SCREENING MODEL AND METHOD FOR HBV CCCDNA-TARGETING DRUG

20230323369 · 2023-10-12

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention belongs to the field of virology, in particular to the field of hepatitis B virus treatment. Provided are a model and a method for screening HBV cccDNA inhibitors. According to the screening model and the method, the detection of a split luciferase is used as an alternative index ofHBV cccDNA detection, and a cccDNA-targeted drug can be screened in high throughput.

Claims

1. An isolated nucleic acid molecule, which comprises a variant of HBV genome sequence, wherein the variant comprises: a HBV genome fragment comprising C-ORF, S-ORF and P-ORF, the C-ORF comprises an exogenous insertion sequence between precore and core genes, and the exogenous insertion sequence comprises a nucleotide sequence encoding a first fragment of luciferase; the first fragment of luciferase is capable of binding to a corresponding second fragment of luciferase of a luciferase fragment complementation assay (LFCA), and thereby generating luciferase activity.

2. The isolated nucleic acid molecule according to claim 1, wherein the HBV genome fragment further comprises an X-ORF.

3. The isolated nucleic acid molecule according to claim 1 or 2, wherein the variant comprises the exogenous insertion sequence between the precore and core genes of the HBV genome sequence.

4. The isolated nucleic acid molecule according to any one of claims 1 to 3, wherein the first fragment of luciferase is a complementary small fragment capable of binding to LgBiT, such as HiBiT or SmBiT; the second fragment of luciferase is LgBiT; preferably, the first fragment of luciferase is HiBiT and the second fragment of luciferase is LgBiT.

5. The isolated nucleic acid molecule according to claim 4, wherein the exogenous insertion sequence comprises multiple copies of the nucleotide sequence encoding the first fragment of luciferase (e.g., HiBiT) in tandem repeats; preferably, the exogenous insertion sequence comprises three copies of the nucleotide sequence encoding the first fragment of luciferase (e.g., HiBiT) in tandem repeats.

6. The isolated nucleic acid molecule according to claim 5, wherein each copy of the multiple copies of the nucleotide sequence encoding the first fragment of luciferase (e.g., HiBiT) in tandem repeats comprises at its 5′-end a sequence encoding a linker peptide (e.g., a flexible peptide linker).

7. The isolated nucleic acid molecule according to claim 1, wherein the exogenous insertion sequence comprises the sequence set forth in SEQ ID NO:4.

8. The isolated nucleic acid molecule according to any one of claims 1 to 7, wherein the HBV genome is a full-length genome, or an overlength genome, such as a 1.1-fold genome or a 1.3-fold genome; preferably, the HBV genome comprises the sequence set forth in SEQ ID NO: 1.

9. The isolated nucleic acid molecule according to any one of claims 1 to 8, which further comprises an inducible promoter operably linked to the exogenous insertion sequence; preferably, the inducible promoter is a TRE3G promoter, or comprises one or more repeats of Tet operator sequence (TetO); preferably, the inducible promoter has bidirectional activation activity, for example is a TRE3G promoter with bidirectional activation activity.

10. The isolated nucleic acid molecule according to claim 9, wherein the isolated nucleic acid molecule further comprises a reporter gene operably linked to the inducible promoter; preferably, the reporter gene is in the opposite direction to the exogenous insertion sequence; preferably, the reporter gene is selected from fluorescent protein genes (e.g., iRFP) and/or antibiotic resistance genes (e.g., Blasticidin); preferably, the reporter gene comprises a fluorescent protein gene and an antibiotic resistance gene; preferably, the fluorescent protein gene and the antibiotic resistance gene are optionally linked by a nucleotide sequence encoding a self-cleaving peptide (e.g., P2A, E2A, F2A or T2A).

11. The isolated nucleic acid molecule according to claim 9 or 10, wherein the isolated nucleic acid molecule comprises the sequence set forth in SEQ ID NO:8.

