SPRAYABLE CELL-PENETRATING PEPTIDES FOR SUBSTANCE DELIVERY IN PLANTS

Abstract

The invention relates to a complex comprising a Cell Penetrating Peptide and one or more nucleic acids which can be applied to a plant by spraying and which can trigger a physiological outcome. Hereto, the one or more nucleic acids complex with a Cell Penetrating Peptide can be dissolved in water without the presence of additional components in the solution.

Claims

1. A method of introducing a nucleic acid into a plant cell, said method comprising: a) applying a solution of one or more nucleic acids, complexed to one or more Cell Penetrating Peptides to a plant, plant organ or plant tissue by spraying, and b) allowing the one or more nucleic acids to enter said plant cell.

2. The method of claim 1, wherein said plant cell is part of a plant tissue, plant organ, plant epidermis, or any other part of a plant.

3. The method of claim 1, wherein said solution comprising one or more nucleic acids, complexed to Cell Penetrating Peptides is an aqueous solution, optionally a salt solution and/or a buffered solution.

4. The method of claim 3, wherein said solution is devoid of any other additives.

5. The method of claim 1, wherein said nucleic acids include one or more of DNA, RNA, or nucleic acid analogues.

6. The method of claim 1, wherein said Cell Penetrating Peptide is a cationic Cell Penetrating Peptide or an amphiphilic Cell Penetrating Peptide.

7. The method of claim 6, wherein said cationic Cell Penetrating Peptide is one of BP100 (SEQ ID NO: 7), R9 (SEQ ID NO: 8) or D-R9 (SEQ ID NO: 9).

8. The method of claim 6, wherein said amphiphilic Cell Penetrating Peptide is KH9 (SEQ ID NO: 10).

9. The method of claim 1, wherein said Cell Penetrating Peptide is BP100, KH9, R9, D-R9, BP100(KH)9, BP100CH7, KAibA(KH9) and or KAibA(D-R9).

10. The method of claim 1, further comprising adding an organelle targeting peptide to either the nucleic acid prior to addition of the Cell Penetrating Peptides or to the Cell Penetrating Peptide-nucleic acid complex.

11. The method of claim 1, wherein said nucleic acid is conjugated to an organelle targeting sequence.

12. The method of claim 11, wherein said nucleic acid is delivered into an organelle.

13. The method of claim 1, wherein the composition is targeted to a subcellular compartment of a plant cell.

14. The method of claim 1, wherein the Cell Penetrating Peptide acts as an organelle targeting peptide.

15. The method of claim 2, wherein said plant organ is one or more of a leaf, stem, root, or reproductive organ.

16. The method of claim 1, wherein spraying on a leaf is on the adaxial and/or abaxial side of a plant leaf.

17. A method of modulating gene expression in a plant cell, said method comprising: applying a solution of one or more nucleic acids capable of modulating expression of a gene, complexed to one or more Cell Penetrating Peptides dissolved in water to a plant, plant organ or plant tissue by spraying; and b) allowing the one or more nucleic acids capable of modulating expression of a gene to enter said plant cell and to modulate gene expression.

18. A method of applying a nucleic acid to a plant, said method comprising: a. complexing said nucleic acid with a Cell Penetrating Peptide in water; b. applying the solution containing the nucleic acid complexed with the Cell Penetrating Peptide to a plant by spraying; and c. allowing the complex to enter into plant cells.

19. The method of claim 17, wherein said water solution is supplemented with salt and/or a buffer.

20. (canceled)

21. (canceled)

22. (canceled)

23. (canceled)

24. (canceled)

25. The method of claim 1, wherein the spraying comprises dripping, nebulizing, atomizing, misting or any other form of application wherein the solution is applied without directly contacting the plant.

26. (canceled)

27. The method of claim 1, wherein the solution is allowed to enter the plant cells for a period of time, followed by consecutive application of additional solution by way of spraying.

28. The method of claim 1, wherein the method comprises application to a field crop for selectively controlling the growth of weeds and the solution further comprises a herbicide or other pesticide.

29. (canceled)

30. The method of claim 1, wherein the ratio of nucleic acid to Cell Penetrating Peptide ranges between 0.5 to 2.0.

31. The method of claim 1, wherein the nucleic acid comprises a CRISPR-Cas guide RNA.

32. The method of claim 1, wherein the complex is applied to a plant concurrently with another transfection method.

33. (canceled)

34. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0058] FIG. 1. Uptake Efficiency of Cell-Penetrating Peptide-Based DNA Nanocarriers to Plant Leaf After Spray Application [0059] (A) Sprayable peptide-based DNA delivery to Arabidopsis thaliana mediated by cell-penetrating peptide (CPP; BP100(KH)9). The BP100(KH)9/pB1221 complexes were formed in aqueous solution and applied on plant leaves using spray atomizer. The activity of GUS reporter was assayed after 24 hours post spraying. (B) GUS activity in plant leaves transfected with CPP/pDNA complexes after spraying for 24 hours. The distribution of GUS activity in at least 20 sprayed leaves are shown as a box plot. Black bars represent median of GUS activity. Dots represent each data point. Letters indicate the significant differences of GUS activity analyzed by one-way ANOVA with Tukey's HSD test at p=0.05. (C) Histochemical staining of GUS reporter in plant leaves sprayed with BP100(KH)9/pB1221 complex solution. (D) Abundance of trichrome on col-0 and g1-1 Arabidopsis mutant. (E) GUS activity in plant leaves transfected with BP100(KH)9/pB1221 complex via spraying. Asterisks represent the levels of significant difference of GUS activity in two samples analyzed by Student's t-test. NT is non-transfected col-0 leaves. (F) GUS staining in plant leaves after spraying with BP100(KH)9/pB1221 complexes and kept at different humidity conditions. Plus/minus shows the GUS signal in plant leaves observed by stereomicroscopy. Proportion of number represents number of GUS-positive samples per total number of leaves collected for the analysis. Red arrows indicated the GUS-positive spots in plant leaves. Scale bars=500 μm. (G) GUS activity in transgenic Arabidopsis leaves sprayed with BP100(KH)9/pB1221 complex solutions. WT=wild type, OX=STOMAGEN-overexpressor, and RNAi=STOMAGEN-suppressor. Dots represent the distribution of each data point. Error bars=standard deviation (SD). Letters indicate significant differences of mean analyzed by one-way ANOVA with Tukey's HSD test at p=0.05.

