million total reads were generated per sample to analyse RNA expression on a genome-wide scale for primary VSMCs.

(3) FIG. 2. Graph showing the results of principal component analysis of transcript levels of RNA-seq data from primary human AB (n=6) and LIMA (n=11) derived VSMCs, atrial fibroblasts (FIB; n=84) and endothelial cells (EC; n=17).

(4) FIGS. 3A to 3D. Graphs showing RNA expression of (FIG. 3A) CD31 (EC marker), (FIG. 3B) THY-1 (Fibroblast marker), (FIG. 3C) elastin and (FIG. 3D) fibulin (VSMC markers), as determined by RNA-seq analysis [Mann-Whitney U test, 2-sided; Median, 10th-90th Percentile].

(5) FIG. 4. Representative microscopic images of primary human VSMCs, atrial fibroblasts and endothelial cells in culture. White bar represents 100 μm.

(6) FIG. 5. Bar chart showing RNA-seq of TGFβ1-stimulated human VSMCs. The bars indicate the number of reads generated per sample (n=14). Close to 20 million total reads were generated per sample to analyse RNA expression on a genome-wide scale.

(7) FIGS. 6A to 6D. Graphs and charts showing RNA expression signatures of unstimulated and TGFβ1-stimulated human VSMCs from AB and LIMA. (FIGS. 6A and 6B) MA plots showing DEseq263-corrected log 2 fold changes over the mean of normalized count in AB and LIMA respectively. (FIGS. 6C and 6D) graphical representation of all genes upregulated (FC>1) in response to TGFβ1-stimulation of AB and LIMA VSMCs, and their chromosomal genomic position. IL-11 is highlighted.

(8) FIG. 7. Bar chart showing TGFβ1-induced upregulation of IL-11 secretion by VSMCs. VSMCs were unstimulated, or were incubated with TGFβ 1 (5 ng/ml, 24 h) and the collected supernatant was analysed by ELISA to determine the level of IL-11 (n=3). Data expressed as mean±SD, P<0.01 by two-sided paired sample T-test.

(9) FIG. 8. Graph showing expression of IL-11 receptor (IL-11RA) and IL-6 receptor (IL-6R) in 500+ cell types. Large circles highlight IL-11 receptor expression by smooth muscle cells.

(10) FIG. 9. Graph showing that hyper IL-11 is not detected by ELISA for IL-11. Recombinant hyper ILl 1 was added to wells of an ELISA plate at varying concentrations and subsequently measured using a commercially available ELISA for the detection of IL-11.

(11) FIG. 10. Bar chart showing that Hyper IL-11 induces IL-11 secretion by VSMCs. VSMCs were incubated with increasing doses of hyper IL-11 and at the end of the experiment cell culture supernatant was analysed for IL-11 in 2 biological replicates. Data expressed as mean±SD, comparison by one-way ANOVA with Dunnett's multiple comparison. *=P<0.05.

(12) FIG. 11. Graph showing RNA expression signatures of unstimulated and IL-11-stimulated human VSMCs from AB and LIMA. The analysis is based on pooled biological replicates from the AB VSMCs (n=7) and LIMA VSMCs (n=11). MA plot demonstrates DEseq2-corrected log 2 fold changes over the mean of normalized count.

(13) FIGS. 12A to 12E. Graphs and photographs showing the effect of TGFβ 1 and IL-11 stimulation on the expression of markers of VSMC contractile and secretory phenotypes. VSMCs were unstimulated, or were cultured in the presence of TGFβ 1 (5 ng/ml, 24 h) or IL-11 (5 ng/ml, 24 h). Cells were analysed by fluorescence and automated quantification of images in 4 biological replicates. (FIG. 12A) Percentage of SM22α-positive cells. (FIG. 12B) Intensity of myocardin immunostaining. (FIG. 12C) Intensity of collagen I immunostaining. (FIG. 12D) Collagen I content of cell culture supernatant as determined using Sirius Red total collagen assay on 5 biological replicates. (FIG. 12E) Representative high resolution fluorescent images after TGFβ1 and IL-11 treatment of VSMCs. Immunostaining for nuclei (DAPI), Collagen 1 (Col 1) and F-actin (Rhodamine) indicate that both TGFβ1 and IL-11 activate the secretory VSMC phenotype with increased collagen expression. White bar represents 200 μm. All data expressed as mean±SD and statistical significance analysed with one-way ANOVA with Dunnett's multiple comparisons.

(14) FIGS. 13A and 13B. Photographs (FIG. 13A) and bar chart (FIG. 13B) showing the effects of IL-11 and TGFβ1 on the migration of VSMCs in an in vitro wound healing assay. Scratch wound assays were performed with confluent monolayers of VSMCs. After synchronizing the cells by culture low serum media (M231 containing 0.2% FBS) for 24 h, a linear scratch was created with a sterile pipette tip and cells were either untreated (Baseline), or treated with either IL-11 (5 ng/ml) or TGFβ1 (5 ng/ml) for 24 h. The wound area was imaged at 0 h (upper panels) and 24 h (lower panels), and migration was calculated using ImageJ software. All data expressed as mean±SD. Statistical significance was established with one-way ANOVA with Dunnett's multiple comparisons.

(15) FIGS. 14A and 14B. Photographs (FIG. 14A) and graph (FIG. 14B) showing the effects of IL-11 and TGFβ 1 on the migration of VSMCs in a Boyden chamber assay. VSMC migration towards wells containing unsupplemented cell culture medium (Baseline), or medium containing either IL-11 (5 ng/ml) or TGFβ1 (5 ng/ml) was analysed after 24 h. Symbols in the bar represents biological replicates.

(16) FIGS. 15A to 15C. Graphs showing the effect of neutralisation of IL-11-mediated signalling on TGFβ 1-mediated stimulation on the expression of markers of VSMC contractile and secretory phenotypes. VSMCs were unstimulated, or were cultured in the presence of TGFβ1 (5 ng/ml, 24 h) in the presence or absence of an IgG control antibody or neutralizing anti-IL-11 antibody (2 μg/ml). (FIG. 15A) Percentage of EdU-positive cells. (FIG. 15B) Intensity of collagen I immunostaining. (FIG. 15C) Collagen I content of cell culture supernatant as determined using Sirius Red total collagen assay on 5 biological replicates. All data expressed as mean±SD., statistical significance was determined by one-way ANOVA with Dunnett's multiple comparisons.

(17) FIGS. 16A and 16B. Photographs (FIG. 16A) and bar chart (FIG. 165) showing the effects of IL-11 and TGFβ 1 on the migration of VSMCs in an in vitro wound healing assay. Scratch wound assays were performed with confluent monolayers of VSMCs. After synchronizing the cells by culture low serum media (M231 containing 0.2% FBS) for 24 h, a linear scratch was created with a sterile pipette tip and cells were either untreated (Baseline), or treated with TGFβ1 (5 ng/ml) for 24 h, in the presence or absence of an IgG control antibody or neutralizing anti-IL-11 antibody (2 μg/ml). The wound area was imaged at 0 h (upper panels) and 24 h (lower panels), and migration was calculated using ImageJ software. All data expressed as mean±SD. Statistical significance was established with one-way ANOVA with Dunnett's multiple comparisons. Closed symbols represent IgG control treatment and open symbols indicate ant-IL11 antibody treatment. Symbols represents biological replicates. All data expressed as mean t SD. Statistical significance was determined with one-way ANOVA with Holm-Sidak multiple comparisons.

(18) FIG. 17. Micrographs of cryosections of colon from Col1a1-GFP reporter mice treated with IL-11 or PBS. Top row: representative images from PBS-treated mice (n=3). Bottom row: representative images from mice treated with recombinant mouse IL-11 (n=4). Left: Col1a1 and nuclear staining with DAPI. Middle: Immunofluorescence for αSMA, Col1a1 and nuclear staining with DAPI. Right: Images showing expression of αSMA; bars demonstrate increased thickness of the combined smooth muscle layers in the IL-11-treated animals. Scale bar=100 μm.

(19) FIGS. 18A to 18E. The effect of increased IL-11 expression on SMC pathology in the heart. Tamoxifen-induced Cre-mediated IL-11 overexpression in SMCs (SMRS) mice show elevated IL-11 protein expression in the heart (FIG. 18A) and increased heart weight to body weight (HW/BW) ratios (FIG. 18B) compared to SMWT controls. Heart tissue sections from SMRS mice stained with Masson's trichrome show perivascular fibrosis compared to SMWT controls (FIG. 18C). Ventricles of SMRS mice show elevated collagen expression compared to SMWT controls (FIG. 18D; **, *** denotes P<0.01 and P<0.0001 respectively). IL-11 overexpression causes elevated expression of ECM components and inflammatory genes in heart SMCs (FIG. 18E): left bars represent SMWT controls, right bars represent SMRS mice overexpressing IL-11. *, **, *** denotes P<0.05, P<0.01, and P<0.001 respectively.

(20) FIGS. 19A to 19D. Graphs showing the effect of increased IL-11 expression on heart size and function. SMRS mice have a lower body weight (FIG. 19A) and left ventricular (LV) mass (FIG. 19B) compared to SMWT controls, but show increased LV mass ratio when corrected for body weights (FIG. 19C). Left atrium (LA) diameter is increased in SMRS mice compared to controls (FIG. 19D). *, **, ***, **** denote P<0.05, P<0.01, p<0.001 and P<0.0001 respectively.

(21) FIGS. 20A to 20C. Graphs showing that anterior wall thickness (FIG. 20A), LV internal diameter (FIG. 20B) and posterior LV wall thickness (FIG. 20C) at end-diastole are increased in SMRS mice compared to SMWT controls. *, **, ***, **** denote P<0.05, P<0.01, p<0.001 and P<0.0001 respectively.

(22) FIGS. 21A to 21D. Graphs showing that anterior wall thickness (FIG. 21A), LV internal diameter (FIG. 21B) and posterior LV wall thickness (FIG. 21C) at end-systole are increased in SMRS mice compared to SMWT controls. The ejection fraction is conserved in SMRS mice (FIG. 21D). *, **, ***, **** denote P<0.05, P<0.01, p<0.001 and P<0.0001 respectively.

(23) FIGS. 22A to 22E. IL-11 expression in aortic SMC remodelling. IL-11 protein expression is increased in the proximal thoracic aorta of SMRS mice compared to SMWT controls (FIG. 22A). Aortic root internal diameter as measured at end-diastole (FIG. 22B) and end-systole (FIG. 22C) with correction for body weight is greater in SMRS mice compared to SMWT controls. Ascending aorta internal diameter at end-systole with correction for body weight is greater in SMRS mice compared to SMWT controls (FIG. 22D). SMRS mice have preserved aortic peak flow velocity as compared to controls (FIG. 22E). **, **** denote P<0.05 and P<0.0001 respectively.