12. A recombinant HBV cccDNA, which comprises the isolated nucleic acid molecule according to any one of claims 1 to 11; preferably, the recombinant HBV cccDNA comprises the variant of HBV genome sequence as defined in any one of claims 1 to 11; preferably, the recombinant HBV cccDNA is formed by circularization of the isolated nucleic acid molecule according to any one of claims 1 to 11.

13. An expression system, which comprises the isolated nucleic acid molecule according to any one of claims 9 to 11 as a first nucleic acid sequence, and comprises a second nucleic acid sequence, wherein the second nucleic acid sequence comprises a nucleotide sequence coding a transactivator corresponding to the inducible promoter contained in the first nucleic acid sequence; preferably, the transactivator is selected from Tet-On 3G transactivator, rTetR, rtTA; preferably, the second nucleic acid sequence further comprises an expression control element, such as a promoter (e.g., a constitutive promoter) and/or an enhancer, that is operably linked to the nucleotide sequence encoding the transactivator.

14. The expression system according to claim 13, wherein the first nucleic acid sequence comprises a TRE3G promoter as an inducible promoter, and the second nucleic acid sequence comprises a nucleotide sequence encoding a Tet-On 3G transactivator; preferably, the TRE3G promoter comprises the sequence set forth in SEQ ID NO:5; preferably, the nucleotide sequence encoding the Tet-On 3G transactivator comprises the sequence set forth in SEQ ID NO: 10.

15. A vector, which comprises the isolated nucleic acid molecule according to any one of claims 1 to 11, or the expression system according to claim 13 or 14.

16. The vector according to claim 15, wherein the vector comprises the expression system according to claim 13 or 14, wherein the first nucleic acid sequence and the second nucleic acid sequence are provided on the same or different vectors; preferably, the first nucleic acid sequence and the second nucleic acid sequence are provided on the same vector.

17. The vector according to claim 15 or 16, wherein the vector is a transposon vector, such as a PiggyBac transposon vector; preferably, the first nucleic acid sequence and the second nucleic acid sequence are located between the two ITR sequences of the transposon vector.

18. A co-transfection system, which comprises the vector according to any one of claims 15 to 17, and a transposase expression vector; preferably, the transposase expression vector is a PiggyBac transposase expression vector.

19. A host cell, which comprises the isolated nucleic acid molecule according to any one of claims 1 to 11, or the recombinant cccDNA according to claim 12, or the expression system according to claim 13 or 14, or the vector according to any one of claims 15 to 17, or the co-transfection system according to claim 18; preferably, the host cell is selected from eukaryotic cells derived from hepatocyte, such as hepatoma cell or hepatocyte; preferably, the host cell is selected from HepaRG, HepG2 or Huh7.

20. The host cell according to claim 19, wherein the host cell comprises the expression system according to claim 13 or 14 in its genome; preferably, the host cell is capable of stably expressing an HBV cccDNA formed from the variant of HBV genome sequence in the presence of an inducer (e.g., Doxycycline) corresponding to the inducible promoter and transactivator.

21. A kit, which comprises the isolated nucleic acid molecule according to any one of claims 1 to 11, or the expression system according to any one of claims 13 or 14, or the vector according to any one of claims 15 to 17, or the co-transfection system according to claim 18, or the host cell according to claim 19 or 20; preferably, the kit comprises: the vector according to any one of claims 15 to 17, or the co-transfection system according to claim 18; preferably, the kit comprises: the host cell according to claim 19 or 20; preferably, the kit further comprises a LgBiT protein and optionally a luciferase substrate; preferably, the kit further comprises an inducer (e.g., Doxycycline) corresponding to the inducible promoter and transactivator.

22. A method for screening a HBV cccDNA inhibitor, which comprises: (1) providing the host cell according to claim 20; (2) contacting an inducing agent with the host cell, wherein the inducing agent is an inducer (e.g., Doxycycline) corresponding to the inducible promoter and transactivator contained in the host cell; (3) contacting a test agent with the host cell; wherein, steps (2) and (3) can be performed simultaneously or in any order; (4) detecting a level of the first fragment of luciferase in a cell supernatant of the host cell.