[0060] FIG. 2. Translocation of TAMRA-CPPs to Arabidopsis Leaf Cells [0061] (A) Spray application of TAM RA-CPP solution on fully expanded Arabidopsis leaves. After periods of incubation, TAM RA-fluorescent signal was determined in epidermal cells and palisade mesophyll cells on the adaxial side of leaf under confocal fluorescence microscope. (B) Fluorescent microscopic observation of TAMRA-CPPs in Arabidopsis leaf epidermal cells after spraying. Scale bars=50 μm. (C) Fluorescent intensity of TAMRA-CPPs in epidermal cells after spraying. The distributions of fluorescent intensities in epidermal cells of Arabidopsis leaves in 8 areas of interest (ROI) were shown as box plot. Black bars represent medians of intensity values. (D) Microscopic autographs of various TAM RA-CPPs in Arabidopsis palisade mesophyll cell layer. Scale bars=50 μm. (E) Box plot represents the distribution of fluorescent intensities in mesophyll cells of 8 ROIs.

[0062] FIG. 3. Translocation of TAMRA-CPPs to Soybean Leaf [0063] (A) Plant physiologies of three different commercially available soybean cultivars. Seeds and 5-week old soybean plants of cultivars Enrei, Peking, and William-82 were germinated and cultured in the same cultivation conditions. (B) Distributions of fluorescent intensities in soybean leaves after spraying with TAM RA-CPPs solution and washing. The distribution of fluorescent intensity data was shown as box plot with median (black bar). Dots represent each data point in the distribution (n=9). (C) Fluorescent intensities of chemoenzymatically-synthesized TAMRA-alpha-aminoisobutyric acid (Aib)-containing CPPs in soybean (cultivar Enrei) leaves after spraying (n=12). The data was shown as box plot. (D) Fluorescent images of TAMRA-alpha-aminoisobutyric acid (Aib)-containing CPPs in soybean leaves. Scale bars=50 μm.

[0064] FIG. 4. Transfection Efficiency of Spray-Applied pDNA/CPP Complex in Soybean Leaf [0065] (A) Foliar application of pB1221/BP100(KH)9 complex solution to soybean leaves (cultivar Enrei). (B) GUS activity in soybean leaves sprayed with BP100(KH)9/pB1221 complex solution at 24 hours post spraying. The distribution of data was illustrated by box plot. Black bars represent the median of distributed data. Dot indicates each data points in the analysis (n=16). Different number of asterisks shows differences in levels of statistical significance. n.s. =no statistically significant difference. (C) Expression of GUS reporter protein in soybean leaf cells stained with GUS staining solution. Scale bars=500 μm.

[0066] FIG. 5. Targeted DNA Delivery to Arabidopsis Chloroplast Using Peptide Carrier-Based Spray Application [0067] (A) Formation of clustered pDNA/chloroplast-targeting/cell-penetrating peptide (pDNA/CTP/CPP) nanocarrier. The complex of pPsbA::Rluc (chloroplast-specific expression vector) with CTP (KH)90EP34 were formed in Milli-q water for specific targeting of pDNA delivery to chloroplasts. CPP BP100 was subsequently added to pDNA/CTP complex solution to enhance cell penetration efficiency of the resulting pDNA/CTP/CPP complex to plant cell. (B) After spraying with clustered pDNA/CTP/CPP nanocarriers and control solutions containing pDNA only and pDNA/CTP complex, Arabidopsis leaves were collected and Renilla luciferase (Rluc) activity was assayed at 24, 48, and 72 hours post spraying. The distribution of Rluc activities in plant leaves are shown as box plot with median (black bar). Dots in the plot represent each data point (n=8). WT=wild type (non-sprayed leaves). Letters indicate significant differences of mean of Rluc activity among the treatments (one-way ANOVA with Tukey's HSD test at p=0.05).

[0068] FIG. 6. Suppression of Gene Expression in Plant Cell Mediated by Sprayable Peptide-Based siRNA Cargos [0069] (a) Formulation of siGFPS1/KH9-BP100 complex for yfp gene suppression in transgenic Arabidopsis plants. (b) YFP fluorescence in plant cells at 3-days post spraying with solution containing siGFPS1/KH9-BP100 complex. Scale bars=50 μm. (c) Quantitative fluorescent intensity of YFP in plant cells at 3-days post spraying with siRNA/CPP complex. The distributions of YFP fluorescence from 9 regions of interest (n =9) were shown as box plot. Dots represent the fluorescent values. Black bars are median of the distributed data. Letters indicate significant differences of mean analyzed by one-way ANOVA with Tukey's HSD test at p=0.05. (d) Immunoblot analysis of YFP and endogenous RubisCo Activase 1 protein (e.g. RCA1; a highly abundance plant intracellular protein) in soluble proteins extracted from Arabidopsis leaves after 3 days of spraying with siRNA/CPP complex. The membrane was stained with Ponceau S staining solution prior probing with antibodies. RbcL=RubisCo large subunit. (e) Relative YFP abundance in total leaf protein after 3 days of spraying with siRNA/CPP complex determined by immunoblotting. Relative amounts of YFP to RCA1 were shown as box plot. Circles represent the distribution of data points in box plot. Black bars are median of distributed values. (f) Relative yfp transcript levels in plant leaf at day 3 post spraying with siRNA/CPP complex. Error bars =standard deviation. Circles represent variations of relative yfp transcript levels in 5 different experiments. Statistical differences in (e) and (f) were analyzed by comparative Student's t-test (n=5). *, **=statistically significant difference at p≤0.01 and p 0.001, respectively. n.s.=no significant difference.

EXAMPLES

Chemicals and Common Methods

[0070] Unless indicated otherwise, cloning procedures carried out for the purposes of the present invention including restriction digest, agarose gel electrophoresis, purification of nucleic acids, ligation of nucleic acids, transformation, selection and cultivation of bacterial cells were performed as described (1). Sequence analyses of recombinant DNA were performed with a laser fluorescence DNA sequencer (Applied Biosystems, Foster City, CA, USA) using the Sanger technology (2). Unless described otherwise, chemicals and reagents were obtained from Sigma Aldrich (Sigma Aldrich, St. Louis, USA), from Promega (Madison, WI, USA) or Invitrogen (Carlsbad, CA, USA). Restriction endonucleases were from New England Biolabs (Ipswich, MA, USA) or Roche Diagnostics GmbH (Penzberg, Germany). Oligonucleotides are synthesized by IDT (Coralville, IA, USA).

Identification of Sequences Related to the Nucleic Acid Sequence Used in the Methods of the Invention

[0071] Sequences (full length cDNA, ESTs or genomic) related to the nucleic acid sequence used in the methods of the present invention were identified amongst those maintained in the Entrez Nucleotides database at the National Center for Biotechnology Information (NCBI) and other databases using database sequence search tools, such as the Basic Local Alignment Tool (BLAST) (3, 4). The program is used to find regions of local similarity between sequences by comparing nucleic acid or polypeptide sequences to sequence databases and by calculating the statistical significance of matches. For example, the polypeptide encoded by the nucleic acid used in the present invention was used for the TBLASTN algorithm, with default settings and the filter to ignore low complexity sequences set off. The output of the analysis was viewed by pairwise comparison, and ranked according to the probability score (E-value), where the score reflects the probability that a particular alignment occurs by chance (the lower the E-value, the more significant the hit). In addition to E-values, comparisons were also scored by percentage identity.

