DONOR T-CELLS WITH KILL SWITCH
20210340563 · 2021-11-04
Inventors
- Geoffrey Phillip SYMONDS (Rose Bay, AU)
- Ming Yan (Encino, CA)
- Chi-Lin LEE (Arcadia, CA, US)
- Christopher Walter Alma (Castle Hill, AU)
- Jeffrey S. Bartlett (Columbus, OH, US)
Cpc classification
C12N9/22
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61P7/00
HUMAN NECESSITIES
C12Y204/02008
CHEMISTRY; METALLURGY
International classification
A61K35/17
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The disclosed methods are generally directed to preventing, treating, suppressing, controlling or otherwise mitigating side effects of T-cell therapy, the T-cell therapy designed to accelerate immune reconstitution, induce a graft-versus-malignancy effect, and/or target tumor cells. In some embodiments, the present disclosure provides expression vectors including a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown hypoxanthine-guanine phosphoribosyl transferase.
Claims
1. An expression vector comprising a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown hypoxanthine-guanine phosphoribosyl transferase (HPRT), wherein the shRNA has at least 95% identity to the sequence of any of SEQ ID NOS: 1-7.
2. The expression vector of claim 1, wherein the shRNA has at least 97% identity to the sequence of any one of SEQ ID NOS: 1-7.
3. The expression vector of claim 1, wherein the shRNA has a nucleic acid sequence of any one of SEQ ID NOS: 1-7.
4. The expression vector of claim 1, wherein the shRNA has a nucleic acid sequence of any one of SEQ ID NOS: 2, 5, 6, and 7.
5. The expression vector of claim 1, wherein the first expression control sequence comprises a Pol III promoter or a Pol II promoter.
6. The expression vector of claim 5, wherein the Pol III promoter comprises a 7sk promoter, a mutated 7sk promoter, an H1 promoter, or an EF1a promoter.
7. The expression vector of claim 6, wherein the 7sk promoter has a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 14 or SEQ ID NO: 15.
8. The expression vector of claim 6, wherein the 7sk promoter has a nucleic acid sequence having at least 97% sequence identity to SEQ ID NO: 14 or SEQ ID NO: 15.
9. A host cell transduced with the expression vector of claim 1, wherein the host cell is rendered substantially HPRT deficient following transduction.
10. The host cell of claim 9, wherein the host cell is a lymphocyte.
11. A method of providing benefits of a lymphocyte infusion to a patient in need of treatment thereof while mitigating side effects comprising: generating substantially HPRT deficient lymphocytes from a donor sample, wherein the substantially HPRT deficient lymphocytes are generated by transducing lymphocytes within the donor sample with an expression vector comprising a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown hypoxanthine-guanine phosphoribosyl transferase (HPRT), wherein the shRNA has at least 95% identity to the sequence of any one of SEQ ID NOS: 1-7; positively selecting for the substantially HPRT deficient lymphocytes ex vivo to provide a population of modified lymphocytes; and administering a therapeutically effective amount of the population of modified lymphocytes to the patient contemporaneously with or after an administration of an HSC graft.
12. A method of providing benefits of a lymphocyte infusion to a patient in need of treatment thereof while mitigating side effects comprising: generating substantially HPRT deficient lymphocytes from a donor sample, wherein the substantially HPRT deficient lymphocytes are generating by transfecting lymphocytes within the donor sample with a delivery vehicle including components adapted to knockout HPRT; positively selecting for the substantially HPRT deficient lymphocytes ex vivo to provide a population of modified lymphocytes; administering an HSC graft to the patient; administering a therapeutically effective amount of the population of modified lymphocytes to the patient contemporaneously with or after the administration of the HSC graft.
13. The method of claim 12, wherein the components adapted to knockout HPRT comprise a guide RNA targeting a nucleic acid sequence having at least 90% sequence identity to any one of SEQ ID NOS: 25-39.
14. The method of claim 12, wherein the components adapted to knockout HPRT comprise a guide RNA targeting a nucleic acid sequence selected from the group consisting of SEQ ID NOS: 25-39.
15. The method of claim 12, wherein the components adapted to knockout HPRT further comprises a Cas protein.
16. The method of claim 15, wherein the Cas protein comprises a Cas9 protein or a Cas12 protein.
17. The method of claim 12, wherein the delivery vehicle comprises a nanocapsule which optionally comprises one or more targeting moieties.
18. The method of claim 12, wherein the side effects include development of graft-versus-host disease (GvHD) in the patient.
19. The method of claim 12, wherein the patient in need of treatment thereof has a hematological cancer.
20. The method of claim 12, wherein the method further comprises administering to the patient one or more doses of a dihydrofolate reductase inhibitor.
21. The method of claim 20, wherein the dihydrofolate reductase inhibitor is selected from the group consisting of MTX or MPA.
22. The method of claim 12, wherein the positive selection comprises contacting the substantially HPRT deficient lymphocytes with a purine analog.
23. The method of claim 22, wherein the purine analog is selected from the group consisting of 6-thioguanine (6TG) and 6-mercaptopurin (6-MP).
24. The method of claim 23, wherein an amount of 6TG ranges from between about 1 μg/mL to about 15 μg/mL.
25. The method of claim 12, wherein the positive selection comprises contacting the generated substantially HPRT deficient lymphocytes with both a purine analog and allopurinol.
26. The method of claim 12, wherein each dose of the modified lymphocytes comprises between about 0.1×10.sup.6 cells/kg to about 240×10.sup.6 cells/kg.
27. The method of claim 26, wherein a total dosage of modified lymphocytes comprises between about 0.1×10.sup.6 cells/kg to about 730×10.sup.6 cells/kg.
28. A pharmaceutical composition comprising the expression vectors of claim 1, and a pharmaceutically acceptable carrier or excipient.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
SEQUENCE LISTING
[0078] The nucleic acid and amino acid sequences appended hereto are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. The sequence listing is submitted as an ASCII text file, named “Calimmune-072WO_ST25.txt” created on Dec. 19, 2019, 26 KB, which is incorporated by reference herein.
DETAILED DESCRIPTION
Definitions
[0079] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
[0080] As used herein, the singular terms “a,” “an,” and “the” include plural referents unless the context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise.
[0081] As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
[0082] As used herein, the terms “comprising,” “including,” “having,” and the like are used interchangeably and have the same meaning. Similarly, “comprises,” “includes,” “has,” and the like are used interchangeably and have the same meaning. Specifically, each of the terms is to be interpreted to be an open term meaning “at least the following,” and is also interpreted not to exclude additional features, limitations, aspects, etc. Thus, for example, “a device having components a, b, and c” means that the device includes at least components a, b and c. Similarly, the phrase: “a method involving steps a, b, and c” means that the method includes at least steps a, b, and c. Moreover, while the steps and processes may be outlined herein in a particular order, the skilled artisan will recognize that the ordering steps and processes may vary.
[0083] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and/or” as defined above. For example, when separating items in a list, “or” or “and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0084] As used herein, the terms “administer” or “administering” mean providing a composition, formulation, or specific agent to a subject (e.g. a human patient) in need of treatment, including those described herein.
[0085] As used herein, the term “Cas protein” refers an RNA-guided nuclease comprising a Cas protein, or a fragment thereof. A Cas protein may also be referred to as a CRISPR (clustered regularly interspaced short palindromic repeat)-associated nuclease. CRISPR is an adaptive immune system that provides protection against mobile genetic elements (viruses, transposable elements and conjugative plasmids). CRISPR clusters contain spacers, sequences complementary to antecedent mobile elements, and target invading nucleic acids. CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). Cas proteins include, but are not limited to, Cas9 proteins, Cas9-like proteins encoded by Cas9 orthologs, Cas9-like synthetic proteins, Cpf1 proteins, proteins encoded by Cpf1 orthologs, Cpf1-like synthetic proteins, C2c1 proteins, C2c2 proteins, C2c3 proteins, and variants and modifications thereof. Further examples of Cas proteins include, but are not limited to, Cpf1, C2c1, C2c3, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, and Cas13c. Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, C2c1, C2c3, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, and Cas13c.
[0086] In some embodiments, a Cas protein is a Class 2 CRISPR-associated protein. “Class 2 type CRISPR-Cas systems” as defined herein refer to CRISPR-Cas systems functioning with a single protein as effector complex (such as Cas9). As defined herein, “class 2 type II CRISPR-Cas system” refers to CRISPR-Cas systems comprising the Cas9 gene among its cas genes. A “class 2 type II-A CRISPR-Cas system” refers to CRISPR-Cas systems comprising cas9 and Csn2 genes. A “class 2 type 11-B CRISPR-Cas system” refers to CRISPR-Cas systems comprising the cas9 and cas4 genes. A “class 2 type 11-C CRISPR-Cas system” refers to CRISPR-Cas systems comprising the Cas9 gene but neither the Csn2 nor the Cas4 gene. A “class 2 type V CRISPR-Cas system” refers to CRISPR-Cas systems comprising the cas12 gene (Cas12a, 12b or 12c gene) in its cas genes. A “class 2 type VI CRISPR-Cas system” refers to CRISPR-Cas systems comprising the Cas13 gene (Cas13a, 13b or 13c gene) in its Cas genes. Each wild-type Cas protein interacts with one or more cognate polynucleotide (most typically RNA) to form a nucleoprotein complex (most typically a ribonucleoprotein complex). Additional Cas proteins are described by Haft et. al., “A Guild of 45 CRISPR-Associated (Cas) Protein Families and Multiple CRISPR/Cas Subtypes Exist in Prokaryotic Genomes, PLoS Comput. Biol., 2005, November; 1(6): e60. In some embodiments, the Cas protein is a modified Cas protein, e.g. a modified variant of any of the Cas proteins identified herein.
[0087] As used herein, the terms “Cas9” or “Cas9 protein” refer to an enzyme (wild-type or recombinant) that can exhibit least endonuclease activity (e.g. cleaving the phosphodiester bond within a polynucleotide) guided by a CRISPR RNA (crRNA) bearing complementary sequence to a target polynucleotide. Cas9 polypeptides are known in the art and include Cas9 polypeptides from any of a variety of biological sources, including, e.g., prokaryotic sources such as bacteria and archaea. Bacterial Cas9 includes, Actinobacteria (e.g., Actinomyces naeslundii) Cas9, Aquificae Cas9, Bacteroidetes Cas 9, Chlamydiae Cas9, Chloroflexi Cas9, Cyanobacteria Cas9, Elusimicrobia Cas9, Fibrobacteres Cas9, Firmicutes Cas9 (e.g., Streptococcus pyogenes Cas9, Streptococcus thermophilus Cas9, Listeria innocua Cas9, Streptococcus agalactiae Cas9, Streptococcus mutans Cas9, and Enterococcus faecium Cas9), Fusobacteria Cas9, Proteobacteria (e.g., Neisseria meningitides, Campylobacter jejuni and lari) Cas9, Spirochaetes (e.g., Treponema denticola) Cas9, and the like. Archaea Cas 9 includes Euryarchaeota Cas9 (e.g., Methanococcus maripaludis Cas9) and the like. A variety of Cas9 and related polypeptides are known, and are reviewed in, e.g., Makarova et al. (2011) Nature Reviews Microbiology 9:467-477, Makarova et al. (2011) Biology Direct 6:38, Haft et al. (2005) PLOS Computational Biology I:e60 and Chylinski et al. (2013) RNA Biology 10:726-737; K. Makarova et al., An updated evolutionary classification of CRISPR-Cas systems. (2015) Nat. Rev. Microbio. 13:722-736; and B. Zetsche et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. (2015) Cell. 163(3):759-771.
[0088] Other Cas9 polypeptides include Francisella tularensis subsp. novicida Cas9, Pasteurella multocida Cas9, Mycoplasma gallisepticum str. F Cas9, Nitratifractor salsuginis str DSM 16511 Cas9, Parvibaculum lavamentivorans Cas9, Roseburia intestinalis Cas9, Neisseria cinera Cas9, Gluconacetobacter diazotrophicus Cas9, Azospirillum B510 Cas9, Spaerochaeta globus str. Buddy cas9, Flavobacterium columnare Cas9, Fluviicola taffensis Cas9, Bacteroides coprophilus Cas9, Mycoplasma mobile Cas9, Lactobacillus farciminis Cas9, Streptococcus pasteurianus Cas9, Lactobacillus johnsonii Cas9, Staphylococcus pseudintermedius Cas9, Filifactor alocis Cas9, Treponema denticola Cas9, Legionella pneumophila str. Paris Cas9, Sutterella wadsworthensis Cas9, and Corynebacter diptheriae Cas9. The term “Cas9” includes a Cas9 polypeptide of any Cas9 family, including any isoform of Cas9. Amino acid sequences of various Cas9 homologs, orthologs, and variants beyond those specifically stated or provided herein are known in the art and are publicly available, within the purview of those skill in the art, and thus within the spirit and scope of this disclosure.
[0089] As used herein, the terms “Cas12” or “Cas12 protein” refer to any Cas12 protein including, but not limited to, Cas12 protein such as Cas12a, Cas12b, Cas12c, Cas12d, Cas12e. In some embodiments, a Cas12 protein has an amino acid sequence which is at least 85% (or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%) identical to the amino acid sequence of a functional Cas12 protein, particularly the Cas12a/Cpf1 protein from Acidaminococcus sp. strain BV3L6 (Uniprot Entry: U2UMQ6; Uniprot Entry Name: CS12A_ACISB) or the Cas12a/Cpf1 protein from Francisella tularensis (Uniprot Entry: A0Q7Q2; Uniprot Entry Name: CS12A_FRATN). In some embodiments, the Cas12 protein may be a Cas12 polypeptide substantially identical to the protein found in nature, or a Cas12 polypeptide having at least 85% sequence identity (or at least 90% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity) to the Cas12 protein found in nature and having substantially the same biological activity. Examples of Cas12a proteins include, but are not limited to, FnCas12a, AsCas12a, LbCas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a or Lb4Cas12a; the Cas12a is preferably LbCas12a. Examples of Cas12b proteins include, but are not limited to, AacCas12b, Aac2Cas12b, AkCas12b, AmCas12b, AhCas12b, AcCas12b.
[0090] As used herein, the phrase “effective amount” refers to the amount of a composition or formulation described herein that will elicit the diagnostic, biological or medical response of a tissue, system, animal, or human that is being sought by the researcher, veterinarian, medical doctor or other clinician.
[0091] As used herein, the term “expression cassette” refers to one or more genetic sequences within a vector which can express a RNA, and, in some embodiments, subsequently a protein. The expression cassette comprises at least one promoter and at least one gene of interest. In some embodiments, the expression cassette includes at least one promoter, at least one gene of interest, and at least one additional nucleic acid sequence encoding a molecule for expression (e.g. a RNAi). In some embodiments, expression cassette is positionally and sequentially oriented within the vector such that the nucleic acid in the cassette can be transcribed into RNA, and when necessary, translated into a protein or a polypeptide, undergo appropriate post-translational modifications required for activity in the transformed cell (e.g. transduced stem cell), and be translocated to the appropriate compartment for biological activity by targeting to appropriate intracellular compartments or secretion into extracellular compartments. In some embodiments, the cassette has its 3′ and 5′ ends adapted for ready insertion into a vector, e.g., it has restriction endonuclease sites at each end.
[0092] As used herein, the term “functional nucleic acid” refers to molecules having the capacity to reduce expression of a protein by directly interacting with a transcript that encodes the protein. siRNA molecules, ribozymes, and antisense nucleic acids constitute exemplary functional nucleic acids.
[0093] As used herein, the term “gene” refers broadly to any segment of DNA associated with a biological function. A gene encompasses sequences including but not limited to a coding sequence, a promoter region, a cis-regulatory sequence, a non-expressed DNA segment is a specific recognition sequence for regulatory proteins, a non-expressed DNA segment that contributes to gene expression, a DNA segment designed to have desired parameters, or combinations thereof.
[0094] As used herein, the term “gene silencing” is meant to describe the downregulation, knock-down, degradation, inhibition, suppression, repression, prevention, or decreased expression of a gene, transcript and/or polypeptide product. Gene silencing and interference also describe the prevention of translation of mRNA transcripts into a polypeptide. In some embodiments, translation is prevented, inhibited, or decreased by degrading mRNA transcripts or blocking mRNA translation.
[0095] As used herein, the term “gene expression” refers to the cellular processes by which a biologically active polypeptide is produced from a DNA sequence.
[0096] As used herein, the terms “guide RNA” or “gRNA” refer to a RNA molecule capable of directing a CRISPR effector having nuclease activity to target and cleave a specified target nucleic acid.
[0097] As used herein, the terms “hematopoietic cell transplant” or “hematopoietic cell transplantation” refer to bone marrow transplantation, peripheral blood stem cell transplantation, umbilical vein blood transplantation, or any other source of pluripotent hematopoietic stem cells. Likewise, the terms “stem cell transplant,” or “transplant,” refer to a composition comprising stem cells that are in contact with (e.g. suspended in) a pharmaceutically acceptable carrier. Such compositions are capable of being administered to a subject through a catheter.
[0098] As used herein, the term “host cell” refers to cells that is to be modified using the methods of the present disclosure. In some embodiments, the host cells are mammalian cells in which the expression vector can be expressed. Suitable mammalian host cells include, but are not limited to, human cells, murine cells, non-human primate cells (e.g. rhesus monkey cells), human progenitor cells or stem cells, 293 cells, HeLa cells, D17 cells, MDCK cells, BHK cells, and Cf2Th cells. In certain embodiments, the host cell comprising an expression vector of the disclosure is a hematopoietic cell, such as hematopoietic progenitor/stem cell (e.g. CD34-positive hematopoietic progenitor/stem cell), a monocyte, a macrophage, a peripheral blood mononuclear cell, a CD4+T lymphocyte, a CD8+T lymphocyte, or a dendritic cell. The hematopoietic cells (e.g. CD4+T lymphocytes, CD8+T lymphocytes, and/or monocyte/macrophages) to be transduced with an expression vector of the disclosure can be allogeneic, autologous, or from a matched sibling. The hematopoietic progenitor/stem cell are, in some embodiments, CD34-positive and can be isolated from the patient's bone marrow or peripheral blood. The isolated CD34-positive hematopoietic progenitor/stem cell (and/or other hematopoietic cell described herein) is, in some embodiments, transduced with an expression vector as described herein.
[0099] As used herein, the terms “hypoxanthine-guanine phosphoribosyltransferase” or “HPRT” refer to an enzyme involved in purine metabolism encoded by the HPRT1 gene (see, for example, SEQ ID NO: 12). HPRT1 is located on the X chromosome, and thus is present in single copy in males. HPRT1 encodes the transferase that catalyzes the conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate by transferring the 5-phosphorobosyl group from 5-phosphoribosyl 1-pyrophosphate to the purine. The enzyme functions primarily to salvage purines from degraded DNA for use in renewed purine synthesis.
[0100] As used herein, the term “indel” refers to a mutation named with the blend of insertion and deletion. It refers to a length difference between two alleles where it is unknowable if the difference was originally caused by a sequence insertion or by a sequence deletion. If the number of nucleotides in the insertion/deletion is not divisible by three, and it occurs in a protein coding region, it is also a frameshift mutation (frameshift mutation will in general cause the reading of the codons after the mutation to code for different amino acid).
[0101] As used herein, the term “lentivirus” refers to a genus of retroviruses that are capable of infecting dividing and non-dividing cells. Several examples of lentiviruses include HIV (human immunodeficiency virus: including HIV type 1, and HIV type 2), the etiologic agent of the human acquired immunodeficiency syndrome (AIDS); visna-maedi, which causes encephalitis (visna) or pneumonia (maedi) in sheep, the caprine arthritis-encephalitis virus, which causes immune deficiency, arthritis, and encephalopathy in goats; equine infectious anemia virus, which causes autoimmune hemolytic anemia, and encephalopathy in horses; feline immunodeficiency virus (Hy), which causes immune deficiency in cats; bovine immune deficiency virus (BIV), which causes lymphadenopathy, lymphocytosis, and possibly central nervous system infection in cattle; and simian immunodeficiency virus (SIV), which causes immune deficiency and encephalopathy in sub-human primates.
[0102] As used herein, the term “lentiviral vector” is used to denote any form of a nucleic acid derived from a lentivirus and used to transfer genetic material into a cell via transduction. The term encompasses lentiviral vector nucleic acids, such as DNA and RNA, encapsulated forms of these nucleic acids, and viral particles in which the viral vector nucleic acids have been packaged.
[0103] As used herein, the terms “knock down” or “knockdown” when used in reference to an effect of RNAi on gene expression, means that the level of gene expression is inhibited, or is reduced to a level below that generally observed when examined under substantially the same conditions, but in the absence of RNAi.
[0104] As used herein, the terms “knock-out” or “knockout” refer to partial or complete suppression of the expression of an endogenous gene. This is generally accomplished by deleting a portion of the gene or by replacing a portion with a second sequence, but may also be caused by other modifications to the gene such as the introduction of stop codons, the mutation of critical amino acids, the removal of an intron junction, etc. Accordingly, a “knock-out” construct is a nucleic acid sequence, such as a DNA construct, which, when introduced into a cell, results in suppression (partial or complete) of expression of a polypeptide or protein encoded by endogenous DNA in the cell. In some embodiments, a “knockout” includes mutations such as, a point mutation, an insertion, a deletion, a frameshift, or a missense mutation
[0105] As used herein, the terms “multiplicity of infection” or “MOI” means the ratio of agents (e.g. phage or more generally virus, bacteria) to infection targets (e.g. cell). For example, when referring to a group of cells inoculated with virus particles, the multiplicity of infection or MOI is the ratio of the number of virus particles to the number of target cells present in a defined space.
[0106] As used herein, the term “minicell” refers to anucleate forms of bacterial cells, engendered by a disturbance in the coordination, during binary fission, of cell division with DNA segregation. Minicells are distinct from other small vesicles that are generated and released spontaneously in certain situations and, in contrast to minicells, are not due to specific genetic rearrangements or episomal gene expression. Minicells of the present disclosure are anucleate forms of E. coli or other bacterial cells, engendered by a disturbance in the coordination, during binary fission, of cell division with DNA segregation. Prokaryotic chromosomal replication is linked to normal binary fission, which involves mid-cell septum formation. In E. coli, for example, mutation of min genes, such as minCD, can remove the inhibition of septum formation at the cell poles during cell division, resulting in production of a normal daughter cell and an anucleate minicell. See de Boer et al., 1992; Raskin & de Boer, 1999; Hu & Lutkenhaus, 1999; Harry, 2001. Minicells are distinct from other small vesicles that are generated and released spontaneously in certain situations and, in contrast to minicells, are not due to specific genetic rearrangements or episomal gene expression. For practicing the present disclosure, it is desirable for minicells to have intact cell walls (“intact minicells”). In addition to min operon mutations, anucleate minicells also are generated following a range of other genetic rearrangements or mutations that affect septum formation, for example in the divIVB1 in B. subtilis. See Reeve and Cornett, 1975; Levin et al., 1992. Minicells also can be formed following a perturbation in the levels of gene expression of proteins involved in cell division/chromosome segregation. For example, overexpression of minE leads to polar division and production of minicells. Similarly, chromosome-less minicells may result from defects in chromosome segregation for example the smc mutation in Bacillus subtilis (Britton et al., 1998), spoOJ deletion in B. subtilis (Ireton et al., 1994), mukB mutation in E. coli (Hiraga et al., 1989), and parC mutation in E. coli (Stewart and D'Ari, 1992). Gene products may be supplied in trans. When over-expressed from a high-copy number plasmid, for example, CafA may enhance the rate of cell division and/or inhibit chromosome partitioning after replication (Okada et al., 1994), resulting in formation of chained cells and anucleate minicells (Wachi et al., 1989; Okada et al., 1993). Minicells can be prepared from any bacterial cell of Gram-positive or Gram-negative origin.
[0107] As used herein, the term “mutated” refers to a change in a sequence, such as a nucleotide or amino acid sequence, from a native, wild-type, standard, or reference version of the respective sequence, i.e. the non-mutated sequence. A mutated gene can result in a mutated gene product. A mutated gene product will differ from the non-mutated gene product by one or more amino acid residues. In some embodiments, a mutated gene which results in a mutated gene product can have a sequence identity of about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or greater to the corresponding non-mutated nucleotide sequence.
