B3 TRANSCRIPTION FACTOR GENE FOR SIMULTANEOUSLY IMPROVING LENGTH, STRENGTH AND ELONGATION OF COTTON FIBERS AND USE THEREOF

20230323382 · 2023-10-12

    Inventors

    Cpc classification

    International classification

    Abstract

    Providing a B3 transcription factor gene for simultaneously improving length, strength and elongation of cotton fibers. The cDNA sequence of gene GHFLS in tetraploid upland cotton TM-1 is SEQ ID NO. 1, and the genome sequence is SEQ ID NO. 2; GHFLS contains a non-synonymous mutation SNP, located at 1391 bp of the coding region with the base changing from A to G and the corresponding amino acid changing from Lys to Arg. The GHFLS gene was overexpressed in Arabidopsis thaliana caused a significant reduction in the root length of the T2 generation, demonstrating its important role in the cell elongation mechanism. The fiber quality of the cotton variety (line) with haplotype AA is significantly better than that with haplotype GG. The gene has important research value and application prospect in efficiently identifying high-quality fiber upland cotton varieties, improving cotton fiber quality and cultivating new varieties of high-quality cotton fibers.

    Claims

    1. A B3 transcription factor gene GHFLS for simultaneously improving length, strength and elongation of cotton fibers, wherein, a genomic sequence of the gene is as shown in SEQ ID NO. 2; the B3 transcription factor gene GHFLS comprises a non-synonymous mutation SNP locus, which is located at 1391 bp of a coding region sequence, wherein a base of the SNP locus changes from A to G, and the corresponding amino acid changes from Lys to Arg.

    2. Use of the transcription factor gene GHFLS according to claim 1 in identifying an upland cotton variety with high-quality fibers.

    3. The use according to claim 2, comprising detecting the SNP locus, and selecting a cotton with a base A at 1391 bp of the coding region sequence is as a high-quality fiber cotton variety.

    4. The use according to claim 3, wherein, a primer for detecting the SNP locus is specifically an upstream primer as shown in SEQ ID NO. 5 and a downstream primer as shown in SEQ ID NO. 6.

    5. Use of the transcription factor gene GHFLS according to claim 1 in culturing a new variety with high-quality cotton fibers by genetic engineering.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0023] FIG. 1 shows the GWAS correlation analysis results of different yield traits of cotton;

    [0024] FE, FS and FL represent fiber elongation, fiber strength and fiber length, respectively; the abscissa indicates the position (Mb) on the chromosome, and the ordinate indicates the significance of SNP locus association, which is represented by −log.sub.10(P value).

    [0025] FIG. 2 shows the expression levels of GHFLS in different tissues and development stages of cotton;

    [0026] the abscissa represents different tissues, including Root, Stem, Leaf, ovule and fiber; the ovule tissue includes those collected 3 and 1 days before flowering, the day of flowering and 1 to 25 days after flowering, and the fiber tissue includes those collected 5 to 25 days after flowering.

    [0027] FIG. 3 shows the sequence information of GHFLS and identification of different haplotypes;

    [0028] there is a non-synonymous mutation SNP locus in the GHFLS sequence in the variety population, which is located at the position of 1391 bp in the genome sequence; the base of this SNP locus changes from A to G, and the corresponding amino acid changes from Lys to Arg.

    [0029] FIG. 4 shows the comparative analysis of yield traits among different haplotypes of GHFLS;

    [0030] the box represents the distribution of quality traits of the variety population; the abscissa refers to different planting environments, and the ordinate refers to the corresponding quality traits, namely fiber elongation, fiber strength and fiber length; there are 280 and 118 varieties containing AA and GG haplotypes respectively; white represents the distribution of quality traits of haplotype AA, and black represents the distribution of quality traits of GG; the horizontal line in the box represents the median value of character distribution; * * means there is a difference at the level of 0.01; * means there is a difference at the level of 0.05.

    [0031] FIG. 5 shows that the GHFLS gene negatively regulates the root development of Arabidopsis thaliana;

    [0032] the left box diagram represents the root length statistics of transgenic Arabidopsis thaliana and wild type; the ordinate is the root length of Arabidopsis thaliana, and * * indicates the difference at the level of 0.01; the photo on the right is the root growth photo of transgenic Arabidopsis thaliana and wild type in different strains.