[0072] Percentage identity refers to the number of identical nucleotides (or amino acids) between the two compared nucleic acid (or polypeptide) sequences over a particular length. In some instances, the default parameters may be adjusted to modify the stringency of the search. For example, the E-value may be increased to show less stringent matches. This way, short nearly exact matches may be identified.

[0073] Escherichia coli was used as propagation microorganism for all the plasmids used in our experiments, as well as for further propagation, maintenance of the modified targets, and heteroexpression of target protein. E. coli was grown according standard microbiological practices (5).

Example 1

Generation of Labelled-Cell Penetrating Peptides (CPP) Solution and CPP-Nucleic Acid Solution

[0074] Cell-penetrating peptides (CPPs), also called protein transduction domains, are short peptides that facilitate the transport of cargo molecules through membranes to gain access to the cells. In many cases, CPPs are coupled to cargo molecules through covalent conjugation, forming CPP-cargo complexes. To date, DNA, RNA, nanomaterials and proteins such as antibodies were reported as cargo molecules. Most studies of the complex of CPPs and protein have contributed to the applications in mammalian cells, whereas only very limited studies have focused on plant cells. This could be due to the complicated cell wall structure of plant shows intransigence on internalization such big cargo molecules, and the slight negatively net charge of the cellulose could reduce interaction between the CPP and lipid bilayer by the physical and the chemical manners. The plant cells are mainly containing cellulose, hemicellulose and pectin. These biochemical compositions are changing during the plant growth, indicating that optimization of various conditions to achieve delivery of cargo molecule into plant cells is needed. BP100 (KKLFKKILKYL—SEQ ID NO: 7) is an amphiphilic peptide and has CPP function. KH9 (KHKHKHKHKHKHKHKHKH—SEQ ID NO: 10), R9 (RRRRRRRRR SEQ ID NO: 8), and D-R9 (rrrrrrrrr, D-form of R9 - SEQ ID NO: 9) are peptides containing both CPP and cationic biomolecule binding functions. BP100(KH)9 (KKLFKKILKYLKHKHKHKHKHKHKHKHKH—SEQ ID NO: 11) and BP100CH7 (KKLFKKILKYLHHCRGHTVHSHHHCIR—SEQ ID NO: 12) are fusion peptides containing CPP and cationic sequences which are designed as stimulus-response peptides and could release the cargo molecules (peptides, protein, RNA, DNA) into the cytoplasm. KAibA(KH)9, K-alpha-aminoisobutyric acid (AibA)-AKHKHKHKHKHKHKHKHKH, and KAibA(D-R9), K-alpha-aminoisobutyric acid (AibA)-Arrrrrrrrr are synthetic peptides and containing both CPP and cationic biomolecule binding functions. KAibA (U.S. Ser. No. 16/832,749) was chemoenzymatically synthesized using the polymerization reaction (ACS Biomater. Sci. Eng. 2020, 6, 6, 3287-3298). TAMRA-CPPs are CPPs that labeled by fluorescent molecule 5-carboxytetramethylrhodamine (TAMRA) at the C-terminal end and were used for optimization of various conditions. For the labelling of CPP with TAMRA, the amino acids in Boc-CPPs were deprotected using tri-fluoroacetic acid (TFA). A solution of tetramethylrhodamine-5-isothiocyanate in dimethyl sulfoxide (DMSO) was added to CPP solutions and kept stirring at 25° C. for 14 h. The solution was centrifuged at maximum speed at 4° C. for 60 minutes and the precipitate was washed with Milli-Q water. After lyophilizing, a pink solid was obtained. Dried precipitate of TAM RA-CPP was re-suspended with Milli-q and the TAMRA-CPP solution was kept at 1.0 mg/mL concentration in −80° C. Plasmid DNA that contains expression cassette of reporter gene such as GUS (SEQ ID NO: 1), GFP (SEQ ID NO: 2), DsRed (SEQ ID NO: 3), and Renilla luciferase (Rluc—SEQ ID NO: 4) was used to detect successful delivery into plant cells. Plasmid DNA that contains expression cassette of herbicide tolerant gene such as PPO (SEQ ID NO: 6)or ALS (SEQ ID NO: 5) was used for further application. Gene expression cassettes containing either CaMV 355 promoter or chloroplast specific promoter; PsbA or rrn16S gene promoter, gene of interest, and NOS terminator, were cloned into pB1221 vector. Plasmid DNA with concentration at 1.0 mg/mL was prepared by Maxi prep (QIAGEN) according to the manufacture protocol. To prepare the CPP-DNA solution, plasmid DNA (1.0 mg/mL) was mixed with CPP (1.0 mg/mL) at various N/P ratios. For BP100(KH)9-DNA complex, the complex was prepared in N/P ratio at 0.5, 1.0, 1.5 and 2.0. The complex solutions were pipetted gently and incubated at RT for 30 min in the dark. This solution was adjusted to final volume of 5 mL by adding autoclaved Milli-q water, and then continuing incubation under the same condition for another 30 min. Each solution was repeatedly pipetted and used for spraying application.

Example 2

Plant Growth Conditions

[0075] Seeds of Arabidopsis thaliana ecotype col-0, mutant lines gl-1 and over expressor and transcriptional repressor of STOMAGEN gene, STOMAGEN-Ox and STOMAGEN-RNAi, were germinated in pots with planting medium containing a mixture of soil (Pro-Mix; Premier Tech Ltd, Quebec, Canada) and vermiculite in a ratio of 2:1. Plants were grown and incubated under 16 hours light/8 hours dark at 21° C. in a plant incubator (Biotron NK System, Osaka, Japan). Two weeks old plants were used for experiments.

[0076] Seeds of soybean (Glycine max) cultivars Enrei, William-82, and Peking, were germinated between germination papers that has been moistened with tap water. Then the seeds with papers were placed in a plastic bag and incubated in a growth chamber under 18 hours light/6 hours dark at 26° C. for three days. One and a quarter tea spoon of Multicoat 4 was mixed with 2 L of autoclaved sand, which was then moistened with tap water. Three days old soybean seedlings were then transplanted into containers filled with moist sand mix and incubated in the same growth chamber. Leaves from 5 weeks old plants were used for experiments.

[0077] Seeds of tomato (Solanum lycopersicum) were germinated on wet filter paper, and then moved to pots with planting medium containing a mixture of soil. Plants were grown and incubated under for 16 hours light at 28° C/8 hours dark at 20° C. in a plant incubator. Leaves from 2-month-old plants were used for experiments.