[0108] As used herein, the term “nanocapsules” refers to nanoparticles having a shell, e.g. a polymeric shell, encapsulating one or more components, e.g. one or more proteins and/or one or more nucleic acids. In some embodiments, the nanocapsules have an average diameter of less than or equal to about 200 nanometers (nm), for example between about 1 to 200 nm, or between about 5 to about 200 nm, or between about 10 to about 150 nm, or 15 to 100 nm, or between about 15 to about 150 nm, or between about 20 to about 125 nm, or between about 50 to about 100 nm, or between about 50 to about 75 nm. In other embodiments, the nanocapsules have an average diameter of between about 10 nm to about 20 nm, about 20 to about 25 nm, about 25 nm to about 30 nm, about 30 nm to about 35 nm, about 35 nm to about 40 nm, about 40 nm to about 45 nm, about 45 nm to about 50 nm, about 50 nm to about 55 nm, about 55 nm to about 60 nm, about 60 nm to about 65 nm, about 70 to about 75 nm, about 75 nm to about 80 nm, about 80 nm to about 85 nm, about 85 nm to about 90 nm, about 90 nm to about 95 nm, about 95 nm to about 100 nm, or about 100 nm to about 110 nm. In some embodiments, the nanocapsules are designed to degrade in about 1 hour, or about 2 hours, or about 3 hours, or about 4 hours, or about 5 hours, or about 6 or about 12 hours, or about 1 day, or about 2 days, or about 1 week, or about 1 month. In some embodiments, the surface of the nanocapsule can have a charge between about 1 to about 15 millivolts (mV) (such as measured in a standard phosphate solution). In other embodiments, the surface of the nanocapsule can have a charge of between about 1 to about 10 mV.
[0109] As used herein, the terms “positively charged monomer” or “cationic monomer” refer to monomers having a net positive charge, i.e. +1, +2, +3. In some embodiments, the positively charged monomer is a monomer including positively-charged groups. As used herein, the terms “negatively charged monomer” or “anionic monomer” refer to monomers having a net negative charge, i.e. −1, −2, −3. In some embodiments, the negatively charged monomer is a monomer including negatively-charged groups. As used herein, the term “neutral monomer” refers to monomers having a net neutral charge.
[0110] As used herein, the term “polymer” is defined as being inclusive of homopolymers, copolymers, interpenetrating networks, and oligomers. Thus, the term polymer may be used interchangeably herein with the term homopolymers, copolymers, interpenetrating polymer networks, etc. The term “homopolymer” is defined as a polymer derived from a single species of monomer. The term “copolymer” is defined as a polymer derived from more than one species of monomer, including copolymers that are obtained by copolymerization of two monomer species, those obtained from three monomers species (“terpolymers”), those obtained from four monomers species (“quaterpolymers”), etc. The term “copolymer” is further defined as being inclusive of random copolymers; alternating copolymers, graft copolymers, and block copolymers. Copolymers, as that term is used generally, include interpenetrating polymer networks. The term “random copolymer” is defined as a copolymer comprising macromolecules in which the probability of finding a given monomeric unit at any given site in the chain is independent of the nature of the adjacent units. In a random copolymer, the sequence distribution of monomeric units follows Bernoullian statistics. The term “alternating copolymer” is defined as a copolymer comprising macromolecules that include two species of monomeric units in alternating sequence.
[0111] As used herein, the term “crosslinker” refers to a bond or moiety which provides a link (e.g. an intramolecular link or intermolecular link) between two or more molecular chains, domains, or other moieties. In some embodiments, a crosslinker is a molecule which forms links between molecular chains to form a connected molecule.
[0112] As used herein, the term “operably linked” refers to functional linkage between a nucleic acid expression control sequence (such as a promoter, signal sequence, enhancer or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence affects transcription and/or translation of the nucleic acid corresponding to the second sequence when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the expression control sequence.
[0113] As used herein, the term “promoter” refers to a recognition site of a polynucleotide (DNA or RNA) to which an RNA polymerase binds. An RNA polymerase initiates and transcribes polynucleotides operably linked to the promoter. In some embodiments, promoters operative in mammalian cells comprise an AT-rich region located approximately 25 to 30 bases upstream from the site where transcription is initiated and/or another sequence found 70 to 80 bases upstream from the start of transcription, a CNCAAT region where N may be any nucleotide.
[0114] As used herein, the terms “pharmaceutically acceptable carrier or excipient” refers to a carrier or excipient that is useful in preparing a pharmaceutical formulation that is generally safe, non-toxic, and is neither biologically or otherwise undesirable, and includes a carrier or excipient that is acceptable for veterinary use as well as human pharmaceutical use.
[0115] As used herein, the term “retroviruses” refers to viruses having an RNA genome that is reverse transcribed by retroviral reverse transcriptase to a cDNA copy that is integrated into the host cell genome. Retroviral vectors and methods of making retroviral vectors are known in the art. Briefly, to construct a retroviral vector, a nucleic acid encoding a gene of interest is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective. In order to produce virions, a packaging cell line containing the gag, pol, and env genes but without the LTR and packaging components is constructed (Mann et al., Cell, Vol. 33:153-159, 1983). When a recombinant plasmid containing a cDNA, together with the retroviral LTR and packaging sequences, is introduced into this cell line, the packaging sequence allows the RNA transcript of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media. The media containing the recombinant retroviruses is then collected, optionally concentrated, and used for gene transfer.
[0116] As used herein, the terms “siRNA” or “small interference RNA” refer to a short double-strand RNA composed of about ten nucleotides to several tens of nucleotides, which induce RNAi (RNA interference), i.e. induce the degradation of the target mRNA or inhibit the expression of the target gene via cleavage of the target mRNA. RNA interference (“RNAi”) is a method of post-transcriptional inhibition of gene expression that is conserved throughout many eukaryotic organisms, and it refers to a phenomenon in which a double-stranded RNA composed of a sense RNA having a sequence homologous to the mRNA of the target gene and an antisense RNA having a sequence complementary thereto is introduced into cells or the like so that it can selectively induce the degradation of the mRNA of the target gene or can inhibit the expression of the target gene. RNAi is induced by a short (i.e., less than about 30 nucleotides) double-stranded RNA molecule present in cells (Fire A. et al., Nature, 391: 806-811, 1998). When siRNA is introduced into cells, the expression of the snRNA of the target gene having a nucleotide sequence complementary to that of the siRNA will be inhibited.
[0117] As used herein, the terms “small hairpin RNA” or “snRNA” refer to RNA molecules comprising an antisense region, a loop portion and a sense region, wherein the sense region has complementary nucleotides that base pair with the antisense region to form a duplex stem. Following post-transcriptional processing, the small hairpin RNA is converted into a small interfering RNA by a cleavage event mediated by the enzyme which is a member of the RNase III family. As used herein, the phrase “post-transcriptional processing” refers to mRNA processing that occurs after transcription and is mediated, for example, by the enzymes and/or Drosha.
[0118] As used herein, the term “subject” refers to a mammal such as a human, mouse or primate. Typically, the mammal is a human (Homo sapiens).
[0119] As used herein, the term “substantially HPRT deficient” refers to cells, e.g. host cells, where the level of HPRT gene expression is reduced by at least about 50%. In some embodiments, the level of HPRT gene expression is reduced by at least about 55%. In some embodiments, the level of HPRT gene expression is reduced by at least about 60%. In some embodiments, the level of HPRT gene expression is reduced by at least about 65%. In some embodiments, the level of HPRT gene expression is reduced by at least about 70%. In some embodiments, the level of HPRT gene expression is reduced by at least about 75%. In some embodiments, the level of HPRT gene expression is reduced by at least about 80%. In some embodiments, the level of HPRT gene expression is reduced by at least about 85%. In some embodiments, the level of HPRT gene expression is reduced by at least about 90%. In some embodiments, the level of HPRT gene expression is reduced by at least about 95%. In other embodiments, residual HPRT gene expression is at most about 40%. In other embodiments, residual HPRT gene is at most about 35%. In other embodiments, residual HPRT gene expression is at most about 30%. In other embodiments, residual HPRT gene expression is at most about 25%. In other embodiments, residual HPRT gene expression is at most about 20%. In other embodiments, residual HPRT gene expression is at most about 15%. In other embodiments, residual HPRT gene expression is at most about 10%.
[0120] As used herein, the terms “transduce” or “transduction” refers to the delivery of a gene(s) using a viral or retroviral vector by means of infection rather than by transfection. For example, an anti-HPRT gene carried by a retroviral vector (a modified retrovirus used as an expression vector for introduction of nucleic acid into cells) can be transduced into a cell through infection and provirus integration. Thus, a “transduced gene” is a gene that has been introduced into the cell via lentiviral or vector infection and provirus integration. Viral vectors (e.g., “transducing vectors”) transduce genes into “target cells” or host cells.
[0121] As used herein, the term “transfection” refers to the process of introducing naked DNA into cells by non-viral methods.
[0122] As used herein, the term “transduction” refers to the introduction of foreign DNA into a cell's genome using a viral vector.
[0123] As used herein, the terms “treatment,” “treating,” or “treat,” with respect to a specific condition, refer to obtaining a desired pharmacologic and/or physiologic effect. The effect can be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or can be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease. “Treatment”, as used herein, covers any treatment of a disease or disorder in a subject, particularly in a human, and includes: (a) preventing the disease or disorder from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease or disorder, i.e., arresting its development; and (c) relieving or alleviating the disease or disorder, i.e., causing regression of the disease or disorder and/or relieving one or more disease or disorder symptoms. “Treatment” can also encompass delivery of an agent or administration of a therapy in order to provide for a pharmacologic effect, even in the absence of a disease, disorder or condition. The term “treatment” is used in some embodiments to refer to administration of a compound of the present disclosure to mitigate a disease or a disorder in a host, preferably in a mammalian subject, more preferably in humans. Thus, the term “treatment” can include includes: preventing a disorder from occurring in a host, particularly when the host is predisposed to acquiring the disease but has not yet been diagnosed with the disease; inhibiting the disorder; and/or alleviating or reversing the disorder. As far as the methods of the present disclosure are directed to preventing disorders, it is understood that the term “prevent” does not require that the disease state be completely thwarted. Rather, as used herein, the term preventing refers to the ability of the skilled artisan to identify a population that is susceptible to disorders, such that administration of the compounds of the present disclosure can occur prior to onset of a disease. The term does not mean that the disease state must be completely avoided.
[0124] As used herein, the term “vector” refers to a nucleic acid molecule capable of mediating entry of, e.g., transferring, transporting, etc., another nucleic acid molecule into a cell. The transferred nucleic acid is generally linked to, e.g., inserted into, the vector nucleic acid molecule. A vector may include sequences that direct autonomous replication or may include sequences sufficient to allow integration into host cell DNA. As will be evident to one of ordinary skill in the art, viral vectors may include various viral components in addition to nucleic acid(s) that mediate entry of the transferred nucleic acid. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viral vectors. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors (including lentiviral vectors), and the like.
[0125] Expression Vectors
[0126] The present disclosure provides, in some embodiments, expression vectors (e.g. lentiviral expression vectors) including at least one nucleic acid sequence for expression. In some embodiments, the expression vectors include a first nucleic acid sequence encoding an agent designed to knockdown the HPRT gene or otherwise effectuate a decrease in HPRT gene expression. In some embodiments, HPRT gene expression is reduced by 80% or more.
[0127] In some embodiments, the present disclosure provides an expression vector comprising a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown hypoxanthine-guanine phosphoribosyltransferase (HPRT), wherein the shRNA has at least 90% identity to the sequence of any one of SEQ ID NOS: 2, 5, 6, and 7. In some embodiments, the shRNA has a nucleic acid sequence having at least 95% identity to the sequence of any one of SEQ ID NOS: 2, 5, 6, and 7. In some embodiments, the shRNA has a nucleic acid sequence having at least 97% identity to the sequence of any one of SEQ ID NOS: 2, 5, 6, and 7. In some embodiments, the shRNA comprises the nucleic acid sequence of any one of SEQ ID NOS: 2, 5, 6, and 7. In some embodiments, the shRNA to knockdown hypoxanthine-guanine phosphoribosyltransferase (HPRT) is the only transgene for expression in the expression vector.
[0128] In some embodiments, there is provided an expression vector consisting essentially of a first expression control sequence operably linked to a first nucleic acid sequence as the transgene for expression, the first nucleic acid sequence encoding a shRNA to knockdown hypoxanthine-guanine phosphoribosyl transferase (HPRT), wherein the shRNA has at least 90% identity to the sequence of any of SEQ ID NOS: 2, 5, 6, and 7. Specifically, in some embodiments there is provided an expression vector consisting essentially of a first nucleic acid sequence as the only transgene for expression, the first nucleic acid sequence encoding a shRNA to knockdown hypoxanthine-guanine phosphoribosyl transferase (HPRT), wherein the shRNA has at least 90% identity to the sequence of any of SEQ ID NOS: 2, 5, 6, and 7.
[0129] In further aspects, there is provided an expression vector comprising a first expression control sequence operably linked to a first nucleic acid sequence as the transgene, the first nucleic acid sequence encoding a shRNA to knockdown hypoxanthine-guanine phosphoribosyl transferase (HPRT), wherein the shRNA has at least 90% identity to the sequence of any of SEQ ID NOS: 2, 5, 6, and 7, wherein the first nucleic acid sequence is the only element for expression. Specifically, in some embodiments there is provided an expression vector comprising a first nucleic acid sequence as the only transgene for expression, the first nucleic acid sequence encoding a shRNA to knockdown hypoxanthine-guanine phosphoribosyl transferase (HPRT), wherein the shRNA has at least 90% identity to the sequence of any of SEQ ID NOS: 2, 5, 6, and 7.
[0130] In some embodiments, the expression vector is a self-inactivating lentiviral vector. In other embodiments, the expression vector is a retroviral vector. A lentiviral genome is generally organized into a 5′ long terminal repeat (LTR), the gag gene, the pol gene, the env gene, the accessory genes (nef, vif, vpr, vpu) and a 3′ LTR. The viral LTR is divided into three regions called U3, R and U5. The U3 region contains the enhancer and promoter elements. The U5 region contains the polyadenylation signals. The R (repeat) region separates the U3 and U5 regions and transcribed sequences of the R region appear at both the 5′ and 3′ ends of the viral RNA. See, for example, “RNA Viruses: A Practical Approach” (Alan J. Cann, Ed., Oxford University Press, (2000)); 0 Narayan and Clements (1989) J. Gen. Virology, Vol. 70:1617-1639; Fields et al. (1990) Fundamental Virology Raven Press.; Miyoshi H, Blamer U, Takahashi M, Gage F H, Verma I M. (1998) J Virol., Vol. 72(10):8150 7, and U.S. Pat. No. 6,013,516. Examples of lentiviral vectors that have been used to infect HSCs are described in the publications which follows, each of which are hereby incorporated herein by reference in their entireties: Evans et al., Hum Gene Ther., Vol. 10:1479-1489, 1999; Case et al., Proc Natl Acad Sci USA, Vol. 96:2988-2993, 1999; Uchida et al., Proc Natl Acad Sci USA, Vol. 95:11939-11944, 1998; Miyoshi et al., Science, Vol. 283:682-686, 1999; and Sutton et al., J. Virol., Vol. 72:5781-5788, 1998.
[0131] In some embodiments, the expression vector is a modified lentivirus, and thus is able to infect both dividing and non-dividing cells. In some embodiments, the modified lentiviral genome lacks genes for lentiviral proteins required for viral replication, thus preventing undesired replication, such as replication in the target cells. In some embodiments, the required proteins for replication of the modified genome are provided in trans in the packaging cell line during production of the recombinant retrovirus or lentivirus.
[0132] In some embodiments, the expression vector comprises sequences from the 5′ and 3′ long terminal repeats (LTRs) of a lentivirus. In some embodiments, the vector comprises the R and U5 sequences from the 5′ LTR of a lentivirus and an inactivated or self-inactivating 3′ LTR from a lentivirus. In some embodiments, the LTR sequences are HIV LTR sequences.
[0133] Additional components of a lentiviral expression vector (and methods of synthesizing and/or producing such vectors) are disclosed in United States Patent Application Publication No. 2018/0112220, the disclosure of which is hereby incorporated by reference herein in its entirety. In some embodiments, the lentiviral expression vector comprises a TL20c backbone having at least 90% identity to that of SEQ ID NO: 16. In some embodiments, the lentiviral expression vector comprises a TL20c backbone having at least 95% identity to that of SEQ ID NO: 16. In some embodiments, the lentiviral expression vector comprises a nucleic acid sequence having at least 90% identity to that of SEQ ID NO: 17. In some embodiments, the lentiviral expression vector comprises a nucleic acid sequence having at least 90% identity to that of SEQ ID NO: 17. In some embodiments, the lentiviral expression vector comprises at least one of a WPRE element or a Rev Response element (see, for example, SEQ ID NOS: 18 and 19, respectively).
[0134] In some embodiments, the lentiviral vectors contemplated herein may be integrative or non-integrating (also referred to as an integration defective lentivirus). As used herein, the term “integration defective lentivirus” or “IDLV” refers to a lentivirus having an integrase that lacks the capacity to integrate the viral genome into the genome of the host cells. In some applications, the use of by an integrating lentivirus vector may avoid potential insertional mutagenesis induced by an integrating lentivirus. Integration defective lentiviral vectors typically are generated by mutating the lentiviral integrase gene or by modifying the attachment sequences of the LTRs (see, e.g., Sarkis et al., Curr. Gene. Ther., 6: 430-437 (2008)). Lentiviral integrase is coded for by the HIV-1 Pol region and the region cannot be deleted as it encodes other critical activities including reverse transcription, nuclear import, and viral particle assembly. Mutations in pol that alter the integrase protein fall into one of two classes: those which selectively affect only integrase activity (Class I); or those that have pleiotropic effects (Class II). Mutations throughout the N and C terminals and the catalytic core region of the integrase protein generate Class II mutations that affect multiple functions including particle formation and reverse transcription. Class I mutations limit their affect to the catalytic activities, DNA binding, linear episome processing and multimerization of integrase. The most common Class I mutation sites are a triad of residues at the catalytic core of integrase, including D64, D116, and E152. Each mutation has been shown to efficiently inhibit integration with a frequency of integration up to four logs below that of normal integrating vectors while maintaining transgene expression of the NILV. Another alternative method for inhibiting integration is to introduce mutations in the integrase DNA attachment site (LTR att sites) within a 12 base-pair region of the U3 region or within an 11 base-pair region of the U5 region at the terminal ends of the 5′ and 3′ LTRs, respectively. These sequences include the conserved terminal CA dinucleotide which is exposed following integrase-mediated end-processing. Single or double mutations at the conserved CA/TG dinucleotide result in up to a three to four log reduction in integration frequency; however, it retains all other necessary functions for efficient viral transduction.
[0135] In some embodiments, the vector is an adeno-associated virus (AAV) vector. As used herein, the term “adeno-associated virus (AAV) vector” means an AAV viral particle containing an AAV vector genome (which, in turn, comprises the first and second expression cassettes referred to herein). It is meant to include AAV vectors of all serotypes, preferably AAV-1 through AAV-9, more preferably AAV-1, AAV-2, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, and combinations thereof. AAV vectors resulting from the combination of different serotypes may be referred to as hybrid AAV vectors. In one embodiment, the AAV vector is selected from the group consisting of AAV-1, AAV-2, AAV-4, AAV-5 and AAV-6, and combinations thereof. In one embodiment, the AAV vector is an AAV-5 vector. In one embodiment, the AAV vector is an AAV-5 vector comprising AAV-2 inverted terminal repeats (ITRs). Also contemplated by the present disclosure are AAV vectors comprising variants of the naturally occurring viral proteins, e.g., one or more capsid proteins.
[0136] Components to Effectuate the Knockdown of the HPRT Gene
[0137] In some embodiments, the nucleic acid sequence encoding the agent designed to knockdown the HPRT gene is an RNA interference agent (RNAi). In some embodiments, the RNAi agent is an shRNA, a microRNA, or a hybrid thereof.
[0138] RNAi
[0139] In some embodiments, the expression vector comprises a first nucleic acid sequence encoding an RNAi. RNA interference is an approach for post-transcriptional silencing of gene expression by triggering degradation of homologous transcripts through a complex multistep enzymatic process, e.g. a process involving sequence-specific double-stranded small interfering RNA (siRNA). A simplified model for the RNAi pathway is based on two steps, each involving a ribonuclease enzyme. In the first step, the trigger RNA (either dsRNA or miRNA primary transcript) is processed into a short, interfering RNA (siRNA) by the RNase II enzymes DICER and Drosha. In the second step, siRNAs are loaded into the effector complex RNA-induced silencing complex (RISC). The siRNA is unwound during RISC assembly and the single-stranded RNA hybridizes with mRNA target. It is believed that gene silencing is a result of nucleolytic degradation of the targeted mRNA by the RNase H enzyme Argonaute (Slicer). If the siRNA/mRNA duplex contains mismatches the mRNA is not cleaved. Rather, gene silencing is a result of translational inhibition.
[0140] In some embodiments, the RNAi agent is an inhibitory or silencing nucleic acid. As used herein, a “silencing nucleic acid” refers to any polynucleotide which is capable of interacting with a specific sequence to inhibit gene expression. Examples of silencing nucleic acids include RNA duplexes (e.g. siRNA, shRNA), locked nucleic acids (“LNAs”), antisense RNA, DNA polynucleotides which encode sense and/or antisense sequences of the siRNA or shRNA, DNAzymses, or ribozymes. The skilled artisan will appreciate that the inhibition of gene expression need not necessarily be gene expression from a specific enumerated sequence, and may be, for example, gene expression from a sequence controlled by that specific sequence.
[0141] Methods for constructing interfering RNAs are known in the art. For example, the interfering RNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e., each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure); the antisense strand comprises nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e., an undesired gene) and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. Alternatively, interfering RNA may be assembled from a single oligonucleotide, where the self-complementary sense and antisense regions are linked by means of nucleic acid based or non-nucleic acid-based linker(s). The interfering RNA can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The interfering RNA can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNA interference.
[0142] In some embodiments, the interfering RNA coding region encodes a self-complementary RNA molecule having a sense region, an antisense region and a loop region. When expressed, such an RNA molecule desirably forms a “hairpin” structure and is referred to herein as an “shRNA.” In some embodiments, the loop region is generally between about 2 and about 10 nucleotides in length (by way of example only, see SEQ ID NO: 20). In other embodiments, the loop region is from about 6 to about 9 nucleotides in length. In some embodiments, the sense region and the antisense region are between about 15 and about 30 nucleotides in length. Following post-transcriptional processing, the small hairpin RNA is converted into a siRNA by a cleavage event mediated by the enzyme DICER, which is a member of the RNase III family. The siRNA is then capable of inhibiting the expression of a gene with which it shares homology. Further details are described by see Brummelkamp et al., Science 296:550-553, (2002); Lee et al, Nature Biotechnol., 20, 500-505, (2002); Miyagishi and Taira, Nature Biotechnol 20:497-500, (2002); Paddison et al. Genes & Dev. 16:948-958, (2002); Paul, Nature Biotechnol, 20, 505-508, (2002); Sui, Proc. Natl. Acad. Sd. USA, 99(6), 5515-5520, (2002); and Yu et al. Proc NatlAcadSci USA 99:6047-6052, (2002), the disclosures of which are hereby incorporated by reference herein in their entireties.
[0143] shRNA
[0144] In some embodiments, the first nucleic acid sequence encodes a shRNA targeting an HPRT gene. In some embodiments, the first nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 90% identity to that of SEQ ID NO: 1 (referred to herein as “sh734”). In yet other embodiments the first nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 95% identity to that of SEQ ID NO: 1. In further embodiments, the first nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 96% identity to that of SEQ ID NO: 1. In further embodiments, the first nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 97% identity to that of SEQ ID NO: 1. In even further embodiments, the first nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 98% identity to that of SEQ ID NO: 1. In yet further embodiments, the first nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 99% identity to that of SEQ ID NO: 1. In other embodiments, the first nucleic acid sequence encoding a shRNA targeting an HPRT gene has the nucleic acid sequence of SEQ ID NO: 1.