    DESCRIPTION OF EMBODIMENTS

    Example 1 Excavation of Transcription Factor Gene GHFLS Related to Cotton Quality Traits

    [0033] According to 486 modern upland cotton varieties or strains, the quality traits (fiber elongation, fiber strength, fiber length, micronaire value, fiber uniformity) were investigated in detail from 2016 to 2017 by planting three replicates in each variety field in Korla, Xinjiang and Shihezi, Xinjiang. At the same time, the these 486 cotton varieties (lines) were subjected to genome-wide re-sequencing, and 7.55 Tb sequencing data were obtained, with an average sequencing depth of 10.51×. These sequences were compared to the genome sequence of cotton upland cotton TM-1, and the whole genome SNP was identified by bioinformatics software. A total of 4 489 601 high-quality SNPs (a minimum gene frequency >0.05) were excavated for subsequent analysis. Firstly, genome-wide association study was performed, and then SNP signal correlation loci were screened according to P<1×10.sup.−6. By analyzing these correlation loci, we found that a SNP signal correlation locus (D11:23877270) on D11 chromosome can simultaneously correlate three quality traits of fiber elongation, fiber strength and fiber length (FIG. 1). This SNP locus was located in the exon region of the gene, and causes the mutation of the amino acid sequence. The gene is a B3 transcription factor family gene named GHFLS.

    Example 2 Acquisition of Transcription Factor Gene GHFLS

    [0034] A cDNA sequence and a genome sequence of GHFLS were obtained from the genome sequence of upland cotton, see SEQ ID NO. 1 and SEQ ID NO. 2. According to the two ends of cDNA, full-length primers were designed for PCR amplification, and the primer sequences were F1: SEQ ID NO. 3 and R1:SEQ ID NO. 4. The PCR reaction procedure was as follows: pre-denaturing at 94° C. for 5 min; denaturing at 94° C. for 30 sec, annealing at 60° C. for 1 min, stretching at 72° C. for 1 min for 30 cycles; at last, extending at 72° C. for 10 min. The PCR products were sequenced and compared with cDNA to determine the accuracy of the sequence.

    Example 3 Expression Level Analysis of GHFLS in Different Tissues and Development Stages of Cotton

    [0035] In this experiment, RNA samples from different tissues and development stages of cotton TM-1 were collected for transcriptome sequencing. The samples included roots, stems, leaves, ovules and fibers. Ovule tissue included those collected 3 and 1 days before flowering, the day of flowering and 1 to 25 days after flowering. The fiber tissue included the those collected 5 to 25 days after flowering. Transcriptome sequencing was carried out on an Illumina HiSeq 2500 platform, and the average sequencing depth of each sample reached 6 Gb. The gene expression level was calculated by comparing the sequenced reads with the upland cotton genome, and the calculated expression level was expressed by the number of sequencing fragments contained in every thousand transcription sequencing bases per million sequencing bases (FPKM). The experimental results are shown in FIG. 2. This gene was preferentially expressed in ovules of TM-1 cotton 3 and 1 days before flowering, and ovules and seeds of 1, 3, 5, 10 and 20 days after flowering, which indicated that this gene was related to fiber quality traits.

    Example 4 Use of B3 Transcription Factor Gene GHFLS in Identifying High-Quality Cotton Varieties and Improving Quality Traits

    [0036] Based on the position of SNP locus (D11:23877270) on chromosome D11, genome amplification primers were designed at both ends, and the primer sequences were F2: SEQ ID NO. 5 and R2: SEQ ID NO. 6. By using this pair of primers, the DNA of 486 varieties was amplified by PCR and sequenced. The PCR reaction procedure was as follows: pre-denaturing at 94° C. for 5 min; denaturing at 94° C. for 30 sec, annealing at 58° C. for 1 min, and stretching at 72° C. for 45 sec for 30 cycles; at last, extending at 72° C. for 10 min. According to the sequencing results, the genotype of each population at the SNP locus was analyzed. It was confirmed that the GHFLS sequence contained a non-synonymous mutation SNP locus, which was located at the position of 1391 bp in the genome sequence. The base of this SNP locus changed from A to G, and the corresponding amino acid changed from Lys to Arg. According to the base information of this SNP locus, modern upland cotton varieties (lines) can be divided into AA and GG haplotypes (FIG. 3).

    [0037] According to that genotype of SNP pair at the 1391 bp position of the GHFLS genome sequence, 280 haplotype AA material and 118 haplotype GG materials were identified from this natural population (FIG. 3 and table 1). Among them, Deltapine cotton 15, Stoneville cotton 2B, 108ϕ, KK1543, 611custom-character, which have made outstanding contributions to the breeding of upland cotton varieties in China, are all high fiber quality haplotypes AA, which further reflects the far-reaching influence of cotton varieties in America and Central Asian countries such as and Uzbekistan on the improvement of cotton varieties in China (Fang et al., 2017; Han et al., 2020). Most varieties bred in Xinjiang are GG haplotype, which indicates that high fiber quality haplotype AA has important utilization value.