Example 3

Test of Various Spray Conditions

[0078] For the initial testing and optimizing the spray condition, one milliliter of BP100(KH)9/pB1221-GUS complex solution was sprayed on leaves of Arabidopsis thaliana ecotype col-0 (FIG. 1A). Arabidopsis plants sprayed with BP100(KH)9/pB1221-GUS complex were kept at standard culture conditions for 24 hours. Leaves of Arabidopsis sprayed with BP100(KH)9/pB1221-GUS complexes showed significantly higher GUS activity than that in the leaves sprayed with the solution containing pB1221-GUS plasmid DNA (pDNA) only (FIG. 1B and C). To access whether leaf trichrome is the target cell of the CPP-based nanocarrier transfection of plasmid DNA, a solution containing BP100(KH)9/pB1221-GUS complexes was sprayed on leaves of the non-glandular trichrome Arabidopsis mutant, gl-1 (FIG. 1D). Spray application of BP100(KH)9/pB1221-GUS complex showed enhanced GUS activities in both col-0 and gl-1 Arabidopsis leaves (FIG. 1E). Stomatal number and aperture play significant roles in biomolecule translocation to plant leaf tissue and cell layer. The feasibility of BP100(KH)9/pB1221-GUS nanocarrier uptake in different stomata opening stages were determined in various humidity conditions by spraying complex solution on Arabidopsis col-0 leaves. Spray-treated plants were then cultured in humidity chambers with different percentage of relative humidity (% RH) for 24 hours. After incubation in the humidity chamber, plant leaves were stained with GUS histochemical staining solution. Leaves incubated at 50% RH had maximum GUS signal with the highest detection frequency (FIG. 1F). However, changing the humidity conditions decreased both GUS intensity and detection frequency (FIG. 1F). To further study the role of leaf stomata on nanocarrier uptake, the BP100(KH)9/pB1221-GUS complex solutions were sprayed on leaves of transgenic Arabidopsis thaliana which manifest different number of stomata per area (overexpressor and transcriptional repressor of STOMAGEN gene; STOMAGEN-Ox and STOMAGEN-RNAi, respectively). No enhanced GUS activity was observed in plant leaves treated with solutions containing pDNA only (FIG. 1G). GUS activities were significantly increased in leaves of wild type and STOMAGEN-Ox transgenic line after spraying with BP100(KH)9/pB1221-GUS complexes formed in N/P ratios=0.5 and 2.0 (FIG. 1G). These results suggest that uptake of peptide/biomolecule cargo is a stomatal-dependent phenomenon.

[0079] In summary, we successfully transformed CPP/pDNA complex into Arabidosis leaf by spraying and observed GUS protein expression. Existing trichome or not in the leaf surface didn't make any difference in terms of delivery efficiency. Humidity of 50% was the most efficient condition, and decreasing or increasing the humidity decreased the delivery efficiency. Existing stomata in the leaf surface was critical to have the efficient delivery.

Example 4

Examining Penetrating Efficiency on Different Type of CPPs

[0080] To identify the CPP that shows highest penetrating efficiency using spray method in Arabidopsis leaf, TAMRA-BP100, TAMRA-KH9, TAMRA-R9, and TAMRA-D-R9 (these CPPs were labelled with TAMRA fluorophore) were used. Each TAMRA-CPP was adjusted as concentration at 1 mg/L in water. One millilitre of TAMRA-CPP solution was applied at a leaf surface. Leaf surface was washed three times with water after 30, 90 and 150 min post spraying, and the intensity of fluorescence was measured by CLSM imaging analysis (FIG. 2A). The fluorescent intensity increased over the time in epidermal cells (FIG. 2B and C). BP100 and D-R9 showed higher cell penetrating efficiency compared with KH9 and R9 (FIG. 2B and C). The fluorescent intensities of TAMRA-BP100 and TAMRA-D-R9 at 150 min showed 5-fold higher than the intensity at 30 min (FIG. 2B and C). To identify the depth of penetration, the intensity of fluorescence in mesophyll cell layer. On mesophyll cells, D-R9 showed the highest penetrating efficiency (FIG. 2D and E).

[0081] In summary, the cell penetrating efficiency was gradually increased over the incubation time in Arabidopsis leaf. We observed significant difference of cell penetrating efficiency between CPPs.

[0082] BP100 and D-form of R9 (D-R9) showed higher efficiency compared with KH9 and R9. In addition to that, D-R9 was able to penetrate deep inside of the tissue and stay longer without degradation.

Example 5

Introduction of DNA Coding PPO Gene into Soybean (Glycine max) Leaf by Spraying CPP and Plasmid DNA Solution

[0083] Soybean leaves are different in both architecture and leaf chemical components. We further examined the translocation efficiency of highly efficient native CPP sequences in soybean leaves. Leaves from 5 weeks old plants were used for the experiment. Solutions containing 1.0 mg/mL of natural TAMRA-CPP; TAMRA-BP100, TAMRA-KH9, TAMRA-R9, and TAMRA-D-R9 were sprayed on soybean leaves of 3 different cultivars (Enrei, Peking, and William-82) and incubated for 30 min, 90 min, and 150 min (FIG. 3A). The fluorescence imaging and image analysis were conducted to determine the translocation efficiency of these CPPs to plant leaves. The fluorescence intensity of TAMRA-CPPs was gradually increased over the incubation time (FIG. 3B). Different soybean cultivars responded differently to the translocation of CPPs to plant cells. Among the three cultivars, Peking showed the highest susceptibility to the translocation of all three CPPs to plant cells (FIG. 3B). Considering the translocation efficiencies of these three CPPs, TAMRA-D-R9 showed the highest fluorescence intensity in epidermal cells of leaves of all three soybean cultivars (FIG. 3B). This result suggested that there are significant efficiency differences between conditions, and there is a room to improve.

[0084] The chemoenzymatically-synthesized poly-alpha-aminoisobytyric acid (Aib)-contained CPPs showed remarkable activity to translocate across the tough plant cell boundaries. We tried to determine the efficiency of artificial CPPs containing Aib to soybean leaves using spraying. KAibA, KAibK, and KAibG were synthesized and labelled with TAMRA as described in Example 1. The solutions containing 1 mg/mL of these artificial TAMRA-CPPs were sprayed to fully expanded leaves of 5-weeks old soybean cultivar Enrei and the fluorescence imaging was carried out at 30 min, 90 min, and 150 min after spraying. FIG. 3C shows the fluorescent intensity of artificial TAMRA-CPPs in soybean leaves. TAMRA-KAibA showed the strongest fluorescence compared to KAibK and KAibG (FIG. 3C and D). These fluorescent intensities in TAMRA-KAibA-sprayed leaf epidermal cells were progressively increased as increasing the incubation time. However, the average fluorescent intensity in TAMRA-KAibA-treated soybean leaves was lower than that previously achieved by TAMRA-D-R9 (FIG. 3B and C).