(24) FIGS. 23A to 23D. The effect of increased IL-11 expression on SMC pathology in the lung. SMRS mice show elevated IL-11 protein expression in the lungs (FIG. 23A), increased lung to body weight ratios (FIG. 23B) and elevated collagen expression in the lungs when corrected for lung-to-body-weight (LW/BW) ratio (FIG. 23C) compared to SMWT controls. FIG. 23D shows that SMRS mice lungs show increased lung fibrosis and infiltrating cell infiltrates compared to SMWT controls in two representative examples.

(25) FIG. 24. Graph showing that SMRS mice have elevated expression of extracellular matrix and inflammatory genes in the lungs. Left bars represent SMWT controls, right bars represent SMRS mice overexpressing IL-11. **, *** denote P<0.01, and P<0.001 respectively.

(26) FIGS. 25A to 25C. The effect of increased IL-11 expression on SMC pathology in the liver. SMRS mice show elevated IL-11 protein expression in the liver (FIG. 25A), unchanged liver to body weight ratios (FIG. 25B) and elevated collagen expression in livers (FIG. 25C) compared to SMWT controls. * denotes P<0.05.

(27) FIG. 26. Graph showing that SMRS mice have elevated expression of extracellular matrix and inflammatory genes in the liver. Left bars represent SMWT controls, right bars represent SMRS mice overexpressing IL-11 in SMCs. *, *** denote P<0.05, and P<0.001 respectively.

(28) FIGS. 27A to 27C. The effect of increased IL-11 expression on SMC pathology in the kidney. SMRS mice show elevated IL-11 protein expression in the kidney (FIG. 27A), increased kidney-to-body weight ratios (FIG. 27B) and demonstrate a trend towards elevated collagen expression in kidneys (FIG. 27C) compared to controls. * denotes P<0.05.

(29) FIG. 28. Graph showing that SMRS mice have elevated expression of extracellular matrix and inflammatory genes in the kidney. Left bars represent SMWT controls, right bars represent SMRS mice overexpressing IL-11 in SMCs. *, **, *** denote P<0.05, P<0.01 and P<0.001 respectively.

(30) FIGS. 29A to 29C. The effect of increased IL-11 expression on SMC pathology in inflammatory bowel disorders. SMRS mice present red and swollen rectums (arrows) when IL-11 is induced with tamoxifen (Tam) compared to administration with corn oil control vehicle (Veh) or control SMWT mice with either treatment (FIG. 29A). SMRS mice produce softer and paler stools after Tam induction compared to SMWT controls (FIG. 29B). Calprotectin (S100A8/A9) levels are elevated in stool samples of SMRS mice compared to SMWT controls (FIG. 29C).

(31) FIGS. 30A to 30C. The effect of increased IL-11 expression on SMC pathology in the gastro-intestinal tract. The gastro-intestinal tract from SMRS mice demonstrates redness and swelling compared to SMWT controls (FIG. 30A). SMRS mice show elevated IL-11 expression in the colon compared to SMWT controls (FIG. 30B). Representative sections of the colon and small intestine from SMRS mice stained with Masson's trichrome demonstrate greater wall thickness and intestinal fibrosis compared to SMWT controls (FIG. 30C).

(32) FIG. 31. Graph showing that SMRS mice have elevated expression of extracellular matrix and inflammatory genes in the colon. Left bars represent SMWT controls, right bars represent SMRS mice overexpressing IL-11 in SMCs. *, **, *** denote P<0.05, P<0.01 and P<0.001 respectively.

(33) FIGS. 32A to 32D. IL-11 is upregulated in heart, lung and aorta tissues of mice with Marfan's Syndrome (MFS; FIG. 32A). FIGS. 32B to 32D depict densitometry assessment of IL-11 expression as compared to GAPDH expression in heart, lung, and aorta of MFS mice, respectively.

(34) FIGS. 33A to 33D. Thoracic aortic constriction (TAC)-induced aortic remodelling is reduced by inhibiting IL-11-mediated signalling using anti-IL11RA antibodies. FIGS. 33A and 33B show aortic root internal dimension at end-systole and end-diastole for sham controls without TAC, and post-TAC mice after treatment with anti-IL11, anti-IL11Rα or IgG control antibodies. FIGS. 33C and 33D show aortic arch peak velocity and pressure gradient, respectively. *, **, *** denote P<0.05, P<0.01 and P<0.001 respectively.

(35) FIG. 34. Representative sections of proximal thoracic aorta were stained with Masson's trichrome (n=5/group), showing that TAC-induced aortic remodelling is ameliorated with neutralizing IL-11 and IL-11Rα antibodies, see arrows. Scale bar represents 100 μm.

(36) FIGS. 35A and 35B. Representative images (FIG. 35A) and cumulative plots (FIG. 35B) show migration of VSMCs from mice treated with recombinant mouse IL-11 (5 ng/ml) and recombinant mouse TGFβ1 (5 ng/ml) with and without anti-IL11 antibody (2 μg/ml) or equivalent concentration of IgG isotype control for 0 h (upper panels) or 24 h (lower panels). Scale bar represents 200 μm.*, ** denotes P<0.05, P<0.01 respectively.

(37) FIGS. 36A and 36B. Representative images (FIG. 36A) and cumulative plots (FIG. 36B) show wild-type (WT) and IL11ra1-ablated (KO) mice treated with no stimulants, angiotensin II (ANGII, 100 μM), recombinant mouse TGFβ1 (5 ng/ml), and recombinant mouse IL-11 (5 ng/ml) for 0 h (upper panels) and 48 h (lower panels). Scale bar represents 200 μm. *, **, ***, **** denote P<0.05, P<0.01, P<0.001 and P<0.0001 respectively.

EXAMPLES

(38) In the following Examples, the inventors demonstrate that IL-11 gene and protein expression is upregulated in SMCs in response to treatment with TGFβ1, that IL-11 stimulation of SMCs causes production of IL-11 in an autocrine loop, that stimulation of SMCs with either of TGFβ1 or IL-11 decreases expression of the normal, contractile SMC phenotype and upregulates expression of markers of the pathological secretory SMC phenotype, and that inhibition of IL-11-mediated signalling with neutralising anti-IL-11 antibody abrogates the effects of TGFβ1 stimulation on SMC phenotype/activity.

(39) SMC phenotype can switch between physiological contractile/relaxation phenotype and a pathological proliferative/hyperplastic/matrix-synthesizing state.sup.3. The latter pathological phenotype is implicated in several diseases which are often associated with increased TGFβ1-signalling, as well as activation of other pathways.

(40) TGFβ1 and its receptors have been suggested as therapeutic targets for SMC related diseases, but their inhibition is associated with severe side effects.sup.59,60. The inventors sought to identify targetable factors downstream of TGFβ1 that are necessary for the effects of TGFβ1-signalling in SMCs. A systematic integrative target discovery platform was employed to identify a robust signature of the effects of TGFβ1 effect in SMCs, using primary human vascular SMCs (VSMCs) obtained from several individuals.

Example 1: Patient Cohort and VSMC Preparation

(41) Patients aged ≥21 and ≤81 undergoing coronary artery bypass grafting (CABG) at the National Heart Centre Singapore were recruited to the study. Patients with valvular heart disease or previous atrial intervention were excluded. The aortic button (AB) and left internal mammary artery (LIMA) tissues were harvested and samples used to outgrow primary vascular smooth muscle cells (VSMCs) by explant-culture method. Biopsies of the aortic button and/or left internal mammary artery were obtained from 15 patients (AB: n=6; LIMA: n=11) undergoing CABG. VSMCs were then prepared from these samples as follows.

(42) AB and LIMA biopsies were collected from CABG patients at the time of open chest surgery. The tunica adventitial layer was removed and the endothelium was gently scraped with forceps, tunica media layer was minced into 1-2 mm.sup.3 pieces, and placed in 6 cm dishes. The spacing between adjacent tissues was around 5 mm. Human VSMCs were cultured in vitro in M231 medium (M-231-500, Life Technologies) supplemented with smooth muscle growth supplement (SMGS; S-007-25, Life Technologies) and 1% antibiotic-antimycotic (15240062, Life Technologies), in a humidified atmosphere at 37° C. and 95% air/5% CO.sub.2. Cell culture medium was changed with fresh medium every 2-3 days to remove cell debris and to maintain a physiological pH. At 80-90% confluence, cells were passaged by detachment with accutase (A6964, Sigma-Aldrich) using standard cell dissociation techniques. At passage 1-2, fibroblasts and endothelial cells were depleted from the cell cultures by magnetic separation with LD columns (130-042-901, Miltenyi Biotec) using micro-beads tagged with either CD90 (Thy-1, 130-096-253, Miltenyi Biotec) for fibroblast depletion, and CD144 (VE-Cadherin, 130-097-857, Miltenyi Biotec) for endothelial cell depletion. The negatively selected VSMCs remaining in the culture were used in further passaging. All experiments were carried out at low cell passages (SP4) and cells were synchronised in serum-starved with 0.2% fetal bovine serum (10500064, Life Technologies) in M231 basal media for 16 h prior to treatment in serum-free M231 medium.

(43) Molecular and cellular phenotyping was performed to characterize the VSMC transition driven by TGFβ1-stimulation, and the results were integrated with large databases of gene expression in human tissues (GTEx61) and cell types (FANTOM62).

Example 2: RNA-Seq Analysis

(44) RNA-seq analysis was performed on different cell types as follows.

(45) Total RNA was isolated using Trizol Plus RNA mini kit (12183555, Life Technologies). RNA was quantified using Qubit RNA high sensitivity assay kit (Life Technologies) and assessed for degradation based on RNA integrity number (RIN) using the LabChip GX RNA Assay Reagent Kit (Perkin Elmer). TruSeq Stranded mRNA Library Prep kit (Illumina) was used to assess transcript abundance following standard instructions from the manufacturer. Briefly, poly(A)+ RNA was purified from 0.8-1 ug of total RNA with RIN>7, fragmented, and used for cDNA synthesis, followed by 3′ adenylation, adaptor ligation, and PCR amplification. The final libraries were quantified using KAPA library quantification kits (KAPA Biosystems) on StepOnePlus Real-Time PCR system (Applied Biosystems) according to manufacturer's guide. The quality and average fragment size of the final libraries were determined using LabChip GX DNA High Sensitivity Reagent Kit (Perkin Elmer). Libraries were pooled and sequenced on a NextSeq 500 benchtop sequencer using 75-bp paired-end sequencing chemistry.