    [0038] By using t-test statistical test method, the correlation of quality traits between two groups of haplotypes was calculated (FIG. 4). The results showed that the fiber elongation of haplotype AA was superior to that of GG haplotype cotton in three environments, namely, the average values of Korla in 2016, two points in two years (2016 Shihezi, 2016 Korla, 2017 Shihezi, 2017 Korla) and the average values of Korla in 2016 and 2017, showing extremely significant differences (P<0.01); the fiber strength of haplotype AA was also significantly higher than that of GG haplotype material in Korla environment in 2016 (P=0.032); at the same time, the fiber length of haplotype AA was superior to that of GG haplotype materials in the average of two points in two years in 2016 Korla, 2016 Shihezi, 2017 Shihezi, and the averages of Korla in 2016 and 2017 and the averages in two years in Shihezi (P<0.01).

    [0039] A GHFLS gene overexpression vector CaMV 35S::GHFLS (vector name pBinGFP4) was constructed, and Arabidopsis thaliana was infected by dipping flowers. The positive plants were identified by kanamycin sulfate screening and PCR detection. By way of selfing and screening, homozygous T2 positive clones were obtained. The root lengths of different strains of Arabidopsis thaliana overexpressing GHFLS and that of wild-type were compared, and it was found that the root length of overexpressed Arabidopsis thaliana was significantly shortened (FIG. 5). The results further prove that the GHFLS gene plays an important role in cell elongation mechanism.

    [0040] It can be seen from the above results that the gene GHFLS has important research value in improving cotton quality traits and cultivating new varieties of high-quality cotton fibers. On the one hand, molecular markers can be designed according to the haplotype of the gene GHFLS, so as to effectively identify cotton quality traits, which has a good application value in the research of breeding high-quality fiber cotton varieties. On the other hand, the gene containing high-quality haplotype AA can be transferred into cotton varieties by means of genetic engineering to improve cotton quality, or the SNP locus in haplotype GG can be subjected to site-specific mutagenesis and transformed to a high-quality haplotype to cultivate new cotton varieties of high-quality fibers.

