MVD as epigenetic marker for the identification of immune cells, in particular CD56+ NK cells

Abstract

The present invention relates to a method, in particular an in vitro method, for identifying CD56+ NK cells, comprising analyzing the methylation status of at least one CpG position in the mammalian gene region for mevalonate (diphospho) decarboxylase (MVD), wherein a demethylation or lack of methylation of said gene region is indicative for a CD56+ NK cell, when compared to a non-CD56+ NK cell. The analyses according to the invention can identify CD56+ NK cells on an epigenetic level and distinguish them from all other cells in complex samples, such as, for example, other blood or immune cells. The present invention furthermore provides an improved method for quantifying CD56+ NK cells, in particular in complex samples. The method can be performed without a step of purifying and/or enriching cells, preferably in whole blood and/or non-trypsinized tissue.

Claims

1. A method of producing and detecting an amplicon from a bisulfite treated human mevalonate diphosphate decarboxylase (MVD) gene, the method comprising: (a) bisulfite treating human genomic DNA from a sample comprising human immune cells to convert unmethylated cytosines to uracils; (b) amplifying a region of the human MVD gene from the bisulfite treated DNA using methylation specific primers to produce an amplicon comprising thymine-guanine (TG) at TG positions 255 and 269 of SEQ ID NO: 2- and c) detecting the amplicon with a probe comprising the nucleic acid sequence of SEQ ID NO: 8.

2. The method according to claim 1, wherein the TG are detected by a method selected from a methylation specific enzymatic digest, bisulfite sequencing, promoter methylation analysis, CpG island methylation analysis, methylation-specific PCR (MSP), quantitative polymerase chain reaction (qPCR) assay, methylation-sensitive single-nucleotide primer extension (MsSNuPE), and other methods relying on a detection of amplified DNA.

3. The method according to claim 1, further comprising comparing a relative amount of a methylation frequency in the region of the human MVD gene with relative amounts of a methylation frequency in a human control gene.

4. The method according to claim 1, wherein said sample is selected from blood, a tissue, or an organ.

5. The method according to claim 1, wherein said method is performed without a step of purifying and/or enriching said human immune cells.

6. The method according to claim 1, wherein said human suffers from or is likely to suffer from an autoimmune disease, transplant rejection, infection disease, cancer, and/or allergy.

7. The method of claim 1 performed using a kit comprising a) a bisulfite reagent, and b) materials for the analysis of the methylation status of CpG positions selected from the CpG positions in the region according to SEQ ID NO: 1.

8. The method according to claim 1, wherein the amplifying comprises using an oligomer according to any of SEQ ID NOs: 4-7 or 9-11.

9. The method according to claim 3, wherein the control gene is human glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

10. The method according to claim 5, wherein the sample is whole blood and/or non-trypsinized tissue.

11. The method according to claim 1, wherein the human genomic DNA is from a blood sample.

12. The method according to claim 1, further comprising d) detecting a methylation status of cytosine-phosphate-guanine (CpG) positions from the amplicon.

13. A method of producing and detecting an amplicon from a human mevalonate diphosphate decarboxylase (MVD) gene, the method comprising: (a) bisulfite treating DNA from a human sample to generate bisulfite treated DNA where unmethylated cytosines are converted to uracils, (b) amplifying with polymerase chain reaction (PCR) a region of the bisulfite treated DNA corresponding to a human mevalonate diphosphate decarboxylase (MVD) gene to produce the amplicon from the bisulfite treated DNA, and c) detecting the amplicon with a probe comprising the nucleic acid sequence of SEQ ID NO: 8, wherein the PCR is performed with methylation specific primers that amplify SEO ID NO: 2.

14. The method of claim 13, wherein the sample is a blood sample.

15. The method of claim 13, further comprising d) detecting a methylation status of at least one cytosine-phosphate-guanine (CpG) position of SEQ ID NO: 1 from the amplicon.