[0085] Transfection of pB1221-GUS to soybean leaves mediated by CPP/pDNA cargos was carried out using the same protocol as in Arabidopsis (FIG. 4A). GUS histochemical staining and enzymatic assay in transfected leaves were performed after 24 hours post spraying. GUS activity assay result suggested that CPP/pDNA complex-based transfection protocol developed for Arabidopsis is able to transform soybean leaf cells (FIG. 4B). GUS activity in soybean leaves sprayed with BP100(KH)9/pB1221-GUS complex was significantly higher than that in the leaves sprayed with peptide and pDNA only (FIG. 4B). GUS staining indicated that expression of GUS is epidermal cell-specific (FIG. 4C), suggesting lower penetration ability of this CPP/pDNA complex in soybean leaf cell than in the Arabidopsis cells. Using this optimized condition, PPO gene was delivered into 5 weeks old soybean leaves of cultivar Peking. Plasmid DNA which contains PPO expression cassette was mixed with D-R9 and incubated for 30 min. The solution was sprayed on the leaf surface. Twenty-four hours after the spray, the leaf surface was washed with water three times. Then leaf tissue was immediately frozen. RT-PCR and western blot analysis were performed to examine the PPO gene expression and PPO protein accumulation. As a control, the empty vector was sprayed at the same time. Three biological replications, three independent experiments were done.

[0086] In summary, we successfully delivered pDNA into soybean leaf by CPP-pDNA complex spraying method. However, the efficiency was lower than that of Arabidopsis leaf in conditions that we tested here. The cell penetrating efficiency gradually increased over the incubation time same as that of Arabidopsis leaves. We observed BP100 and D-R9 showed higher cell penetrating efficiency in general, and the cultivar Peking and D-R9 combination showed the most efficient cell penetrating effect.

Example 6

Targeted Gene Delivery into Arabidopsis Chloroplast by Spraying Solution Containing Chloroplast-Targeting Peptide, and CPP BP100

[0087] Next, we attempted to deliver DNA to a specific organelle in the cell using CPP spray method. We chose chloroplast as a target organelle. Approximately 100 chloroplasts exist per epidermal cell in Arabidopsis leaf. Chloroplast-targeting peptide, (KH)90EP34; KHKHKHKHKHKHKHKHKHMFAFQYLLVM was used for chloroplast-specific gene delivery into Arabidopsis leaf. Plasmid DNA (pDNA) which contains a Renilla luciferase (Rluc) gene expression cassette under transcriptional regulation with PsbA gene promoter and chloroplast-targeting peptide (CTP), (KH)90EP34, were first mixed together and incubated for 30 min to form pDNA/CTP complex in N/P ratio=1.0 (FIG. 5A). Then cell-penetrating peptide (CPP), BP100, was added and further incubated for 30 min to form the clustered pDNA/CTP/CPP complex in N/P ratio=1.0 (FIG. 5A). The clustered pDNA/CTP/CPP complex solution was sprayed on fully expanded Arabidopsis leaf surface using spray atomizer (FIG. 5A). At 24, 48, and 72 hours after spraying, the leaf was washed three times with water, and Rluc activity in sprayed plant leaves was assayed. Rluc activity in plant leaves sprayed with pDNA only and pDNA/CTP complex was not significantly different from the basal level in non-transfected leaves (FIG. 5B). When we deliver pPsbA::Rluc using clustered CTP/CPP carrier, Rluc activity was 2-10-fold higher than the values in control experiments. (FIG. 5B). Interestingly, this expression of Rluc gene in clustered pDNA/CTP/CPP complex-sprayed plant leaves were maintained up to 72 hours post spraying (FIG. 5B).

[0088] With these results, we concluded that the sprayable peptide-based biomolecule application technique can apply for organelle targeted application as well.

Example 7

RNA Delivery and Local Gene Silencing in Arabidopsis Leaf

[0089] Transient RNA interference (RNAi) technology is an outstanding tool for plant biotechnology to emphatically engineer the function of a target plant metabolic process. Artificial small RNA molecules such as short-interference RNA (siRNA), micro-RNA, (miRNA), and short-hairpin RNA (shRNA) have abilities to transcriptionally-suppress the expression of plant metabolic enzymes (6). However, these short RNA molecules are sensitive to the histrionic RNA degradation process in plant cells. CPPs demonstrate their function in fortifying the interacting RNA molecules against RNA degradation process. Free siRNA molecules applied to plant cells using high-pressure spraying consequentially suppressed the expression of target mRNA molecules (7). Additionally, recent studies demonstrated that conjugating small RNA molecules with NPs such as CPP (8), 3-dimentional (3-D) DNA nanostructures (9), and carbon nanotubes (10) enhanced gene silencing efficiency and stability of RNA molecules in plant cells after infiltration. Hence, we attempted to develop a high-throughput spray application technique to apply siRNA/peptide complex to plant cells for efficient gene knockdown. We synthesized 27-bp siGFPS1 RNA duplexes which showed superior activity to silence GFP synthesis in the transfected cells (11). To test gene silencing function of siGFPS1, the synthetic double-stranded siRNA molecules were formed complexes with KH9-BP100 and syringe-infiltrated to transgenic Arabidopsis leaves overexpressing yellow-fluorescent protein (YFP) (FIG. 6a). At day-3 post infiltration, we observed significant reductions of YFP fluorescence and protein accumulation in leaves infiltrated with siGFPS1/KH9-BP100 complexes.

[0090] Intriguingly, spraying of siGFPS1/KH9-BP100 complex solution to YFP overexpression plants drastically reduced YFP fluorescence in plant cells after 3 days post application (FIG. 6b and c). We examined 45.5% decrease of YFP protein and 54.1% reduction of yfp transcripts in leaves sprayed with siRNA/CPP complexes at day-3 of spraying (FIG. 6d to f) which is comparable to the efficiency previously achieved by double-stranded GFP5/CPP complex infiltration (8). However, this efficiency is lower than that of 3-D DNA nanostructures-, carbon dots- and carbon nanotubes-mediated GFP silencing in plant cells infiltrated or sprayed by siRNA/NP conjugates (7,9,12). This could be due to the different physicochemical properties, surface coating chemistries, and cellular uptake and distribution of different NPs. Taken together, our results suggest a potential use of CPP-mediated siRNA spraying for suppression of target protein in plant cells. This peptide carrier-based RNAi foliar spraying enables a high-throughput application in plant metabolic engineering, non-transgenically.

[0091] In summary, we concluded that RNAs can be delivered with avoiding the degradation into Arabidopsis leaf with CPP spray method and were able to play a role in the local gene expression suppression.