    TABLE-US-00001 TABLE 1 Identification of haplotypes with high fiber quality and low fiber quality in population varieties Haplotype Name of variety (line) AA Guannong No. 1 Jinyu No. 5 Han cotton 559 Arcot-1 High Si-1 Xinluzao No. 41 Han 685 Deltapine cotton 16 quality Xinluzao No. 10 Jinxiu cotton 99B DP99B fiber No. 1 Jinke 707 Jiang No. 1 Han 5158 Zhongzhi cotton No. 2 Xinluzhong Acala SJ-5 Liao 96-63-70 D208 No. 35 Liao cotton 10 DELFOS 531C Ji 151 Handan 109 Zhongmiansuo 16 Su cotton 22 Chuangzao 2 86-1 Ji cotton 616 Ji 668 Guoxin cotton 11 Jinzi cotton Xinluzao No. 12 Er cotton 14 L0014 Ji 1516 Qin 514 Han 7860 Deltapine Yu cotton No. 8 cotton 15 Heishan cotton 601 Department 7 Erjing No. 1 No. 1 Wan cotton 73-10 Jin cotton 28 Original 32 Zhongmiansuo 79 Wan cotton 17 Wan cotton No. 3 Xinluzao No. 3 Zhongmiansuo 35 Zhongmiansuo Jin cotton 29 Xinluzao No. 21 Yu cotton 20 No. 45 Xiang cotton 13 Xinshi H8 Xiaoxian Daling Xinluzao No. 59 Sheng cotton Xilunzhong Yu cotton 15 Zhongmiansuo 17 No. 1 No. 40 Xinluzhong Yinshan No. 6 Sun Zhong Zhongmiansuo 30 No. 13 long staple Huiyuan 15-1 Xinzhi cotton Lu cotton No. 9 GK99-1 No. 5 Xiang cotton Brazil 001 Zhongmiansuo Yu cotton 11 No. 11 No. 9 Cooperative Liao cotton No. 1 Yu cotton 19 Shiduan 5 cottonseed in Brazil Zhong 50 Liao cotton 9 SGK321 Chuan 01 Western Indian D201 Zhongmiansuo 49 Lumianyan 28 cotton Brazil wool 9D208 Zhongmiansuo 27 Ao cotton 618 Ji cotton No. 1 Xinluzao No. 47 Xinluzao No. 22 Zhongmiansuo 25 Su cotton No. 5 Xinzhong No. 41 Guoxin cotton 3 Xuzhou 142 Liu cotton No. 2 29-64 Hua 101 Si cotton No. 3 2010 cited Bazhou 5409 Si cotton 2B Chuan 65 Ji cotton No. 7 Zhonglvxu No. 1 LE-6 Nongxin No. 1 Shan 401 Zhengnong cotton Su cotton No. 2 Shaanxi 920346 No. 4 Chuan cotton 56 Jin cotton 19 Ejing 92 Xinluzao No. 15 Xinluzao No. 6 GK164 Yun 219 E cotton 17 HZ06331 Zhong 915 M14 thin wool K7 Xinluzhong No. 7 14JSC3 Yu cotton No. 5 Renhe No. 39 Moyu No. 1 Xian III9704 Er cotton 21 KK 1543 Eguang cotton Xiang SC-24 Zhongmiansuo 108Φ No. 3 Er cotton No. 4 Shan cotton No. 1 Yuzao 95-408 Daling cotton (Chaoyang) Lu cottonyan 22 Huazhong 910102 Chuan 267 611 custom-character Xinluzhong No. 9 Zhongmiansuo Er cotton 20 602 No. 42 Chuan cotton 45 Zhongmiansuo Su cotton 9 Wangjiang long- No. 64 staple cotton Shizao No. 2 Zhongmiansuo 41 cotton 20 Brazil 004 PAYMASTER54 E cotton 16 Ji cotton 15 Xinzhong No. 21 E cotton 10 Ba cotton No. 3 Su cotton 15 Shan cotton No. 6 Huihe 38 NC20B Ji cotton 11 COKER'S FOSTER Er cotton 12 217 E cotton 2 Xinzhong No. 23 Erkang cotton 3 Ji 122 Zhongmiansuo 44 Hua cotton No. 5 Erkang cotton 9 Zhongmiansuo Erjing 8891 Zheng cotton 18 No. 58 Lu cotton 10 Fu cotton No. 6 Han cotton 