(46) Raw sequencing data (.bcl files) were demultiplexed into individual FastQ read files with Illumina's bcl2fastq v2.16.0.10 based on unique index pairs. The adaptor sequences and low quality reads/bases were trimmed using Trimmomatic v0.36.sup.6 and the read quality was assessed using FastQC v0.11.5. High-quality reads were mapped to Ensembl human GRCh38 v86 ref or mouse GRCm38 v86 reference genome using Spliced Transcripts Alignment to a Reference (STAR) v2.5.2b.sup.7. STAR alignment options were selected based on parameters used in ENCODE project. Strand-specific raw counts of uniquely mapped reads (paired-end) were summarized with featureCounts.sup.8 to get gene-level quantification of genomic features: featureCounts -t exon -g gene_id -s 2-p. Differential expression (DE) was performed with DESeq2 v1.14.1 by using raw read counts from featureCounts. We performed a minimal pre-filtering to remove genes that have no reads or only 1 read across all samples to reduce the data size and speed up the analysis process. Sample IDs were included as covariates in DESeq2 design formula to remove batch effect due to samples and increase the sensitivity for finding differences among the conditions. Basal condition was always used as the reference level for pairwise comparison. Shrinkage MA-plot was generated to show the log 2 fold changes over the mean of normalized counts and points will be colored red if adjusted p value was less than 0.1.

(47) Primary human VSMCs were sequenced to a depth of ˜20M reads per sample. The vast majority of reads mapped to a unique position of the genome. Uniquely aligning reads were counted to assess the expression level of all annotated genes (FIG. 1).

Example 3: Validation of VSMC Culture Purity

(48) To ensure the purity of the VSMC culture, Principal Component Analysis (PCA) was performed in which the RNA-seq data obtained for VSMC cultures (not stimulated with TGFβ1) was compared with RNA-seq data generated from primary cardiac fibroblasts (FIB) and human umbilical vein endothelial cells (EC).

(49) Primary human fibroblasts were obtained using the explant method with atrial biopsies from the right atrium of patients (n=84) undergoing CABG procedure. Human cardiac fibroblasts (FIB) were prepared as follows: right atrial biopsies were weighed, minced into 1-2 mm.sup.3 pieces, and placed in 6 cm dishes. Human FIBs were grown and maintained in DMEM (Life technologies) supplemented with 20% fetal bovine serum (FBS, Hyclone) and 1% penicillin/streptomycin (Gibco), in a humidified atmosphere at 37° C. and 5% CO.sub.2. Fresh medium was renewed every 2-3 days. At 80-90% confluence, cells were passaged using standard trypsinization techniques. All experiments were carried out at low cell passage (<P4) and cells were cultured in serum-free DMEM media for 16 h prior to treatment.

(50) Human umbilical vein endothelial cells (EC) were sourced from Lonza (CC-2519). ECs were grown and maintained in 10 cm dishes with EGM-2 Bullet Kit medium (Lonza, CC-3162), in a humidified atmosphere at 37° C. and 5% CO.sub.2. Fresh medium was renewed every 2-3 days. At 80-90% confluence, cells were passaged using standard trypsinization techniques. All experiments were carried out at low cell passage (<P4) and cells were cultured in serum-free EBM-2 basal media for 16 h prior to treatment. The results of the principal component analysis are shown in FIG. 2. Cell types were found to cluster into distinct groups, demonstrating that ensuring that AB and LIMA VSMC cultures were not ECs or FIBs. The analysis also showed that VSMCs derived from AB or LIMA are dissimilar.

(51) Analysis of RNA expression levels of marker genes for ECs, FIBs and VSMCs also confirmed the results of the PCA: CD31, an endothelial cell marker gene, was highly expressed in the ECs, but not in VSMCs or FIB cultures. This further confirmed that ECs were not present in the VSMC cultures. VSMCs also express lower levels of THY-1, a fibroblast marker, and higher levels of the vascular smooth muscle markers ELN and FBLN as compared to the other cell types (FIGS. 3A to 3D).

(52) FIG. 4 moreover demonstrates morphological differences between ECs, fibroblasts and VSMCs as determined by microscopy. Taken together, FIGS. 2, 3 and 4 demonstrate that the following studies were obtained using pure cultures of primary human VSMCs.

Example 4: RNA-Seq Analysis of Changes in RNA Expression Associated with TGFβ1 Signalling

(53) RNA-seq analysis was performed on both baseline and TGFβ1 stimulated VSMCs from the AB and LIMA at early passages 3-4 to assess genome-wide changes in RNA expression in response to TGFβ1 signalling. VSMCs were stimulated with TGFβ1 (5 ng/ml; 24 hours) and performed RNA-seq analysis was performed as described in Example 2 (FIG. 5).

(54) RNA transcript levels were then compared between TGFβ1-stimulated and unstimulated VSMCs to identify genes that had their expression upregulated by stimulation with TGFβ1. Uniquely aligning reads were counted for each gene locus and differential expression was detected using the DEseq2.sup.63 package.

(55) The results of the analysis are shown in FIG. 6. IL-11 was found to be upregulated significantly in VSMCs derived from AB and LIMA in response to TGFβ1 stimulation (FC 4.39 and FC 3.16 respectively; adjusted P-values=1.69.sup.e-11 and 4.55.sup.e-07 respectively). This highly significant upregulation of IL-11 in both AB and LIMA derived VSMCs confirmed that TGFβ 1 upregulates IL-11 at the RNA level across different types of VSMCs and in several individuals.

(56) The inventors then confirmed that this robust signature of IL-11 upregulation also occurred at the protein level by performing ELISA analysis on cell culture supernatant obtained from unstimulated VSMCs, and VSMCs stimulated with TGFβ1 (5 ng/ml, 24 h), for 3 replicates. A 39-fold increase in IL-11 was detected in the cell culture supernatant of VSMCs stimulated with TGFβ1 (FIG. 7). The fact that the increase in secreted IL-11 induced by stimulation with TGFβ1 was larger than the increase in IL-11 RNA levels (compare FIGS. 6C and 6D with FIG. 7) suggests that TGFβ1 may influence IL-11 levels through post-transcriptional regulation.

Example 5: Analysis of Targets for IL-11

(57) To explore whether IL-11 secreted by VMSCs in response to stimulation with TGFβ1 acts on VMSCs or only signals to other cell types in the proximity, expression of IL-11 receptor α (IL-11RA) was analysed across 500+ cell lines in the PHANTOM.sup.62 catalogue.

(58) Expression levels of all genes in primary cell types with replicates were downloaded from FANTOM5.sup.62 web resource (119 cell types). Since the FANTOM5 data is at the level of transcription start site (TSS) expression derived from CAGE sequencing gene expression was calculated by summing all counts that were assigned to a given gene. These were then normalised by library size in order to calculate the TPM for each gene. In order to compare the expression profiles of IL-11RA and IL-6R the TPM for these two genes were extracted across different primary cell samples that covered cell types from all lineages. In each case, where the expression of either IL-11RA or IL-6R was above the level of noise these cell types were highlighted and categorized them as described in the FANTOM5 cell type ontology.

(59) The results are shown in FIG. 8. It was found that cells tended to express either the IL-11 receptor or the IL-6 receptor, but rarely both together. IL-6 receptor expression was mostly on immune cells, whereas IL-11 receptor expression was detected mesenchymal lineage and smooth muscle cells (highlighted in FIG. 8).

Example 6: Production of IL-11 by VSMCs in Response to Stimulation with IL-11

(60) Several smooth muscle cell lines express IL-11 receptor, implying that IL-11 is not only secreted, but also has a direct effect on VSMCs. This suggests the possibility for an autocrine IL-11 loop, if IL-11 induces its own expression on VSMCs. To test this hypothesis, an IL-11:IL-11RA fusion protein referred to as hyper IL-11.sup.64 was prepared by recombinant DNA and protein expression techniques. Hyper IL-11 was constructed using fragment of IL-11 RA (amino acid residues 1 to 317 consisting of domain 1 to 3; UniProtKB: 014626) and IL-11 (amino acid residues 22 to 199 of UniProtKB: P20809) with a 20 amino acid long linker (SEQ ID NO:5). The amino acid sequence for Hyper IL-11 is shown in SEQ ID NO:4.

(61) Hyper IL-11 is a powerful stimulator of IL-11 signalling, similar to the IL-6:IL-6R fusion protein described in Lokau et al., Cell Reports (2016) 14, 1761-1773. The inventors confirmed that the ELISA used for the detection of soluble secreted IL-11 does not recognize hyper IL-11 (FIG. 9). Briefly, IL-11 levels in equal volumes of cell culture media were added to wells of an ELISA plate, and IL-11 was quantified using the Human IL-11 Quantikine ELISA kit (D1100, R&D Systems) as per manufacturer's protocol.

(62) The inventors then used the same ELISA kit to analyse IL-11 secretion into the cell culture medium of VSMCs stimulated with hyper IL-11. Briefly, VSMCs were cultured in the presence of 0.2, 0.5, and 1 ng/ml, hyper IL-11 for 24 h, and the cell culture supernatant was subsequently analysed for IL-11 using the Human IL-11 Quantikine ELISA kit. In this way, the inventors were able to determine whether IL-11-mediated signalling in VSMCs (triggered by hyper IL-11) results in the production of IL-11 by VSMCs in an autocrine fashion.

(63) The results are shown in FIG. 10. Hyper IL-11 was found to induce secretion of IL-11 by VSMCs, in a dose-dependent manner.

Example 7: Effect of IL-11 Stimulation on Gene Expression by VSMCs

(64) The inventors next analysed the effects of IL-11 stimulation on RNA expression by VSMCs. Human AB and LIMA VSMCs were cultured for 24 h in the presence of 5 ng/ml recombinant human interleukin-11 (IL-11; PHC0115, Life Technologies), and RNA seq analysis was then performed as described in Example 2.

(65) The results are shown in FIG. 11. IL-11 was found not to induce a strong transcriptional response in VSMCs. Moreover, stimulation with IL-11 did not strongly upregulate expression or IL-11 RNA, suggesting that increased IL-11 protein expression in response to treatment with IL-11 (FIG. 10) is achieved through post-transcriptional regulation.

Example 8: Effect of IL-11 Treatment on VSMC Phenotype

(66) The inventors then further explored the effect of IL-11 on VSMCs phenotype and activity by analysis for markers of the different SMC phenotypes using the Operetta platform.