[0145] In some embodiments, the nucleic acid sequence of SEQ ID NO: 1 may be modified. In some embodiments, modifications include: (i) the incorporation of a hsa-miR-22 loop sequence (e.g. CCUGACCCA) (SEQ ID NO: 21); (ii) the addition of a 5′-3′ nucleotide spacer, such as one having two or three nucleotides (e.g. TA); (iii) a 5′ start modification, such as the addition of one or more nucleotides (e.g. G); and/or (iv) the addition of two nucleotides 5′ and 3′ to the stem and loop (e.g. 5′ A and 3′ T). In general, first generation shRNAs are processed into a heterogenous mix of small RNAs, and the accumulation of precursor transcripts has been shown to induce both sequence-dependent and independent nonspecific off-target effects in vivo. Therefore, based on the current understanding of DICER processing and specificity, design rules were applied design that would optimize the structure of the sh734 and DICER processivity and efficiency (see also Gu, S., Y. Zhang, L. Jin, Y. Huang, F. Zhang, M. C. Bassik, M. Kampmann, and M. A. Kay. 2014. Weak base pairing in both seed and 3′ regions reduce RNAi off-targets and enhances si/shRNA designs. Nucleic Acids Research 42:12169-12176).
[0146] In some embodiments, the nucleic acid sequence of SEQ ID NO: 1 is modified by adding two nucleotides 5′ and 3′ (e.g., G and C, respectively) to the hairpin loop (SEQ ID NO: 20), thereby lengthening the guide strand from about 19 nucleotides to about 21 nucleotides in length and replacing the loop with the hsa-miR-22 loop CCUGACCCA (SEQ ID NO: 21), to provide the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 90% identity to that of SEQ ID NO: 2. In other embodiments, the first nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 95% identity to that of SEQ ID NO: 2. In other embodiments, the first nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 96% identity to that of SEQ ID NO: 2. In other embodiments, the first nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 97% identity to that of SEQ ID NO: 2. In other embodiments, the first nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 98% identity to that of SEQ ID NO: 2. In other embodiments, the first nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 99% identity to that of SEQ ID NO: 2. In yet other embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene has the sequence of SEQ ID NO: 2. It is believed that the shRNA encoded by SEQ ID NO: 2 achieves similar knockdown of HPRT as compared with SEQ ID NO: 1. Likewise, it is believed that a cell rendered substantially HPRT deficient through the knockdown of HPRT via expression of the shRNA encoded by SEQ ID NO: 2 allows for selection using a thioguanine analog (e.g. 6TG).
[0147] In some embodiments, the RNAi present within the vector encodes for a nucleic acid molecule, such as one having at least 90% sequence identity to one of SEQ ID NO: 3 or SEQ ID NO: 4. In some embodiments, the RNAi present within the vector encodes for a nucleic acid molecule, such as one having at least 95% sequence identity to one of SEQ ID NO: 3 or SEQ ID NO: 4. In some embodiments, the nucleic acid molecules having at least 90% sequence identity to one of SEQ ID NO: 3 or SEQ ID NO: 4 are found in the cytoplasm of a host cell.
[0148] In some embodiments, the present disclosure provides for a host cell including at least one nucleic acid molecule having at least 90% sequence identity to one of SEQ ID NO: 3 or SEQ ID NO: 4. In some embodiments, the present disclosure provides for a host cell including at least one nucleic acid molecule having at least 95% sequence identity to one of SEQ ID NO: 3 or SEQ ID NO: 4. In some embodiments, the present disclosure provides for a host cell including at least one nucleic acid molecule having one of SEQ ID NO: 3 or SEQ ID NO: 4.
[0149] In some embodiments, the first nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 80% identity to that of SEQ ID NO: 5 (referred to herein as “shHPRT 616”). In other embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 90% identity to that of SEQ ID NO: 5 In yet other embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene shRNA has a sequence having at least 95% identity to that of SEQ ID NO: 5. In further embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 96% identity to that of SEQ ID NO: 5. In further embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 97% identity to that of SEQ ID NO: 5. In even further embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 98% identity to that of SEQ ID NO: 5. In yet further embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 99% identity to that of SEQ ID NO: 5. In other embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene has the sequence of SEQ ID NO: 5 (see also
[0150] In some embodiments, the first nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 80% identity to that of SEQ ID NO: 6 (referred to herein as “shHPRT 211”). In other embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 90% identity to that of SEQ ID NO: 6. In yet other embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene shRNA has a sequence having at least 95% identity to that of SEQ ID NO: 6. In further embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 96% identity to that of SEQ ID NO: 6. In further embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 97% identity to that of SEQ ID NO: 6. In even further embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 98% identity to that of SEQ ID NO: 6. In yet further embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 99% identity to that of SEQ ID NO: 6. In other embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene has the sequence of SEQ ID NO: 6 (see also
[0151] In some embodiments, the nucleic acid sequence encoding a shRNA targeting an HPRT gene has a sequence having at least 80% identity to that of SEQ ID NO: 7 (referred to herein as “shHPRT 734.1”) (see also
[0152] MicroRNA
[0153] MicroRNAs (miRs) are a group of non-coding RNAs which post-transcriptionally regulate the expression of their target genes. It is believed that these single stranded molecules form a miRNA-mediated silencing complex (miRISC) complex with other proteins which bind to the 3′ untranslated region (UTR) of their target mRNAs so as to prevent their translation in the cytoplasm.
[0154] In some embodiments, shRNA sequences are embedded into micro-RNA secondary structures (“micro-RNA based shRNA”). In some embodiments, shRNA nucleic acid sequences targeting HPRT are embedded within micro-RNA secondary structures. In some embodiments, the micro-RNA based shRNAs target coding sequences within HPRT to achieve knockdown of HPRT expression, which is believed to be equivalent to the utilization of shRNA targeting HPRT without attendant pathway saturation and cellular toxicity or off-target effects. In some embodiments, the micro-RNA based shRNA is a de novo artificial microRNA shRNA. The production of such de novo micro-RNA based shRNAs are described by Fang, W. & Bartel, David P. The Menu of Features that Define Primary MicroRNAs and Enable De Novo Design of MicroRNA Genes. Molecular Cell 60, 131-145, the disclosure of which is hereby incorporated by reference herein in its entirety.
[0155] In some embodiments, the micro-RNA based shRNA has a nucleic acid sequence having at least 80% identity to that of SEQ ID NO: 8. In some embodiments, the micro-RNA based shRNA has a nucleic acid sequence having at least 90% identity to that of SEQ ID NO: 8. In some embodiments, the micro-RNA based shRNA has a nucleic acid sequence having at least 95% identity to that of SEQ ID NO: 8. In some embodiments, the micro-RNA based shRNA has a nucleic acid sequence having at least 96% identity to that of SEQ ID NO: 8. In some embodiments, the micro-RNA based shRNA has a nucleic acid sequence having at least 97% identity to that of SEQ ID NO: 8. In some embodiments, the micro-RNA based shRNA has a nucleic acid sequence having at least 98% identity to that of SEQ ID NO: 8. In some embodiments, the micro-RNA based shRNA has a nucleic acid sequence having at least 99% identity to that of SEQ ID NO: 8. In some embodiments, the micro-RNA based shRNA has the sequence of SEQ ID NO: 8 (“miRNA734-Denovo”) (see also
[0156] In some embodiments, the micro-RNA based shRNA has a sequence having at least 80% identity to that of SEQ ID NO: 9. In some embodiments, the micro-RNA based shRNA has a nucleic acid sequence having at least 90% identity to that of SEQ ID NO: 9. In some embodiments, the micro-RNA based shRNA has a sequence having at least 95% identity to that of SEQ ID NO: 9. In some embodiments, the micro-RNA based shRNA has a sequence having at least 96% identity to that of SEQ ID NO: 9. In some embodiments, the micro-RNA based shRNA has a sequence having at least 97% identity to that of SEQ ID NO: 9. In some embodiments, the micro-RNA based shRNA has a sequence having at least 98% identity to that of SEQ ID NO: 9. In some embodiments, the micro-RNA based shRNA has a sequence having at least 99% identity to that of SEQ ID NO: 9. In some embodiments, the micro-RNA based shRNA has the nucleic acid sequence of SEQ ID NO: 9 (“miRNA211-Denovo”) (see also
[0157] In other embodiments, the micro-RNA based shRNA is a third generation miRNA scaffold modified miRNA 16-2 (hereinafter “miRNA-3G”) (see, e.g.,
[0158] In some embodiments, the miRNA-3G has a nucleic acid sequence having at least 80% identity to that of SEQ ID NO: 10. In some embodiments, the miRNA-3G has a nucleic acid sequence having at least 90% identity to that of SEQ ID NO: 10. In some embodiments, the miRNA-3G has a sequence having at least 95% identity to that of SEQ ID NO: 10. In some embodiments, the miRNA-3G has a sequence having at least 96% identity to that of SEQ ID NO: 10. In some embodiments, the miRNA-3G has a sequence having at least 97% identity to that of SEQ ID NO: 10. In some embodiments, the miRNA-3G has a sequence having at least 98% identity to that of SEQ ID NO: 10. In some embodiments, the miRNA-3G has a sequence having at least 99% identity to that of SEQ ID NO: 10. In some embodiments, the miRNA-3G has the nucleic acid sequence of SEQ ID NO: 10 (“miRNA211-3G”) (see also
[0159] In some embodiments, the miRNA-3G has a nucleic acid sequence having at least 80% identity to that of SEQ ID NO: 11. In some embodiments, the miRNA-3G has a nucleic acid sequence having at least 90% identity to that of SEQ ID NO: 11. In some embodiments, the miRNA-3G has a nucleic acid sequence having at least 95% identity to that of SEQ ID NO: 11. In some embodiments, the miRNA-3G has a nucleic acid sequence having at least 96% identity to that of SEQ ID NO: 11. In some embodiments, the miRNA-3G has a nucleic acid sequence having at least 97% identity to that of SEQ ID NO: 11. In some embodiments, the miRNA-3G has a nucleic acid sequence having at least 98% identity to that of SEQ ID NO: 11. In some embodiments, the miRNA-3G has a nucleic acid sequence having at least 99% identity to that of SEQ ID NO: 11. In other embodiments, the miRNA-3G has the nucleic acid sequence of SEQ ID NO: 11 (“miRNA734-3G”) (see also
[0160] In some embodiments, the sh734 shRNA is adapted to mimic a miRNA-451 (see SEQ ID NO: 24) structure with a 17 nucleotide base pair stem and a 4-nucleotide loop (miR-451 regulates the drug-transporter protein P-glycoprotein). Notably, this structure does not require processing by DICER. It is believed that the pre-451 mRNA structure is cleaved by Ago2 and subsequently by poly(A)-specific ribonuclease (PARN) to generate the mature miRNA-451 structural mimic. It is believed that Ago-shRNA mimics of the structure of the endogenous miR-451 and may have the advantage of being DICER independent. This is believed to restrict off target effects of passenger loading, with variable 3′-5′ exonucleolytic activity (23-26 nt mature) (see Herrera-Carrillo, E., and B. Berkhout. 2017. DICER-independent processing of small RNA duplexes: mechanistic insights and applications. Nucleic Acids Res. 45:10369-10379). It is also believed that there exist advantages of utilizing alternate DICER independent processing of shRNAs, including efficient reduced off-target effects of single RNAi-active guide, no saturation of cellular RNAi DICER machinery, and shorter RNA duplexes are less likely to trigger innate RIG-I response.
[0161] Alternatives to RNAi
[0162] As an alternative to the incorporation of a RNAi, in some embodiments, the expression vectors may include a nucleic acid sequence which encodes antisense oligonucleotides that bind sites in messenger RNA (mRNA). Antisense oligonucleotides of the present disclosure specifically hybridize with a nucleic acid encoding a protein and interfere with transcription or translation of the protein. In some embodiments, an antisense oligonucleotide targets DNA and interferes with its replication and/or transcription. In other embodiments, an antisense oligonucleotide specifically hybridizes with RNA, including pre-mRNA (i.e. precursor mRNA which is an immature single strand of mRNA), and mRNA. Such antisense oligonucleotides may affect, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity that may be engaged in or facilitated by the RNA. The overall effect of such interference is to modulate, decrease, or inhibit target protein expression.
[0163] In some embodiments, the expression vectors incorporate a nucleic acid sequence encoding for an exon skipping agent or exon skipping transgene. As used herein, the phrase “exon skipping transgene” or “exon skipping agent” refers to any nucleic acid that encodes an antisense oligonucleotide that can generate exon skipping. “Exon skipping” refers to an exon that is skipped and removed at the pre-mRNA level during protein production. It is believed that antisense oligonucleotides may interfere with splice sites or regulatory elements within an exon. This can lead to truncated, partially functional, protein despite the presence of a genetic mutation. Generally, the antisense oligonucleotides may be mutation-specific and bind to a mutation site in the pre-messenger RNA to induce exon skipping.
[0164] Exon skipping transgenes encode agents that can result in exon skipping, and such agents are antisense oligonucleotides. The antisense oligonucleotides may interfere with splice sites or regulatory elements within an exon to lead to truncated, partially functional, protein despite the presence of a genetic mutation. Additionally, the antisense oligonucleotides may be mutation-specific and bind to a mutation site in the pre-messenger RNA to induce exon skipping. Antisense oligonucleotides for exon skipping are known in the art and are generally referred to as AONs. Such AONs include small nuclear RNAs (“snRNAs”), which are a class of small RNA molecules that are confined to the nucleus and which are involved in splicing or other RNA processing reactions. Examples of antisense oligonucleotides, methods of designing them, and related production methods are disclosed, for example, in U.S. Publication Nos. 20150225718, 20150152415, 20150140639, 20150057330, 20150045415, 20140350076, 20140350067, and 20140329762, the disclosures of which are hereby incorporated by reference herein in their entireties.
[0165] In some embodiments, the expression vectors of the present disclosure include a nucleic acid which encodes an exon skipping agent which results in exon skipping during the expression of HPRT or which causes an HPRT duplication mutation (e.g. a duplication mutation in Exon 4) (see Baba S, et al. Novel mutation in HPRT1 causing a splicing error with multiple variations. Nucleosides Nucleotides Nucleic Acids. 2017 Jan. 2; 36(1):1-6, the disclosure of which is hereby incorporated by reference herein in its entirety.
[0166] In some embodiments, HPRT may be replaced with a modified mutated sequence by spliceosome trans-splicing, thus facilitating of HPRT. In some embodiments, this (1) requires a mutated coding region to replace the coding sequence in a target RNA, (2) a 5′ or 3′ splice site, and/or (3) a binding domain, i.e., antisense oligonucleotide sequence, which is complementary to the target HPRT RNA. In some embodiments, all three components are required.
[0167] Promoters
[0168] Various promoters may be used to drive expression of each of the nucleic acid sequences incorporated within the disclosed expression vectors. For example, a first nucleic acid sequence encoding an RNAi (e.g. an anti-HPRT shRNA) may be expressed from a first promoter selected from one of a Pol III promoter or a Pol II promoter. Likewise, and by way of another example, a first nucleic acid sequence encoding a micro-RNA based shRNA to downregulate HPRT may be expressed from a first promoter selected from one of a Pol III promoter or a Pol II promoter. In some embodiments, the promoters may be constitutive promoters or inducible promoters as known to those of ordinary skill in the art. In some embodiments, the promoter includes at least a portion of an HIV LTR (e.g. TAR).
[0169] Non-limiting examples of suitable promoters include, but are not limited to, RNA polymerase I (pol I), polymerase II (pol II), or polymerase III (pol III) promoters. By “RNA polymerase III promoter” or “RNA pol III promoter” or “polymerase III promoter” or “pol III promoter” it is meant any invertebrate, vertebrate, or mammalian promoter, e.g., human, murine, porcine, bovine, primate, simian, etc. that, in its native context in a cell, associates or interacts with RNA polymerase III to transcribe its operably linked gene, or any variant thereof, natural or engineered, that will interact in a selected host cell with an RNA polymerase III to transcribe an operably linked nucleic acid sequence. RNA pol III promoters suitable for use in the expression vectors of the disclosure include, but are not limited, to human U6, mouse U6, and human H1 others.
[0170] Examples of pol II promoters include, but are not limited to, Ef1 alpha, CMV, and ubiquitin. Other specific pol II promoters include, but are not limited to, ankyrin promoter (Sabatino D E, et al., Proc Natl Acad Sd USA. (24):13294-9 (2000)), spectrin promoter (Gallagher P G, et al., J Biol Chem. 274(10):6062-73, (2000)), transferrin receptor promoter (Marziali G, et al., Oncogene. 21(52):7933-44, (2002)), band 3/anion transporter promoter (Frazar T F, et al., Mol Cell Biol (14):4753-63, (2003)), band 4.1 promoter (Harrison P R, et al., Exp Cell Res. 155(2):321-44, (1984)), BcI-X1 promoter (Tian C, et al., Blood 15; 101(6):2235-42 (2003)), EKLF promoter (Xue L, et al., Blood. 103(11):4078-83 (2004)). Epub 2004 Feb. 5), ADD2 promoter (Yenerel M N, et al., Exp Hematol. 33(7):758-66 (2005)), DYRK3 promoter (Zhang D, et al., Genomics 85(1): 117-30 (2005)), SOCS promoter (Sarna M K, et al., Oncogene 22(21):3221-30 (2003)), LAF promoter (To M D, et al., bit J Cancer 1; 115(4):568-74, (2005)), PSMA promoter (Zeng H, et al., JAndrol (2):215-21, (2005)), PSA promoter (Li H W, et al., Biochem Biophys Res Commun 334(4): 1287-91, (2005)), Probasin promoter (Zhang J, et al., 145(1):134-48, (2004)). Epub 2003 Sep. 18), ELAM-I promoter/E-Selectin (Walton T, et al., Anticancer Res. 18(3A):1357-60, (1998)), Synapsin promoter (Thiel G, et al., ProcNatl Acad Sd USA., 88(8):3431-5 (1988)), Willebrand factor promoter (Jahroudi N, Lynch D C. Mol Cell-5zo/.14(2):999-1008, (1994)), FLT1 (Nicklin S A, et al., Hypertension 38(1):65-70, (2001)), Tau promoter (Sadot E, et al., JMoI Biol. 256(5):805-12, (1996)), Tyrosinase promoter (Lillehammer T, et al., Cancer Gene Ther. (2005)), pander promoter (Burkhardt B R, et al., Biochim Biophys Acta. (2005)), neuron-specific enolase promoter (Levy Y S, et al., JMolNeurosci. 21(2):121-32, (2003)), hTERT promoter (Ito H, et al., Hum Gene Ther 16(6):685-98, (2005)), HRE responsive element (Chadderton N, et al., IntJRadiat Oncol Biol Phys. 62(1):2U-22, (2005)), lck promoter (Zhang D J, et al., J Immunol. 174(11):6725-31, (2005)), MHCII promoter (De Geest B R, et al., Blood. 101(7):2551-6, (2003), Epub 2002 Nov. 21), and CD1 Ic promoter (Lopez-Rodriguez C, et al., J Biol Chem. 272(46):29120-6 (1997)).
[0171] In some embodiments, the promoter driving expression of the agent designed to knockdown HPRT is an RNA pol III promoter. In some embodiments, the promoter driving expression of the agent designed to knockdown HPRT is a 7sk promoter (e.g. a 7SK human 7S K RNA promoter). In some embodiments, the 7sk promoter has the nucleic acid sequence provided by ACCESSION AY578685 (Homo sapiens cell-line HEK-293 7SK RNA promoter region, complete sequence, ACCESSION AY578685).
[0172] In some embodiments, the 7sk promoter has a sequence having at least 90% identity to that of SEQ ID NO: 14. In some embodiments, the 7sk promoter has a nucleic acid sequence having at least 95% identity to that of SEQ ID NOS: 14. In some embodiments, the 7sk promoter has a nucleic acid sequence having at least 96% identity to that of SEQ ID NOS: 14. In some embodiments, the 7sk promoter has a nucleic acid sequence having at least 97% identity to that of SEQ ID NOS: 14. In some embodiments, the 7sk promoter has a nucleic acid sequence having at least 98% identity to that of SEQ ID NOS: 14. In some embodiments, the 7sk promoter has a nucleic acid sequence having at least 99% identity to that of SEQ ID NOS: 14. In some embodiments, the 7sk promoter has the nucleic acid sequence set forth in SEQ ID NOS: 14.
[0173] In some embodiments, the 7sk promoter utilized comprises at least one mutation and/or deletion in its nucleic acid sequence in comparison to the 7sk promoter. Suitable 7sk promoter mutations are described in Boyd, D. C., Turner, P. C., Watkins, N. J., Gerster, T. & Murphy, S. Functional Redundancy of Promoter Elements Ensures Efficient Transcription of the Human 7SK Gene in vivo. Journal of Molecular Biology 253, 677-690 (1995), the disclosure of which is hereby incorporated by reference herein in its entirety. In some embodiments, functional mutations or deletions in the 7sk promoter are made in cis-regulatory elements to regulate expression levels of the promoter-driven transgene, including sh734. The mutations described are used to establish the correlation between sh734 expression levels driven by the Pol III promoter and to introduce functionality to undergo stable selection in the presence of 6TG therapy and long-term stability and safety. The location of 7sk promoter mutations are depicted in
[0174] In some embodiments, the 7sk promoter has a nucleic acid sequence having at least 95% identity to that of SEQ ID NOS: 15. In some embodiments, the 7sk promoter has a nucleic acid sequence having at least 96% identity to that of SEQ ID NOS: 15. In some embodiments, the 7sk promoter has a nucleic acid sequence having at least 97% identity to that of SEQ ID NOS: 15. In some embodiments, the 7sk promoter has a nucleic acid sequence having at least 98% identity to that of SEQ ID NOS: 15. In some embodiments, the 7sk promoter has a nucleic acid sequence having at least 99% identity to that of SEQ ID NOS: 15. In some embodiments, the 7sk promoter has the nucleic acid sequence set forth in SEQ ID NOS: 15.
[0175] In other embodiments, the promoter is a tissue specific promoter. Several non-limiting examples of tissue specific promoters that may be used include lck (see, for example, Garvin et al., MoI. Cell Biol. 8:3058-3064, (1988)) and Takadera et al., MoI. Cell Biol. 9:2173-2180, (1989)), myogenin (Yee et al., Genes and Development 7:1277-1289 (1993), and thyl (Gundersen et al., Gene 113:207-214, (1992)).
[0176] Non-limiting examples of combinations of nucleic acid sequences operably linked to a promoter are set forth in the table which follows:
TABLE-US-00001 Promoter shRNA SEQ No. Type Promoter ID NO: 1 Pol III 7sk 1 2 Pol III Mutant 7sk with a single 1 mutation 3 Pol III Mutant 7sk with two mutations 1 4 Pol III Mutant 7sk with three mutations 1 5 Pol III H1 1 6 Pol II EF 1a 5 7 Pol II EF 1a 6 8 Pol II EF 1a 7
[0177] Production of Vectors
[0178] In some embodiments, an expression cassette, such as one including a nucleic acid sequence adapted to knockdown HPRT, is inserted into an expression vector, such as a lentiviral expression vector, to provide a vector having at least one transgene for expression. In some embodiments, the lentiviral expression vector may be selected from the group consisting of pTL20c, pTL20d, FG, pRRL, pCL20, pLKO.1 puro, pLKO.1, pLKO.3G, Tet-pLKO-puro, pSico, pLJM1-EGFP, FUGW, pLVTHM, pLVUT-tTR-KRAB, pLL3.7, pLB, pWPXL, pWPI, EF.CMV.RFP, pLenti CMV Puro DEST, pLenti-puro, pLOVE, pULTRA, pLJM1-EGFP, pLX301, pInducer20, pHIV-EGFP, Tet-pLKO-neo, pLV-mCherry, pCW57.1, pLionII, pSLIK-Hygro, and pInducer10-mir-RUP-PheS. In other embodiments, the lentiviral expression vector may be selected from AnkT9W vector, a T9Ank2W vector, a TNS9 vector, a lentiglobin HPV569 vector, a lentiglobin BB305 vector, a BG-1 vector, a BGM-1 vector, a d432βAγ vector, a mLAβΔγV5 vector, a GLOBE vector, a G-GLOBE vector, a βAS3-FB vector, a V5 vector, a V5m3 vector, a V5m3-400 vector, a G9 vector, and a BCL11A shmir vector. In some embodiments, the lentiviral expression vector may be selected from the group consisting pTL20c, pTL20d, FG, pRRL and pCL20. In still other embodiments, the lentiviral expression vector is pTL20c.