23. The method according to claim 22, wherein, step (1) comprises the following steps: (1a) introducing the first nucleotide sequence and the second nucleotide sequence in the expression system according to claim 13 or 14 into the host cell, wherein the first nucleotide sequence and the second nucleotide sequence are provided on the same or different expression vectors, and the first nucleic acid sequence is the isolated nucleic acid molecule according to any one of claims 9 to 11; (1b) culturing the host cell; preferably, the host cell is selected from eukaryotic cells derived from hepatocytes, such as hepatoma cell or hepatocyte; preferably, the host cell is selected from HepaRG, HepG2 or Huh7; preferably, in step (1a), the expression vector is a transposon vector (e.g., PiggyBac transposon vector), and the step further comprises: introducing a transposase expression vector (e.g., PiggyBac transposase expression vector) into the host cell; preferably, the step (1) further comprises: (1c) identifying and selecting a host cell with the expression system according to claim 13 or 14 integrated in its genome; preferably, whether the expression system has been integrated into the genome of the host cell is identified by detecting a reporter gene contained in the first nucleic acid sequence.

24. The method according to claim 22 or 23, wherein, in step (4), the level of the first fragment of luciferase is detected by a luciferase fragment complementation assay; preferably, the detection is carried out with a second fragment of luciferase that is complementary to the first fragment of luciferase; preferably, the first fragment of luciferase is a complementary small fragment capable of binding to LgBiT, such as HiBiT or SmBiT, and the second fragment of luciferase is a LgBiT protein; preferably, the first fragment of luciferase is HiBiT, and the second fragment of luciferase is the LgBiT protein.

25. The method according to any one of claims 22 to 24, which further comprises the steps of: (5) comparing the detection result of step (4) with the level of the first fragment of luciferase detected in the absence of the test agent; wherein, if the detection result in step (4) is lower than the detection result in the absence of the test agent, it indicates that the test agent is an HBV cccDNA inhibitor.

26. An isolated nucleic acid molecule, which comprises a variant of HBV genome sequence, the variant comprising from the 5′ to 3′: (i) a nucleotide sequence encoding a first fragment of luciferase; the first fragment of luciferase is capable of binding to a corresponding second fragment of luciferase of a luciferase fragment complementation assay (LFCA), thereby producing a luciferase activity; (ii) a sequence of the 3′ end region of C-ORF of HBV genome; (iii) an HBV genome fragment containing S-ORF and P-ORF; (iv) a sequence of the 5′ end region of C-ORF of HBV genome, which can form a complete C-ORF sequence with the sequence described in (ii); and, the variant is located between two site-specific recombinase recognition sequences arranged in the same orientation.

27. The isolated nucleic acid molecule according to claim 26, wherein the HBV genome is a full-length genome, or an overlength genome, such as a 1.1-fold genome or a 1.3-fold genome; preferably, the HBV genome comprises the sequence set forth in SEQ ID NO: 1.

28. The isolated nucleic acid molecule according to claim 26 or 27, wherein the sequence of (iii) further comprises an X-ORF; preferably, the sequence of (iii) comprises a HBV genome fragment from which C-ORF is removed; preferably, the sequence of (iii) comprises the sequence set forth in SEQ ID NO: 16.

29. The isolated nucleic acid molecule according to any one of claims 26 to 28, wherein the sequence of (ii) comprises a core gene, and the sequence of (iv) comprises a pre-core gene; preferably, the sequence of (ii) comprises the sequence set forth in SEQ ID NO: 14; preferably, the sequence of (iv) comprises the sequence set forth in SEQ ID NO: 15.

30. The isolated nucleic acid molecule according to any one of claims 26 to 29, wherein the site-specific recombinase recognition sequences are selected from a loxP sequence or a FRT sequence.

31. The isolated nucleic acid molecule according to claims 26 to 30, wherein the first fragment of luciferase is a complementary small fragment capable of binding to LgBiT, such as HiBiT or SmBiT, and the second fragment of luciferase is LgBiT; preferably, the first fragment of luciferase is HiBiT and the second fragment of luciferase is LgBiT.