Example 8

Large Scale and Field Application for Agriculture Use

[0092] The spray method is applicable in a large-scale field application. Delivering and expressing herbicide tolerant gene such as ALS, and PPO or insect resistant genes on leaf surface in economically important crops is a great example. First the solution containing biologically active molecules such as plasmid DNA harbouring a gene expression cassette, RNA molecules and proteins and BP100(KH)9 is sprayed on soybean field using controlled spraying system that is used for herbicide treatment. We expect active enzyme can be available in the cells within a shorter period by protein delivery than nucleic acids delivery, therefore, protein delivery is suitable especially for insect treatment application which requires quick treatment. Proteins are mixed with protease inhibitors to minimize the protein degradation, and then mixed with CPP. After 24 hours of application, the herbicide chemical for corresponding enzymes is sprayed in the field using the sprayer. We select CPPs which penetrate efficiently soybean leaf but not leaves of weeds like morning glory. The soybean plant transiently gains the tolerance to the herbicide and then sequential herbicide spraying successfully kills only weeds around soybean. This method can be automated. Weeds can be detected and captured by drone camera, and weed intensity can be analyzed by image analysis program, and semi-automatic application of the CPP-biomolecule solution, followed by spraying of herbicide solution can reduce weed presence.

[0093] We here demonstrate the agriculture large-scale CPP-biomolecule complexes spray application using DNA, RNA as a biomolecule in soybean as an example. This approach is valuable not only for row crops, but also for vegetables where transgenic plants are not yet accepted by public, such as pepper, onion and carrot.

References

[0094] 1. Sambrook, J., E. F. Fritsch, and T. Maniatis (1989) Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press.

[0095] 2. F. Sanger, S. Nicklen, and A. R. Coulson (1977) DNA sequencing with chain-terminating inhibitors. PNAS 74(12):5463-5467.

[0096] 3. Altschul S F, Gish W, Miller W, Myers E W, Lipman D J (1990) Basic local alignment search tool. J Mol Biol. 215(3):403-410.

[0097] 4. Altschul S F, Madden T L, Schaffer A A, et al. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25(17):3389-3402.

[0098] 5. J. F. Sambrook and D. W. Russell, ed. Molecular Cloning: A Laboratory Manual, 3rd ed. (2001) Vols 1,2 and 3, Cold Spring Harbor Laboratory Press.

[0099] 6. Dalakouras A, et al. (2020) Genetically Modified Organism-Free RNA Interference: Exogenous Application of RNA Molecules in Plants. Plant Physiol 182(1):38-50.

[0100] 7. Dalakouras A, Wassenegger M, McMillan J N, Cardoza V, Maegele I, Dadami E, Runne M, Krczal G, Wassenegger M (2016) Induction of Silencing in Plants by High-Pressure Spraying of In Vitro-Synthesized Small RNAs. Front Plant Sci 7:1327.

[0101] 8. Numata K, Ohtani M, Yoshizumi T, Demura T, Kodama Y (2014) Local Gene Silencing in Plants via Synthetic DsRNA and Carrier Peptide. Plant Biotechnol J 12(8):1027-1034.

[0102] 9. Zhang H, Zhang H, Demirer G S, Gonzalez-Grandio E, Fan C, Landry M P (2020) Engineering DNA Nanostructures for SiRNA Delivery in Plants. Nat Protoc. 15(9):3064-3087.

[0103] 10. Demirer G S, Zhang H, Goh N S, Pinals R L, Chang R, Landry M P Carbon (2020) Nanocarriers Deliver SiRNA to Intact Plant Cells for Efficient Gene Knockdown. Sci Adv 6(26):eaaz0495.

[0104] 11. Kim D H, Behlk M A, Rose S D, Chang M S, Choi S, Rossi J J (2005) Synthetic DsRNA Dicer Substrates Enhance RNAi Potency and Efficacy. Nat. Biotechnol 23(2):222-226.

[0105] 12. Schwartz S H, Hendrix B, Hoffer P, Sanders R A, Zheng W (2020) Carbon Dots for Efficient Small Interfering RNA Delivery and Gene Silencing in Plants. Plant Physiol 184 (2):647-657.