[0179] In some embodiments, the expression cassette comprises a nucleic acid sequence having at least 95% sequence identity to that of SEQ ID NO: 13. In other embodiments, the expression cassette comprises a nucleic acid sequence having at least 96% sequence identity to that of SEQ ID NO: 13. In other embodiments, the expression cassette comprises a nucleic acid sequence having at least 97% sequence identity to that of SEQ ID NO: 13. In other embodiments, the expression cassette comprises a nucleic acid sequence having at least 98% sequence identity to that of SEQ ID NO: 13. In yet other embodiments, the expression cassette comprises a nucleic acid sequence having at least 99% sequence identity to that of SEQ ID NO: 13. In further embodiments, the expression cassette has the nucleic acid sequence of SEQ ID NO: 13.
[0180] In some embodiments, the plasmid has a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 17. In some embodiments, the plasmid has a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 17. In some embodiments, the plasmid has a nucleic acid sequence having at least 96% sequence identity to SEQ ID NO: 17. In some embodiments, the plasmid has a nucleic acid sequence having at least 97% sequence identity to SEQ ID NO: 17. In some embodiments, the plasmid has a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 17. In some embodiments, the plasmid has a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 17. In some embodiments, the plasmid has a nucleic acid sequence of SEQ ID NO: 17.
[0181] In some embodiments, the plasmid includes a TL20 viral backbone having a nucleic acid sequence having at least 90% sequence identity to that of SEQ ID NO: 16. In some embodiments, the plasmid includes a TL20 viral backbone having a nucleic acid sequence having at least 95% sequence identity to that of SEQ ID NO: 16. In some embodiments, the plasmid includes a TL20 viral backbone having a nucleic acid sequence having at least 96% sequence identity to that of SEQ ID NO: 16. In some embodiments, the plasmid includes a TL20 viral backbone having a nucleic acid sequence having at least 97% sequence identity to that of SEQ ID NO: 16. In some embodiments, the plasmid includes a TL20 viral backbone having a nucleic acid sequence having at least 98% sequence identity to that of SEQ ID NO: 16. In some embodiments, the plasmid includes a TL20 viral backbone having a nucleic acid sequence having at least 99% sequence identity to that of SEQ ID NO: 16. In some embodiments, the plasmid includes a TL20 viral backbone having a nucleic acid sequence of SEQ ID NO: 16.
[0182] In one or more embodiments, the first nucleic acid sequence encoding a shRNA targeting an HPRT gene may be inserted into an expression vector in different orientations relative to other vector elements (compare, for example, the orientations of the 7sk promoter between
[0183] In some embodiments, the 7sk/sh734 expression cassette is located upstream relative to other vector elements, such as the UbC driven GFP.
[0184] In some embodiments, the 7sk/sh734 expression cassette is located downstream relative to other vector elements, such as the UbC driven GFP.
[0185] In some embodiments, the 7sk/sh734 expression cassette and the other vector elements, such as the UbC driven GFP, are oriented in the same direction.
[0186] In some embodiments, the 7sk/sh734 expression cassette and the other vector elements, such as the UbC driven GFP, are oriented in opposing directions.
[0187] In some embodiments, the 7sk/sh734 expression cassette is oriented in a forward direction relative the other vector elements, such as the UbC driven GFP.
[0188] In some embodiments, the 7sk/sh734 expression cassette is oriented in a reverse direction relative the other vector elements, such as the UbC driven GFP.
[0189] In some embodiments, the 7sk/sh734 expression cassette is located upstream and oriented in a forward direction relative the other vector elements, such as the UbC driven GFP.
[0190] In some embodiments, the 7sk/sh734 expression cassette is located upstream and oriented in a reverse direction relative the other vector elements, such as the UbC driven GFP.
[0191] In some embodiments, the 7sk/sh734 expression cassette is located downstream and oriented in a forward direction relative the other vector elements, such as the UbC driven GFP.
[0192] In some embodiments, the 7sk/sh734 expression cassette is located downstream and oriented in a reverse direction relative the other vector elements, such as the UbC driven GFP.
[0193] Non-Viral Delivery of Agents to Downregulate HPRT or to Knockout HPRT
[0194] In some embodiments, agents designed to knockdown the HPRT gene (including expression constructs including an RNAi) may be delivered through a nanocapsule other non-viral delivery vehicle. Delivery of such an agent through this method represents an alternative to effectuating downregulation of HPRT by means of an expressed RNAi or other agent from an expression vector. As described further herein, it is possible to deliver antisense RNA, oligonucleotides designed for exon skipping, or gene editing machinery using nanocapsules.
[0195] In general, a nanocapsule is a vesicular system that exhibits a typical core-shell structure in which active molecules are confined to a reservoir or cavity that is surrounded by a polymer membrane or coating. In some embodiments, the shell of a typical nanocapsule is made of a polymeric membrane or coating. In some embodiments, the nanocapsules are derived from a biodegradable or bioerodable polymeric material, i.e. the nanocapsules are biodegradable and/or erodible polymeric nanocapsules. For example, the components for knockdown and/or knockout be encapsulated within a nanocapsule comprising one or more biodegradable polymers such as polylactide-polyglycolide, poly(orthoesters) and poly(anhydrides). In some embodiments, the polymeric nanocapsules are comprised of two different positively charged monomers, at least one neutral monomer, and a cross-linker. In some embodiments, the nanocapsule is an enzymatically degradable nanocapsule. In some embodiments, the nanocapsule consists of a single-protein core and a thin polymeric shell cross-linked by peptides. In some embodiments, a nanocapsule may be selected such that it is specifically recognizable and able to be cleaved by a protease. In some embodiments, the cleavable cross-linkers include a peptide sequence or structure that is a substrate of a protease or another enzyme.
[0196] Examples of nanocapsules includes, without limitation, those described in U.S. Pat. No. 9,782,357; those described in United States Patent Application Publication Nos. 2017/0354613, and 2015/0071999; and those described in PCT Publication Nos. WO2016/085808 and WO2017/205541, the disclosures of which are hereby incorporated by reference herein in their entireties. In some embodiments, the nanocapsules described in the aforementioned publications may be modified to carry and/or encapsulate components for knockdown and/or knockout, e.g. a Cas protein and/or a gRNA. Other suitable nanocapsules, their methods of synthesis, and/or methods of encapsulation, are further disclosed in United States Patent Publication No. 2011/0274682, the disclosure of which is hereby incorporated by reference herein in its entirety. Yet other suitable nanocapsules which may be modified to carry and/or encapsulate components to effectuate knockdown or knockout of HPRT are described in PCT Publication Nos. WO2013/138783, WO2013/033717, and WO2014/093966, the disclosures of which are hereby incorporated by reference herein in their entireties.
[0197] In some embodiments, the nanocapsules are adapted to target specific cell types (e.g. T-cells, CD34 hematopoietic stem cells and progenitor cells) in vivo. For example, the nanocapsules may include one or more targeting moieties coupled to a polymer nanocapsule. In some embodiments, the targeting moiety delivers the polymer nanocapsules to a specific cell type, wherein the cell type is selected from the group comprising immune cells, blood cells, cardiac cells, lung cells, optic cells, liver cells, kidney cells, brain cells, cells of the central nervous system, cells of the peripheral nervous system, cancer cells, cells infected with viruses, stem cells, skin cells, intestinal cells, and/or auditory cells. In some embodiments, the targeting moieties are antibodies.
[0198] In some embodiments, the nanocapsules further comprise at least one targeting moiety. In some embodiments, the nanocapsules comprise between 2 and between 6 targeting moieties. In some embodiments, the targeting moieties are antibodies. In some embodiments, the targeting moieties target any one of the CD117, CD10, CD34, CD38, CD45, CD123, CD127, CD135, CD44, CD47, CD96, CD2, CD4, CD3, and CD9 markers. In some embodiments, the targeting moiety targets any one of a human mesenchymal stem cell CD marker, including the CD29, CD44, CD90, CD49a-f, CD51, CD73 (SH3), CD105 (SH2), CD106, CD166, and Stro-1 markers. In some embodiments, the targeting moiety targets any one of a human hematopoietic stem cell CD marker including CD34, CD38, CD45RA, CD90, and CD49.
[0199] Suitable payloads for such nanocapsules include synthetic oligonucleotides, shRNAs, miRNAs, and Ago-shRNAs targeting HPRT. In some embodiments, the payloads may be expressed in Pol III or Pol II driven promoter cassettes.
[0200] In other embodiments, agents for downregulating HPRT may be formulated within bio-nanocapsules, which are nano-size capsules produced by a genetically engineered microorganism. In some embodiments, a bio-nanocapsule is a virus protein-derived or modified virus protein-derived particle, such as a virus surface antigen particle (e.g., a hepatitis B virus surface antigen (HBsAg) particle). In other embodiments, a bio-nanocapsule is a nano-size capsule comprising a lipid bilayer membrane and a virus protein-derived or modified virus protein-derived particle such as a virus surface antigen particle. Such particles can be purified from eukaryotic cells, such as yeasts, insect cells, and mammalian cells. The size of a capsule may range from between about 10 nm to about 500 nm. In other embodiments, the size of the capsule may range from between about 20 nm to about 250 nm. In yet other embodiments, the size of the capsule may range from between about 80 nm to about 150.
[0201] Antisense RNA
[0202] Antisense RNA (asRNA) is a single-stranded RNA that is complementary to a messenger RNA (mRNA) strand transcribed within a cell. Without wishing to be bound by any particular theory, it is believed that antisense RNA may be introduced into a cell to inhibit translation of a complementary mRNA by base pairing to it and physically obstructing the translation machinery. Said another way, antisense RNAs are single-stranded RNA molecules that exhibit a complementary relationship to specific mRNAs.
[0203] Antisense RNAs may be utilized for gene regulation and specifically target mRNA molecules that are used for protein synthesis. The antisense RNA can physically pair and bind to the complementary mRNA, thus inhibiting the ability of the mRNA to be processed in the translation machinery. In some embodiments, phosphorothioate-modified antisense oligonucleotides may be utilized to target sequences within the coding region of HPRT mRNA. These oligonucleotides can be delivered to specific cell populations and anatomic sites cells using targeted nanoparticles, as described above.
[0204] Exon Skipping
[0205] As noted herein, exon skipping may be utilized to create a defect within the HPRT gene that results in HPRT deficiency. In some embodiments, an oligonucleotide (including a modified oligonucleotide) may be delivered by means of a nanocapsule, the oligonucleotide designed to target un-spliced HPRT mRNA and mediate either premature termination or skipping of an intron required for activity. An HPRT duplication mutation, e.g. e.g. a duplication mutation in Exon 4, (see Baba S, et al., “Novel mutation in HPRT1 causing a splicing error with multiple variations,” Nucleosides Nucleotides Nucleic Acids. 2017 Jan. 2; 36(1):1-6) could be introduced to cause a splicing error and functional inactivation of the HPRT protein. Replacing HPRT with a modified mutated sequence by spliceosome trans-splicing is a potential therapeutic strategy to knockdown HPRT. It is believed that this requires (1) a mutated coding region to replace the coding sequence in target RNA, (2) a 5′ or 3′ splice site, and (3) a binding domain, e.g., an antisense oligonucleotide sequence, which is complementary to target RNA.
[0206] The oligonucleotides may be structurally modified such that they are nuclease resistant. In some embodiments, the oligonucleotides have modified backbones or non-natural inter-nucleoside linkages. Such oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. In some embodiments, modified oligonucleotides that do not have a phosphorus atom in their inter-nucleoside backbone can also be considered to be oligonucleotides. In other embodiments, the oligonucleotides are modified such that both the sugar and the inter-nucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Modified oligonucleotides may also contain one or more substituted sugar moieties. Oligonucleotides may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. Certain nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the disclosure. These include, without limitation, 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by about 0.6 to about 1.2° C. and are presently preferred base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.
[0207] Gene Editing to Knockout HPRT
[0208] The present disclosure also provides compositions for the knockout of HPRT. In some embodiments, a gene editing approach may be used to knockout HPRT. For example, isolated cells may be treated with a HPRT-targeted CRISPR/Cas9 RNP or with a HPRT-targeted CRISPR/Cas12a RNP. A “ribonucleoprotein complex” as provided herein refers to a complex or particle including a nucleoprotein and a ribonucleic acid A “nucleoprotein” as provided herein refers to a protein capable of binding a nucleic acid (e.g., RNA, DNA). Where the nucleoprotein binds a ribonucleic acid, it is referred to as “ribonucleoprotein.” The interaction between the ribonucleoprotein and the ribonucleic acid may be direct, e.g., by covalent bond, or indirect, e.g., by non-covalent bond (es. electrostatic interactions (e.g. ionic bond, hydrogen bond, halogen bond), van der Waals interactions (e.g. dipole-dipole, dipole-induced dipole, London dispersion), ring stacking (pi effects), hydrophobic interactions and the like). In some embodiments, the ribonucleoprotein includes an RNA-binding motif non-covalently bound to the ribonucleic acid. For example, positively charged aromatic amino acid residues (e.g., lysine residues) in the RNA-binding motif may form electrostatic interactions with the negative nucleic acid phosphate backbones of the RNA, thereby forming a ribonucleoprotein complex. Non-limiting examples of ribonucleoproteins include ribosomes, telomerase, RNAseP, hnRNP, CRISPR associated protein 9 (Cas9) and small nuclear RNPs (snRNPs). The ribonucleoprotein may be an enzyme. In embodiments, the ribonucleoprotein is an endonuclease. Thus, in some embodiments, the ribonucleoprotein complex includes an endonuclease and a ribonucleic acid. In some embodiments, the endonuclease is a CRISPR associated protein 9. In some embodiments, the endonuclease is a CRISPR associated protein 12a.
[0209] In some embodiments, the ribonucleic acid is a guide RNA (see, e.g., SEQ ID NOS: 25-39). In some embodiments, the CRISPR associated protein 9 is bound to a ribonucleic acid thereby forming a ribonucleoprotein complex. In some embodiments, the endonuclease is Cas9 and the ribonucleic acid is a guide RNA. In some embodiments, the CRISPR associated protein 12a is bound to a ribonucleic acid thereby forming a ribonucleoprotein complex. In some embodiments, the endonuclease is Cas12a and the ribonucleic acid is a guide RNA. In some embodiments, the CRISPR associated protein 12b is bound to a ribonucleic acid thereby forming a ribonucleoprotein complex. In some embodiments, the endonuclease is Cas12b and the ribonucleic acid is a guide RNA. As such the guide RNA (or gRNA) may include a ribonucleotide sequence capable of binding a nucleoprotein, thereby forming ribonucleoprotein complex. In some embodiments, the guide RNA includes one or more RNA molecules. In some embodiments, the gRNA includes a nucleotide sequence complementary to a target site. The complementary nucleotide sequence may mediate binding of the ribonucleoprotein complex to the target site thereby providing the sequence specificity of the ribonucleoprotein complex. Thus, in some embodiments, the guide RNA is complementary to a target nucleic acid.
[0210] In some embodiments, the guide RNA (e.g. any of those of SEQ ID NOS: 25-39) binds a target nucleic acid sequence. In some embodiments, the complement of the guide RNA has a sequence identity of about 50% of a target nucleic acid. In some embodiments, the complement of the guide RNA has a sequence identity of about 55% of a target nucleic acid. In some embodiments, the complement of the guide RNA has a sequence identity of about 60% of a target nucleic acid. In some embodiments, the complement of the guide RNA has a sequence identity of about 65% of a target nucleic acid. In some embodiments, the complement of the guide RNA has a sequence identity of about 70% of a target nucleic acid. In some embodiments, the complement of the guide RNA has a sequence identity of about 75% of a target nucleic acid. In some embodiments, the complement of the guide RNA has a sequence identity of about 80% of a target nucleic acid. In some embodiments, the complement of the guide RNA has a sequence identity of about 85% of a target nucleic acid. In some embodiments, the complement of the guide RNA has a sequence identity of about 90% of a target nucleic acid. In some embodiments, the complement of the guide RNA has a sequence identity of about 95% of a target nucleic acid. In some embodiments, the complement of the guide RNA has a sequence identity of about 96% of a target nucleic acid. In some embodiments, the complement of the guide RNA has a sequence identity of about 97% of a target nucleic acid. In some embodiments, the complement of the guide RNA has a sequence identity of about 98% of a target nucleic acid. In some embodiments, the complement of the guide RNA has a sequence identity of about 99% of a target nucleic acid.
[0211] A target nucleic acid sequence as provided herein is a nucleic acid sequence expressed by a cell. In some embodiments, the target nucleic acid sequence is an exogenous nucleic acid sequence. In some embodiments, the target nucleic acid sequence is an endogenous nucleic acid sequence. In some embodiments, the target nucleic acid sequence forms part of a cellular gene. Thus, in some embodiments, the guide RNA is complementary to a cellular gene or fragment thereof. In some embodiments, the guide RNA is about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% complementary to the target nucleic acid sequence. In e some embodiments, the guide RNA is about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% complementary to the sequence of a cellular gene. In some embodiments, the guide RNA binds a cellular gene sequence.
[0212] In some embodiments, the present disclosure provides for a composition which includes a gRNA which targets a sequence within the human hypoxanthine phosphoribosyltransferase (HPRT) gene (SEQ ID NO: 12). In some embodiments, the gRNA and another component necessary for gene editing are provided within a nanocapsule. In some embodiments, the composition includes a gRNA which targets a sequence within Chromosome X of a human at a location ranging from about 134460145 to about 134500668. In some embodiments, the composition includes a gRNA which targets a sequence having a location within Chromosome X ranging from about 134460145 to about 134500668, and wherein the sequence targeted has a length ranging from about 14 to about 28 consecutive base pairs. In some embodiments, the composition includes a gRNA which targets a sequence having a location within Chromosome X ranging from about 134460145 to about 134500668, and wherein the sequence targeted has a length ranging from about 15 to about 26 consecutive base pairs. In some embodiments, the composition includes a gRNA which targets a sequence having a location within Chromosome X ranging from about 134460145 to about 134500668, and wherein the sequence targeted has a length ranging from about 16 to about 24 consecutive base pairs. In some embodiments, the composition includes a gRNA which targets a sequence having a location within Chromosome X ranging from about 134460145 to about 134500668, and wherein the sequence targeted has a length ranging from about 17 to about 22 consecutive base pairs. In some embodiments, the composition includes a gRNA which targets a sequence having a location within Chromosome X ranging from about 134460145 to about 134500668, and wherein the sequence targeted has a length ranging from about 18 to about 22 consecutive base pairs.
[0213] In some embodiments, the composition includes a gRNA having at least 90% identity to any one of SEQ ID NOS: 25-39. In some embodiments, the composition includes a gRNA having at least 95% identity to any one of SEQ ID NOS: 25 39. In some embodiments, the composition includes a gRNA having at least 96% identity to any one of SEQ ID NOS: 25-39. In some embodiments, the composition includes a gRNA having at least 97% identity to any one of SEQ ID NOS: 25-39. In some embodiments, the composition includes a gRNA having at least 98% identity to any one of SEQ ID NOS: 25-39. In some embodiments, the composition includes a gRNA having at least 99% identity to any one of SEQ ID NOS: 25-39. In some embodiments, the composition includes a gRNA which comprises any one of SEQ ID NOS: 25-39. In some embodiments, the composition is a nanocapsule and the gRNA and another component for gene editing (e.g. a Cas protein) are included within the nanocapsule.
[0214] In some embodiments, the composition includes a gRNA having a nucleotide sequence which has at least 90% sequence identity to a target sequence located within Chromosome X at a position ranging from between about 134460145 to about 134500668. In some embodiments, the composition includes a gRNA having a nucleotide sequence which has at least 95% sequence identity to a target sequence located within Chromosome X at a position ranging from between about 134460145 to about 134500668. In some embodiments, the composition includes a gRNA having a nucleotide sequence which has at least 96% sequence identity to a target sequence located within Chromosome X at a position ranging from between about 134460145 to about 134500668. In some embodiments, the composition includes a gRNA having a nucleotide sequence which has at least 97% sequence identity to a target sequence located within Chromosome X at a position ranging from between about 134460145 to about 134500668. In some embodiments, the composition includes a gRNA having a nucleotide sequence which has at least 98% sequence identity to a target sequence located within Chromosome X at a position ranging from between about 134460145 to about 134500668. In some embodiments, the composition includes a gRNA having a nucleotide sequence which has at least 99% sequence identity to a target sequence located within Chromosome X at a position ranging from between about 134460145 to about 134500668.
[0215] In some embodiments, a complement of a target sequence within Chromosome X at a position ranging from between about 134460145 to about 134500668 has least 90% identity to any one of SEQ ID NOS: 25-39. In some embodiments, a complement of a target sequence within Chromosome X at a position ranging from between about 134460145 to about 134500668 has least 95% identity to any one of SEQ ID NOS: 25-39. In some embodiments, a complement of a target sequence within Chromosome X at a position ranging from between about 134460145 to about 134500668 has least 97% identity to any one of SEQ ID NOS: 25-39. In some embodiments, a complement of a target sequence within Chromosome X at a position ranging from between about 134460145 to about 134500668 has least 99% identity to any one of SEQ ID NOS: 25-39.
[0216] Host Cells
[0217] The present disclosure also provides a host cell comprising the novel expression vectors of the present disclosure. A “host cell” or “target cell” means a cell that is to be transformed (i.e. transduced or transfected) using the compositions, e.g. expression vectors or nanocapsules, of the present disclosure. In some embodiments, the host cell is rendered substantially HPRT deficient after transduction with an expression vector encoding a nucleic adapted to knockdown HPRT. In other embodiments, the host cell is rendered substantially HPRT deficient after transfection with a nanocapsule including components designed to effectuate knockout of HPRT. Methods of transducing host cells with an expression vector to knockdown HPRT or transfecting host cells with a nanocapsule to knockout HPRT are described in co-pending U.S. patent application Ser. No. 16/038,643, the disclosure of which is hereby incorporated by reference herein in its entirety. In some embodiments, the host cells are isolated and/or purified.
[0218] In some embodiments, the host cells are mammalian cells in which the expression vector can be expressed. Suitable mammalian host cells include, but are not limited to, human cells, murine cells, non-human primate cells (e.g. rhesus monkey cells), human progenitor cells or stem cells, 293 cells, HeLa cells, D17 cells, MDCK cells, BHK cells, and Cf2Th cells. In certain embodiments, the host cell comprising an expression vector of the disclosure is a hematopoietic cell, such as hematopoietic progenitor/stem cell (e.g. CD34-positive hematopoietic progenitor/stem cell), a monocyte, a macrophage, a peripheral blood mononuclear cell, a CD4+T lymphocyte, a CD8+T lymphocyte, or a dendritic cell.
[0219] The hematopoietic cells (e.g. CD4+T lymphocytes, CD8+T lymphocytes, and/or monocyte/macrophages) to be transduced with an expression vector or transfected with a nanocapsule of the present disclosure can be allogeneic, autologous, or from a matched sibling. The hematopoietic progenitor/stem cell are, in some embodiments, CD34-positive and can be isolated from the patient's bone marrow or peripheral blood. The isolated CD34-positive hematopoietic progenitor/stem cell (and/or other hematopoietic cell described herein) is, in some embodiments, transduced with an expression vector as described herein.
[0220] In some embodiments, the modified host cells are combined with a pharmaceutically acceptable carrier. In some embodiments, the host cells or transduced host cells are formulated with PLASMA-LYTE A (e.g. a sterile, nonpyrogenic isotonic solution for intravenous administration; where one liter of PLASMA-LYTE A has an ionic concentration of 140 mEq sodium, 5 mEq potassium, 3 mEq magnesium, 98 mEq chloride, 27 mEq acetate, and 23 mEq gluconate). In other embodiments, the host cells or transduced host cells are formulated in a solution of PLASMA-LYTE A, the solution comprising between about 8% and about 10% dimethyl sulfoxide (DMSO). In some embodiments, the less than about 2×10.sup.7 host cells/transduced host cells are present per mL of a formulation including PLASMA-LYTE A and DMSO.