32. The isolated nucleic acid molecule according to any one of claims 26 to 31, which comprises the sequence set forth in SEQ ID NO: 17.

33. A recombinant HBV cccDNA, which is formed by circularization of the variant of HBV genome sequence in the isolated nucleic acid molecule according to any one of claims 26 to 32; preferably, the recombinant HBV cccDNA is formed by circularization of the isolated nucleic acid molecule according to any one of claims 26 to 32 in the presence of a site-specific recombinase (e.g., Cre recombinase or FLP recombinase) corresponding to the site-specific recombinase recognition sequence; preferably, the recombinant HBV cccDNA comprises C-ORF, S-ORF, P-ORF, and the C-ORF comprises a nucleotide sequence encoding the first fragment of luciferase (e.g., HiBiT); preferably, the recombinant HBV cccDNA further comprises an X-ORF; Preferably, the recombinant HBV cccDNA comprises: a C-ORF comprising a nucleotide sequence encoding the first fragment of luciferase (e.g., HiBiT), and a HBV genome fragment from which the C-ORF has been removed; preferably, the recombinant cccDNA comprises the sequence set forth in SEQ ID NO: 18.

34. A vector, which comprises the isolated nucleic acid molecule according to any one of claims 26 to 32.

35. The vector according to claim 34, which is a transposon vector, such as a PiggyBac transposon vector; preferably, the isolated nucleic acid molecule is located between the two ITR sequences of the transposon vector.

36. A co-transfection system, which comprises the vector according to claim 35, and a transposase expression vector; preferably, the transposase expression vector is a PiggyBac transposase expression vector.

37. A host cell, which comprises the isolated nucleic acid molecule according to any one of claims 26 to 32, or the recombinant cccDNA according to claim 33, or the vector according to claim 34 or 35, or the co-transfection system according to claim 36; preferably, the host cell is selected from eukaryotic cells derived from hepatocyte, such as hepatoma cell or hepatocyte; preferably, the host cell is selected from HepaRG, HepG2 or Huh7.

38. The host cell according to claim 37, wherein the host cell comprises the isolated nucleic acid molecule according to any one of claims 26 to 32 in its genome; preferably, the host cell is capable of stably expressing the recombinant HBV cccDNA formed by circularization of the variant of HBV genome sequence in the presence of a site-specific recombinase (e.g., Cre recombinase or FLP recombinase) corresponding to the site-specific recombinase recognition sequence.

39. A kit, which comprises the isolated nucleic acid molecule according to any one of claims 26 to 32, or the recombinant cccDNA according to claim 33, or the vector according to claim 34 or 35, or the co-transfection system according to claim 36, or the host cell according to claim 37 or 38; preferably, the kit comprises: the vector according to claim 34 or 35, or the co-transfection system according to claim 36; preferably, the kit comprises: the host cell according to claim 37 or 38; preferably, the kit further comprises a LgBiT protein and optionally a luciferase substrate; preferably, the kit further comprises a recombinase (e.g., Cre recombinase or FLP recombinase) or a recombinase (e.g., Cre recombinase or FLP recombinase) expression vector.

40. A method for screening an HBV cccDNA inhibitor, comprising: (1) providing the host cell according to claim 38; (2) introducing a recombinase or a recombinase expression vector into the host cell, wherein the recombinase corresponds to the site-specific recombinase recognition sequence contained in the host cell; (3) contacting a test agent with the host cell; (4) detecting a level of the first fragment of luciferase in a cell supernatant of the host cell.

41. The method according to claim 40, wherein step (1) comprises the steps of: (1a) introducing the isolated nucleic acid molecule according to any one of claims 26 to 32 or the vector according to claim 34 or 35 into the host cell; (1b) culturing the host cell; preferably, the host cell is selected from eukaryotic cells derived from hepatocyte, such as hepatoma cell or hepatocyte; preferably, the host cell is selected from HepaRG, HepG2 or Huh7; preferably, in step (1a), the expression vector is a transposon vector (e.g., PiggyBac transposon vector), and the step further comprises: introducing a transposase expression vector (e.g., PiggyBac transposase expression vector) into the host cell.