16. The method of claim 1, wherein the amplicon comprises SEQ ID NO: 2.

17. The method of claim 1, wherein the step of amplifying uses methylation specific primers that amplify SEO ID NO: 2.

18. The method of claim 13, wherein the amplicon comprises SEQ ID NO: 2.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the analysis of CpG sites on amplicon No. 2674 (SEQ ID NO: 1) according to the invention. The horizontal boxes in the table correspond to the CpG positions in the amplicon as analyzed (e.g. CpG 1, 2, etc.) with the positions indicated (67, 76, 90, 117, 153, 177, 182, 210, 219, 255, 269, 292, 301, 321, 338, 370, 375, 388, 392, and 412, corresponding to CpG 3, 4, . . . etc.), and the columns correspond to the cell types as analyzed. The abbreviations at the bottom indicate BLC25=B-lymphocytes; CTL01=CD8.sup.+ cytotoxic T-cells; GRC52=granulocytes; MOC26=CD14.sup.+ monocytes; NKC15=CD56.sup.+ NK-cells; and THC14=CD4+ Helper T-cells, respectively.

(2) FIG. 2, parts A and B, are a series of graphs depicting the TpG-specific PCR-system using plasmid-DNA test-template (A) and the CpG-specific PCR-system using plasmid-DNA test-template (B).

(3) SEQ ID NO: 1 shows the genomic sequence of amplicon AMP2674 according to the present invention.

(4) SEQ ID NOs: 2 and 3 show the sequences of bisulfite-converted target-regions of preferred qPCR-assay-systems of the invention.

(5) SEQ ID NOs: 4 to 11 show the sequences of specific oligomers (primers and probes) according to the present invention.

EXAMPLES

Example 1

(6) In order to identify CD56+ NK cells, qPCR was performed on bisulphite converted samples stemming from the human genomic region according to the following sequence (AMP2674, SEQ ID NO: 1), relevant CpGs are shaded in gray:

(7) TABLE-US-00001

(8) For the actual epigenetic profiling of the amplicon region in blood cell subtypes, the immune cell populations as analyzed were as follows (see FIG. 1) BLC25=B-lymphocytes CTL01=CD8+ cytotoxic T-cells GRC52=granulocytes MOC26=CD14+ monocytes NKC=CD56+ NK-cells NKT=CD56+CD3+ NKT-cells THC14=CD4+ Helper T-cells

(9) The bisulfite-converted target-regions of preferred qPCR-assay-system as developed were:

(10) TABLE-US-00002 TpG-specific (SEQ ID NO: 2): 0 CpG-specific: (SEQ ID NO: 3):

(11) The respective sequence of the assay-target region is underlined.

(12) The following primers and probe were used for the qPCR:

(13) TABLE-US-00003 Forward amplifica- 2674r GGTGTGGGTTTGAGTTTATTT  tion primer (SEQ ID NO: 4) Reverse amplifica- 2674q AACCCCTAATTTCCTTCTTACT  tion primer (SEQ ID NO: 5) Forward primer 2674r_T_fw GTTTTGTGGTATTTTTATAGAGTAGT  TpG-specific (SEQ ID NO: 6) Reverse primer 2674q_T_rev AGATGGGATGGAATGGTTGT  TpG-specific (SEQ ID NO: 7) Probe TpG- 2674_TP CCTAAACCACCTCTTCCCCTACA  specific (SEQ ID NO: 8) Forward primer 2674r_C_fw TTTTGTGGTATTTTTATAGAGTAGC  CpG-specific (SEQ ID NO: 9) Reverse primer 2674q_C_rev CCATATACGCCCTCCTCG  CpG-specific (SEQ ID NO: 10) Probe CpG- 2674_CP AAACCGCCTCTTCCCCTACG  specific (SEQ ID NO: 11)

(14) The specificity of the TpG-specific PCR-system was demonstrated using test-templates (plasmid-DNA) as shown in FIGS. 2A-2B.

(15) The cell type specificity (as measured by qPCR) was found as follows:

(16) TABLE-US-00004 Type of immune cell qPCR-Detection [%] CD56+ NK-cells 93.29 CD56+CD3+ NK T-cells 8.94 CD56++ NK-cells (“bright”) 1.43 B-cells 0.46 CD14+ monocytes 0.28 CD8+ T-cells 1.75 CD4+ T-cells 0.24 CD15+ granulocytes 0.33