[0221] In some embodiments, the host cells are rendered substantially HPRT deficient after transduction with an expression vector according to the present disclosure. In some embodiments, the level of HPRT gene expression is reduced by at least about 80%. It is believed that cells having 20% or less residual HPRT gene expression are sensitive to a purine analog, such as 6TG, allowing for their selection with the purine analog (see, for example,
[0222] In some embodiments, transduction of host cells may be increased by contacting the host cell, in vitro, ex vivo, or in vivo, with an expression vector of the present disclosure and one or more compounds that increase transduction efficiency. For example, in some embodiments, the one or more compounds that increase transduction efficiency are compounds that stimulate the prostaglandin EP receptor signaling pathway, i.e. one or more compounds that increase the cell signaling activity downstream of a prostaglandin EP receptor in the cell contacted with the one or more compounds compared to the cell signaling activity downstream of the prostaglandin EP receptor in the absence of the one or more compounds. In some embodiments, the one or more compounds that increase transduction efficiency are a prostaglandin EP receptor ligand including, but not limited to, prostaglandin E2 (PGE2), or an analog or derivative thereof. In other embodiments, the one or more compounds that increase transduction efficiency include, but are not limited to, RetroNectin (a 63 kD fragment of recombinant human fibronectin fragment, available from Takara); Lentiboost (a membrane-sealing poloxamer, available from Sirion Biotech), Protamine Sulphate, Cyclosporin H, and Rapamycin. In yet other embodiments, the one or more compounds that increase transduction efficiency include poloxamers (e.g. poloxamer F127).
[0223] Pharmaceutical Compositions
[0224] The present disclosure also provides for compositions, including pharmaceutical compositions, comprising one or more expression vectors and/or non-viral delivery vehicles (e.g. nanocapsules) as disclosed herein. In some embodiments, pharmaceutical compositions comprise an effective amount of at least one of the expression vectors and/or non-viral delivery vehicles as described herein and a pharmaceutically acceptable carrier. For instance, in certain embodiments, the pharmaceutical composition comprises an effective amount of an expression vector and a pharmaceutically acceptable carrier. An affective amount can be readily determined by those skilled in the art based on factors such as body size, body weight, age, health, sex of the subject, ethnicity, and viral titers.
[0225] In another aspect of the present disclosure is a pharmaceutical composition comprising (a) an expression vector, including a nucleic acid sequence encoding a shRNA targeting an HPRT gene; and (b) a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition is formulated as an emulsion. In some embodiments, the pharmaceutical composition is formulated within micelles. In some embodiments, the pharmaceutical composition is encapsulated within a polymer. In some embodiments, the pharmaceutical composition is encapsulated within a liposome. In some embodiments, the pharmaceutical composition is encapsulated within minicells or nanocapsules.
[0226] In another aspect of the present disclosure is a pharmaceutical composition comprising (a) a population of nanocapsules, each nanocapsule including a payload to adapted knockout HPRT (e.g. a Cas9 protein or a Cas12a protein and/or a gRNA, such as a gRNA of any one of SEQ ID NOS: 25-39); and (b) a pharmaceutically acceptable carrier. In some embodiments, the nanocapsule is a polymer nanocapsule. In some embodiments, the polymer nanocapsule further comprises at least one targeting moiety to facilitate delivery of the ribonucleoprotein or ribonucleoprotein complex to a particular type of cell. In some embodiments, the polymer nanocapsule is erodible or biodegradable. In some embodiments, the polymer nanocapsule includes a pH sensitive cross-linker.
[0227] In some embodiments, the polymer nanocapsule has a size ranging from between about 50 nm to about 250 nm. In some embodiments, the polymer nanocapsule has an average diameter of less than or equal to about 200 nanometers (nm). In some embodiments, the polymer nanocapsule has an average diameter of between about 1 to 200 nm. In some embodiments, the polymer nanocapsule has an average diameter of between about 5 to about 200 nm. In some embodiments, the polymer nanocapsule has an average diameter of between about 10 to about 150 nm, or 15 to 100 nm. In some embodiments, the polymer nanocapsule has an average diameter of between about 15 to about 150 nm. In some embodiments, the polymer nanocapsule has an average diameter of between about 20 to about 125 nm. In some embodiments, the polymer nanocapsule has an average diameter of between about 50 to about 100 nm. In some embodiments, the polymer nanocapsule has an average diameter of between about 50 to about 75 nm. In some embodiments, the surface of the nanocapsule can have a charge between about 1 to about 15 millivolts (my) (such as measured in a standard phosphate solution). In other embodiments, the surface of the nanocapsule can have a charge between about 1 to about 10 mV.
[0228] The phrases “pharmaceutically acceptable” or “pharmacologically acceptable” refer to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human. For example, an expression vector may be formulated with a pharmaceutically acceptable carrier. As used herein, “pharmaceutically acceptable carrier” includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like acceptable for use in formulating pharmaceuticals, such as pharmaceuticals suitable for administration to humans. Methods for the formulation of compounds with pharmaceutical carriers are known in the art and are described in, for example, in Remington's Pharmaceutical Science, (17th ed. Mack Publishing Company, Easton, Pa. 1985); and Goodman & Gillman's: The Pharmacological Basis of Therapeutics (11th Edition, McGraw-Hill Professional, 2005); the disclosures of each of which are hereby incorporated herein by reference in their entirety.
[0229] In some embodiments, the pharmaceutical compositions may comprise any of the expression vectors, nanocapsules, or compositions disclosed herein in any concentration that allows the silencing nucleic acid administered to achieve a concentration in the range of from about 0.1 mg/kg to about 1 mg/kg. In some embodiments, the pharmaceutical compositions may comprise the expression vector in an amount of from about 0.1% to about 99.9% by weight. Pharmaceutically acceptable carriers suitable for inclusion within any pharmaceutical composition include water, buffered water, saline solutions such as, for example, normal saline or balanced saline solutions such as Hank's or Earle's balanced solutions), glycine, hyaluronic acid etc. The pharmaceutical composition may be formulated for parenteral administration, such as intravenous, intramuscular or subcutaneous administration. Pharmaceutical compositions for parenteral administration may comprise pharmaceutically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and non-aqueous carriers, solvents, diluents or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.), carboxymethylcellulose and mixtures thereof, vegetable oils (such as olive oil), injectable organic esters (e.g. ethyl oleate).
[0230] The pharmaceutical composition may be formulated for oral administration. Solid dosage forms for oral administration may include, for example, tablets, dragees, capsules, pills, and granules. In such solid dosage forms, the composition may comprise at least one pharmaceutically acceptable carrier such as sodium citrate and/or dicalcium phosphate and/or fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; binders such as carboxylmethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose and acacia; humectants such as glycerol; disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, silicates, and sodium carbonate; wetting agents such as acetyl alcohol, glycerol monostearate; absorbants such as kaolin and bentonite clay; and/or lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, and mixtures thereof. Liquid dosage forms for oral administration may include, for example, pharmaceutically acceptable emulsions, solutions, suspensions, syrups and elixirs. Liquid dosages may include inert diluents such as water or other solvents, solubilizing agents and/or emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethyl formamide, oils (such as, for example, cottonseed oil, corn oil, germ oil, castor oil, olive oil, sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
[0231] The pharmaceutical compositions may comprise penetration enhancers to enhance their delivery. Penetration enhancers may include fatty acids such as oleic acid, lauric acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, reclineate, monoolein, dilaurin, caprylic acid, arachidonic acid, glyceryl 1-monocaprate, mono and di-glycerides and physiologically acceptable salts thereof. The compositions may further include chelating agents such as, for example, ethylenediaminetetraacetic acid (EDTA), citric acid, salicylates (e.g. sodium salicylate, 5-methoxysalicylate, homovanilate).
[0232] The pharmaceutical compositions may comprise any of the expression vectors disclosed herein in an encapsulated form. For example, the expression vectors may be encapsulated by biodegradable polymers such as polylactide-polyglycolide, poly(orthoesters) and poly(anhydrides), or may be encapsulated in liposomes or dispersed within a microemulsion. Liposomes may be, for example, lipofectin or lipofectamine. In another example, a composition may comprise the expression vectors disclosed herein in or on anucleated bacterial minicells (Giacalone et al, Cell Microbiology 2006, 8(10): 1624-33). The expression vectors disclosed herein may be combined with nanoparticles.
[0233] Stable Producer Cell Lines
[0234] In another aspect of the present disclosure is a stable producer cell line for generating viral titer, wherein the stable producer cell line is derived from one of a GPR, GPRG, GPRT, GPRGT, or GPRT-G packing cell line. In some embodiments, the stable producer cell line is derived from the GPRT-G cell line. In some embodiments, the stable producer cell line is generated by (a) synthesizing an expression vector by cloning at least a nucleic acid sequence encoding an anti-HPRT shRNA into a recombinant plasmid (i.e. the synthesized vector may be any one of the vectors described herein); (b) generating DNA fragments from the synthesized vector; (c) forming a concatemeric array from (i) the generated DNA fragments from the synthesized vector, and (ii) from DNA fragments derived from an antibiotic resistance cassette plasmid; (d) transfecting one of the packaging cell lines with the formed concatemeric array; and (e) isolating the stable producer cell line. Additional methods of forming a stable producer cell line are disclosed in International Application No. PCT/US2016/031959, filed May 12, 2016, the disclosure of which is hereby incorporated by reference herein in its entirety.
[0235] Kits
[0236] In some embodiments is a kit comprising an expression vector or a composition comprising an expression vector as described herein. The kit may include a container, where the container may be a bottle comprising the expression vector or composition in an oral or parenteral dosage form, each dosage form comprising a unit dose of the expression vector. The kit may comprise a label or the like, indicating treatment of a subject according to the methods described herein. Likewise, in other embodiments is a kit comprising a composition comprising a population of nanocapsules including a payload adapted to knockout HPRT as described herein.
[0237] In some embodiments, the kit may include additional active agents. The additional active agents may be housed in a container separate from the container housing the vector or composition comprising the vector. For example, in some embodiments, the kit may comprise one or more doses of a purine analog (e.g. 6TG) and optionally instructions for dosing the purine analog for conditioning and/or chemoselection (as those steps are described further herein). In other embodiments, the kit may comprise one or more doses of MTX or MPA and optionally instructions for dosing the MTX or MPA for negative selection as described herein.
[0238] Preparation of Substantially HPRT-Deficient Lymphocytes (“Modified Lymphocytes”)
[0239] In one aspect of the present disclosure is a method of producing HPRT-deficient lymphocytes, e.g. T-cells (also referred to herein as “modified lymphocytes” or “modified T-cells”). With reference to
[0240] The skilled artisan will appreciate that the cells may be collected by any means. For example, the cells may be collected by apheresis, leukapheresis, or merely through a simple venous blood draw. In embodiments where the HSC graft is collected contemporaneously with the cells for modification, the HSC graft is cryopreserved so as to allow time for manipulation and testing of the lymphocytes, e.g. T-cells, collected. Non-limiting examples of T-cells include T helper T-cells (e.g. Th1, Th2, Th9, Th17, Th22, Tfh), regulatory T-cells, natural killer T-cells, gamma delta T-cells, and cytotoxic lymphocytes (CTLs).
[0241] Following collection of the cells, the lymphocytes, e.g. T-cells, are isolated (step 120). The lymphocytes, e.g. T-cells, may be isolated from the aggregate of cells collected by any means known to those of ordinary skill in the art. For example, CD3+ cells may be isolated from the collected cells via CD3 microbeads and the MACS separation system (Miltenyi Biotec). It is believed that the CD3 marker is expressed on all T-cells and is associated with the T-cell receptor. It is believed that about 70 to about 80% of human peripheral blood lymphocytes and about 65-85% of thymocytes are CD3+. In some embodiments, the CD3+ cells are magnetically labeled with CD3 MicroBeads. Then the cell suspension is loaded onto a MACS Column which is placed in the magnetic field of a MACS Separator. The magnetically labeled CD3+ cells are retained on the column. The unlabeled cells run through and this cell fraction is depleted of CD3+ cells. After removal of the column from the magnetic field, the magnetically retained CD3+ cells can be eluted as the positively selected cell fraction.
[0242] Alternatively, CD62L+ T-cells may be isolated from the collected cells is via an IBA life sciences CD62L Fab Streptamer Isolation Kit. Isolation of human CD62L+ T-cells is performed by positive selection. PBMCs are labeled with magnetic CD62L Fab Streptamers. Labeled cells are isolated in a strong magnet where they migrate toward the tube wall on the side of the magnet. This CD62L positive cell fraction is collected and cells are liberated from all labeling reagents by addition of biotin in a strong magnet. The magnetic Streptamers migrate toward the tube wall and the label-free cells remain in the supernatant. Biotin is removed by washing. The resulting cell preparation is highly enriched with CD62L+ T-cells with a purity of more than 90%. No depletion steps and no columns are needed.
[0243] In alternative embodiments, the lymphocytes, e.g. T-cells, are not isolated at step 120, but rather the aggregate of cells collected at step 110 are used for subsequent modification. While in some embodiments the aggregate of cells may be used for subsequent modification, in some instances the method of modification may be specific for a particular cell population within the total aggregate of cells. This could be done in a number of ways; for example, targeting genetic modification to a particular cell type by targeting gene vector delivery, or by targeting expression of, for example a shRNA to HPRT to a particular cell type, i.e., T-cells.
[0244] Following isolation of the T-cells, the T-cells are treated to decrease HPRT activity (step 130), i.e. to decrease expression of the HPRT gene. For example, the T-cells may be treated such that they have about 50% or less residual HPRT gene expression, about 45% or less residual HPRT gene expression, about 40% or less residual HPRT gene expression, about 35% or less residual HPRT gene expression, about 30% or less residual HPRT gene expression, about 25% or less residual HPRT gene expression, about 20% or less residual HPRT gene expression, about 15% or less residual HPRT gene expression, about 10% or less residual HPRT gene expression, or about 5% or less residual HPRT gene expression.
[0245] The lymphocytes, e.g. T-cells, may be modified according to several methods. In some embodiments, T-cells may be modified by transduction with an expression vector, e.g. a lentiviral vector, encoding a shRNA targeted to the HPRT gene, such as described herein. For example, an expression vector may comprise a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown HPRT, wherein the shRNA has at least 90% identity to the sequence of any of SEQ ID NOS: 2, 5, 6, and 7. By way of another example, an expression vector may comprise a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown HPRT, wherein the shRNA has at least 90% identity to the sequence of any of SEQ ID NOS: 8, 9, 10, and 11. In some embodiments, the expression vector is encapsulated within a nanocapsule.
[0246] Alternatively, the lymphocytes, e.g. T-cells, may be modified by transfection with a nanocapsule including a payload adapted to knockout HPRT, i.e. gene editing approach may be used to knockout HPRT. For example, T-cells may be treated with a HPRT-targeted CRISPR/Cas9 RNP, a CRISPR/Cas12a RNP, or a CRISPR/Cas12b RNP, as described herein. In some embodiments, the nanocapsule may include a gRNA having at least 90% sequence identity to any one of SEQ ID NOS: 25-39. In other embodiments, the nanocapsule may include a gRNA having at least 95% sequence identity to any one of SEQ ID NOS: 25-39.
[0247] After the T-cells are modified at step 130, the population of HPRT-deficient T-cells is selected for and/or expanded (step 140). In some embodiments, the culture may concurrently select for and expand cells with enhanced capacity for engraftment (e.g. central memory or T stem cell phenotype). In some embodiments, the culture period is less than 14 days. In some embodiments, the culture period is less than 7 days.
[0248] In some embodiments, the step of selecting for and expanding cells comprises treating the population of HPRT-deficient (or substantially HPRT-deficient) lymphocytes, e.g. T-cells, ex vivo with a guanosine analog antimetabolite (such as 6-thioguanine (6TG), 6-mercaptopurine (6-MP), or azathiopurine (AZA). In some embodiments, the lymphocytes, e.g. T-cells, are cultured in the presence of 6-thioguanine (“6TG”), thus killing cells which have not been modified at step 130. 6TG is a guanine analog that can interfere with dGTP biosynthesis in the cell. Thio-dG can be incorporated into DNA during replication in place of guanine, and when incorporated, often becomes methylated. This methylation can interfere with proper mis-match DNA repair and can result in cell cycle arrest, and/or initiate apoptosis. 6TG has been used clinically to treat patients with certain types of malignancies due to its toxicity to rapidly dividing cells. In the presence of 6TG, HPRT is the enzyme responsible for the integration of 6TG into DNA and RNA in the cell, resulting in blockage of proper polynucleotide synthesis and metabolism (see
[0249] The generated HPRT-deficient cells are then contacted with a purine analog ex vivo. For the knockdown approach, it is believed that there still may be residual HPRT in the cells and that HPRT-knockdown cells can tolerate a range of purine analog but will be killed at high dosages/amounts. In this situation, the concentration of purine analogs used for ex vivo selection ranges from about 15 μM to about 200 nM. In some embodiments, the concentration of purine analogs used for ex vivo selection ranges from about 10 μM to about 50 nM. In some embodiments, the concentration of purine analogs used for ex vivo selection ranges from about 5 μM to about 50 nM. In some embodiments, the concentration ranges from about 2.5 μM to about 10 nM. In other embodiments, the concentration ranges from about 2 μM to about 5 nM. In yet other embodiments, the concentration ranges from about 1 μM to about 1 nM.
[0250] For the knockout approach, HPRT it is believed that HPRT may be totally eliminated or near totally eliminated from HPRT-knockout cells and the generated HPRT-deficient cells will be highly tolerant to purine analogs. In some embodiments, the concentration of purine analogs used for ex vivo selection in this case ranges from about 200 μM to about 5 nM. In some embodiments, the concentration of purine analogs used for ex vivo selection in this case ranges from about 100 μM to about 20 nM. In some embodiments, the concentration ranges from 80 μM about to about 10 nM. In other embodiments, the concentration ranges from about 60 μM to about 10 nM. In yet other embodiments, the concentration ranges from about 40 μM to about 20 nM.
[0251] In other embodiments, modification of the cells (e.g. through knockdown or knockout of HPRT) may be efficient enough such that ex vivo selection for the HPRT-deficient cells is not necessary, i.e. selection with 6TG or other like compound is not required.
[0252] In some embodiments, the generated HPRT-deficient cells are contacted with both a purine analog and with allopurinol which is an inhibitor of xanthine oxidase (XO). By inhibiting XO, more available 6TG to be metabolized by HPRT. When 6TG is metabolized by HPRT it forms 6TGNs which are the toxic metabolites to the cells (6TGN encompasses monophosphate (6TGMP), diphosphate (6-TGDP) and triphosphate (6TGTP)) (see
[0253] In some embodiments, allopurinol is introduced to the generated HPRT-deficient cells prior to introduction of the purine along. In other embodiments, allopurinol is introduced to the generated HPRT-deficient cells simultaneously with the introduction of the purine along. In yet other embodiments, allopurinol is introduced to the generated HPRT-deficient cells following the introduction of the purine along.
[0254] Following selection and expansion, the modified lymphocytes, e.g. T-cells, product is tested. In some embodiments, the modified lymphocytes, e.g. T-cells, product is tested according to standard release testing (e.g. activity, mycoplasma, viability, stability, phenotype, etc.; see Molecular Therapy: Methods & Clinical Development Vol. 4 Mar. 2017 92-101, the disclosure of which is hereby incorporated by reference herein in its entirety).
[0255] In other embodiments, the modified lymphocytes, e.g. T-cells, product is tested for sensitivity to a dihydrofolate reductase inhibitor (e.g. MTX or MPA). Dihydrofolate reductase inhibitors, including both MTX and MPA, are believed to inhibit de novo synthesis of purines but have different mechanisms of action. For example, it is believed that MTX competitively inhibits dihydrofolate reductase (DHFR), an enzyme that participates in tetrahydrofolate (THF) synthesis. DHFR catalyzes the conversion of dihydrofolate to active tetrahydrofolate. Folic acid is needed for the de novo synthesis of the nucleoside thymidine, required for DNA synthesis. Also, folate is essential for purine and pyrimidine base biosynthesis, so synthesis will be inhibited. Mycophenolic acid (MPA) is potent, reversible, non-competitive inhibitor of inosine-5′-monophosphate dehydrogenase (IMPDH), an enzyme essential to the de novo synthesis of guanosine-5′-monophosphate (GMP) from inosine-5′-monophosphate (IMP).
[0256] Dihydrofolate reductase inhibitors, including both MTX or MPA, therefore inhibit the synthesis of DNA, RNA, thymidylates, and proteins. MTX or MPA blocks the de novo pathway by inhibiting DHFR. In HPRT−/− cell, there is no salvage or de novo pathway functional, leading to no purine synthesis, and therefore the cells die. However, the HPRT wild type cells have a functional salvage pathway, their purine synthesis takes place and the cells survive. In some embodiments, the modified lymphocytes, e.g. T-cells, are substantially HPRT-deficient. In some embodiments, at least about 70% of the modified lymphocyte, e.g. T-cells, population is sensitive to MTX or MPA. In some embodiments, at least about 75% of the modified lymphocyte, e.g. T-cells, population is sensitive to MTX or MPA. In some embodiments, at least about 80% of the modified lymphocyte, e.g. T-cells, population is sensitive to MTX or MPA. In some embodiments, at least about 85% of the modified lymphocyte, e.g. T-cells, population is sensitive to MTX or MPA. In other embodiments, at least about 90% of the modified lymphocyte, e.g. T-cells, population is sensitive to MTX or MPA. In yet other embodiments, at least about 95% of the modified lymphocyte, e.g. T-cells, population is sensitive to MTX or MPA. In yet other embodiments, at least about 97% of the modified lymphocyte, e.g. T-cells, population is sensitive to MTX or MPA.
[0257] In some embodiments, an alternative agent may be used in place of either MTX or MPA, including, but not limited to ribavarin (IMPDH inhibitor); VX-497 (IMPDH inhibitor) (see Jain J, VX-497: a novel, selective IMPDH inhibitor and immunosuppressive agent, J Pharm Sci. 2001 May; 90(5):625-37); lometrexol (DDATHF, LY249543) (GAR and/or AICAR inhibitor); thiophene analog (LY254155) (GAR and/or AICAR inhibitor), furan analog (LY222306) (GAR and/or AICAR inhibitor) (see Habeck et al., A Novel Class of Monoglutamated Antifolates Exhibits Tight-binding Inhibition of Human Glycinamide Ribonucleotide Formyltransferase and Potent Activity against Solid Tumors, Cancer Research 54, 1021-2026, February 1994); DACTHF (GAR and/or AICAR inhibitor) (see Cheng et. al. Design, synthesis, and biological evaluation of 10-methanesulfonyl-DDACTHF, 10-methanesulfonyl-5-DACTHF, and 10-methylthio-DDACTHF as potent inhibitors of GAR Tfase and the de novo purine biosynthetic pathway; Bioorg Med Chem. 2005 May 16; 13(10):3577-85); AG2034 (GAR and/or AICAR inhibitor) (see Boritzki et. al. AG2034: a novel inhibitor of glycinamide ribonucleotide formyltransferase, Invest New Drugs. 1996; 14(3):295-303); LY309887 (GAR and/or AICAR inhibitor) ((2S)-2-[[5-[2-[(6R)-2-amino-4-oxo-5,6,7,8-tetrahydro-1H-pyrido[2,3-d]pyrimidin-6-yl]ethyl]thiophene-2-carbonyl]amino]pentanedioic acid); alimta (LY231514) (GAR and/or AICAR inhibitor) (see Shih et. al. LY231514, a pyrrolo[2,3-d]pyrimidine-based antifolate that inhibits multiple folate-requiring enzymes, Cancer Res. 1997 Mar. 15; 57(6):1116-23); dmAMT (GAR and/or AICAR inhibitor), AG2009 (GAR and/or AICAR inhibitor); forodesine (Immucillin H, BCX-1777; trade names Mundesine and Fodosine) (inhibitor of purine nucleoside phosphorylase [PNP]) (see Kicska et. al., Immucillin H, a powerful transition-state analog inhibitor of purine nucleoside phosphorylase, selectively inhibits human T lymphocytes (T-cells), PNAS Apr. 10, 2001. 98 (8) 4593-4598); and immucillin-G (inhibitor of purine nucleoside phosphorylase [PNP]).
[0258] Given the sensitivity to MTX or MPA of the modified T-cells produced according to steps 110 through 140, MTX or MPA (or another dihydrofolate reductase inhibitor) may be used to selectively eliminate HPRT-deficient cells, as described herein. In some embodiments, an analog or derivative of MTX or MPA may be substituted for MTX or MPA. Derivatives of MTX are described in U.S. Pat. No. 5,958,928 and in PCT Publication No. WO/2007/098089, the disclosures of which are hereby incorporated by reference herein in their entireties.