(67) VSMCs were seeded in 96-well black CellCarrier plates (Perkin-Elmer) at a density of 1×10.sup.4 cells/well and incubated in media for 24 h. Cells were then cultured without stimulation, or stimulated by culture for 24 h with TGFβ1 (5 ng/ml), IL-11 (5 ng/ml). Cells were subsequently rinsed in phosphate-buffered saline (PBS) and fixed in 4% paraformaldehyde (28908, Life Technologies) for 15 m. Cells were permeabilized with 0.1% Triton X-100 (Sigma-Aldrich) in PBS for 10 m, and rinsed in PBS and wash buffer (0.25% BSA and 0.1% Tween-20 in PBS). Non-specific sites were blocked using wash buffer with addition of 0.25% BSA (blocking solution; 30 m). Cells were incubated overnight at 4° C. with antibodies: transgelin (SM22α, 1:200; AB14106, Abcam), collagen I (Col1, 1:500; AB292, Abcam), myocardin (MYOCD, 1:200; AB203614, Abcam). All primary antibodies were diluted in blocking solution. Following wash buffer rinses, cells were incubated with goat anti-mouse (AB150113, Abcam) or anti-rabbit (AB150077, Abcam) AF488 for 1 h at room temperature (RT) in the dark. Secondary antibodies were diluted 1:1000 in blocking solution. Cells were counter-stained with rhodamine-phalloidin (1:1000, R415, Life Technologies) and DAPI (1 μg/ml, D1306, Life Technologies) in blocking solution (1 h). Plates were scanned and images were collected with an Operetta high-content imaging system 1438 (PerkinElmer) using a 10×objective lens. Each condition was assayed from at least two wells and a minimum of 7 fields per well. The quantification of SM22α positive cells was performed using Harmony software version 3.5.2 (PerkinElmer). The measurement of collagen I and MYOCD fluorescence intensity per area were performed with Columbus 2.7.1 (PerkinElmer).

(68) Deposition of collagen was also analysed using a colorimetric assay. Total secreted collagen in cell culture supernatant was determined using the Sirius red collagen detection kit (9062, Chondrex) in accordance with the manufacturer's instructions.

(69) The results of the experiments are showing FIGS. 12A to 12E. Both TGFβ1 and IL-11 were found to cause reduced expression of markers of the contractile VSMC phenotype (i.e. SM22α, myocardin) and to increase expression of collagen I, a marker of the secretory VSMC phenotype.

(70) The results suggest that IL-11 is a driver of the pathogenic transition of VSMCs from the contractile to the secretory phenotype, and is not a protective response to stimulation with TGFβ1.

Example 9: Effect of IL-11 Treatment on VSMC Migration

(71) An in vitro scratch and Boyden chamber assays were performed to analyse the influence of IL-11 stimulation on VSMCs migration.

(72) In vitro scratch wound assays and Boyden chamber assays were performed in duplicate per patient sample. Scratch wound assays were performed with confluent monolayers of VSMCs. After synchronizing the cells by culture low serum media (M231 containing 0.2% FBS) for 24 h, a linear scratch was created with a sterile pipette tip and cells were treated with: either IL-11 (5 ng/ml) or TGFβ1 (5 ng/ml) for 24 h. The wound area was imaged at 0 and 24 h and migration was calculated using ImageJ software. Briefly, migration of VSMCs was calculated using the formula “migration=(A0-A1)/A0×100”, wherein A0 is the area of the wound at 0 h and A1 is the area unoccupied by VSMCs after 24 h. 6 to 10 random regions were analysed per treatment and averaged.

(73) Boyden chamber assays were performed using a Cell Migration Assay kit (CBA-100, Cell Biolabs Inc) as per the manufacturer's protocol. VSMCs (5×10.sup.4 cells/well) were seeded inside transwell inserts, and the bottom well of the Boyden chamber contained cell culture medium, or cell culture medium supplemented with either TGFβ1 (5 ng/ml) or IL-11 (5 ng/ml). After 24 h VSMC migration towards the bottom well was determined colorimetrically at OD 560 nm.

(74) The results of the experiments are shown in FIGS. 13A-B and 14A-B. Treatment with IL-11 or TGFβ1 significantly increased wound closure (FIGS. 13A and 13B). A trend towards increased migration of VSMCs towards compartments containing TGFβ1 or IL-11 was observed (FIGS. 14A and 14B; P=0.15).

(75) To inhibit IL-11 signalling, cells were treated with IL-11 neutralizing antibody (2 μg/mL, MAB218, R&D Systems) or mouse IgG type 2a (2 μg/mL, MAB003, R&D Systems) for 24 h in the presence of TGFβ1.

Example 10: Analysis of the Effect of IL-11 Neutralisation on TGFβ1-Mediated Effects on VSMCs

(76) The inventors next investigated whether IL-11 was required for the TGFβ1-mediated effect on VSMC phenotype and activity.

(77) VSMCs were seeded in 96-well black CellCarrier plates and incubated in media for 24 h as described in Example 8. Cells were then cultured without stimulation, or stimulated by culture for 24 h with TGFβ 1 (5 ng/ml), IL-11 (5 ng/ml) in the presence of EdU (10 μM/ml); and in the presence or absence of an IgG control antibody or neutralizing anti-IL-11 antibody (2 μg/ml). Cells were subsequently rinsed, fixed and stained for analysis as described in Example 8. Incorporated EdU was labeled with AlexaFluor (AF) 488 using Click-iT EdU labeling kit (C10350, LifeTechnologies). 100 μl of Click-iT reaction cocktail was used per well and consisted of 85 μl Click-iT reaction buffer, 4 μl copper sulphate, 0.25 μl AF488 azide and 10 μl reaction buffer additive. This cocktail was incubated for 30 m at room temperature, cells washed once with 100 μl of Click-iT reaction rinse buffer. In addition, rinse with wash buffer (0.25% BSA and 0.1% Tween-20 in PBS). Plates were scanned and imaged as described in Example 8. Quantification of EdU positive cells was performed using Harmony software version 3.5.2 (PerkinElmer).

(78) The results are shown in FIGS. 15A to 15C. Inhibition of IL-11-mediated signalling using neutralizing anti-IL-11 antibody was found to inhibit TGFβ1-mediated stimulation of VSMC proliferation (FIG. 15A), and collagen I production (FIGS. 158 and 15C).

(79) In vitro scratch wound assays were performed as described in Example 9, in which cells were treated with either IL-11 (5 ng/ml) or TGFβ1 (5 ng/ml) in the presence of either neutralizing anti-IL-11 antibody (2 μg/ml, MAB218, R&D Systems) or mouse IgG type 2a (2 μg/ml, MAB003, R&D Systems) for 24 h. The wound areas were imaged and analysed as described in Example 9.

(80) The results are shown in FIGS. 16A and 16B. Inhibition of IL-11-mediated signalling using neutralizing anti-IL-11 antibody was found to abrogate the TGFβ1-mediated increase in wound closure by VSMCs.

(81) TGFβ1-induced cell proliferation and collagen production was reduced using IL-11 neutralizing antibodies (FIG. 13). This was also true for VSMC migration in wound closure (FIG. 14).

Example 11: Statistical Analysis

(82) Statistical analyses of high content imaging and protein data was performed using GraphPad Prism 6 software. Fluorescence intensity (collagen I, MYOCD) was normalized to the number of cells detected in the field and recorded for 7 fields/well. Cells expressing EdU and SM22α were quantified using previously mentioned software and a percentage of EdU+ve or SM22α+ve VSMCs was determined for each field. Outliers (ROUT 2%, Prism Software) were removed before analysis. When several experimental groups were compared to one condition (i.e. to unstimulated cells), we corrected P values according to Dunnett's. When we compared several conditions within one experiment, we corrected for multiple testing according to Holm-Sidak. The criterion for statistical significance was P<0.05. Values of P<0.05, P<0.01, P<0.001, and P<0.0001 are denoted by *, **, ***, and ****, respectively.

Example 12: Conclusions

(83) Taken together, the data suggest that IL-11 acts downstream of TGFβ1 signalling in VSMCs, and drives the pathological switch from the contractile to the secretory VSMC phenotype, and is required for the TGFβ1-mediated effects in VSMCs.

(84) Thus inhibition of IL-11-mediated signalling is identified as a treatment option for diseases and conditions which involve transition of VSMCs from the contractile to the secretory VSMC phenotype, and/or effects of TGFβ1 signalling in VSMCs.

Example 13: IL-11 Increases Intestinal Smooth Muscle Cell Mass and Collagen Content

(85) 10-week old Col1a1-GFP reporter male mice were subjected to daily SC injection with either 100 μg/kg of recombinant mouse IL-11 (rmIL11) or an identical volume of PBS for 20 days (PBS: n=3, IL-11: n=4). At sacrifice, the colon was fixed in accordance with standard cryosectioning protocols. Frozen blocks were sectioned at 10 μm thickness. Serial sections were fixed and blocked with 5% bovine serum albumin followed by incubation overnight at 4° C. with primary rabbit anti-αSMA antibodies (1:200 dilution, Ab5694, Abcam). Following PBS washes, sections were incubated with goat anti-rabbit IgG H&L (Alexa Fluor® 647) antibodies (1:500 dilution, Ab150079, Abcam) and counterstained with DAPI nuclear staining. After mounting, images were captured on the Olympus BX51 microscope using fluorescence microscopy using ImagePro software.

(86) The results are shown in FIG. 17. IL-11 was found to induce expansion of the muscularis mucosa, circular muscle and longitudinal muscle layers, and to cause an increase in collagen secreting smooth muscle cells in these layers in mouse colon.

(87) IL-11 mediated signaling is thus demonstrated to increase secretory SMC number and activity in a variety of different tissues.

Example 14: IL-11 Overexpression Contributes to SMC Pathology in the Heart/Aorta

(88) The effect of increased IL-11 expression on fibrosis of the heart was investigated using mice that conditionally express IL-11 in smooth muscle cells upon induction with tamoxifen.

(89) Smooth muscle cell specific Cre male mice (B6. FVB-Tg(Myh11-cre/ERT2)1Soff/J) were purchased from Jackson Laboratory (01979; Bar Harbor, Me.) and crossed with female mice carrying the ROSA-IL11 gene (C57BL/6N-Gt(ROSA)26Sor.sup.tm1(CAG-il11)Cook/J) available from Jackson Laboratory (031928) to generate mice with conditional expression of mouse IL-11 solely in smooth muscle cells (SMRS). Tamoxifen induction procedure was initiated at 6 weeks of age and comprised of 3 doses of 1 mg/kg across a week injected intraperitoneally followed by a week of wash-out. Smooth muscle-specific Cre only littermates (SMWT) were designated as mouse strain controls and corn oil was administered as vehicle controls for tamoxifen.

(90) FIG. 18A shows elevated IL-11 protein expression in the hearts of 8-week old SMRS mice compared to SMWT controls following two weeks of tamoxifen induction (n=6-7 per group), detected by immunoblotting. FIG. 18B shows that heart weight to body weight (HW/BW) ratios in 8-week-old SMRS mice were elevated compared to SMWT controls (n=8 per group).