42. The method according to claim 40 or 41, wherein, in step (4), the level of the first fragment of luciferase is detected by a luciferase fragment complementation assay; preferably, the detection is performed with a second fragment of luciferase that is complementary to the first fragment of luciferase; preferably, the first fragment of luciferase is a complementary small fragment capable of binding to LgBiT, such as HiBiT or SmBiT, and the second fragment of luciferase is a LgBiT protein; preferably, the first fragment of luciferase is HiBiT, the second fragment of luciferase is the LgBiT protein.

43. The method according to any one of claims 40 to 42, which further comprises the steps of: (5) comparing the detection result of step (4) with a level of the first fragment of luciferase detected in the absence of the test agent; wherein, if the detection result in step (4) is lower than the detection result in the absence of the test agent, it indicates that the test agent is an HBV cccDNA inhibitor.

44. Use of the isolated nucleic acid molecule according to any one of claims 1 to 11, or the expression system according to claim 13 or 14, or the vector according to any one of claims 15 to 17, or the co-transfection system according to claim 18, or the host cell according to claim 19 or 20, or the kit according to claim 21, or the isolated nucleic acid molecule according to any one of claims 26 to 32, or the recombinant cccDNA according to claim 33, or the vector according to claim 34 or 35, or the co-transfection system according to claim 36, or the host cell according to claim 37 or 38, or the kit according to claim 39, for screening an HBV cccDNA inhibitor.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0142] FIG. 1 shows the schematic diagram of PiggyBac transposon vector used for the construction of stable integration cell lines in Example 1.

[0143] FIG. 2 shows a schematic diagram of the HBV modification of the reporter model in which cccDNA generated during HBV replication process is indicated by HiBiT in Example 1.

[0144] FIG. 3 shows the viral replication and expression of HBV variant integrated with HiBiT tags of different sequences as assessed in Example 1.

[0145] FIG. 4 shows the evaluation of RG-Hibit16 cells for screening inhibitors that inhibit HBV cccDNA formation in Example 1.

[0146] FIG. 5 shows the schematic diagram and functional verification of HiBiT as the rcccDNA reporter model in Example 2.

[0147] FIG. 6 shows the screening of compounds targeting HBV cccDNA using RG-Hibit16 and G2-Rcccl in Example 3.

[0148] FIG. 7 shows verification of compounds with inhibitory effect on HBV cccDNA in the HepG2-hNTCP-2B1 infection model in Example 3.

[0149] FIG. 8 shows verification of compounds with promoting effect on HBV cccDNA in the HepG2-hNTCP-2B1 infection model in Example 3.

SEQUENCE INFORMATION

[0150] The information on the partial sequences involved in the present invention is provided as follows.

TABLE-US-00001 SEQ ID NO Description 1 HBV 1.1-fold genome sequence 2 Amino acid sequence of HiBiT 3 Nucleotide sequence of HiBiT 4 Hibit16 insertion sequence 5 TRE3G promoter 6 Amino acid sequence of P2A 7 Nucleotide sequence of P2A 8 HBV genome variant sequence containing Hibit16 9 Amino acid sequence of Tet-On 3G 10 Nucleotide sequence of Tet-On 3G 11 Amino acid sequence of iRFP 12 Nucleotide sequence of iRFP 13 Blasticidin-resistant gene 14 Rcccla Sequence of 3′ end region of C-ORF of HBV genome 15 Rcccla Sequence of 5′ end region of C-ORF of HBV genome 16 Rcccla Sequence of HBV genome fragment in which C-ORF is removed 17 Rcccla linear replicon sequence 18 Rcccla recombinant cccDNA sequence 19 loxP sequence 20 Amino acid sequence of Cre recombinase 21 Nucleotide sequence of Cre recombinase 22-30 Primers, probes

EXAMPLES

[0151] The present invention will now be described with reference to the following examples, which are intended to illustrate, but not limit, the present invention.