[0259] Methods of Treatment
[0260] In some embodiments, the modified lymphocytes, e.g. T-cells, prepared according to steps 110 to 140 are administered to a patient (step 150). In some embodiments, the modified lymphocytes, e.g. T-cells, (or CAR T-cells or TCR T-cells as described herein) are provided to the patient in a single administration (e.g. a single bolus, or administration over a set time period, for example and infusion over about 1 to 4 hours or more). In other embodiments, multiple administrations of the modified lymphocytes, e.g. T-cells, are made. If multiple doses of the modified lymphocytes, e.g. T-cells, are administered, each dose may be the same or different (e.g. escalating doses, decreasing doses).
[0261] In some embodiments, an amount of the dose of modified T-cells is determined based on the CD3-positive T-cell content/kg of the subject's body weight. In some embodiments, the total dose of modified T-cells ranges from about 0.1×10.sup.6/kg body weight to about 730×10.sup.6/kg body weight. In other embodiments, the total dose of modified T-cells ranges from about 1×10.sup.6/kg body weight to about 500×10.sup.6/kg body weight. In yet other embodiments, the total dose of modified T-cells ranges from about 1×10.sup.6/kg body weight to about 400×10.sup.6/kg body weight. In further embodiments, the total dose of modified T-cells ranges from about 1×10.sup.6/kg body weight to about 300×10.sup.6/kg body weight. In yet further embodiments, the total dose of modified T-cells ranges from about 1×10.sup.6/kg body weight to about 200×10.sup.6/kg body weight.
[0262] Where multiple doses are provided, the frequency of dosing may range from about 1 week to about 36 weeks. Likewise, where multiple doses are provided, each dose of modified T-cells ranges from about 0.1×10.sup.6/kg body weight to about 240×10.sup.6/kg body weight. In other embodiments, each dose of modified T-cells ranges from about 0.1×10.sup.6/kg body weight to about 180×10.sup.6/kg body weight. In other embodiments, each dose of modified T-cells ranges from about 0.1×10.sup.6/kg body weight to about 140×10.sup.6/kg body weight. In other embodiments, each dose of modified T-cells ranges from about 0.1×10.sup.6/kg body weight to about 100×10.sup.6/kg body weight. In other embodiments, each dose of modified T-cells ranges from about 0.1×10.sup.6/kg body weight to about 60×10.sup.6/kg body weight. Other dosing strategies are described by Gozdzik J et al., Adoptive therapy with donor lymphocyte infusion after allogenic hematopoietic SCT in pediatric patients, Bone Marrow Transplant, 2015 January; 50(1):51-5), the disclosure of which is hereby incorporated by reference in its entirety.
[0263] The modified lymphocytes, e.g. T-cells, may be administered alone or as part of an overall treatment strategy. In some embodiments, the modified lymphocytes, e.g. T-cells, are administered following an HSC transplant, such as about 2 to about 4 weeks after the HSC transplant. For example, in some embodiments, the modified lymphocytes, e.g. T-cells, are administered after administration of an HSC transplant to help prevent or mitigate post-transplant immune deficiency. It is believed that the modified lymphocytes, e.g. T-cells, may provide a short term (e.g. about 3 to about 9 month) immune reconstitution and/or protection. As another example, and in other embodiments, the modified lymphocytes, e.g. T-cells, are administrated as part of cancer therapy to help induce a graft-versus-malignancy (GVM) effect or a graft-versus-tumor (GVT) effect. As a further example, the modified T-cells are CAR-T cells or TCR-modified T-cells which are HPRT-deficient, and which are administered as part of a cancer treatment strategy. Administration of the modified lymphocytes, e.g. T-cells, according to each of these treatment avenues are described in more detail herein. Of course, the skilled artisan will appreciate that other treatments for any underlying condition may occur prior to, subsequent to, or concurrently with administration of the modified lymphocytes, e.g. T-cells.
[0264] Administration of lymphocytes, e.g. T-cells, to a patient may result in unwanted side effects, including those recited herein. For example, graft-versus-host disease may occur after a patient is treated with lymphocytes, including modified T-cells (e.g. via knockdown or knockout of HPRT). In some aspects of the present disclosure, following administration of the modified lymphocytes, e.g. T-cells, at step 150, the patient is monitored for the onset of any side effects, including, but not limited to, GvHD. Should any side effects arise, such as GvHD (or symptoms of GvHD), MTX or MPA is administered to the patient (in vivo) at step 160 to remove at least a portion of the modified lymphocytes, e.g. T-cells, in an effort to suppress, reduce, control, or otherwise mitigate side effects, e.g. GvHD. In some embodiments, MTX or MPA is administered in a single dose. In other embodiments, multiple does of MTX and/or MPA are administered.
[0265] It is believed that the modified lymphocytes, e.g. T-cells, of the present disclosure (once selected for ex vivo and administered to the patient or mammalian subject), may serve as a modulatable “on”/“off” switch given their sensitivity to dihydrofolate reductase inhibitors (including both MTX or MPA). The modulatable switch allows for regulation of immune system reconstitution by selectively killing at least a portion of the modified lymphocytes, e.g. T-cells, in vivo through the administration of MTX to the patient should any side effects occur. This modulatable switch may be further regulated by administering further modified lymphocytes, e.g. T-cells, to the patient following MTX administration to allow further immune system reconstitution after side effects have been reduced or otherwise mitigated. Likewise, the modulatable switch allows for regulation of a graft-versus-malignancy effect by selectively killing at least a portion of the modified lymphocytes, e.g. T-cells, in vivo through the administration of MTX should any side effects occur. Again, the GVM effect may be fine-tuned by subsequently dosing further aliquots of modified lymphocytes, e.g. T-cells, to the patient once side effects are reduced or otherwise mitigated. This same principle applies to CAR-T cell therapy or therapy with TCR-modified T-cells, where again the CAR-T cells or TCR-modified T-cells may be selectively turned on/off through MTX administration. In view of this, the person of ordinary skill in the art will appreciate that any medical professional overseeing treatment of a patient can balance immune system reconstitution and/or the GVM effect while keeping side effects at bay or within tolerable or acceptable ranges. By virtue of the above, patient treatment may be enhanced while mitigating adverse effects.
[0266] In some embodiments, an amount of MTX administered ranges from about 2 mg/m.sup.2/infusion to about 100 mg/m.sup.2/infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg/m.sup.2/infusion to about 90 mg/m.sup.2/infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg/m.sup.2/infusion to about 80 mg/m.sup.2/infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg/m.sup.2/infusion to about 70 mg/m.sup.2/infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg/m.sup.2/infusion to about 60 mg/m.sup.2/infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg/m.sup.2/infusion to about 50 mg/m.sup.2/infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg/m.sup.2/infusion to about 40 mg/m.sup.2/infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg/m.sup.2/infusion to about 30 mg/m.sup.2/infusion. In some embodiments, an amount of MTX administered ranges from about 20 mg/m.sup.2/infusion to about 20 mg/m.sup.2/infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg/m.sup.2/infusion to about 10 mg/m.sup.2/infusion. In some embodiments, an amount of MTX administered ranges from about 2 mg/m.sup.2/infusion to about 8 mg/m.sup.2/infusion. In other embodiments, an amount of MTX administered ranges from about 2.5 mg/m.sup.2/infusion to about 7.5 mg/m.sup.2/infusion. In yet other embodiments, an amount of MTX administered is about 5 mg/m.sup.2/infusion. In yet further embodiments, an amount of MTX administered is about 7.5 mg/m.sup.2/infusion.
[0267] In some embodiments, between 2 and 6 infusions are made, and the infusions may each comprise the same dosage or different dosages (e.g. escalating dosages, decreasing dosages, etc.). In some embodiments, the administrations may be made on a weekly basis, or a bi-monthly basis.
[0268] In yet other embodiments, the amount of MTX administered is titrated such that uncontrolled side effects, e.g. GvHD, is resolved, while preserving at least some modified lymphocytes, e.g. T-cells, and their concomitant effects on reconstituting the immune system, targeting cancer, or inducing the GVM effect. In this regard, it is believed that at least some of the benefit of the modified lymphocytes, e.g. T-cells, may still be recognized while ameliorating side effects, e.g. GvHD. In some embodiments, additional modified lymphocytes, e.g. T-cells, are administered following treatment with MTX, i.e. following resolution, suppression, or control of the side effects, e.g. GvHD.
[0269] In some embodiments, the subject receives doses of MTX prior to administration of the modified lymphocytes, e.g. T-cells, such as to control or prevent side effects after HSC transplantation. In some embodiments, existing treatment with MTX is halted prior to administration of the modified lymphocytes, e.g. T-cells, and then resumed, at the same or different dosage (and using a same or different dosing schedule), upon onset of side effects following treatment with the modified lymphocytes, e.g. T-cells. In this regard, the skilled artisan can administer MTX on an as-need basis and consistent with the standards of care known in the medical industry.
[0270] Additional Treatment Strategies
[0271]
[0272]
[0273] In another aspect of the present disclosure is a method of treating a patient having cancer by administering modified CAR T cells to a patient in need thereof, the modified CAR T cells being HPRT-deficient.
EXAMPLES
Example 1—HPRT Knockdown Versus Knockout with 6TG Selection
[0274] K562 cells were transduced with an expression vector including a nucleic acid sequence designed to knockdown HPRT and a nucleic acid sequence encoding the green fluorescent protein (GFP) (MOI=1/2/5); or were transfected with a nanocapsule including CRISPR/Cas9 and a sgRNA to knockout HPRT (100 ng/5×10.sup.4 cells) at day zero (0). 6TG was added into the medium from day 3 through day 14. The medium was refreshed every 3 to 4 days. GFP was analyzed on a flow machine and the InDel % as analyzed with a T7E1 assay.
[0275] CEM cells were transduced with an expression vector including a nucleic acid sequence designed to knockdown HPRT and a nucleic acid sequence encoding the green fluorescent protein or transfected with a nanocapsule including CRISPR/Cas9 and a sgRNA to HPRT at day 0. 6TG was added into the medium from day 3 to day 17. The medium was refreshed every 3 to 4 days. GFP as analyzed on a flow machine and the InDel % is analyzed by a T7E1 assay.
Example 2—Negative Selection with MTX or MPA
[0276] Transduced or transfected K562 cells (such as those from Example 1) were cultured with or without MTX from day 0 to day 14. The medium was refreshed every 3 to 4 days. GFP was analyzed on a flow machine and the InDel % was analyzed by T7E1 assay.
[0277] Transduced or transfected CEM cells (such as those from Example 1) were cultured with or without MTX from day 0 to day 14. The medium was refreshed every 3 to 4 days. GFP was analyzed on flow machine and InDel % was analyzed by T7E1 assay.
Example 3—Negative Selection with MTX for K562 Cells
[0278] K562 cells were transduced with either (i) a TL20cw-GFP virus soup at dilution factor of 16, (ii) a TL20cw-Ubc/GFP-7SK/sh734 virus soup at a dilution factor of 16 (one sequentially encoding GFP and a shRNA designed to knockdown HPRT); or (iii) a TL20cw-7SK/sh734-UBC/GFP virus soup at a dilution factor of 16 (one sequentially encoding a shRNA designed to knockdown HPRT and GFP) (see
Example 4—Transfection/Transduction, Selection and Expansion of Modified T Cells
[0279] Primary human T-cell purification will be performed using peripheral blood mononuclear cells (PBMC) derived from bulk buffy packs (Australian Red Cross Blood Service), allowing enrichment of sufficient numbers of T-cells for down-stream applications. The remaining cells will be cryopreserved for future T cell function analyses, such as assessment of T cell proliferation in response to allo-antigens. Purified T-cells will be stimulated in vitro with immobilized anti-CD3 and recombinant human (rh)IL-2 (as per current published protocols REF) for 48 hours followed by transduction with lentivirus, or transfection with DNA-containing nanoparticles, for modification of the HPRT gene. These modified T-cells will be cultured (2-3 days) followed by further expansion for up to 14 days in the presence of rhIL-2. Throughout the culture conditions, samples will be collected for assessment of the proportion of cells having successfully undergone gene-modification as determined by detection of a fluorescent tracer (e.g. GFP), as well as quantitative RT-PCR (qPCR) for detection of HPRT gene expression levels.
[0280] At 14-days post gene-modification, selection of gene-modified T-cells will be performed using 6-thioguanine (6TG) to assess the dose required for negative selection of all non-modified T-cells. Titration of the 6TG dose will also allow assessment of the potential donor-dependent sensitivity to this selection method, and how this may relate to the known TPMT genotype-dependent sensitivity to purine analogues. Investigation of 6TG dose titration will also serve to assess the potential for dose-window variability based on the levels of shRNA expression. Selection will be followed by expansion of the modified T-cells with a selection of various cytokine combinations (IL-2/IL-7/IL-15/IL-21). The expanded T cell population will finally be tested for sensitivity to “kill switch” activation via the use of methotrexate.
Example 5—Functional Assessment of Modified Primary Human T-Cells
[0281] The functional capacity of the modified T-cells will be assessed using in vitro methods to gain understanding of the potential consequences of gene-modification and culture conditions. T cell subtype proportions within the culture will be phenotyped, including assessment of naïve T-cells, effector T cell subtypes, memory T cell subtypes, regulatory T-cells etc. and including cell surface T-cells markers such as CD3/CD4/CD8/CD25/CD27/CD28/CD45RA/RO/CD56/CD62L/CD127 or FoxP3 and CD44). The potential development of T cell exhaustion as a consequence of extended culture conditions will also be assessed using flow cytometry. The functional capacity of the gene-modified T-cells to react to viral peptides will be assessed using T cell proliferation and cytokine release assays. This functional response to viral peptides from viruses such as Epstein Barr Virus (EBV) and cytomegalovirus (CMV) is believed to be particularly relevant, as these are the main viruses re-activated in the context of immune suppression and are relevant for patients in the clinic.
[0282] Finally, each of the donor modified T cell cultures will be assessed for alloreactivity against haplo-identical donor PBMCs cryopreserved (and genotyped) using in vitro proliferation assays. This is designed to mimic and measure the potential alloreactivity in a transplant context. The functional capacity of the regulatory T cell compartment within the gene-modified T cell pool could potentially also be assessed in this context.
Example 6—Phenotypic and Functional Characterization of “Residual” Gene-Modified T Cell Populations Post Methotrexate Dosing
[0283] An understanding of the capacity for remaining gene-modified cells present within recipient post kill-switch induction and resolution of conditions such as GvHD or CRS, is the ability of the gene-modified cells to expand and re-constitute in appropriate numbers and with relevant function. The minimum threshold level for donor cell depletion followed by appropriate expandability and functional activity will therefore be important to understand. Clinical trials performed by third parties have shown that kill switch activation results in >99% depletion of donor T-cells in vivo within 2 hours, and that resolution of symptoms of GvHD and CRS occurs within 24-48 hours. In addition, the <1% of modified cells remaining in recipients are capable of re-expanding without resulting in re-activation of GvHD or CRS. The hypothesis that activation of the kill switch results in preferential death of actively expanding donor allo-reactive T-cells, therefore resulting in depletion of the T cell repertoire that has the potential to lead to relapse of GvHD/CRS. Ex vivo analysis of the re-expanded cells shows that the remaining repertoire is capable of recognizing and responding to viral antigens, indicating that the recipients will not be immunocompromised. In addition, the recipients in these trials remained disease-free to 100 days, with data not yet available beyond this limited follow-up period. Finally, it will be determined whether or not the residual/re-expanded populations remain susceptible to kill switch induction in a second pass if depletion of these cells is required at a later time due to donor cell related complications.
Example 7—In Vivo Proof-of-Concept Studies in Mouse Models
[0284] Animal studies will be conducted to explore the in vivo behavior and properties of modified T-cells in both GvHD-resistant and GvHD-sensitive humanized NSG mice. Initial studies will aim to evaluate T cell engraftment and the MTX-induced “kill-switch” function in the modified T-cells. These studies will be conducted in GvHD-resistant mice. Studies to follow will aim to establish a mouse model of GvHD, providing a clinically-relevant in vivo setting in which to test the “kill-switch.” With a clear understanding of T-cell dose, distribution and function together with an understanding of MTX responsiveness, an in vivo POC study will be conducted in GvHD-sensitive mice receiving a leukemia-challenge. It will be shown that modified T-cells can be manipulated by triggering the MTX “kill-switch” to minimize GvHD while maintaining the ability to mount a GVT response.
Example 8—Understanding T Cell Dose, Engraftment, Distribution, Survival and Methotrexate-Sensitivity
[0285] MHC KO NSG mice (GvHD-resistant) will be transplanted with different doses of modified T-cells, in order to establish an optimal T cell dose for sustained engraftment. At different time points the distribution of T-cells in lymphoid and non-lymphoid organs will be analyzed.
[0286] Using the optimal T-cell dose determined as noted herein (i), mice will be treated with different doses of methotrexate twenty-four to forty-eight hours following engraftment. The number of remaining T-cells in lymphoid and non-lymphoid organs will be determined in an analysis time-course designed to understand how rapidly the modified T-cells are eliminated.
[0287] A parallel study will be initiated to explore the longevity of the modified T-cell graft and MTX sensitivity of these T-cells over time. Mice receiving an optimal dose of modified T-cells will be aged for six months and then the MTX-induced “kill-switch” will be triggered. The number of remaining T-cells in lymphoid and non-lymphoid organs will be determined at the previously determined optimal analysis time. It will be shown how well modified T-cells could respond to the MTX “kill-switch” when triggered at a later time point, as may be the case in late-onset Acute or Chronic GvHD.
Example 9—Establishment and Characterization of a GvHD Mouse Model and Analysis of Modified T-Cell Graft
[0288] To initiate GvHD, irradiation conditioned NSG mice will be transplanted with the optimal dose of modified T-cells within 2-24 h post conditioning. From published literature, GvHD develops in these mice by about day 25 (body posture, activity, fur and skin condition and weight loss monitored) with disease end point reached by ˜day 55 (>20% weight loss with clinical symptoms of GvHD). Should disease progression be significantly slower or more aggressive, T-cell doses higher and lower respectively, than the optimal dose could be tested (approx. 10.sup.6-10.sup.7 T-cells based on literature).
[0289] With T-cell dose and disease kinetics optimized, T cell engraftment will be explored in a time-course analysis. T cell seeding of different organs is a feature of the GvHD and this will be explored in our model. The time course analysis time points will be determined by the onset and severity of GvHD observed.
[0290] When the modified T-cells are clearly detectable in lymphoid organs, T-cell (CD4+ and CD8+) functionality will be analyzed. T-cells will be stimulated in vitro with various stimuli (e.g. PMA, CD3/CD28) and analyzed for phenotype, proliferation, cytokine production and ex vivo anti-tumor cytotoxicity. T-cells will be specifically analyzed for their ability to respond to viral peptides e.g. CMV, EBV & FLU (Proimmune ProMix CEF peptide pool) as a measure of their ability to respond to latent virus reactivation.
Example 10—Activation of Methotrexate-Induce “Kill Switch” in GvHD Model
[0291] NSG mice will be irradiated and transplanted with modified T-cells as per previously determined optimal conditions. At the acute or chronic phase of GvHD, mice will be administered with different doses of MTX including an optimal dose. The percentage of modified T-cells in peripheral blood will be determined weekly until the end of the experiments. GvHD development will be monitored to confirm if mice can be rescued from developing progressive disease. Infiltration of modified T-cells into various organs will be quantified to understand the severity of GvHD at a systemic level.
Example 11—Modified T-Cells POC in a GVT/GvHD Mouse Model
[0292] NSG mice will be irradiated and transplanted with modified T-cells as per previously determined optimal conditions. Within twenty-four post-irradiation, mice will receive a dose of P815 H2-Kd cell line to establish leukemia. The P815 cells will be previously transduced to express GFP for in vivo biodistribution and assessment of tumor growth. At the onset of GvHD mice will be treated with the optimal dose of MTX and disease progression as well as leukemia burden will be monitored until the end of the experiment.
Example 12—HPRT Knockout Guide RNAs
[0293]
TABLE-US-00002 SEQ ID NO: Name Nucleotide Sequence 33 IN-1 ATTATGCTGAGGATTTGGAA 34 IDT-1 GATGATCTCTCTCAACTTTAAC 35 IDT-6 CATACCTAATCATTATGCTG 36 IDT-4 GGTTATGACCTTGATTTATT 37 IDT-2 CATGGACTAATTATGGACAG 38 IDT-3 TAGCCCTCTGTGTGCTCAAG 27 C1-gRNA3 CGTGACGTAAAGCCGAACCC 26 C1-gRNA2 GCGGGTCGCCATAACGGAGC 25 C1-gRNA1 GTTATGGCGACCCGCAGCCC 39 Nat Paper GCCCTGGCCGGTTCAGGCCCACG
Example 13—HPRT Targeted Knockout Resistance to 6-TG
[0294] Method
[0295] Jurkat cells were electroporated with a ribonucleoprotein (RNP) complex containing guide RNA (gRNA; GS-4; designated IDT-4) together with the Cas9 and tracrRNA. Cells which were confirmed to be transfected with the gRNA via tracr RNA were purified using fluorescence activated cells sorting (FACS) and subsequently cultured for 72 hours. Increasing concentrations of 6-thioguanine (6-TG) were then administered to the transduced cultured cells to assess resistance. Wild type (unmodified) Jurkat cells were used as a control.
[0296] Results
[0297] Luminescence (ATP detection) was used to assess cell viability. IDT-4 modified cells demonstrated resistance to increasing doses of 6-TG (tested up to 10 uM). Unmodified Jurkat cells (wild type) showed a decrease in cell viability with increasing concentrations of 6-TG (see
[0298] Unmodified (WT) and IDT-4 modified Jurkat cells were also analyzed for HPRT protein using Western blot (see
Example 14—Long-Term Cell Viability/Survival
[0299] Method
[0300] HPRT Knockout Jurkat cells (modified with guide RNA IDT-4; as described Example 1; designated HPRT−/−) were mixed together with Jurkat cells modified to express GFP alone (WT GFP) in approximately equal proportions.
[0301] Cells were cultured under standard culture conditions for 18 days before re-assessing the proportion of GFP+ cells in the culture.
[0302] Results
[0303] GFP proportion of cells at Day 18 was substantially similar to Day 1 (see
Example 15—HPRT Knockout Jurkat Cells—Methotrexate Sensitivity
[0304] Method & Results
[0305] (A) MTX Dose Response
[0306] Jurkat cells (unmodified; WT) were cultured with increasing concentrations of methotrexate (MTX) to determine the MTX dosage window required to kill WT cells (see
[0307] (B) HPRT Knockout MTX Dose Response
[0308] Dose response of HPRT Knockout (IDT-4 modified) Jurkat cells to MTX was compared to unmodified Jurkat cells (WT) to determine sensitivity to MTX (see
Example 16—HPRT Knockdown Jurkat Cells
[0309] Method
[0310] Jurkat T cells were modified with lentiviral vectors (A) TL20cw-7SK/sh734-UbC/GFP or (B) TL20cw-UbC/GFP-7SK/sh734. Jurkat cells were transduced with respective lentiviral vectors using 1 ml of un-diluted virus containing medium (VCM) together with 8 ng/ml of polybrene by centrifuging at 2,500 rpm for 90 minutes at room temperature followed by incubating for 60 minutes at 37° C. The cells were then cultured for 4 days post-transduction and removal of the VCM before using flow cytometry to determine the transduction efficiency (GFP positive cells).
[0311] Results
[0312] The Jurkat cells demonstrated a high transduction efficiency at day 4 post spin-inoculation, with the sh734-GFP (see
Example 17—HPRT Knockdown CEM T Cells
[0313] Method
[0314] CEM T cells were modified with the lentiviral vectors TL20cw-7SK/sh734-UbC/GFP (sh734-GFP) and TL20cw-UbC/GFP-7SK/sh734 (GFP-sh734).
[0315] CEM cells were spin-infected with 1 ml of undiluted virus containing medium (VCM) together with 10 ng/ml polybrene by centrifuging at 2,500 rpm for 90 minutes at room temperature followed by incubation for 60 minutes at 37° C. The proportion of GFP+ cells was determined after 4 days by flow cytometry. Transduction efficiencies were relatively low.