802 Liao 61107 Xinluzao No. 39 Lu cottonyan 16 Lu cotton No. 1 Kangsanxing peach Ji cotton 10 Zhong 412 Xinluzao No. 29 Wan cotton No. 9 New B1 Shiyuan 321 Brazil 007 Xinluzao No. 58 Xinluzao No. 40 Lanker 207 Lu cottonyan 32 Xuzhou 514 Zhongmiansuo 23 cotton No. 1 Su cotton 11 TM-1 52-128 Brazil 015 Xinzhong No. 29 Xinzhong No. 45 Si cotton No. 1 Brazil 0101 4005 Xinluzao No. 49 Zhongmiansuo 19 Xuzhou Banban Antiyellowing cotton Indian bract leaf Jin cotton 12 LE Xinzhong No. 26 Ke 178 JB298 Zhongmiansuo Yuan 93 No. 10 Kang 393 Xinluzhong No. 1 Changrong Brazil 014 Zhong 27 cotton 69 Xinluzao No. 50 Han cotton 103 Guo cotton 9 Zhengzhou long staple cotton Su cotton 20 6193 Xinluzao No. 37 Bao 6722 Hu cotton 204 Han 4104 Yu cotton No. 1 K2 Chuan D9809 Xinzhong No. 28 Jing cotton SGK958 Xinluzao No. 60 Zhong C3787 Dunhuang 77-116 Xinzhong No. 30 Xinluzao No. 51 Aizi cotton 927 Zhongmiansuo 24 Su 7235 Lu cottonyan 29 Xinluzao No. 24 Zhongmiansuo 43 Lu cottonyan 21 Xuzhou 58 Zhong 35 Xuzhou Datao JCG53 Shi cotton No. 1 Zhongmiansuo DP2824-092 Yinrui 361 No. 50 Shikang 126 Liao cotton 6611 97-4-2 Department 8-1 Xinluzao No. 13 Cotton -2 Acala SJ-1 Ji cotton 958 Xuzhou 209 Medium C378 Brazil 011 Xinzhong No. 47 GG Xinzhi No. 5 Xinluzhong No. 3 50-15 Xinzhong No. 19 Low fiber Xinluzao No. 9 Sha 2 Jin cotton No. 6 TRICE quality 27-15K 666 Xiang cotton 16 Liao 18 Xinluzao No. 11 97-3-24-1-1 Su cotton 12 Zhong 36 Zhong 30 Siyang 331 Line 5 introduced 46-13 individual plant Xinluzao No. 72 Yanzao No. 2 Chaoyang cotton Xinluzao No. 16 No. 2 Jin cotton No. 11 Xinluzao No. 54 Xinluzao No. 53 Yinshan No. 8 Xiang cotton Xinluzao No. 48 Liao cotton 17 Chuan 737-1 No. 10 62-17 Su cotton No. 3 Arcot 402bne Handan 173 Xinzhong No. 12 29-1 SW1 18-3 Xinluzao 62 Xinzhong No. 14 X933 609 Xinzhong No. 11 Yuzao 73 14-21 Jin cotton No. 2 Xinluzao No. 5 Xinluzao No. 61 Xinluzao No. 46 Ken 0074 Xinluzao No. 2 Xinluzao No. 42 Liao No. 19 C1470 Ji cotton 27 Liao cotton 19 Jinzhong 119 66-241 Xinzhong No. 10 Xinluzao No. 35 DB3 Xinluzao No. 18 Er cotton 6 Xinluzao No. 7 Chuan 338 9456D K1 98-17 Beiche No. 1 71-7 Xinluzao No. 32 Xinluzao No. 8 Zhong 295-7 Salt No. 1 Xinluzhong No. 6 Xinzhong No. 34 115-23 Jin cotton 18 Xinluzao No. 26 Liao 229 Yinshan No. 7 Xinzhong No. 20 Xinluzao No. 38 Si cotton No. 4 98-1 9884 Xinzhong No. 48 822 variant strain Line 7-1 Xinluzao No. 17 Xinluzao No. 1 GK24 ShiZao3 Zhong 870203 Ken 1042 9456D-1 B99621 Xinzhong No. 32 Xinluzao No. 33 Xiang 4108 Xinluzao No. 28 Zhong cotton 36 Yu cotton 18 Yu cotton 112 Xinluzao No. 20 Chaoyang cotton No. 1 Y- bud yellow Jin 10 Shu cotton No. 1 Shuihu cotton 72-8 97-3-12-1 Xinluzao No. 25 Liao cotton 18 2-67 Jing cotton No. 1 MA-6