(91) Heart sections from SMRS and SMWT mice were assessed for collagen by staining with Masson's trichrome stain. Increased expression/secretion of extracellular matrix (ECM) components such as collagen indicate a secretory SMC phenotype. Heart tissue was fixed in 10% neutral-buffered formalin for 24-48 hours, dehydrated and embedded in formalin. Sections (5 μm) were stained with Masson's trichrome staining. In addition, the amount of collagen in ventricular tissues was quantified by colorimetric detection of hydroxyproline using a Quickzyme Total Collagen assay kit (Quickzyme Biosciences).

(92) FIG. 18C shows representative heart sections stained with Masson's trichrome (n=3 per group). Heart tissue from SMRS mice demonstrates perivascular fibrosis compared to SMWT controls. FIG. 18D shows that ventricles of SMRS mice demonstrate elevated collagen expression compared to SMWT controls based on hydroxyproline assessment (HPA; n=5-6 per group). Statistical analyses were performed using two-tailed unpaired T-test. **, **** denotes P<0.01 and P<0.0001 respectively.

(93) Thus, overexpression of IL-11 in smooth muscle cells contributes to perivascular fibrosis in the heart.

(94) Expression of ECM and Inflammatory Genes

(95) Gene expression of a number of ECM components and inflammatory genes in heart tissue was quantified by RT-PCR. Heart tissue samples were obtained from tamoxifen-induced Cre-mediated SMC IL-11 overexpression mice.

(96) Total RNA was extracted from snap-frozen tissues using Trizol reagent (Invitrogen) followed by Purelink RNA mini kit (Invitrogen) purification. The cDNA was prepared using an iScript cDNA synthesis kit, in which each reaction contained 1 μg of total RNA, as per manufacturer's instructions. Quantitative RT-PCR gene expression analysis was performed on duplicate samples with fast SYBR green (Qiagen) technology using QuantStudio (Applied Biossystem). Expression data were normalized to GAPDH mRNA expression levels and we used the 2.sup.−ΔΔCt method to calculate fold change. Specific primer probes were obtained from Integrated DNA Technologies and are shown in Table 1.

(97) TABLE-US-00002 Genes Forward primer (5′ to 3′) Reverse primer (5′ to 3′) IL-11 AATTCCCAGCTGACGGAGATCACA TCTACTCGAAGCCTTGTCAGCACA IL-11ra CAGCACGTCCTGAAGTCTCC GGAAGTAAGGTAGCGGGTGG TGFβ1 CCCTATATTTGGAGCCTGGA CTTGCGACCCACGTAGTAGA Col1a1 GGGGCAAGACAGTCATCGAA GTCCGAATTCCTGGTCTGGG Col1a2 CCCAGAGTGGAACAGCGATT ATGAGTTCTTCGCTGGGGTG Col3a1 ATGCCCACAGCCTTCTACAC ACCAGTTGGACATGATTCACAG FN1 CACCCGTGAAGAATGAAGA GGCAGGAGATTTGTTAGGA MMP2 ACAAGTGGTCCGCGTAAAGT AAACAAGGCTTCATGGGGGC TIMP-1 GGGCTAAATTCATGGGTTCC CTGGGACTTGTGGGCATATC IL6 AGGATACCACTCCCAACAGACC AGTGCATCATCGTTGTTCATACA TNFα CTCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCC CCL2 GAAGGAATGGGTCCAGACAT ACGGGTCAACTTCACATTCA CCL5 GCTGCTTTGCCTACCTCTCC TCGAGTGACAAACACGACTGC

(98) The results are shown in FIG. 18E. IL-11 overexpression causes elevated expression of ECM components and inflammatory genes in heart SMCs. Columns indicate average gene expression (normalized to GAPDH expression) with left bars denoting SMWT control and right bars denoting SMRS overexpression groups (n=5 per group). Extracellular matrix genes includes collagens (Col1a1, Col1a2, Col3a1), fibronectin (FN1), matrix metalloproteinase (MMP2), and tissue inhibitor of matrix metalloproteinase (TIMP-1). Inflammatory genes included interleukin-6 (IL-6), tumour necrosis factor alpha (TNFα), C—C motif chemokine ligand-2 and -5 (CCL2 and CCL5 respectively). Statistical analysis was performed using a two-tailed unpaired T-test. *, **, *** denotes P<0.05, P<0.01, and P<0.001 respectively.

(99) Heart Size and Function

(100) Tamoxifen-induced Cre-mediated IL-11 overexpressing mice were employed to analyse the effect of IL-11 overexpression on heart size and function.

(101) IL-11 expression was induced as before. Trans-thoracic echocardiography was performed on all mice using Vevo 2100 with a MS400 linear array transducer (VisualSonics), 18-38 MHz by a single, trained echocardiographer blinded to genotype and treatment group. Mice were anaesthetised with 2% isofluorane and maintained at 0.6-1.0% isotlurane, while the body temperature was maintained at 37° C. on a heated platform. Chest and neck hair were removed using depilatory cream and a layer of acoustic coupling gel was applied to the thorax. An average of 10 cardiac cycles of standard 2D and rn-mode short axis at mid papillary muscle level were obtained and stored for offline analysis for LV dimensions and wall thickness according to previously described methods (Gao S, et al. Curr. Protoc Mouse Biol 2011, 1, 71-83). LV ejection fraction was calculated using a modified Quinone method (Tortoledo F A, et al. Circulation 1983, 67, 579-584). Left atrium (LA) diameter was measured in parasternal long axis view and averaged across 3 measurements. LV mass was estimated according to previous literature (Fard C Y, et al. J Am Soc Echocardiogr 2000; 13: 582-7).

(102) The results are shown in FIGS. 19A to 21D. FIG. 19A shows that SMRS mice have a lower body weight compared to SMWT controls, measured prior to echocardiography. Estimated LV mass based on echocardiography demonstrates lower heart weights in SMRS mice compared to SMWT controls but increased LV mass ratio when corrected for body weights (FIGS. 19B and 19C). FIG. 19D represents left atrium (LA) diameter measured in parasternal long axis view and shows increased LA size in SMRS mice compared to SMWT controls.

(103) FIGS. 20A to 20C show anterior wall thickness, LV internal diameter, and posterior LV wall thickness, respectively, at end-diastole with correction for body weight. All three measurements were increased in SMRS mice compared to SMWT controls.

(104) FIGS. 21A to 21C show anterior wall thickness, LV internal diameter, and posterior LV wall thickness, respectively, at end-systole with correction for body weight. All three measurements were increased in SMRS mice compared to SMWT controls.

(105) FIG. 21D shows that the ejection fraction was preserved in SMRS mice as compared to SMWT controls.

(106) In FIGS. 19A-21D, each dot represents an individual mouse. Statistical analyses were performed using two-tailed unpaired T-test. *, **, ***, **** denote P<0.05, P<0.01, p<0.001 and P<0.0001 respectively.

(107) Thus, tamoxifen-induced Cre-mediated IL-11 overexpression in smooth muscle cells results in left ventricular (LV) hypertrophy and chamber stiffness with preserved systolic function as indicated by echocardiography.

(108) Aortic Remodelling

(109) Tamoxifen-induced Cre-mediated IL-11 mice were employed to analyse the effect of IL-11 overexpression on aortic SMCs.

(110) 8-week-old SMRS mice, as before, were subjected to two weeks of tamoxifen induction (n=6-7 per group).

(111) Trans-thoracic echocardiography was performed on all mice using Vevo 2100 with a MS400 linear array transducer (VisualSonics), 18-38 MHz by a single, trained echocardiographer blinded to genotype and treatment group. Mice were anaesthetised with 2% isofluorane and maintained at 0.6-1.0% isoflurane, while the body temperature was maintained at 37° C. on a heated platform. Chest and neck hair were removed using depilatory cream and a layer of acoustic coupling gel was applied to the thorax. Aortic root and ascending aortic sizes were assessed from B and m-mode of parasternal long-axis view, using inner edge-to-inner edge in accordance with the widely accepted American and European guidelines (Lang R M, et al. Recommendations for chamber quantification. Eur J Echocardiogr 7, 79-108 (2006)). Peak aortic flow velocity was obtained by applying pulse wave Doppler across the aortic valve from the aortic arch at suprasternal view. All measurements were averaged over three cardiac cycles.

(112) The results are shown in FIGS. 22A-E. Each dot represents an individual mouse. Statistical analyses were performed using two-tailed unpaired T-test. **, **** denote P<0.05 and P<0.0001 respectively.

(113) FIG. 22A demonstrates elevated IL-11 protein expression in the proximal thoracic aorta of 8-week-old SMRS mice compared to SMWT controls (detected by immunoblotting). FIGS. 22B and 22C show that aortic root internal diameter as measured at end-diastole and end-systole respectively with correction for body weight is greater in SMRS mice compared to SMWT controls. FIG. 22D shows that ascending aorta internal diameter at end-systole with correction for body weight is greater in SMRS mice compared to SMWT controls. FIG. 22E shows that SMRS mice have preserved aortic peak flow velocity compared to controls.

(114) Thus, tamoxifen-induced Cre-mediated IL-11 overexpression in smooth muscle cells results in aortic remodelling with preserved flow velocity.

Example 15: IL-11 Overexpression Contributes to SMC Pathology in the Lung

(115) The effect of increased IL-11 expression on fibrosis of the lung was investigated using the tamoxifen-induced Cre-mediated SMC IL-11 overexpression mouse model.

(116) 8-week old SMRS mice were subjected to two weeks of tamoxifen induction as before (n=3 per group). Collagen expression was measure by hydroxyproline assessment as described in Example 14 (n=6 per group). Representative lung sections were stained with Masson's trichrome stain, as described in Example 14 (n=3 per group).

(117) The results are shown in FIGS. 23A-D. FIG. 23A demonstrates elevated IL-11 protein expression in the lungs of 8-week-old SMRS mice compared to SMWT controls (detected by immunoblotting). FIG. 23B shows that SMRS mice demonstrate increased lung to body weight ratios as compared to SMWT controls (n=8 per group). FIG. 23C shows that lungs of SMRS mice demonstrate elevated collagen expression when corrected for lung-to-body weight ratio as compared to controls based on hydroxyproline assessment. FIG. 23D provides representative lung sections stained with Masson's trichrome and demonstrates increased lung fibrosis and infiltrating cell infiltrates in SMRS lungs as compared to SMWT controls.

(118) Thus, tamoxifen-induced Cre-mediated IL-11 overexpression in smooth muscle cells results in increased lung fibrosis.

(119) Expression of ECM and Inflammatory Genes

(120) RT-PCR was performed as described in Example 14.