TABLE-US-00001 Sequences SEQ ID No: 1, GUS cDNA sequence ATGGGGTTACGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTCGACGGCCTGTGGGCATTCAGTCTGG ATAGGGAGAACTGTGGAATCGACCAACGTTGGTGGGAAAGCGCGTTACAAGAAAGCCGGGCTATCGCTGTG CCAGGCAGTTTTAACGATCAGTTCGCCGATGCAGATATTCGTAATTATGCGGGCAACGTCTGGTATCAGCGCG AAGTCTTTATACCGAAAGGTTGGGCAGGCCAGCGTATCGTGCTGCGTTTCGATGCGGTCACTCATTACGGCAA AGTGTGGGTCAATAATCAGGAAGTGATGGAGCATCAGGGCGGCTATACGCCATTTGAAGCCGATGTCACGCC GTATGTTATTGCCGGGAAAAGTCTACGTAAGTTTCTGCTTCTACCTTTGATATATATATAATAATTATCATTAAT TAGTAGTAATATAATATTTCAAATATTTTTTTCAAAATAAAAGAATGTAGTATATAGCAATTCCTTTTCTGTAGT TTATAAGTGTGTATATTTTAATTTATAACTTTTCTAATATATGACCAAAATTTGTTGATGTGCAGGTATCACCGT TTGTGTGAACAACGAACTGAACTGGCAGACTATCCCGCCGGGAATGGTGATTACCGACGAAAACGGCAAGAA AAAGCAGTCTTACTTCCATGATTTCTTTAACTATGCCGGAATCCATCGCAGCGTAATGCTCTACACCACGCCGA ACACCTGGGTGGACGATATAACCGTGGTGACGCATGTCGCGCAAGACTGTAACCACGCTTCTGTTGACTGGCA AGTTGTGGCCAATGGTGATGTCAGCGTTGAACTGCGTGATGCGGATCAACAGGTGGTTGCAACTGGACAAGG CACTAGCGGGACTTTGCAAGTGGTGAATCCGCACCTCTGGCAACCGGGTGAAGGTTATCTCTATGAACTGTGC GTCACAGCCAAAAGCCAGACAGAGTGTGATATTTACCCGCTTCGCGTCGGCATCCGGTCAGTGGCAGTGAAG GGCGAACAGTTCCTGATTAACCACAAACCGTTCTACTTTACTGGCTTTGGTCGTCATGAAGATGCGGACTTGCG TGGCAAAGGATTCGATAACGTGCTGATGGTTCACGACCACGCTCTTATGGACTGGATTGGGGCCAACTCCTAC CGTACCTCGCATTACCCTTACGCTGAAGAAATGCTCGACTGGGCAGATGAACATGGCATCGTGGTGATTGATG AAACTGCTGCTGTCGGCTTTAACCTCTCTTTAGGCATTGGTTTCGAGGCGGGCAACAAGCCGAAAGAACTGTA CAGCGAGGAAGCAGTCAACGGGGAAACTCAGCAAGCGCACTTACAGGCGATCAAGGAGCTGATAGCGCGTG ACAAAAACCACCCAAGCGTGGTGATGTGGAGTATTGCCAACGAACCGGATACCCGTCCGCAAGGAGCTAGGG AGTATTTCGCGCCACTGGCGGAAGCAACCAGAAAACTCGACCCGACCAGGCCGATCACCTGTGTCAATGTAAT GTTCTGCGACGCTCACACCGATACCATCAGCGATCTCTTTGATGTGCTGTGCCTGAACCGTTATTACGGATGGT ATGTCCAAAGCGGCGATTTGGAAACGGCAGAGAAGGTACTGGAAAAAGAACTTCTGGCCTGGCAGGAGAAA CTGCATCAGCCGATTATCATCACCGAATACGGCGTGGATACGTTAGCCGGGCTGCACTCAATGTACACCGACA TGTGGAGTGAGGAGTATCAGTGTGCATGGCTGGATATGTATCACCGCGTCTTTGATCGCGTCAGCGCCGTCGT CGGTGAACAGGTATGGAATTTCGCCGATTTTGCGACCTCGCAAGGCATATTGCGCGTTGGCGGTAACAAGAA AGGGATCTTCACCAGGGATCGCAAACCGAAGTCGGCGGCTTTTCTGCTGCAAAAACGCTGGACTGGCATGAA CTTCGGTGAAAAACCGCAGCAGGGAGGCAAACAATGA SEQ ID No: 2, GFP cDNA sequence ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAA CGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCAT CTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTC AGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGC GCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGG TGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTAC AACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATC CGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGC CCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGC GATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA SEQ ID No: 3, DsRed cDNA sequence ATGGGGTCTTCCAAGAATGTTATCAAGGAGTTCATGAGGTTTAAGGTTCGCATGGAAGGAACGGTCAATGGG CACGAGTTTGAAATAGAAGGCGAAGGAGAGGGGAGGCCATACGAAGGCCACAATACCGTAAAGCTTAAGGT AACCAAGGGGGGACCTTTGCCATTTGCTTGGGATATTTTGTCACCACAATTTCAGTATGGAAGCAAGGTATAT GTCAAGCACCCTGCCGACATACCAGACTATAAAAAGCTGTCATTTCCTGAAGGATTTAAATGGGAAAGGGTCA TGAACTTTGAAGACGGTGGCGTCGTTACTGTAACCCAGGATTCCAGTTTGCAGGATGGCTGTTTCATCTACAA GGTCAAGTTCATTGGCGTGAACTTTCCTTCCGATGGACCTGTTATGCAAAAGAAGACAATGGGCTGGGAAGCC AGCACTGAGCGTTTGTATCCTCGTGATGGCGTGTTGAAAGGAGAGATTCATAAGGCTCTGAAGCTGAAAGAC GGTGGTCATTACCTAGTTGAATTCAAAAGTATTTACATGGCAAAGAAGCCTGTGCAGCTACCAGGGTACTACT ATGTTGACTCCAAACTGGATATAACAAGCCACAACGAAGACTATACAATCGTTGAGCAGTATGAAAGAACCGA GGGACGCCACCATCTGTTCCTTTAG SEQ ID No: 4, Renilla luciferase (Rluc) cDNA sequence ATGGCTTCGAAGGTGTACGACCCCGAGCAGAGGAAGAGGATGATCACCGGCCCCCAGTGGTGGGCCAGGTG CAAGCAGATGAACGTGCTGGACAGCTTCATCAACTACTACGACAGCGAGAAGCACGCCGAGAACGCCGTGAT CTTCCTGCACGGCAACGCCGCTAGCAGCTACCTGTGGAGGCACGTGGTGCCCCACATCGAGCCCGTGGCCAG GTGCATCATCCCCGATCTGATCGGCATGGGCAAGAGCGGCAAGAGCGGCAACGGCAGCTACAGGCTGCTGG ACCACTACAAGTACCTGACCGCCTGGTTCGAGCTCCTGAACCTGCCCAAGAAGATCATCTTCGTGGGCCACGA CTGGGGCGCCTGCCTGGCCTTCCACTACAGCTACGAGCACCAGGACAAGATCAAGGCCATCGTGCACGCCGA GAGCGTGGTGGACGTGATCGAGAGCTGGGACGAGTGGCCAGACATCGAGGAGGACATCGCCCTGATCAAGA GCGAGGAGGGCGAGAAGATGGTGCTGGAGAACAACTTCTTCGTGGAGACCGTGCTGCCCAGCGTTATCATG AGAAAGCTGGAGCCCGAGGAGTTCGCCGCCTACCTGGAGCCCTTCAAGGAGAAGGGCGAGGTGAGAAGACC CACCCTGAGCTGGCCCAGAGAGATCCCCCTGGTGAAGGGCGGCAAGCCCGACGTGGTGCAGATCGTGAGAA