[0316] Modified CEM cells were subjected to 6-TG selection with 5 uM 6-TG for a total of 17 days. Cells containing the sh734 were successfully selected by 6-TG, increasing to 28.8% GFP+ in the case of sh734-GFP and 42.4% GFP+ in the case of GFP-sh734, indicating that these cells had a survival advantage over non-transduced cells (see
Example 18—Vector Production—HPRT Knockdown
[0317] Candidate vectors were prepared by insertion of an expression cassette comprising 7SK/sh734 into a pTL20cw vector (see, e.g.,
TABLE-US-00003 Relative location/orientation Vector of 7SK/sh734 TL20cw-7SK/sh734-UbC/GFP upstream/forward TL20cw-r7SK/sh734-UbC/GFP upstream/reverse TL20cw-UbC/GFP-7SK/sh734 downstream/forward TL20cw-UbC/GFP-r7SK/sh734 downstream/reverse
Example 19—Transduction/Transfection
[0318] K562 or Jurkat cells were transduced with a vector including a nucleic acid sequence designed to knockdown HPRT and a nucleic acid sequence encoding the green fluorescent protein (GFP) (MOI from 0.1-5); or were transfected with a nanocapsule comprising CRISPR/Cas9 and a sgRNA to HPRT (100 ng/5×10.sup.4 cells).
Example 20—Knockdown of HPRT and 6TG Resistance
[0319] 6-TG stock solution was added into the medium containing transduced/transfected K562 or Jurkat cells at day 3 or 4 post-transduction/transfection. 6-TG was maintained until day 14 or longer to a final concentration e.g. 300 nM for K562 cell and 2.5 uM for Jurkat cell. The medium was refreshed every 3 to 4 days. GFP was analyzed on flow machine, VCN was analyzed by VCN ddPCR assay and InDel % as analyzed with T7E1 assay. Results are provided in the Table which follows in
TABLE-US-00004 Day 0 Day 35 sh734/ sh734/ Vectors Dilution % GFP+ % GFP+ Rel. HPRT % GFP+ % GFP+ Rel. HPRT Mock Mock 0.4 1 0.7 1 TL20cw-UbC/GFP 1024 10.4 ND 0.95 9.1 N/A N/A TL20cw-7SK/sh734-UbC/GFP 1024 8.3 3.03 1.19 99.6 21.06 0.087 TL20cw-r7SK/sh734-UbC/GFP 1024 8.2 4.49 0.71 95.4 27 48 0.070 TL20cw-UbC/GFP-7SK/sh734 1024 12.4 0.87 0.94 59.6 6.98 0.223 TL20cw-UbC/GFP-r7SK/sh734 1024 10.1 0.27 0.72 98 15.17 0.163
Additional Embodiments
[0320] In a first additional embodiment is a method of providing benefits of a lymphocyte infusion to a patient in need of treatment thereof while mitigating side effects comprising: generating HPRT deficient lymphocytes from a donor sample; positively selecting for the HPRT deficient lymphocytes ex vivo to provide a population of modified lymphocytes; administering an HSC graft to the patient; administering the population of modified lymphocytes to the patient following the administration of the HSC graft; and optionally administering methotrexate (MTX) if the side effects arise. In some embodiments, the patient treated receives the benefit of receiving T-cells to fight infection, support engraftment, and prevent disease relapse. In addition, should GvHD occur, T-cells may be removed through administration of one or more doses of MTX.
[0321] In some embodiments, the HPRT deficient lymphocytes are generated through knockout of the HPRT gene, such as by transfection of lymphocytes with a population of nanocapsules including a payload adapted to knockout HPRT (e.g. a payload including a guide RNA having the sequence of any one of SEQ ID NOS: 25-39). In other embodiments, the HPRT deficient lymphocytes are generated through knockdown of the HPRT gene, such as by transduction of lymphocytes with an expression vector including a nucleic acid sequence encoding an RNA interference agent (e.g. a nucleic acid encoding a shRNA having the sequence of any one of SEQ ID NOS: 1, 2, and 5-11). In some embodiments, the positive selection comprises contacting the generated HPRT deficient lymphocytes with a purine analog (e.g. 6-thioguanine (6TG), 6-mercaptopurine (6-MP), or azathioprine (AZA)). In some embodiments, the positive selection comprises contacting the generated HPRT deficient lymphocytes with a purine analog and a second agent (e.g. allopurinol). In some embodiments, the purine analog is 6TG. In some embodiments, the modified lymphocytes are administered as a single bolus. In some embodiments, the modified lymphocytes are administered as multiple doses. In some embodiments, each dose comprises between about 0.1×10.sup.6 cells/kg to about 240×10.sup.6 cells/kg. In some embodiments, the MTX is optionally administered upon diagnosis of GvHD. In some embodiments, an amount of MTX administered ranges from about 2 mg/m.sup.2/infusion to about 8 mg/m.sup.2/infusion. In some embodiments, the MTX is administered in titrated doses.
[0322] It is believed that the methods of the present disclosure exploits the purine salvage pathway via modification of the gene encoding the enzyme hypoxanthine-guanine phosphoribosyl transferase (HPRT), which facilitates the recycling of purines. Inhibition of HPRT expression via either gene knockout or gene knockdown renders the modified cells solely dependent on the de novo purine biosynthesis pathway for survival. In non-modified cells, delivery of the purine analogue 6-thioguanine (6TG), which is converted through HPRT, ultimately leads to accumulation of 6-thioguanine nucleotides (6TGN), which are toxic to the cell via several mechanisms including incorporation into DNA during S-phase. Inhibition of the HPRT enzyme in the gene modified cells and subsequent treatment with 6TG, a drug already used in the treatment of various leukemias as well as severe inflammatory diseases, provides these cells with a survival advantage over non-modified cells, and therefore a mechanism by which to select modified cells in vitro and potentially in vivo. In addition, inhibition of the de novo purine biosynthesis pathway in these HPRT enzyme deficient cells, such as with methotrexate (MTX), results in cell apoptosis (due to an also non-functional purine salvage pathway), thereby providing a mechanism by which another approved drug can be used as a “kill switch” inducer in modified cells.
[0323] In a second additional embodiment is a composition including a component which reduces or eliminates HPRT expression in hematopoietic stem cells (“HSCs”). In some embodiments, the HSCs are lymphoid cells. In some embodiments, the lymphoid cells are T-cells. In some embodiments, the composition includes a first component which effectuates a knockdown of the HPRT gene. In other embodiments, the composition includes a first component which effectuates a knockout of the HPRT gene. In some embodiments, the composition includes a lentiviral expression vector including a first nucleic acid encoding an agent adapted to knockdown the HPRT gene (e.g. an RNA interference agent (RNAi)). In some embodiments, the lentiviral expression vector may be incorporated within a nanocapsule, such as one adapted to target HSCs.
[0324] In a third additional embodiment is an expression vector including a nucleic acid sequence encoding an RNAi to effectuate knockdown of HPRT. In some embodiments, the lentiviral expression vectors are suitable for producing selectable genetically modified cells, such as HSCs. In some embodiments, the HSCs transduced ex vivo may be administered to a patient in need of treatment. In some embodiments, the nucleic acid encoding the RNAi encodes a small hairpin ribonucleic acid molecule (“shRNA”) targeting HPRT. In some embodiments, the first nucleic acid sequence encoding the shRNA targeting the HPRT gene has a sequence having at least 90% identity to that of SEQ ID NO: 1, and wherein the first nucleic acid sequence is operably linked to a 7sk promoter or a mutated variant thereof. In some embodiments, the first nucleic acid sequence encoding the shRNA targeting the HPRT gene has a sequence having at least 95% identity to that of SEQ ID NO: 1, and wherein the first nucleic acid sequence is operably linked to a 7sk promoter or a mutated variant thereof. In some embodiments, the first nucleic acid sequence encoding the shRNA targeting the HPRT gene has a sequence having at least 97% identity to that of SEQ ID NO: 1, and wherein the first nucleic acid sequence is operably linked to a 7sk promoter or a mutated variant thereof. In some embodiments, the first nucleic acid sequence encoding the shRNA targeting the HPRT gene has a sequence of SEQ ID NO: 1, and wherein the first nucleic acid sequence is operably linked to a 7sk promoter or a mutated variant thereof.
[0325] In some embodiments, the first nucleic acid sequence encoding the shRNA targeting the HPRT gene has a sequence having at least 90% identity to that of SEQ ID NO: 2. In some embodiments, the first nucleic acid sequence encoding the shRNA targeting the HPRT gene has a sequence having at least 95% identity to that of SEQ ID NO: 2. In some embodiments, the first nucleic acid sequence encoding the shRNA targeting the HPRT gene has a sequence having at least 97% identity to that of SEQ ID NO: 2. In some embodiments, the first nucleic acid sequence encoding the shRNA targeting the HPRT gene has a sequence of SEQ ID NO: 2.
[0326] In some embodiments, the first nucleic acid sequence encoding the shRNA targeting the HPRT gene has a sequence having at least 80% identity to any one of SEQ ID NOS: 5, 6, and 7. In some embodiments, the first nucleic acid sequence encoding the shRNA targeting the HPRT gene has a sequence having at least 90% identity to any one of SEQ ID NOS: 5, 6, and 7. In some embodiments, the first nucleic acid sequence encoding the shRNA targeting the HPRT gene has a sequence having at least 95% identity to any one of SEQ ID NOS: 5, 6, and 7. In some embodiments, the first nucleic acid sequence encoding the shRNA targeting the HPRT gene has a sequence having at least 97% identity to any one of SEQ ID NOS: 5, 6, and 7. In some embodiments, the first nucleic acid sequence encoding the shRNA targeting the HPRT gene has a sequence of any one of SEQ ID NOS: 5, 6, and 7.
[0327] In some embodiments, the first nucleic acid sequence is operably linked to a Pol III promoter. In some embodiments, the Pol III promoter is a Homo sapiens cell-line HEK-293 7sk RNA promoter (see, for example, SEQ ID NO: 14). In some embodiments, the Pol III promoter is a 7sk promoter which includes a single mutation in its nucleic acid sequence as compared with SEQ ID NO: 14. In some embodiments, the Pol III promoter is a 7sk promoter which includes multiple mutations in its nucleic acid sequence as compared with SEQ ID NO: 14. In some embodiments, the Pol III promoter is a 7sk promoter which includes a deletion in its nucleic acid sequence as compared with SEQ ID NO: 14. In some embodiments, the Pol III promoter is a 7sk promoter which includes both a mutation and a deletion in its nucleic acid sequence as compared with SEQ ID NO: 14. In some embodiments, the first nucleic acid sequence is operably linked to promoter having at least 95% identity to that of SEQ ID NO: 14. In some embodiments, the first nucleic acid sequence is operably linked to promoter having at least 97% identity to that of SEQ ID NO: 14. In some embodiments, the first nucleic acid sequence is operably linked to promoter having at least 98% identity to that of SEQ ID NO: 14. In some embodiments, the first nucleic acid sequence is operably linked to promoter having at least 99% identity to that of SEQ ID NO: 14. In some embodiments, the first nucleic acid sequence is operably linked to a promoter having SEQ ID NO: 14.
[0328] In a fourth additional embodiment is a lentiviral expression vector comprising a nucleic acid sequence encoding a micro-RNA based shRNA targeting a HPRT gene. In some embodiments, the nucleic acid sequence encoding the micro-RNA based shRNA targeting the HPRT gene has a sequence having at least 80% identity to any one of SEQ ID NOS: 8, 9, 10, and 11. In some embodiments, the nucleic acid sequence encoding the micro-RNA based shRNA targeting the HPRT gene has a sequence having at least 90% identity to any one of SEQ ID NOS: 8, 9, 10, and 11. In some embodiments, the nucleic acid sequence encoding the micro-RNA based shRNA targeting the HPRT gene has a sequence having at least 95% identity to any one of SEQ ID NOS: 8, 9, 10, and 11. In some embodiments, the nucleic acid sequence encoding the micro-RNA based shRNA targeting the HPRT gene has a sequence having at least 97% identity to any one of SEQ ID NOS: 8, 9, 10, and 11. In some embodiments, the nucleic acid sequence encoding the micro-RNA based shRNA targeting the HPRT gene has a sequence of any one of SEQ ID NOS: 8, 9, 10, and 11. In some embodiments, the nucleic acid sequence encoding the micro-RNA based shRNA targeting the HPRT gene is operably linked to a Pol III or Pol II promoter, including any of those described herein.
[0329] In a fifth additional embodiment is a polynucleotide sequence including (a) a first portion encoding an shRNA targeting HPRT; and (b) a second portion encoding a first promoter driving expression of the sequence encoding the shRNA targeting HPRT. In some embodiments, the polynucleotide further comprises (c) a third portion encoding a central polypurine tract element; and (d) a fourth portion encoding a Rev response element (SEQ ID NO: 19). In some embodiments, the polynucleotide sequence further comprises a WPRE element (e.g. the WPRE element comprising SEQ ID NO: 18). In some embodiments, the polynucleotide sequence further comprises an insulator.
[0330] In a sixth additional embodiment are HSCs (e.g. CD34.sup.+ HSCs) which have been transduced with an expression vector or transfected with a nanocapsule, each including an agent designed to reduce HPRT expression (e.g. an RNAi for knockdown of HPRT). In some embodiments, the HSCs are T-cells. In some embodiments, the transduced HSCs constitute a cell therapy product which may be administered to a subject in need of treatment thereof, e.g. a patient treated with the transduced HSCs received the benefit of receiving cells (such as T-cells that can be expanded ex vivo) to fight infection, support engraftment, and prevent disease relapse.
[0331] In a seventh additional embodiment is a host cell transduced with any one of an expression vector, and wherein the host cell is HPRT deficient. In some embodiments, the host cell is a T-cell. In some embodiments, the expression vector comprises a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown HPRT, wherein the shRNA has at least 95% identity to the sequence of SEQ ID NO: 1.
[0332] In an eight additional embodiment is a pharmaceutical composition comprising the host cell, wherein the host cell is formulated with a pharmaceutically acceptable carrier or excipient. In some embodiments, the host cell is an HPRT deficient host cell derived by transducing a hostel cell with an expression vector. In some embodiments, the expression vector comprises a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown HPRT, wherein the shRNA has at least 95% identity to the sequence of SEQ ID NO: 1.
[0333] In a ninth additional embodiment is a method of generating HPRT-deficient cells comprising: transducing a population of host cells with an expression vector, and positively selecting for the HPRT-deficient cells by contacting the population of the transduced host cells with at least a purine analog. In some embodiments, the purine analog is selected from the group consisting of 6TG and 6-mercaptopurin. In some embodiments, the expression vector comprises a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown HPRT, wherein the shRNA has at least 95% identity to the sequence of SEQ ID NO: 1.
[0334] In a tenth additional embodiment is a method of providing benefits of a lymphocyte infusion to a patient in need of treatment thereof while mitigating side effects comprising: generating HPRT deficient lymphocytes from a donor sample, wherein the HPRT deficient lymphocytes are generating by transducing lymphocytes within the donor sample with an expression vector, positively selecting for the HPRT deficient lymphocytes ex vivo to provide a population of modified lymphocytes; administering an HSC graft to the patient; administering a therapeutically effective amount of the population of modified lymphocytes to the patient following the administration of the HSC graft; and optionally administering a dihydrofolate reductase inhibitor if the side effects arise. In some embodiments, the expression vector comprises a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown HPRT, wherein the shRNA has at least 95% identity to the sequence of SEQ ID NO: 1.
[0335] In an eleventh additional embodiment is a method of providing benefits of a lymphocyte infusion to a patient in need of treatment thereof while mitigating side effects comprising: generating HPRT deficient lymphocytes from a donor sample, wherein the HPRT deficient lymphocytes are generating by transducing lymphocytes within the donor sample with an expression vector; positively selecting for the HPRT deficient lymphocytes ex vivo to provide a population of modified lymphocytes; and administering the population of modified lymphocytes to the patient contemporaneously with or after an administration of an HSC graft. In some embodiments, the method further comprises administering to the patient one or more doses of a dihydrofolate reductase inhibitor. In some embodiments, the expression vector comprises a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown HPRT, wherein the shRNA has at least 95% identity to the sequence of SEQ ID NO: 1.
[0336] In a twelfth additional embodiment is a method of treating a hematological cancer in a patient in need of treatment thereof comprising: generating HPRT deficient lymphocytes from a donor sample, wherein the HPRT deficient lymphocytes are generating by transducing lymphocytes within the donor sample with an expression vector; positively selecting for the HPRT deficient lymphocytes ex vivo to provide a population of modified lymphocytes; inducing at least a partial graft versus malignancy effect by administering an HSC graft to the patient; and administering the population of modified lymphocytes to the patient following the detection of residual disease or disease recurrence. In some embodiments, the method further comprises administering to the patient at least one dose of a dihydrofolate reductase inhibitor to suppress at least one symptom of GvHD or CRS. In some embodiments, the expression vector comprises a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown HPRT, wherein the shRNA has at least 95% identity to the sequence of SEQ ID NO: 1.
[0337] In a thirteenth additional embodiment is a method of treating a patient with hypoxanthine-guanine phosphoribosyl transferase (HPRT) deficient lymphocytes including the steps of: (a) isolating lymphocytes from a donor subject; (b) transducing the isolated lymphocytes with an expression vector; (c) exposing the transduced isolated lymphocytes to an agent which positively selects for HPRT deficient lymphocytes to provide a preparation of modified lymphocytes; (d) administering a therapeutically effective amount of the preparation of the modified lymphocytes to the patient following hematopoietic stem-cell transplantation; and (e) optionally administering methotrexate or mycophenolic acid following the development of graft-versus-host disease (GvHD) in the patient. In some embodiments, the expression vector comprises a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown HPRT, wherein the shRNA has at least 95% identity to the sequence of SEQ ID NO: 1.
[0338] In a fourteenth additional embodiment is a method of providing benefits of a lymphocyte infusion to a patient in need of treatment thereof while mitigating side effects comprising: generating substantially HPRT deficient lymphocytes from a donor sample, wherein the substantially HPRT deficient lymphocytes are generating by transfecting lymphocytes within the donor sample with a delivery vehicle including an endonuclease and a gRNA targeting HPRT; positively selecting for the substantially HPRT deficient lymphocytes ex vivo to provide a population of modified lymphocytes; administering an HSC graft to the patient; administering a therapeutically effective amount of the population of modified lymphocytes to the patient following the administration of the HSC graft; and optionally administering MTX if the side effects arise.
[0339] In a fifteenth additional embodiment is a method of providing benefits of a lymphocyte infusion to a patient in need of treatment thereof while mitigating side effects comprising: generating substantially HPRT deficient lymphocytes from a donor sample, wherein the substantially HPRT deficient lymphocytes are generating by transfecting lymphocytes within the donor sample with a delivery vehicle including a Cas protein (e.g. Cas9, Cas12a, Cas12b) and a gRNA targeting the HPRT gene; positively selecting for the substantially HPRT deficient lymphocytes ex vivo to provide a population of modified lymphocytes; administering an HSC graft to the patient; administering a therapeutically effective amount of the population of modified lymphocytes to the patient following the administration of the HSC graft; and optionally administering MTX if the side effects arise.