(121) FIG. 24 shows that tamoxifen-induced Cre-mediated IL-11 overexpression in smooth muscle cells causes elevated expression of extracellular matrix and inflammatory genes in the lungs. Columns indicate average gene expression (normalized to GAPDH expression) with left bars denoting SMWT and right bars denote for SMRS groups (n=5 per group). Extracellular matrix genes includes collagens (Col1a1, Col1a2, Col3a1), fibronectin (FN1), matrix metalloproteinase (MMP2), and tissue inhibitor of matrix metalloproteinase (TIMP-1). Inflammatory genes included interleukin-6 (IL-6), tumour necrosis factor alpha (TNFα), C—C motif chemokine ligand-2 and -5 (CCL2 and CCL5 respectively). Statistical analyses were performed using two-tailed unpaired T-test. **, *** denote P<0.01, and P<0.001 respectively.

Example 16: IL-11 Overexpression Contributes to SMC Pathology in the Liver

(122) The effect of increased IL-11 expression on fibrosis of the liver was investigated using the tamoxifen-induced Cre-mediated SMC IL-11 overexpression mouse model.

(123) Tamoxifen induction and hydroxyproline assessment were performed as described in Example 14.

(124) The results are shown in FIGS. 25A to 25C. FIG. 25A demonstrates elevated IL-11 protein expression in the liver of 8-week-old SMRS mice compared to SMWT controls following two weeks of tamoxifen induction (n=6-7 per group; detected by immunoblotting). FIG. 25B shows that SMRS mice demonstrate unchanged liver-to-body weight ratios as compared to controls (n=8 per group). FIG. 25C shows that livers of SMRS mice demonstrated elevated collagen expression as compared to controls based on hydroxyproline assessment (n=5-6 per group). Statistical analyses were performed using two-tailed unpaired T-test. * denotes P<0.05.

(125) Thus, tamoxifen-induced Cre-mediated IL-11 overexpression in smooth muscle cells results in increased liver fibrosis.

(126) Expression of ECM and Inflammatory Genes

(127) RT-PCR was performed as described in Example 14.

(128) FIG. 26 shows that tamoxifen-induced Cre-mediated IL-11 overexpression in smooth muscle cells causes elevated extracellular matrix protein expression in the liver. Columns indicate average gene expression (normalized to GAPDH expression) with left bars denoting SMWT and right bars denote for SMRS groups (n=5 per group). Extracellular matrix genes includes collagens (Col1a1, Col1a2, Col3a1), fibronectin (FN1), matrix metalloproteinase (MMP2), and tissue inhibitor of matrix metalloproteinase (TIMP-1).

(129) Inflammatory genes included interleukin-6 (IL-6), tumour necrosis factor alpha (TNFα). C—C motif chemokine ligand-2 and -5 (CCL2 and CCL5 respectively). Statistical analyses were performed using two-tailed unpaired T-test. *, *** denote P<0.05, and P<0.001 respectively.

Example 17: IL-11 Overexpression Contributes to SMC Pathology in the Kidney

(130) The effect of increased IL-11 expression on fibrosis of the kidney was investigated using the tamoxifen-induced Cre-mediated SMC IL-11 overexpression mouse model.

(131) Tamoxifen induction and hydroxyproline assessment were performed as described in Example 14.

(132) The results are shown in FIGS. 27A to 27C. FIG. 27A demonstrates elevated IL-11 protein expression in the kidney of 8-week-old SMRS mice compared to SMWT controls following two weeks of tamoxifen induction (n=6-7 per group; detected by immunoblotting). FIG. 27B shows that SMRS mice demonstrate increased kidney-to-body weight ratios as compared to SMWT controls (n=8 per group). FIG. 27C shows that kidneys of SMRS mice demonstrate a trend towards elevated collagen expression compared to controls based on hydroxyproline assessment (P=0.12, n=5 per group). Statistical analyses were performed using two-tailed unpaired T-test. * denotes P<0.05.

(133) Thus, tamoxifen-induced Cre-mediated IL-11 overexpression in smooth muscle cells results in increased kidney fibrosis.

(134) Expression of ECM and Inflammatory Genes

(135) RT-PCR was performed as described in Example 14.

(136) FIG. 28 shows that tamoxifen-induced Cre-mediated IL-11 overexpression in smooth muscle cells demonstrate elevated extracellular matrix protein expression in the kidney. Columns indicate average gene expression (normalized to GAPDH expression) with left bars denoting SMWT and right bars denote for SMRS groups (n=5 per group). Extracellular matrix genes includes collagens (Col1a1, Col1a2, Col3a1), fibronectin (FN1), matrix metalloproteinase (MMP2), and tissue inhibitor of matrix metalloproteinase (TIMP-1). Inflammatory genes included interleukin-6 (IL-6), tumour necrosis factor alpha (TNFα), C—C motif chemokine ligand-2 and -5 (CCL2 and CCL5 respectively). Statistical analyses were performed using two-tailed unpaired T-test. *, **, *** denote P<0.05, P<0.01 and P<0.001 respectively.

Example 18: IL-11 Overexpression Contributes to SMC Pathology in Inflammatory Bowel Disorders

(137) The effect of increased IL-11 expression on inflammatory bowel disorders was investigated using the tamoxifen-induced Cre-mediated SMC IL-11 overexpression mouse model.

(138) Tamoxifen induction was performed as described in Example 14. The levels of fecal calprotectin (S100A8/A9) were quantified using Mouse S100A8/S100A9 Heterodimer Duoset ELISA (DY8596-05) according to manufacturer's instructions. Fecal calprotectin was extracted using fecal extraction buffer (0.1 M Tris, 0.15 M NaCl, 1.0 M urea, 10 mM CaCl.sub.2), 0.1 M citric acid monohydrate, 5 g/l BSA).

(139) FIG. 29A shows rectums of SMRS and SMWT control mice after administration of either vehicle (corn oil) or tamoxifen (3 doses of 1 mg/kg/day). SMRS mice receiving tamoxifen present red and swollen rectums (arrows) compared to other mouse groups, indicating inflammatory bowel condition.

(140) FIG. 29B depicts representative images of stool samples from SMRS and SMWT mice after tamoxifen treatment. SMRS mice produce softer and paler stools compared to SMWT controls.

(141) FIG. 29C shows that calprotectin (S100A8/A9) levels, reflecting inflammatory cell activity in the gut, are elevated in stool samples of SMRS mice compared to SMWT controls (n=8 per group).

(142) Thus, tamoxifen-induced Cre-mediated IL-11 overexpression in smooth muscle cells results in inflammatory bowel phenotype in SMRS mice.

Example 19: IL-11 Overexpression Contributes to SMC Pathology in the Gastro-Intestinal Tract

(143) The effect of increased IL-11 expression on the gastro-intestinal tract was investigated using the tamoxifen-induced Cre-mediated SMC IL-11 overexpression mouse model.

(144) Tamoxifen induction and staining with Masson's trichrome were performed as described in Example 14. FIG. 30A shows that the isolated gastro-intestinal tract in SMRS mice demonstrates redness and swelling compared to SMWT controls. FIG. 30B demonstrates elevated IL-11 expression in the colon of 8-week-old SMRS mice compared to SMWT controls following two weeks of tamoxifen induction (n=3 per group; detected by immunoblotting). FIG. 30C depicts representative sections of the small intestine and colon from SMWT and SMRS mice stained with Masson's trichrome (n=3 per group). SMRS mice intestinal walls demonstrate greater wall thickness and intestinal fibrosis compared to controls.

(145) Thus, tamoxifen-induced Cre-mediated IL-11 overexpression in smooth muscle cells results in inflamed gastro-intestinal tract and intestinal fibrosis.

(146) Expression of ECM and Inflammatory Genes

(147) RT-PCR was performed as described in Example 14.

(148) FIG. 31 shows that tamoxifen-induced Cre-mediated IL-11 overexpression in smooth muscle cells causes elevated extracellular matrix protein expression in the colon. Columns indicate average gene expression (normalized to GAPDH expression) with left bars denoting SMWT and right bars denote for SMRS groups (n=5 per group). Extracellular matrix genes includes collagens (Col1a1, Col1a2, Col3a1), fibronectin (FN1), matrix metalloproteinase (MMP2), and tissue inhibitor of matrix metalloproteinase (TIMP-1).

(149) Inflammatory genes included interleukin-6 (IL-6), tumour necrosis factor alpha (TNFα), C—C motif chemokine ligand-2 and -5 (CCL2 and CCL5 respectively). Statistical analyses were performed using two-tailed unpaired T-test. *, **, *** denote P<0.05, P<0.01 and P<0.001 respectively.

Example 20: IL-11 Expression in Marfan's Syndrome

(150) Marfan's Syndrome (MFS) is an autosomal dominant connective tissue condition with elevated TGFβ signalling. MFS mice were used to investigate IL-11 expression.

(151) All mice were from a C57BL/6 genetic background and they were bred and housed in the same room and provided food and water ad libitum. MFS (B6.129-Fbn1.sup.tm1Hpd/J) mice were purchased from Jackson Laboratory (012885; Bar Harbor, Me.). Heterozygous mice that develop classical manifestations of human disease (including aortic aneurysms and lung defects) were used in experiments.

(152) Western blot analysis was carried out on total protein extracts from mouse heart, lung and thoracic aorta.

(153) Frozen tissues were homogenized by gentle rocking in lysis buffer (RIPA buffer containing protease and phosphatase inhibitors (Roche)) followed by centrifugation to clear the lysate. Equal amounts of protein lysates were separated by SDS-PAGE, transferred to a PVDF membrane, and incubated overnight with anti-IL11 (MAB218, R&D systems) and anti-GAPDH (2118, Cell Signaling) antibodies. Proteins were visualized using the ECL detection system (Pierce) with the appropriate secondary antibodies: anti-rabbit HRP (7074, Cell Signaling) or anti-mouse HRP (7076, Cell Signaling).

(154) FIGS. 32A-D shows that IL-11 is upregulated in the heart, lung and aorta in Marian's Syndrome (MFS) mice. FIG. 32A shows that heart, lung, and aorta tissue of MFS mice demonstrated increased IL-11 expression as compared to wild-type (WT) controls assessed by western blotting. FIGS. 32B to 32D depict densitometry assessment of IL-11 expression as compared to GAPDH expression in heart, lung, and aorta of MFS mice, respectively.

Example 21: Effect of IL-11 Inhibition on Aortic Remodelling

(155) Transverse aortic constriction (TAC) in mice was employed to analyse the effect of inhibition of IL-11-mediated signalling on TAC-induced aortic remodelling of SMCs.