ACTACAACGCCTACCTGAGAGCCAGCGACGACCTGCCCAAGATGTTCATCGAGAGCGACCCCGGCTTCTTCAG CAACGCCATCATTGAGGGCGCCAAGAAGTTCCCCAACACCGAGTTCGTGAAGGTGAAGGGCCTGCACTTCAG CCAGGAGGACGCCCCCGACGAGATGGGCAAGTACATCAAGAGCTTCGTGGAGAGAGTGCTGAAGAACGAGC AGAGATCTATCTAG SEQ ID No: 5, ALS cDNA sequence ATGGCGGCGGCAACAACAACAACAACAACATCTTCTTCGATCTCCTTCTCCACCAAACCATCTCCTTCCTCCTCC AAATCACCATTACCAATCTCCAGATTCTCCCTCCCATTCTCCCTAAACCCCAACAAATCATCCTCCTCCTCCCGCC GCCGCGGTATCAAATCCAGCTCTCCCTCCTCCATCTCCGCCGTGCTCAACACAACCACCAATGTCACAACCACT CCCTCTCCAACCAAACCTACCAAACCCGAAACATTCATCTCCCGATTCGCTCCAGATCAACCCCGCAAAGGCGC TGATATCCTCGTCGAAGCTTTAGAACGTCAAGGCGTAGAAACCGTATTCGCTTACCCTGGAGGTGCATCAATG GAGATTCACCAAGCCTTAACCCGCTCTTCCTCAATCCGTAACGTCCTTCCTCGTCACGAACAAGGAGGTGTATT CGCAGCAGAAGGATACGCTCGATCCTCAGGTAAACCAGGTATCTGTATAGCCACTTCAGGTCCCGGAGCTACA AATCTCGTTAGCGGATTAGCCGATGCGTTGTTAGATAGTGTTCCTCTTGTAGCAATCACAGGACAAGTCCCTCG TCGTATGATTGGTACAGATGCGTTTCAAGAGACTCCGATTGTTGAGGTAACGCGTTCGATTACGAAGCATAAC TATCTTGTGATGGATGTTGAAGATATCCCTAGGATTATTGAGGAAGCTTTCTTTTTAGCTACTTCTGGTAGACC TGGACCTGTTTTGGTTGATGTTCCTAAAGATATTCAACAACAGCTTGCGATTCCTAATTGGGAACAGGCTATGA GATTACCTGGTTATATGTCTAGGATGCCTAAACCTCCGGAAGATTCTCATTTGGAGCAGATTGTTAGGTTGATT TCTGAGTCTAAGAAGCCTGTGTTGTATGTTGGTGGTGGTTGTTTGAATTCTAGCGATGAATTGGGTAGGTTTG TTGAGCTTACGGGGATCCCTGTTGCGAGTACGTTGATGGGGCTGGGATCTTATCCTTGTGATGATGAGTTGTC GTTACATATGCTTGGAATGCATGGGACTGTGTATGCAAATTACGCTGTGGAGCATAGTGATTTGTTGTTGGCG TTTGGGGTAAGGTTTGATGATCGTGTCACGGGTAAGCTTGAGGCTTTTGCTAGTAGGGCTAAGATTGTTCATA TTGATATTGACTCGGCTGAGATTGGGAAGAATAAGACTCCTCATGTGTCTGTGTGTGGTGATGTTAAGCTGGC TTTGCAAGGGATGAATAAGGTTCTTGAGAACCGAGCGGAGGAGCTTAAGCTTGATTTTGGAGTTTGGAGGAA TGAGTTGAACGTACAGAAACAGAAGTTTCCGTTGAGCTTTAAGACGTTTGGGGAAGCTATTCCTCCACAGTAT GCGATTAAGGTCCTTGATGAGTTGACTGATGGAAAAGCCATAATAAGTACTGGTGTCGGGCAACATCAAATG TGGGCGGCGCAGTTCTACAATTACAAGAAACCAAGGCAGTGGCTATCATCAGGAGGCCTTGGAGCTATGGGA TTTGGACTTCCTGCTGCGATTGGAGCGTCTGTTGCTAACCCTGATGCGATAGTTGTGGATATTGACGGAGATG GAAGCTTTATAATGAATGTGCAAGAGCTAGCCACTATTCGTGTAGAGAATCTTCCAGTGAAGGTACTTTTATTA AACAACCAGCATCTTGGCATGGTTATGCAATGGGAAGATCGGTTCTACAAAGCTAACCGAGCTCACACATTTC TCGGGGATCCGGCTCAGGAGGACGAGATATTCCCGAACATGTTGCTGTTTGCAGCAGCTTGCGGGATTCCAG CGGCGAGGGTGACAAAGAAAGCAGATCTCCGAGAAGCTATTCAGACAATGCTGGATACACCAGGACCTTACC TGTTGGATGTGATTTGTCCGCACCAAGAACATGTGTTGCCGATGATCCCGAATGGTGGCACTTTCAACGATGT CATAACGGAAGGAGATGGCCGGATTAAATACTGA SEQ ID No: 6, PPO cDNA sequence ATGGTTATTCAGTCTATTACCCACCTCTCCCCAAACCTCGCTTTGCCATCTCCACTTTCTGTGTCCACCAAGAACT ACCCAGTTGCTGTGATGGGCAACATCTCTGAGAGAGAGGAACCTACCTCTGCTAAGAGGGTTGCAGTTGTTG GAGCTGGTGTTTCTGGACTTGCTGCTGCTTACAAGCTCAAGTCCCACGGACTTTCAGTGACCCTTTTCGAGGCT GATTCTAGGGCTGGTGGAAAGCTTAAGACCGTGAAGAAGGATGGCTTCATCTGGGATGAGGGTGCTAACACT ATGACCGAGTCTGAGGCTGAGGTGTCCTCCCTTATTGATGATCTTGGCCTCAGAGAGAAGCAACAGCTCCCAA TCTCTCAGAACAAGCGTTACATTGCTAGGGATGGACTTCCAGTGCTCCTCCCATCTAACCCAGCTGCTTTGCTC ACCTCCAACATCCTTTCCGCTAAGTCCAAGCTCCAGATCATGCTCGAACCATTCCTTTGGAGGAAGCACAACGC TACCGAGCTTTCTGATGAGCACGTTCAAGAGTCTGTGGGCGAGTTCTTCGAGAGGCATTTCGGCAAAGAATTC GTGGACTACGTGATCGATCCATTCGTTGCTGGAACTTGCGGAGGTGATCCTCAGTCTCTTTCTATGCATCACAC CTTCCCAGAGGTGTGGAACATCGAGAAGAGGTTCGGATCTGTGTTCGCTGGCCTTATCCAGTCCACCCTCTTG TCCAAGAAAGAAAAGGGTGGCGAGAACGCCTCCATCAAGAAGCCAAGAGTTAGGGGCTCATTCAGCTTCCAA GGTGGAATGCAAACCCTCGTGGATACCATGTGCAAGCAGCTTGGAGAGGATGAGCTTAAGTTGCAGTGCGAG GTGCTCAGCCTTTCCTATAACCAGAAGGGAATCCCATCCCTCGGCAACTGGTCTGTGTCATCTATGTCCAACAA CACCTCCGAGGACCAGTCTTACGATGCTGTTGTTGTGACCGCCCCAATCCGTAACGTGAAAGAAATGAAGATC ATGAAGTTCGGCAACCCCTTCTCCCTCGACTTCATTCCAGAGGTTACCTACGTGCCACTCTCCGTGATGATTACC GCTTTCAAGAAAGACAAGGTGAAGAGGCCACTCGAGGGATTCGGAGTGCTCATTCCTTCTAAAGAGCAGCAC AACGGACTCAAGACTGAGGGAACCCTCTTCTCCTCTATGATGTTCCCAGATAGGGCCCCTTCCGATATGTGCCT TTTCACTACTGTTGTGGGCGGCTCTAGGAACAGAAAGCTTGCTAACGCTTCCACCGACGAGCTGAAGCAGATC GTGTCATCTGATCTTCAGCAGCTTCTCGGAACCGAGGACGAACCATCTTTCGTGAACCACCTCTTCTGGTCCAA CGCTTTCCCACTTTACGGCCACAACTACGATTCTGTGCTCAGGGCTATCGACAAGATGGAAAAGGATCTCCCC GGCTTCTTCTACGCTGGAAACCATAAGGGTGGTCTGTCTGTGGGAAAGGCTATGGCTTCTGGATGCAAGGCT GCTGAGCTTGTGATCTCCTACCTCGACTCTCACATCTACGTGAAGATGGACGAAAAGACCGCCTGA SEQ ID No: 7, BP100 KKLFKKILKYL SEQ ID No: 8, R9 RRRRRRRRR SEQ ID No: 9, D-R9 (synthetic) rrrrrrrrr SEQ ID No: 10, KH9 KHKHKHKHKHKHKHKHKH SEQ ID NO: 11, BP100(KH)9 KKLFKKILKYLKHKHKHKHKHKHKHKHKH SEQ ID NO: 12, BP100CH7 KKLFKKILKYLHHCRGHTVHSHHHCIR