    TABLE-US-00002 Sequence Listing SEQ ID NO. 1: Cotton B3 Transcription Factor Family Gene GHFLS cDNA Sequence atggatcgaa gggtgaagaa ggaagctgaa gagataccgc aaagaacgat gtcatttgct 60 ggtcggagac ttaaatctgc tggtgaagaa gacttcatcc tcgctctctc aactcacact 120 cctaagctca acccttcttc ttcggaaaag aaggaaatta gtaagaaggc taatgcgtta 180 actgagagaa aacagaagcg aaagaagtgc caatccgaga ccataattaa acctgcagtg 240 tcagattgtg gggagaagaa aataagctct atgaaaaata aggacgtagg tgatggaaga 300 tgcatagctg aaattaagtc tccagctatg atttgtgcag aggaaattca atcaaaccta 360 gaacctgaat ttcccagttt tgcaaaatct ttggttagat cacatgtcgg aagctgtttt 420 tggatggggc ttccggggat gttctgtaaa atacatttac ctaggaaaga tactacaatc 480 actttggaag acgagagtgg gaaccaattt catgtaaaat actacgctga taaaacggga 540 ttgagtgcag gttggagaca gttttgtagt gcccataatt tgcttgaggg ggatgttttg 600 gtcttccagt tagttgagcc aaccaagttc aagatataca taataagggc acatgattta 660 aatgaattgg atggggctct tggcctccta aatttggatg cttatacaaa acaaagtgat 720 gcagatgatg cagaaactgg tccaacggtc tctaaaagta caaagaggaa acgtccaaaa 780 cctcttccac tagcttctgt taggaagaag aacaagaggt ctggcctaca aagattgtct 840 tgtaacgttg ggcagccggc agagcaatct gaaaatgata gtgaagaagt tggttcagaa 900 gttttggaag gtttcaagcg aaccgagtct gcaattcaat tcaaagacat aacaagtttc 960 gagaacatat tggttgatgg cttggttata gatcctgagc tctcggaaga cattcgcagt 1020 aaatactacc agctatgctg tagtcaaaat gcttttcttc atgaaaatat tatccagggt 1080 ataagtttta aatttaaagt tggaattatt tccgaaactg tcaatattgc tgatgctata 1140 agaacttgca agctcacaac ttctcgagat gaatttgata gttgggacag gaccttgaaa 1200 gcctttgagt tgttgggcat gaatgttggt ttcttacgaa ctcgtcttca ccggcttgta 1260 aaccttgcat ttgaatcaga aggtgctgct gagacaagga ggtattttga agctaaagca 1320 gaacgagatc agacagagaa tgagatacga aaccttgaag caaaactcac ggagctgaag 1380 gatgcaagta aaacctttgg atttgaaatc gagagtttgc aatctaaagc ggaaacaaat 1440 gaattcaggt ttgagaaaga agttaaggct ccatggtga 1500 SEQ ID No. 2 Cotton B3 Transcription Factor Family Gene GHFLS DNA Sequence atggatcgaa gggtgaagaa ggaagctgaa gagataccgc aaagaacgat gtcatttgct 60 ggtcggagac ttaaatctgc tggtgaagaa gacttcatcc tcgctctctc aactcacact 120 cctaagctca acccttcttc ttcggtctct ctctctctct ttcttcttct ttctttactt 180 cttgctttca gtttgtttag ctggattttg aaacaaaacg atagaaacta aagattctga 240 aagaaaatat gttagatctc gtacttgttg ctgtagtttt tattttcttc aaaaaagatc 300 tttagaaggt tcgtactgtc tttgcttgat tgataattat attcattgca ttatatttta 360 tttttgcagg aaaagaagga aattagtaag aaggctaatg cgttaactga gagaaaacag 420 aagcgaaaga agtgccaatc cgagaccata attaaacctg taaaaccttt tttcttcctc 480 ttgttttttt tttgtttaaa tttgttaaat atttttctac ggctattata gaaatattta 540 tgaccaaatg actcaactgt agtctcaaag ttccaaaatc attgcagaga accaatattt 600 gaatgattgc tttttttttt cctttctcaa ttcccaagat tgttttgaaa gagtcaaaag 660 aaaacacata gtagaataat gctaataaat taaacaaaat tggcaactta tgagcaagga 720 gacagaggta aacttatttt ccatggtcaa actggttgcc gtatggaatg gattagaaca 780 gagaatttct aatttcaaac ttccagcaag aattgtttgt cttttatctc agattaatta 840 gcactaacaa ataaatttcc ggacaggcag tgtcagattg tggggagaag aaaataaggt 900 cagtgaacta tccaaaagaa tggaatctgc gtatgctgtt ttactgcttt tggattaatt 960 gtctgatgat gtttaccttt tttttaatga agctctatga aaaataagga cgtaggtgat 1020 ggaagatgca tagctgaaat taagtctcca gctatgattt gtgcagagga aattcaatca 1080 aacctagaac ctgaatttcc cagttttgca aaatctttgg ttagatcaca tgtcggaagc 1140 tgtttttgga tggttagctc cgttaaatgc tataattcac cttgtataat tatatttact 1200 ttttttttga ggtttgtggg atgggtgggg ctaagcctga taacgaaaca gggaatgtgg 1260 ttggccttaa tcttagtcgc agctgccttg ttggccccat cccctccagc