(156) All mice were from a C57BL/6 genetic background and they were bred and housed in the same room and provided food and water ad libitum. Animals underwent thoracotomy with ascending aortic constriction with survival. Terminal studies were conducted at 2 weeks post TAC surgery. Age-matched sham controls underwent the same operative procedure without TAC. Trans-thoracic two-dimensional Doppler echocardiography was used to confirm increased pressure gradients (>40 mmHg) indicative of successful TAC. Mice were euthanized at 2 weeks post-TAC for histological and molecular assessments. For post-operative drug treatment, anti-IL11, anti-IL11Rα or IgG control antibodies were given intraperitoneally at a dose of 20 mg/kg twice per week for two consecutive weeks.

(157) The results are shown in FIGS. 33A to 33D, which demonstrate that TAC-induced aortic remodelling is reduced by inhibiting IL-11-mediated signalling using anti-IL11RA antibodies, despite maintenance of pressure overload in mice.

(158) FIGS. 33A and 33B show aortic root internal dimension at end-systole and end-diastole. FIGS. 33C and 33D show aortic arch peak velocity and pressure gradient, respectively. Statistical analyses were conducted with one-way ANOVA with Sidak post-hoc analyses for multiple comparisons. *, **, *** denote P<0.05, P<0.01 and P<0.001 respectively.

(159) Representative sections of proximal thoracic aorta were fixed in 10% neutral-buffered formalin for 24-48 hours, dehydrated and embedded in formalin. Sections (5 μm) were stained with Masson's trichome staining for collagen assessment, as described in Example 14.

(160) FIG. 34 shows that TAC-induced aortic remodelling is ameliorated with neutralizing IL-11 and IL-11Rα antibodies, see arrows. Representative sections of proximal thoracic aorta were stained with Masson's trichrome (n=5/group). Scale bar represents 100 μm.

Example 22: Effect of Inhibiting IL-11-Mediated Signalling on Aortic VSMC Migration

(161) Mouse VSMCs were isolated and cultured using a modified protocol adapted from published literature (Metz, Richard P., et al. Cardiovascular Development. Humana Press, Totowa, N.J., 2012. 169-176; Weber, Sven C., et al. Pediatric research 70.3 (2011): 236). Thoracic aortas were excised from mice treated with recombinant mouse IL-11 (5 ng/ml) and recombinant mouse TGFβ1 (5 ng/ml) with and without anti-IL11 antibody (2 μg/ml) or equivalent concentration of IgG isotype control. The aortic tissue was minced, digested for 45 minutes in M231 medium containing 1% antibiotic-antimycotic and 0.25 mg/mL Liberase™ (Roche) with mild agitation at 37° C. and subsequently explant cultured in complete M231 supplemented with SMGS and 1% antibiotic-antimycotic at 37° C. Mixed cells were outgrown from digested aortic tissue and at 80-90% confluence at passage 1, VSMCs were enriched via negative selection with magnetic beads against CD45 (leukocytes; 130-052-301, Miltenyi Biotec), CD90.2 (fibroblasts; 130-049-101, Miltenyi Biotec), and CD31 (endothelial cells; 130-097-418, Millenyi Biotec) using the MidiMACS separator according to manufacturer's instructions. Mouse aortic VSMCs were used for downstream experiments at low passages between 3 to 5. To assess VSMC migration, in vitro scratch wound assays were performed with confluent monolayers of murine VSMCs for 24 h.

(162) FIGS. 35A and 35B show that antibody inhibition of IL-11-mediated signalling neutralizes TGFβ1-mediated murine aortic VSMC migration. Representative images (35A) and cumulative plots (35B) show migration of VSMCs from mice treated with recombinant mouse IL-11 (5 ng/ml) and recombinant mouse TGFβ1 (5 ng/ml) with and without anti-IL11 antibody (2 μg/ml) or equivalent concentration of IgG isotype control for 24 h. The wound area was imaged at 0 h (upper panels) and 24 h (lower panels), and migration was calculated using ImageJ software with the MRI wound healing tool, as described below. Scale bar indicates 200 μm distance. All data expressed as mean±SD. Statistical significance was established with two-way ANOVA with Sidak's multiple comparisons. *, ** denotes P<0.05, P<0.01 respectively.

(163) In another study, the effect of multiple known stimulants of VSMC migration was assessed in murine aortic VSMCs with IL-11Rα ablation.

(164) Mouse VSMCs were isolated and cultured using a modified protocol adapted from published literature (Metz, Richard P., et al. Cardiovascular Development. Humana Press, Totowa, N.J., 2012. 169-176; Weber, Sven C., et al. Pediatric research 70.3 (2011): 236). Briefly, 4 to 6 weeks old mice lacking functional alleles for IL11 ra1 (Il11ra1−/−, KO) and their wild-type littermates (Il11ra1+/+, WT) were euthanised and the thoracic aorta excised for VSMC cultures. The thoracic aorta from WT and KO mice were minced, digested for 45 minutes in M231 medium containing 1% antibiotic-antimycotic and 0.25 mg/mL Liberase™ (Roche) with mild agitation at 37° C. and subsequently explant cultured in complete M231 supplemented with SMGS and 1% antibiotic-antimycotic at 37° C. Mixed cells were outgrown from digested aortic tissue and at 80-90% confluence at passage 1, VSMCs were enriched via negative selection with magnetic beads against CD45 (leukocytes; 130-052-301, Miltenyi Biotec), CD90.2 (fibroblasts; 130-049-101, Miltenyi Biotec), and CD31 (endothelial cells; 130-097-418, Miltenyi Biotec) using the MidiMACS separator according to manufacturer's instructions. Mouse aortic VSMCs were used for downstream experiments at low passages between 3 to 5.

(165) To assess VSMC migration, in vitro scratch wound assays were performed with confluent monolayers of murine VSMCs. After serum starvation with low serum media (M231 containing 0.2% FBS) for 24 h, a linear scratch was created with a sterile pipette tip and cells were treated with: either M231 only (unstimulated), angiotensin II (ANGII, 100 μM) (Sigma-Aldrich), mouse IL-11 (5 ng/ml) (Genscript) or mouse TGFβ1 (5 ng/ml) (R&D systems) for 48 h. The wound area were analysed using ImageJ with the “MRI wound healing tool” plugin (available from http//dev.mri.cnrs.fr/projects/imagej-macros/wiki/Wound_Healing_Tool). The wound area was imaged at 0 and 48 h and migration was calculated using the formula “migration=(A0−A1)/A0×100”, wherein A0 is the area of the wound at 0 h and A1 is the area unoccupied by VSMCs after 24 h or 48 h. 6 to 10 random regions were analysed per treatment and averaged. Treatment duration of 48 h was presented for murine stimulation studies in WT and KO VSMCs.

(166) The results are shown in FIGS. 36A and 36B. Representative images (36A) and cumulative plots (36B) show wild-type (WT) and IL11 ra1-ablated (KO) mice treated with no stimulants, angiotensin II (ANGII, 100 μM), recombinant mouse TGFβ1 (5 ng/ml), and recombinant mouse IL-11 (5 ng/ml) for 48 h. The wound area was imaged at 0 h (upper panels) and 48 h (lower panels), and migration was calculated using ImageJ software with the MRI wound healing tool. Scale bar indicates 200 μm distance. All data expressed as mean±SD. Statistical significance was established with two-way ANOVA with Dunnett's multiple comparisons. *, **, ***, **** denote P<0.05, P<0.01, P<0.001 and P<0.0001 respectively.

(167) Thus, IL-11Rα ablation in murine aortic VSMCs is protective against multiple known stimulants of VSMC migration, including IL-11.

REFERENCES

(168) 1. Du, X. & Williams, D. A. Interleukin-11: review of molecular, cell biology, and clinical use. Blood 89, 3897-3908 (1997). 2. Hegner, B. et al. Intrinsic Deregulation of Vascular Smooth Muscle and Myofibroblast Differentiation in Mesenchymal Stromal Cells from Patients with Systemic Sclerosis. PLoS One 11, e0153101 (2016). 3. Guo, X. & Chen, S.-Y. Transforming growth factor-β and smooth muscle differentiation. World J. Biol. Chem. 3, 41-52 (2012). 4. Hautmann, M. B., Madsen, C. S. & Owens, G. K. A Transforming Growth Factor β (TGFβ) Control Element Drives TGFβ-induced Stimulation of Smooth Muscle α-Actin Gene Expression in Concert with Two CArG Elements. J. Biol. Chem. 272, 10948-10956 (1997). 5. Ding, R., Darland, D. C., Parmacek, M. S. & D'Amore, P. A. Endothelial-mesenchymal interactions in vitro reveal molecular mechanisms of smooth muscle/pericyte differentiation. Stem Cells Dev. 13, 509-520 (2004). 6. Taki, H. et al. Monokine stimulation of interleukin-11 production by human vascular smooth muscle cells in vitro. Atherosclerosis 144, 375-380 (1999). 7. Zimmerman, M. A. et al. Interleukin-11 attenuates human vascular smooth muscle cell proliferation.