[0340] In a sixteenth additional embodiment is a lymphocyte transduced with an expression vector comprising a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown HPRT, wherein the shRNA has at least 90% identity to the sequence of any one of SEQ ID NOS: 2, 5, 6, 7, 8, 9, 10, and 11. In some embodiments, the shRNA has at least 95% identity to the sequence of any one of SEQ ID NOS: 2, 5, 6, 7, 8, 9, 10, and 11. In some embodiments, the shRNA has at least 97% identity to the sequence of any one of SEQ ID NOS: 2, 5, 6, 7, 8, 9, 10, and 11. In some embodiments, the shRNA comprises the sequence of any one of SEQ ID NOS: 2, 5, 6, 7, 8, 9, 10, and 11. In some embodiments, the lymphocyte is rendered substantially HPRT deficient following transduction with the expression vector. In some embodiments, the lymphocyte is a T-cell. [0341] Further Embodiment 1. An expression vector comprising a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown hypoxanthine-guanine phosphoribosyl transferase (HPRT), wherein the shRNA has at least 90% identity to the sequence of any of SEQ ID NOS: 2, 5, 6, and 7. [0342] Further Embodiment 2. The expression vector of further embodiment 1, wherein the shRNA has a nucleic acid sequence having at least 95% identity to the sequence of any of SEQ ID NOS: 2, 5, 6, and 7. [0343] Further Embodiment 3. The expression vector of further embodiment 1, wherein the shRNA has a nucleic acid sequence having at least 97% identity to the sequence of any of SEQ ID NOS: 2, 5, 6, and 7. [0344] Further Embodiment 4. The expression vector of further embodiment 1, wherein the shRNA has a nucleic acid sequence of any of SEQ ID NOS: 2, 5, 6, and 7. [0345] Further Embodiment 5. The expression vector of any of the preceding further embodiments, wherein the first expression control sequence comprises a Pol III promoter or a Pol II promoter. [0346] Further Embodiment 6. The expression vector of further embodiment 5, wherein the Pol III promoter is a 7sk promoter, a mutated 7sk promoter, an H1 promoter, or an EF1a promoter. [0347] Further Embodiment 7. The expression vector of further embodiment 6, wherein the 7sk promoter has a nucleic acid sequence having at least 95% sequence identity to that of SEQ ID NO: 14. [0348] Further Embodiment 8. The expression vector of further embodiment 6, wherein the 7sk promoter has a nucleic acid sequence having at least 97% sequence identity to that of SEQ ID NO: 14. [0349] Further Embodiment 9. The expression vector of further embodiment 6, wherein the 7sk promoter has a nucleic acid sequence of SEQ ID NO: 14. [0350] Further Embodiment 10. The expression vector of further embodiment 6, wherein the mutated 7sk promoter has a nucleic acid sequence having at least 95% sequence identity to that of SEQ ID NO: 15. [0351] Further Embodiment 11. The expression vector of further embodiment 6, wherein the mutated 7sk promoter has a nucleic acid sequence having at least 97% sequence identity to that of SEQ ID NO: 15. [0352] Further Embodiment 12. The expression vector of further embodiment 6, wherein the mutated 7sk promoter has a nucleic acid sequence of SEQ ID NO: 15. [0353] Further Embodiment 13. An expression vector comprising a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown HPRT, wherein the shRNA has at least 90% sequence identity to the sequence of any of SEQ ID NOS: 8, 9, 10, and 11. [0354] Further Embodiment 14. The expression vector of further embodiment 13, wherein the shRNA has a nucleic acid sequence having at least 95% identity to the sequence of any of SEQ ID NOS: 8, 9, 10, and 11. [0355] Further Embodiment 15. The expression vector of further embodiment 13, wherein the shRNA has a nucleic acid sequence having at least 97% identity to the sequence of any of SEQ ID NOS: 8, 9, 10, and 11. [0356] Further Embodiment 16. The expression vector of further embodiment 13, wherein the shRNA has a nucleic acid sequence of any of SEQ ID NOS: 8, 9, 10, and 11. [0357] Further Embodiment 17. The expression vector of any of further embodiments 13-16, wherein the first expression control sequence comprises a Pol III promoter or a Pol II promoter. [0358] Further Embodiment 18. The expression vector of further embodiment 17, wherein the Pol III promoter is a 7sk promoter, a mutated 7sk promoter, an H1 promoter, or an EF1a promoter. [0359] Further Embodiment 19. The expression vector of further embodiment 18, wherein the 7sk promoter has a nucleic acid sequence having at least 95% sequence identity to that of SEQ ID NO: 14. [0360] Further Embodiment 20. The expression vector of further embodiment 18, wherein the 7sk promoter has a nucleic acid sequence having at least 97% sequence identity to that of SEQ ID NO: 14. [0361] Further Embodiment 21. The expression vector of further embodiment 18, wherein the 7sk promoter has a nucleic acid sequence of SEQ ID NO: 14. [0362] Further Embodiment 22. The expression vector of further embodiment 18, wherein the mutated 7sk promoter has a nucleic acid sequence having at least 95% sequence identity to that of SEQ ID NO: 15. [0363] Further Embodiment 23. The expression vector of further embodiment 18, wherein the mutated 7sk promoter has a nucleic acid sequence having at least 97% sequence identity to that of SEQ ID NO: 15. [0364] Further Embodiment 24. The expression vector of further embodiment 18, wherein the mutated 7sk promoter has a nucleic acid sequence of SEQ ID NO: 15. [0365] Further Embodiment 25. A host cell transduced with any one of the expression vectors of further embodiments 1-24, and wherein the host cell is rendered substantially HPRT deficient following transduction. [0366] Further Embodiment 26. The host cell of further embodiment 25, wherein the host cell is a T-cell. [0367] Further Embodiment 27. The host cell of further embodiment 26, wherein the T-cell is selected from the group consisting of helper CD4+ T cells, cytotoxic CD8+ T cells, memory T cells, regulatory CD4+ T cells, natural killer T cell, mucosal associated invariant, and gamma delta T cells. [0368] Further Embodiment 28. The host cell of further embodiment 25, wherein the host cell is a lymphocyte. [0369] Further Embodiment 29. A pharmaceutical composition comprising the host cell of any of further embodiments 25-28, wherein the host cell is formulated with a pharmaceutically acceptable carrier or excipient. [0370] Further Embodiment 30. A method of generating HPRT-deficient cells comprising: transducing a population of host cells with the expression vector according to any one of further embodiments 1 to 24; and positively selecting for the HPRT-deficient cells by contacting the population of the transduced host cells with at least a purine analog. [0371] Further Embodiment 31. The method of further embodiment 30, wherein the purine analog is selected from the group consisting of 6TG and 6-mercaptopurin. [0372] Further Embodiment 32. A method of providing benefits of a lymphocyte infusion to a patient in need of treatment thereof while mitigating side effects comprising: generating substantially HPRT deficient lymphocytes from a donor sample, wherein the substantially HPRT deficient lymphocytes are generated by transducing lymphocytes within the donor sample with an expression vector of any of further embodiments 1-24; positively selecting for the substantially HPRT deficient lymphocytes ex vivo to provide a population of modified lymphocytes; administering an hematopoietic stem cell (HSC) graft to the patient; administering a therapeutically effective amount of the population of modified lymphocytes to the patient following the administration of the HSC graft; and optionally administering a dihydrofolate reductase inhibitor if the side effects arise. [0373] Further Embodiment 33. The method of further embodiment 32, wherein the dihydrofolate reductase inhibitor is selected from the group consisting of methotrexate (MTX) or mycophenolic acid (MPA). [0374] Further Embodiment 34. The method of any of further embodiments 32-34, wherein the positive selection comprises contacting the generated substantially HPRT deficient lymphocytes with a purine analog. [0375] Further Embodiment 35. The method of further embodiment 34, wherein the purine analog is 6-thioguanine (6TG). [0376] Further Embodiment 36. The method of further embodiment 35, wherein an amount of 6TG ranges from between about 1 to about 15 μg/mL. [0377] Further Embodiment 37. The method of any of further embodiments 32-34, wherein the positive selection comprises contacting the substantially HPRT deficient lymphocytes with a purine analog and allopurinol. [0378] Further Embodiment 38. The method of any of further embodiments 32-37, wherein the modified lymphocytes are administered as a single bolus. [0379] Further Embodiment 39. The method of any of further embodiments 32-37, wherein multiple doses of the modified lymphocytes are administered to the patient. [0380] Further Embodiment 40. The method of further embodiment 39, wherein each dose of the modified lymphocytes comprises between about 0.1×10.sup.6 cells/kg to about 240×10.sup.6 cells/kg. [0381] Further Embodiment 41. The method of further embodiment 40, wherein a total dosage of modified lymphocytes comprises between about 0.1×10.sup.6 cells/kg to about 730×10.sup.6 cells/kg. [0382] Further Embodiment 42. A method of providing benefits of a lymphocyte infusion to a patient in need of treatment thereof while mitigating side effects comprising: generating substantially HPRT deficient lymphocytes from a donor sample, wherein the substantially HPRT deficient lymphocytes are generated by transducing lymphocytes within the donor sample with an expression vector of any of further embodiments 1-24; positively selecting for the substantially HPRT deficient lymphocytes ex vivo to provide a population of modified lymphocytes; and administering a therapeutically effective amount of the population of modified lymphocytes to the patient contemporaneously with or after an administration of an HSC graft. [0383] Further Embodiment 43. The method of further embodiment 42, wherein the method further comprises administering to the patient one or more doses of a dihydrofolate reductase inhibitor. [0384] Further Embodiment 44. The method of further embodiment 43, wherein the dihydrofolate reductase inhibitor is selected from the group consisting of MTX or MPA. [0385] Further Embodiment 45. The method of any of further embodiments 42-45, wherein the positive selection comprises contacting the substantially HPRT deficient lymphocytes with a purine analog. [0386] Further Embodiment 46. The method of further embodiment 45, wherein the purine analog is 6TG. [0387] Further Embodiment 47. The method of further embodiment 46, wherein an amount of 6TG ranges from between about 1 to about 15 μg/mL. [0388] Further Embodiment 48. The method of any of further embodiments 42-44, wherein the positive selection comprises contacting the generated substantially HPRT deficient lymphocytes with both a purine analog and allopurinol. [0389] Further Embodiment 49. The method of any of further embodiments 42-44, wherein the modified lymphocytes are administered as a single bolus. [0390] Further Embodiment 50. The method of any of further embodiments 42-48, wherein multiple doses of the modified lymphocytes are administered to the patient. [0391] Further Embodiment 51. The method of further embodiment 50, wherein each dose of the modified lymphocytes comprises between about 0.1×10.sup.6 cells/kg to about 240×10.sup.6 cells/kg. [0392] Further Embodiment 52. The method of further embodiment 50, wherein a total dosage of modified lymphocytes comprises between about 0.1×10.sup.6 cells/kg to about 730×10.sup.6 cells/kg. [0393] Further Embodiment 53. A method of treating a hematological cancer in a patient in need of treatment thereof comprising: generating substantially HPRT deficient lymphocytes from a donor sample, wherein the substantially HPRT deficient lymphocytes are generated by transducing lymphocytes within the donor sample with an expression vector of any of further embodiments 1-24; positively selecting for the substantially HPRT deficient lymphocytes ex vivo to provide a population of modified lymphocytes; inducing at least a partial graft versus malignancy effect by administering an HSC graft to the patient; and administering a therapeutically effective amount of the population of modified lymphocytes to the patient following the detection of residual disease or disease recurrence. [0394] Further Embodiment 54. The method of further embodiment 53, further comprising administering to the patient at least one dose of a dihydrofolate reductase inhibitor to suppress at least one symptom of GvHD or CRS. [0395] Further Embodiment 55. The method of further embodiment 54, wherein the dihydrofolate reductase inhibitor is selected from the group consisting of MTX or MPA. [0396] Further Embodiment 56. The method of any of further embodiments 53-55, wherein the positive selection comprises contacting the generated substantially HPRT deficient lymphocytes with a purine analog. [0397] Further Embodiment 57. The method of further embodiment 56, wherein the purine analog is 6TG. [0398] Further Embodiment 58. The method of further embodiment 57, wherein an amount of 6TG ranges from between about 1 to about 15 μg/mL. [0399] Further Embodiment 59. The method of any of further embodiments 53-54 wherein the positive selection comprises contacting the generated substantially HPRT deficient lymphocytes with both a purine analog and allopurinol. [0400] Further Embodiment 60. The method of any of further embodiments 53-59, wherein the modified lymphocytes are administered as a single bolus. [0401] Further Embodiment 61. The method of any of further embodiments 53-59, wherein multiple doses of the modified lymphocytes are administered to the patient. [0402] Further Embodiment 62. The method of further embodiment 61, wherein each dose of the modified lymphocytes comprises between about 0.1×10.sup.6 cells/kg to about 240×10.sup.6 cells/kg. [0403] Further Embodiment 63. The method of further embodiment 61, wherein a total dosage of modified lymphocytes comprises between about 0.1×10.sup.6 cells/kg to about 730×10.sup.6 cells/kg. [0404] Further Embodiment 64. A method of providing benefits of a lymphocyte infusion to a patient in need of treatment thereof while mitigating side effects comprising: generating substantially HPRT deficient lymphocytes from a donor sample, wherein the substantially HPRT deficient lymphocytes are generating by transfecting lymphocytes within the donor sample with a delivery vehicle including components adapted to knockout HPRT; positively selecting for the substantially HPRT deficient lymphocytes ex vivo to provide a population of modified lymphocytes; administering an HSC graft to the patient; administering a therapeutically effective amount of the population of modified lymphocytes to the patient following the administration of the HSC graft. [0405] Further Embodiment 65. The method of further embodiment 64, wherein the components adapted to knockout HPRT comprise a guide RNA having at least 90% sequence identity to any one of SEQ ID NOS: 25-39. [0406] Further Embodiment 66. The method of further embodiment 64, wherein the components adapted to knockout HPRT comprise a guide RNA targeting a nucleic acid sequence selected from the group consisting of SEQ ID NOS: 25-39. [0407] Further Embodiment 67. The method of further embodiment 66, wherein the components adapted to knockout HPRT further comprises a Cas protein. [0408] Further Embodiment 68. The method of further embodiment 67, wherein the Cas protein comprises a Cas9 protein. [0409] Further Embodiment 69. The method of further embodiment 67, wherein the Cas protein comprises a Cas12 protein. [0410] Further Embodiment 70. The method of further embodiment 69, wherein the Cas12 protein is a Cas12a protein. [0411] Further Embodiment 71. The method of further embodiment 69, wherein the Cas12 protein is a Cas12b protein. [0412] Further Embodiment 72. The method of any one of further embodiments 64-71, further comprising administering to the patient one or more doses of a dihydrofolate reductase inhibitor. [0413] Further Embodiment 73. The method of further embodiment 72, wherein the dihydrofolate reductase inhibitor is selected from the group consisting of MTX or MPA. [0414] Further Embodiment 74. The method of any of further embodiments 64-73, wherein the positive selection comprises contacting the generated substantially HPRT deficient lymphocytes with a purine analog. [0415] Further Embodiment 75. The method of further embodiment 74, wherein the purine analog is 6TG. [0416] Further Embodiment 76. The method of further embodiment 75, wherein an amount of 6TG ranges from between about 1 to about 15 μg/mL. [0417] Further Embodiment 77. The method of any of further embodiments 64-73, wherein the positive selection comprises contacting the generated substantially HPRT deficient lymphocytes with both a purine analog and allopurinol. [0418] Further Embodiment 78. The method of any of further embodiments 64-77, wherein the modified lymphocytes are administered as a single bolus. [0419] Further Embodiment 79. The method of any of further embodiments 64-77, wherein multiple doses of the modified lymphocytes are administered to the patient. [0420] Further Embodiment 80. The method of further embodiment 79, wherein each dose of the modified lymphocytes comprises between about 0.1×10.sup.6 cells/kg to about 240×10.sup.6 cells/kg. [0421] Further Embodiment 81. The method of further embodiment 79, wherein a total dosage of modified lymphocytes comprises between about 0.1×10.sup.6 cells/kg to about 730×10.sup.6 cells/kg. [0422] Further Embodiment 82. The method of further embodiment 64, wherein the delivery vehicle is a nanocapsule. [0423] Further Embodiment 83. The method of further embodiment 64, wherein the delivery vehicle is a nanocapsule comprising one or more targeting moieties. [0424] Further Embodiment 84. A method of treating a hematological cancer in a patient in need of treatment thereof comprising: generating substantially HPRT deficient lymphocytes from a donor sample, wherein the substantially HPRT deficient lymphocytes are generating by transfecting lymphocytes within the donor sample with a delivery vehicle including components adapted to knockout HPRT; positively selecting for the substantially HPRT deficient lymphocytes ex vivo to provide a population of modified lymphocytes; inducing at least a partial graft versus malignancy effect by administering an HSC graft to the patient; and administering a therapeutically effective amount of the population of modified lymphocytes to the patient following the detection of residual disease or disease recurrence. [0425] Further Embodiment 85. The method of further embodiment 84, further comprising administering to the patient at least one dose of a dihydrofolate reductase inhibitor to suppress at least one symptom of GvHD or CRS. [0426] Further Embodiment 86. The method of further embodiment 84, wherein the dihydrofolate reductase inhibitor is selected from the group consisting of MTX or MPA. [0427] Further Embodiment 87. The method of any of further embodiments 84-86, wherein the positive selection comprises contacting the generated substantially HPRT deficient lymphocytes with a purine analog. [0428] Further Embodiment 88. The method of further embodiment 87, wherein the purine analog is 6TG. [0429] Further Embodiment 89. The method of further embodiment 88, wherein an amount of 6TG ranges from between about 1 to about 15 μg/mL. [0430] Further Embodiment 90. The method of any of further embodiments 84-86 wherein the positive selection comprises contacting the generated substantially HPRT deficient lymphocytes with both a purine analog and allopurinol. [0431] Further Embodiment 91. The method of any of further embodiments 84-86, wherein the modified lymphocytes are administered as a single bolus. [0432] Further Embodiment 92. The method of any of further embodiments 84-86, wherein multiple doses of the modified lymphocytes are administered to the patient. [0433] Further Embodiment 93. The method of further embodiment 92, wherein each dose of the modified lymphocytes comprises between about 0.1×10.sup.6 cells/kg to about 240×10.sup.6 cells/kg. [0434] Further Embodiment 94. The method of further embodiment 92, wherein a total dosage of modified lymphocytes comprises between about 0.1×10.sup.6 cells/kg to about 730×10.sup.6 cells/kg. [0435] Further Embodiment 95. The method of any one of further embodiments 84-94, wherein the components adapted to knockout HPRT comprise a guide RNA having at least 90% sequence identity to any one of SEQ ID NOS: 25-39. [0436] Further Embodiment 96. The method of any one of further embodiments 84-94, wherein the components adapted to knockout HPRT comprise a guide RNA targeting a nucleic acid sequence selected from the group consisting of SEQ ID NOS: 25-39. [0437] Further Embodiment 97. The method of any one of further embodiments 84-94, wherein the components adapted to knockout HPRT further comprises a Cas protein. [0438] Further Embodiment 98. The method of further embodiment 97, wherein the Cas protein comprises a Cas9 protein. [0439] Further Embodiment 99. The method of further embodiment 97, wherein the Cas protein comprises a Cas12 protein. [0440] Further Embodiment 100. The method of further embodiment 99, wherein the Cas12 protein is a Cas12a protein. [0441] Further Embodiment 101. The method of further embodiment 99, wherein the Cas12 protein is a Cas12b protein. [0442] Further Embodiment 102. The method of any one of further embodiments 84-101, wherein the delivery vehicle is a nanocapsule. [0443] Further Embodiment 103. The method of any one of further embodiments 84-101, wherein the delivery vehicle is a nanocapsule comprising one or more targeting moieties. [0444] Further Embodiment 104. A method of treating a patient with HPRT deficient lymphocytes including the steps of: (a) isolating lymphocytes from a donor subject; (b) transducing the isolated lymphocytes with an expression vector of any one of further embodiments 1 to 24; (c) exposing the transduced isolated lymphocytes to an agent which positively selects for HPRT deficient lymphocytes to provide a preparation of modified lymphocytes; (d) administering a therapeutically effective amount of the preparation of the modified lymphocytes to the patient following hematopoietic stem-cell transplantation; and (e) optionally administering a dihydrofolate reductase inhibitor following the development of graft-versus-host disease (GvHD) in the patient. [0445] Further Embodiment 105. The method of further embodiment 104, wherein the dihydrofolate reductase inhibitor is selected from the group consisting of MTX or MPA. [0446] Further Embodiment 106. The method of any of further embodiments 104-105, wherein the agent which positively selects for the HPRT deficient lymphocytes comprises a purine analog. [0447] Further Embodiment 107. The method of further embodiment 106, wherein the purine analog is 6TG. [0448] Further Embodiment 108. The method of further embodiment 107, wherein an amount of 6TG ranges from between about 1 to about 15 μg/mL. [0449] Further Embodiment 109. A method of treating a patient with HPRT deficient lymphocytes including the steps of: (a) isolating lymphocytes from a donor subject; (b) contacting the isolated lymphocytes with a delivery vehicle including components adapted to knockout HPRT to provide a population of HPRT deficient lymphocytes; (c) exposing the population of HPRT deficient lymphocytes to an agent which positively selects for HPRT deficient lymphocytes to provide a preparation of modified lymphocytes; (d) administering a therapeutically effective amount of the preparation of the modified lymphocytes to the patient following hematopoietic stem-cell transplantation; and (e) optionally administering a dihydrofolate reductase inhibitor following the development of graft-versus-host disease (GvHD) in the patient. [0450] Further Embodiment 110. The method of further embodiment 109, wherein the dihydrofolate reductase inhibitor is selected from the group consisting of MTX or MPA. [0451] Further Embodiment 111. The method of any of further embodiments 109-110, wherein the agent which positively selects for the HPRT deficient lymphocytes comprises a purine analog. [0452] Further Embodiment 112. The method of further embodiment 111, wherein the purine analog is 6TG. [0453] Further Embodiment 113. The method of further embodiment 112, wherein an amount of 6TG ranges from between about 1 to about 15 μg/mL. [0454] Further Embodiment 114. The method of any one of further embodiments 109-113, wherein the components adapted to knockout HPRT comprise a guide RNA having at least 90% sequence identity to any one of SEQ ID NOS: 25-39. [0455] Further Embodiment 115. The method of any one of further embodiments 109-113, wherein the components adapted to knockout HPRT comprise a guide RNA targeting a nucleic acid sequence selected from the group consisting of SEQ ID NOS: 25-39. [0456] Further Embodiment 116. The method of any one of further embodiments 109-113, wherein the components adapted to knockout HPRT further comprises a Cas protein. [0457] Further Embodiment 117. The method of further embodiment 116, wherein the Cas protein comprises a Cas9 protein. [0458] Further Embodiment 118. The method of further embodiment 116, wherein the Cas protein comprises a Cas12 protein. [0459] Further Embodiment 119. The method of further embodiment 118, wherein the Cas12 protein is a Cas12a protein. [0460] Further Embodiment 120. The method of further embodiment 118, wherein the Cas12 protein is a Cas12b protein. [0461] Further Embodiment 121. The method of any one of further embodiments 109-120, wherein the delivery vehicle is a nanocapsule. [0462] Further Embodiment 122. The method of any one of further embodiments 109-120, wherein the delivery vehicle is a nanocapsule comprising one or more targeting moieties. [0463] Further Embodiment 123. Use of a preparation of modified lymphocytes for providing the benefits of a lymphocyte infusion to a subject in need of treatment thereof following hematopoietic stem-cell transplantation, wherein the preparation of the modified lymphocytes are generated by: (a) isolating lymphocytes from a donor subject; (b) transducing the isolated lymphocytes with an expression vector of any one of further embodiments 1 to 24; and (c) exposing the transduced isolated lymphocytes to an agent which positively selects for HPRT deficient lymphocytes to provide the preparation of modified lymphocytes. [0464] Further Embodiment 124. Use of a preparation of modified lymphocytes for providing the benefits of a lymphocyte infusion to a subject in need of treatment thereof following hematopoietic stem-cell transplantation, wherein the preparation of the modified lymphocytes are generated by: (a) isolating lymphocytes from a donor subject; (b) contacting the isolated lymphocytes with a delivery vehicle including components adapted to knockout HPRT to provide a population of substantially HPRT deficient lymphocytes; and (c) exposing the population of HPRT deficient lymphocytes to an agent which positively selects for HPRT deficient lymphocytes to provide a preparation of modified lymphocytes. [0465] Further Embodiment 125. A pharmaceutical composition comprising the expression vectors of any one of further embodiments 1 to 24 and a pharmaceutically acceptable carrier or excipient. [0466] Further Embodiment 126. A kit comprising: (i) a guide-RNA having at least 90% sequence identity to any one of SEQ ID NOS: 25-39; and (ii) a Cas protein. [0467] Further Embodiment 127. The kit of further embodiment 126, wherein the Cas protein is selected from the group consisting of a Cas9 protein and a Cas12 protein. [0468] Further Embodiment 128. The kit of any one of further embodiments 126 to 127, wherein the guide-RNA has at least 95% sequence identity to any one of SEQ ID NOS: 25-39. [0469] Further Embodiment 129. The kit of any one of further embodiments 126 to 127, wherein the guide-RNA has at least 98% sequence identity to any one of SEQ ID NOS: 25-39. [0470] Further Embodiment 130. A kit comprising: (i) a guide-RNA comprising any one of SEQ ID NOS: 25-39; and (ii) a Cas protein. [0471] Further Embodiment 131. The kit of further embodiment 130, wherein the Cas protein is selected from the group consisting of a Cas9 protein and a Cas12 protein. [0472] Further Embodiment 132. A nanocapsule comprising (i) a gRNA having at least 90% sequence identity to any one of SEQ ID NOS: 25-39; and (ii) a Cas protein. [0473] Further Embodiment 133. The nanocapsule of further embodiment 132, wherein the Cas protein is selected from the group consisting of a Cas9 protein and a Cas12 protein. [0474] Further Embodiment 134. The nanocapsule of any one of further embodiments 132 to 133, wherein the guide-RNA has at least 95% sequence identity to any one of SEQ ID NOS: 25-39. [0475] Further Embodiment 135. The nanocapsule of any one of further embodiments 132 to 133, wherein the guide-RNA has at least 98% sequence identity to any one of SEQ ID NOS: 25-39. [0476] Further Embodiment 136. The nanocapsule of any one of further embodiments 132-135, wherein the nanocapsules comprise at least one targeting moiety. [0477] Further Embodiment 137. The nanocapsule of any one of further embodiments 132-136, wherein the nanocapsule comprises a polymeric shell. [0478] Further Embodiment 138. The nanocapsule of any one of further embodiments 132-136, wherein polymeric nanocapsules are comprised of two different positively charged monomers, at least one neutral monomer, and a cross-linker. [0479] Further Embodiment 139. A host cell transfected with the nanocapsule of any one of further embodiments 132-138. [0480] Further Embodiment 140. Use of a preparation of modified lymphocytes for providing the benefits of a lymphocyte infusion to a subject in need of treatment thereof following hematopoietic stem-cell transplantation, wherein the preparation of the modified lymphocytes are generated by: (a) isolating lymphocytes from a donor subject; (b) contacting the isolated lymphocytes with the nanocapsules of any one of further embodiments 132-136; and (c) exposing the population of HPRT deficient lymphocytes to an agent which positively selects for HPRT deficient lymphocytes to provide a preparation of modified lymphocytes. [0481] Further Embodiment 141. A nanocapsule encapsulating any one of the expression vectors of further embodiments 1-26. [0482] Further Embodiment 142. The nanocapsule of further embodiment 141, wherein the nanocapsule comprises a polymeric shell. [0483] Further Embodiment 143. The nanocapsule of further embodiment 141, wherein polymeric nanocapsules are comprised of two different positively charged monomers, at least one neutral monomer, and a cross-linker. [0484] Further Embodiment 144. An expression vector comprising a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown hypoxanthine-guanine phosphoribosyl transferase (HPRT), wherein the shRNA has at least 90% identity to the sequence of any one of SEQ ID NOS: 2, 5, 6, and 7, wherein the expression vector does not include another transgene for expression. [0485] Further Embodiment 145. An expression vector comprising a first expression control sequence operably linked to a first nucleic acid sequence, the first nucleic acid sequence encoding a shRNA to knockdown hypoxanthine-guanine phosphoribosyl transferase (HPRT), wherein the shRNA has at least 90% identity to the sequence of any one of SEQ ID NOS: 2, 5, 6, and 7, wherein the first nucleic acid sequence encoding the shRNA is the only sequence for expression.
[0486] All of the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet are incorporated herein by reference, in their entirety. Aspects of the embodiments can be modified, if necessary, to employ concepts of the various patents, applications and publications to provide yet further embodiments.
[0487] Although the present disclosure has been described with reference to a number of illustrative embodiments, it should be understood that numerous other modifications and embodiments can be devised by those skilled in the art that will fall within the spirit and scope of the principles of this disclosure. More particularly, reasonable variations and modifications are possible in the component parts and/or arrangements of the subject combination arrangement within the scope of the foregoing disclosure, the drawings, and the appended claims without departing from the spirit of the disclosure. In addition to variations and modifications in the component parts and/or arrangements, alternative uses will also be apparent to those skilled in the art.