ggcaccctct 1320 tcctgctcta ccatctccac gagcttaacc ttgcttacag tgatttcaat tggtccccaa 1380 taggatacca gttttgtcag tttactgtgt tgacccatct aaacatcttt cattaaaaaa 1440 tttcaggttc aattccatta gtagtctctc acctttctaa actattatcc cttgatctat 1500 cctatgatga tggtttgatc tttgaagggg atgtcattaa aaatgttgtg ggaaagttga 1560 cacaactaag acaccttctg ctctcatttg ataggtgtct tagttgtgtc aagtttctca 1620 tgacattttc caaagagatg cccttcagat ataagtcatt ataggataga ccaagggttg 1680 atagtttaga aagttgatag attgttaatg gaattttacc tgaaagtttt gattgagaga 1740 tatttatatg ggtcaacatg gtaaactgac caaactaaga tgctattggg taccaattca 1800 aataattgta agcaaggtta agcttatgga gatggtggag gaggaagagg gtgctgttag 1860 tgggcatagg gccaacatag cagttgcaac taagatcaag gcaaatcaca gtacctgttt 1920 gtgtcacact taaccccacc gcacaaatgt agctctgttt tttgaagttt agcccttgat 1980 taacttgtaa ataatgaact ttttgaggtg tatttgtgat agtttctttt ttcttttgac 2040 aggggcttcc ggggatgttc tgtaaaatac atttacctag gaaagatact acaatcactt 2100 tggaagacga gagtgggaac caatttcatg taaaatacta cgctgataaa acgggattga 2160 gtgcaggttg gagacagttt tgtagtgccc ataatttgct tgagggggat gttttggtct 2220 tccagttagt tgagccaacc aagttcaagg tgatgttcaa tagctattct tcttggcttt 2280 caacttctag agcttgaggt ttatattgct tacgtgcaat atgtgattat atatctgttg 2340 atagttctgg cttgtcatta gaatttaata ttaagaggac agttccaggt gtgccatatt 2400 tccccatgtc ccaacattgg atgggcatcc actatgagtg aggggtctga tctgggatct 2460 gatcgtccaa cctaatatat gatcttctat aacagtattt gttataacat tattagtgat 2520 taaaaaaaaa gctggtaaaa tacatgtttg gatggttttt ggaaggacaa attggaaaac 2580 gcaatggaag aaaaatatgg atagagaaac aagggtgcag atgctatcta gttcaggatt 2640 gtactccttg ccctgtacgt ttcatgttgg cttttgtaga aagtttagca taggagcttc 2700 ataggtcata tatatacagc ccttaatagc atggatcaat gtctactgaa ttttgtttga 2760 tctccatctc ttgataatta ataaaggttt aacatgatca tgcatgtatt aagcctatga 2820 agctcaagtg caaatgccct atgttgttaa agttgaggaa agataggttc tacttttatg 2880 ctgctgtctt gtataactat atttttgttt caaaaaaggt taaagggtaa aaaaaaaatc 2940 cttaataaag aaaatcagaa attgattaag tccttatgaa aaaagtaatg cttaattgag 3000 tcctcggtga ctcaagaaaa ttaattagcc ccttccatta atagaaacct tcgatgatcg 3060 atttgatcac ggtcattgat gtggtagatg aaagccatga gaatttgaca tgtggctttc 3120 catatcagca aaaattaaaa aaaattaatt aaaaatttct aaaatatatt taaaaattaa 3180 ttaaaaatac acatccataa tgaatttaga gatatggacg tcctagttta tttgagttta 3240 gacacttatt tctttaggtt cattttggct gaacacaaga ctgtaaaaaa tgataaaaca 3300 ataggtgatg aattgcacca gtcgtagata aaacaatagg tgatcatgta tatctgccga 3360 aatatggtga aaaaacttac cctatatata cagacagaaa tatgatggta aaactttttc 3420 cctatttgaa ctctaattta cgaatatatt tcttttatca tgattgtgat ataataaata 3480 ttaggctaat tttctaccat gttttagcaa atatctatat tatcacttat tgttttactc 3540 tacagctatt gaagccatat tcatcaccta catatgtgta tatatataac tttttgaatt 3600 atatattaat tatttatatt atttatagtt ttatgtttgt ccagaacgaa cttggacaaa 3660 tgtgtccata ttcagatgaa cacggatgta catttgttaa attcattata gatgtgtatt 3720 tttattaatg agttagaata tttttatatt tctttgaagt ttttattgac attgcatgct 3780 gcatatcatc ttctcaatgc ttcggtctgc cacattgact gttactggtc aacaacggtt 3840 ttcgttaacg gaagcggcca attggttttc gtcattgagg aataattggg tgcatttttt 3900 tataagggct taattgattt tctttttctt tttttttatt aagggtttct tttacctttc 3960 aaccttttaa aaattaattt gtccgtacaa ctcaaggatt gttcacctta aggtcactgt 4020 gacgttatga aatgttgtta atttctcaag gtagtggccg ctttagtctt gttacactat 4080 atataaccaa gtatattaca tacctattgc atttgtattg taaaaataga tgattcacga 4140 atttttgctg cccccaaatc cacctgcaat tagaaacaat gctagtgaaa atcttgttca 4200 gcaaaatagt tttggactcc