(169) Am. J. Physiol. Heart Circ. Physiol. 283, H175-80 (2002). 8. Postlethwaite, Postlethwaite, Pattanaik, D. & Brown, M. Vascular involvement in systemic sclerosis (scleroderma). J. Inflamm. Res. 105 (2011). 9. Matucci-Cerinic, M., Kahaleh, B. & Wigley, F. M. Review: Evidence That Systemic Sclerosis Is a Vascular Disease. Arthritis & Rheumatism 65, 1953-1962 (2013). 10. Tuder, R. M., Marecki, J. C., Richter, A., Fijalkowska, I. & Flores, S. Pathology of pulmonary hypertension. Clin. Chest Med. 28, 23-42, vii (2007). 11. Boin, F. et al. Oxidative stress-dependent activation of collagen synthesis is induced in human pulmonary smooth muscle cells by sera from patients with scleroderma-associated pulmonary hypertension. Orphanet J. Rare Dis. 9, 123 (2014). 12. Rabinovitch, M. Molecular pathogenesis of pulmonary arterial hypertension. J. Clin. Invest. 122, 4306-4313 (2012). 13. Gordon, K. J. & Blobe, G. C. Role of transforming growth factor-beta superfamily signalling pathways in human disease. Biochim. Biophys. Acta 1782, 197-228 (2008). 14. Crosas-Molist, E. et al. Vascular smooth muscle cell phenotypic changes in patients with Marfan syndrome. Arterioscler. Thromb. Vasc. Biol. 35, 960-972 (2015). 15. Matt, P. et al. Circulating transforming growth factor-beta in Marian syndrome. Circulation 120, 526-532 (2009). 16. Holm, T. M. et al. Noncanonical TGFbeta signalling contributes to aortic aneurysm progression in Marian syndrome mice. Science 332, 358-361 (2011). 17. Lindsay, M. E. & Dietz, H. C. Lessons on the pathogenesis of aneurysm from heritable conditions. Nature 473, 308-316 (2011). 18. Dietz, H. C. 2006 Curt Stern Award Address. Marfan syndrome: from molecules to medicines. Am. J. Hum. Genet. 81, 662-667 (2007). 19. Goumans, M.-J., Liu, Z. & ten Dijke, P. TGF-beta signalling in vascular biology and dysfunction. Cell Res. 19, 116-127 (2009). 20. Starke, R. M. et al. Vascular smooth muscle cells in cerebral aneurysm pathogenesis. Trans. Stroke Res. 5, 338-346 (2014). 21. Nakajima, N., Nagahiro, S., Sano, T., Satomi, J. & Satoh, K. Phenotypic modulation of smooth muscle cells in human cerebral aneurysmal walls. Acta Neuropathol. 100, 475-480 (2000). 22. Nikol, S. et al. Expression of transforming growth factor-beta 1 is increased in human vascular restenosis lesions. J. Clin. Invest. 90, 1582-1592 (1992). 23. Nabel, E. G. et al. Direct transfer of transforming growth factor beta 1 gene into arteries stimulates fibrocellular hyperplasia. Proc. Natd. Acad. Sci. U.S.A 90, 10759-10763 (1993). 24. Wolf, Y. G., Rasmussen, L. M. & Ruoslahti, E. Antibodies against transforming growth factor-beta 1 suppress intimal hyperplasia in a rat model. J. Clin. Invest. 93, 1172-1178 (1994). 25. Edlin, R. S. et al. Characterization of primary and restenotic atherosclerotic plaque from the superficial femoral artery: Potential role of Smad3 in regulation of SMC proliferation. J. Vasc. Surg. 49, 1289-1295 (2009). 26. Tsai, S. et al. TGF-beta through Smad3 signalling stimulates vascular smooth muscle cell proliferation and neointimal formation. Am. J. Physiol. Heart Circ. Physiol. 297, H540-9 (2009). 27. Mallawaarachchi, C. M., Weissberg, P. L. & Siow, R. C. M. Smad7 gene transfer attenuates adventitial cell migration and vascular remodeling after balloon injury. Arterioscler. Thromb. Vasc. Biol. 25, 1383-1387 (2005). 28. Louis, S. F. & Zahradka, P. Vascular smooth muscle cell motility: From migration to invasion. Exp. Clin. Cardiol. 15, e75-85 (2010). 29. Suwanabol, P. A., Kent, K. C. & Liu, B. TGF-β and restenosis revisited: a Smad link. J. Surg. Res. 167, 287-297 (2011). 30. McCaffrey, T. A. et al. Genomic instability in the type II TGF-beta1 receptor gene in atherosclerotic and restenotic vascular cells. J. Chin. Invest. 100, 2182-2188 (1997). 31. Mallat, Z. et al. Inhibition of transforming growth factor-beta signalling accelerates atherosclerosis and induces an unstable plaque phenotype in mice. Circ. Res. 89, 930-934 (2001). 32. Robertson, A.-K. L. et al. Disruption of TGF-β signalling in T cells accelerates atherosclerosis. J. Clin. Invest. 112, 1342-1350 (2003). 33. Grainger, D. J., Mosedale, D. E., Metcalfe, J. C. & Böttinger, E. P. Dietary fat and reduced levels of TGFbeta1 act synergistically to promote activation of the vascular endothelium and formation of lipid lesions. J. Cell Sci. 113 (Pt 13), 2355-2361 (2000). 34. Grainger, D. J., Witchell, C. M. & Metcalfe, J. C. Tamoxifen elevates transforming growth factor-beta and suppresses diet-induced formation of lipid lesions in mouse aorta. Nat. Med. 1, 1067-1073 (1995). 35. O'Connor, S. C. & Gornik, H. L. Recent developments in the understanding and management of fibromuscular dysplasia. J. Am. Heart Assoc. 3, e001259 (2014). 36. Begelman. S. M. & Olin, J. W. Fibromuscular dysplasia. Curr. Opin. Rheumatol. 12, 41-47 (2000). 37. Ganesh, S. K. et al. Clinical and biochemical profiles suggest fibromuscular dysplasia is a systemic disease with altered TGF-β expression and connective tissue features. FASEB J. 26, 3313-3324 (2014). 38. Weber, B. R. & Dieter, R. S. Renal artery stenosis: epidemiology and treatment. Int. J. Nephrol. Renovasc. Dis. 7, 169-181 (2014). 39. El Mabrouk, M., Diep, 0. N., Benkirane, K., Touyz, R. M. & Schiffrin, E. L. SAM68: a downstream target of angiotensin II signalling in vascular smooth muscle cells in genetic hypertension. Am. J. Physiol. Heart Circ. Physiol. 286, H1954-62 (2004). 40. Zhang, L. et al. Impaired peroxisome proliferator-activated receptor-gamma contributes to phenotypic modulation of vascular smooth muscle cells during hypertension. J. Biol. Chem. 285, 13668-13677 (2010). 41. Warren, H. R. et al. Genome-wide association analysis identifies novel blood pressure loci and offers biological insights into cardiovascular risk. Nat. Genet. 49, 403-415 (2017). 42. Cove-Smith, A. & Hendry, B. M. The regulation of mesangial cell proliferation. Nephron Exp. Nephrol. 108, e74-9 (2008). 43. Diamond, J. R. & Karnovsky, M. J. Focal and segmental glomerulosclerosis: analogies to atherosclerosis. Kidney Int. 33, 917-924 (1988). 44. Herrera, G. A. Plasticity of mesangial cells: a basis for understanding pathological alterations. Ultrastruct. Pathol. 30, 471-479 (2006). 45. Loeffler, I. & Wolf, G. Transforming growth factor-β and the progression of renal disease. Nephrol. Dial. Transplant 29 Suppl 1, 37-45 (2014). 46. Santibanez, J. F., Krstic, J., Quintanilla, M. & Bernabeu, C. TGF-β Signalling and Its Role in Cancer Progression and Metastasis, in eLS 1-9 (2016). 47. Freyer, A. M., Johnson, S. R. & Hall, I. P. Effects of growth factors and extracellular matrix on survival of human airway smooth muscle cells. Am. J. Respir. Cell Mol. Biol. 25, 569-576 (2001). 48. Chung, K. F. The role of airway smooth muscle in the pathogenesis of airway wall remodeling in chronic obstructive pulmonary disease. Proc. Am. Thorac. Soc. 2, 347-54; discussion 371-2 (2005). 49. Chen, G. & Khalil, N. TGF-beta1 increases proliferation of airway smooth muscle cells by phosphorylation of map kinases. Respir. Res. 7, 2 (2006). 50. Ojiaku, C. A., Yoo, E. J. & Panettieri, R. A., Jr. Transforming Growth Factor β1 Function in Airway Remodeling and Hyperresponsiveness. The Missing Link? Am. J. Respir. Cell Mol. Biol. 56, 432-442 (2017). 51. McMillan, S. J., Xanthou, G. & Lloyd, C. M. Manipulation of allergen-induced airway remodeling by treatment with anti-TGF-beta antibody: effect on the Smad signalling pathway. J. Immunol. 174, 5774-5780 (2005). 52. Johnson, P. R. et al. Airway smooth muscle cell proliferation is increased in asthma. Am. J. Respir. Crit. Care Med. 164, 474-477 (2001). 53. Doeing, D. C. & Solway, J. Airway smooth muscle in the pathophysiology and treatment of asthma. J. Appl. Physiol. 114, 834-843 (2013). 54. Takizawa, H. et al. Increased Expression of Transforming Growth Factor-β1 in Small Airway Epithelium from Tobacco Smokers and Patients with Chronic Obstructive Pulmonary Disease (COPD). Am. J. Respir. Crit. Care Med. 163, 1476-1483 (2001). 55. Stanzel, R. D. P., Lourenssen, S., Nair, D. G. & Blennerhassett, M. G. Mitogenic factors promoting intestinal smooth muscle cell proliferation. Am. J. Physiol. Cell Physiol. 299, C805-17 (2010). 56. Graham, M. F., Bryson. G. R. & Diegelmann, R. F. Transforming growth factor beta 1 selectively augments collagen synthesis by human intestinal smooth muscle cells. Gastroenterology 99, 447-453(1990). 57. Zhang, H., Xiong, Z.-M. & Cao, K. Mechanisms controlling the smooth muscle cell death in progeria via down-regulation of poly(ADP-ribose) polymerase 1. Proc. Natl. Acad. Sci. U.S.A 111, E2261-70 (2014). 58. Aliper, A. M. et al. Signalling pathway activation drift during aging: Hutchinson-Gilford Progeria Syndrome fibroblasts are comparable to normal middle-age and old-age cells. Aging 7, 26-37 (2015). 59. Bierie, B. et al. Abrogation of TGF-beta signalling enhances chemokine production and correlates with prognosis in human breast cancer. J. Clin. Invest. 119, 1571-1582 (2009). 60. Shull, M. M. et al. Targeted disruption of the mouse transforming growth factor-beta 1 gene results in multifocal inflammatory disease. Nature 359, 693-699 (1992). 61. GTEx Consortium. The Genotype-Tissue Expression (GTEx) project. Nat. Genet. 45, 580-585 (2013). 62. Andersson, R. et al. An atlas of active enhancers across human cell types and tissues. Nature 507, 455-461 (2014). 63. Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. (2014). doi:10. 1101/002832 64. Dams-Kozlowska, H. et al. A designer hyper interleukin 11 (H11) is a biologically active cytokine. BMC Biotechnol. 12, 8 (2012). 65. Sarah J. Holdsworth-Carson, Marina Zaitseva, Beverley J. Vollenhoven, Peter A. W. Rogers; Clonality of smooth muscle and fibroblast cell populations isolated from human fibroid and myometrial tissues, MHR: Basic science of reproductive medicine, Volume 20, Issue 3, 1 Mar. 2014, Pages 250-259. 66. Nierth-Simpson E N, Martin M M, Chiang T-C, et al. Human Uterine Smooth Muscle and Leiomyoma Cells Differ in Their Rapid 170-Estradiol Signaling: Implications for Proliferation. Endocrinology. 2009; 150(5):2436-2445. 67. Leibsohn S, d'Ablaing G, Mishell D R Jr, Schlaerth J B. Leiomyosarcoma in a series of hysterectomies performed for presumed uterine leiomyomas. Am J Obstet Gynecol 1990; 162:968-74; discussion 974-6. 68. Hussain N, Quezado M, Huizing M, Geho D, White J G, Gahl W, Mannon P. Intestinal disease in Hermansky-Pudlak syndrome: occurrence of colitis and relation to genotype. Clin Gastroenterol Hepatol. 2006 January; 4(1):73-80. 69. Wang, L. & Lyerla, T. Histochem Cell Biol (2010) 134: 205.