caagaagttg gttgagtaat tttactccta aagactacct 4260 ttactgttgt gatttttaac ttttatcgtt gatggtcttg aagtgatgag gtctcccttt 4320 ctcactaaga tctcttttag tgatttacca agcccggaag gtattgaatt ctgggacaac 4380 atttagataa gaaaggatct tcttaatagt tctaattatt tctggtattt ccatagctaa 4440 acttgctaaa gaatactggt tctgatcagg tcggattttg cccctcacta gtttgtaaga 4500 gctgataaac catcagatgc acaaaagctc actgattgtt gcaccaactg aagattttat 4560 atattttaaa tccaagttaa catagttagt gtttggtaaa atgttgtctg aaacacggtg 4620 ggcttatgtt taactgacaa ccatataact tttcaaatgc atggtgaggt ttgttagcag 4680 agatgttaag aaccttaatt tttattatga aaccttattc tttgagatgt agttggggcg 4740 aatgtatgaa acctgaatgt taaagattct gaaaatgtat ttgccttatt atgaggtcac 4800 acattgaagg gctaagtagg tgaaaaacaa tgtcaggggt tttagatatc taactatacg 4860 ggatatactg ttttattaag attggtctgt agtacttgag caagccgata tatcactctc 4920 caaagacttg catatgttgt tttttaagtt tgcttgattt gtaggaggaa tggagagaga 4980 caatatactt agttccagct aactacgcca gagctttaag ggtgcacttg attgagtgga 5040 aaagtggaag gagggaatgt caaggtggaa agaaaataaa ttttgaatgt gtttggtggg 5100 aaagaaaagt gagaggaaag aaaacaaaag agatgactat tttccacctt aatgcatcaa 5160 aacaaatcat tccaaattgg aatgataaga ggagagaaaa tgagaggtga atttatgcta 5220 gttaaaattt atgcattttt ctaaggtttc attttctttc tcttattttt atactctacc 5280 aagcgatgaa tggaaagaaa atttcttttt ctctcaaatt ttccattcta ttccttccta 5340 ccaagcacat cagtggaaag aaaaattata tttttcatct ttttattttt ctactcgtac 5400 aattttctat ccctccaatt tttttttctc tctttcaagt aaagcctaga agtttccata 5460 agaactacat gggtaataga gaactagtgc agagttcata ttatgtttat tccaaatcat 5520 tatatcagca aaacaaaatg actgcttagc aatgtttcta acctggcccc atcagtatat 5580 cgtagaacct aagactgcat taatataaga ggatgcaagg aattaggttt cctcctctat 5640 ttgaagggag attatctttt atttgtttta aatgcatata tttttgtgaa agtacagtta 5700 tttacattag taattactct ctatctaacg tgtatcatct tatttttgta gatatacata 5760 ataagggcac atgatttaaa tgaattggat ggggctcttg gcctcctaaa tttggatgct 5820 tatacaaaac aaagtgatgc aggcaagttg tttggtgtct ttgttaggtc tcttaattat 5880 catgcttgca tgtcagaagt tttgcattat aactgaattt ctggggaaaa aataatagat 5940 gatgcagaaa ctggtccaac ggtctctaaa agtacaaaga ggaaacgtcc aaaacctctt 6000 ccactagctt ctgttaggaa gaagaacaag aggtctggcc tacaaagatt gtcttgtaac 6060 gttgggcagc cggcagagca atctgaaaat gatagtgaag aagttggttc agaagttttg 6120 gaaggtttca agcgaaccga gtctgcaatt caattcaaag acataacaag tttcgagaac 6180 atattggttg atggcttggt tatagatcct gagctctcgg aagacattcg cagtaaatac 6240 taccagctat gctgtagtca aaatgctttt cttcatgaaa atattatcca gggtataagt 6300 tttaaattta aagttggaat tatttccgaa actgtcaata ttgctgatgc tataagaact 6360 tgcaagctca caacttctcg agatgaattt gatagttggg acaggacctt gaaagccttt 6420 gagttgttgg gcatgaatgt tggtttctta cgaactcgtc ttcaccggct tgtaaacctt 6480 gcatttgaat cagaaggtgc tgctgagaca aggaggtatt ttgaagctaa agcagaacga 6540 gatcagacag agaatgagat acgaaacctt gaagcaaaac tcacggagct gaaggatgca 6600 agtaaaacct ttggatttga aatcgagagt ttgcaatcta aagcggaaac aaatgaattc 6660 aggtttgaga aagaagttaa ggctccatgg tga 6720 Primer F1 for Amplification of Cotton B3 Transcription Factor Family Gene GHFLS cDNA Sequence SEQ ID NO. 3 atggatcgaagggtgaagaa 20 Primer R1 for Amplification of Cotton B3 Transcription Factor Family Gene GHFLS cDNA Sequence SEQ ID No. 4 tcaccatggagccttaact 20 Primer F2 for Amplification of Cotton B3 Transcription Factor Family Gene GHFLS SNP Sequence SEQ ID No. 5 acgaaaccttgaagcaaaactca 23 Primer R2 for Amplification of Cotton B3 Transcription Factor Family Gene GHFLS SNP Sequence SEQ ID NO. 6 ttggaggaagccaatttctg 20