[0152] Unless otherwise specified, the molecular biology experimental methods and immunoassays used in the present invention are performed by basically referring to the methods described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, 1989, and F. M. Ausubel et al., Refined Molecular Biology Laboratory Manual, 3rd Edition, John Wiley & Sons, Inc., 1995; and the restriction enzymes were used according to the conditions recommended by the product manufacturer. Those skilled in the art appreciate that the examples describe the present invention by way of example and are not intended to limit the scope of the invention as claimed.

[0153] The main detection methods involved in the following examples are described as follows:

[0154] Detection of HiBiT: Nano Glo HiBiT Extracellular Detection System (Cat. No. N2421) of Promega Corporation was used for HiBiT detection, and the detection steps were carried out according to the kit instructions.

[0155] Detection of HBsAg/HBeAg: The detection procedures of hepatitis B surface antigen (chemiluminescence method CLEIA, product standard number: YZB/Guo 0346-2014) and e antigen (enzyme-linked immunosorbent assay ELISA, product standard number: YZB/Guo 0216-2013) were both carried out according to the detection methods of the kits of Beijing Wantai Company.

[0156] Detection of HBV DNA: For the HBV DNA extraction, after the collected cells were washed with PBS, the virus DNA & RNA extraction kit (Beijing GenMagBio) was used for automatic extraction at the nucleic acid extraction workstation. For the HBV DNA quantification, Premix Ex TaqTM (Takara) was used for the probe method, with the instrument of Roche’s LightCycler® 96, and the primer sequences used are shown in Table 1.

TABLE-US-00002 PCR primer sequences Primer Sequence (5′-3′) SEQ ID NO: HBV-F TTTCACCTCTGCCTAATCAT 22 HBV-R TCAGAAGGCAAAAAAGAGAGTAACTC 23 HBV-Probe HEX-CCTTGGGTGGCTTTGGGGCATGGA-BHQ1 24 cccDNA-Probe FAM-ACCGTGAACGCCCACCGAATGTTGC-BHQ1 25 cccDNA-F TGCACTTCGCTTCACCT 26 cccDNA-R AGGGGCATTTGGTGGTC 27 mt4987F CCCAGCTACGCAAAAT 28 mt5106R AATGCGGTAGTAGTTAGGATA 29 mt5010-Probe HEX-CATACTCCTCAATTACCCACATAG-BHQ1 30

[0157] Detection of HBV cccDNA: The modified Hirt method was used for HBV cccDNA extraction, with Tiangen Plasmid Mini Kit. The lysis buffers involved were Buffer I (50 mM Tris, 10 mM EDTA, pH 7.5), Buffer II (1.2 % SDS), Buffer III (3 M CsCl, 1 M potassium acetate, 0.67 M acetic acid), which were used to replace P1, P2 and P3 in the Tiangen Plasmid Mini Kit respectively. The extraction steps and methods were performed by referring to the plasmid extraction method of the kit. The primers used for fluorescence quantification are shown in Table 1. The instrument used is Roche’s LightCycler® 96. HBV cccDNA and mitochondrial DNA (mtDNA) were quantified respectively, and the relative values of HBV cccDNA and mtDNA were calculated.

[0158] The steps for the detection of HBV DNA by DNA immunoblotting were as follows. DNA extraction: cells were washed once with PBS after treatment; NET Buffer (50 mM Tris-pH8.0, ImM EDTA, 100 mM NaCl, 0.5% NP-40) was added to lyse the cells at 4° C. for 1 h; the cell lysate supernatant was collected, added with 33 .Math.g/mL Micrococcal nuclease and 6 mM CaCl.sub.2 at final concentration, and allowed to stay in 37° C. water bath for 30 minutes; added with 25 mM EDTA at final concentration, and allowed to stay in 65° C. water bath for 15 minutes; added with 200 .Math.g/mL proteinase K and 0.5% SDS at final concentration, and allowed to stay in 50° C. water bath for 12 h; and DNA was extracted with phenol chloroform. Detection: DNA was separated by electrophoresis on 1.2% agarose for 2 h, then the gel was treated with 0.2N HCl, 0.5 M NaOH/1.5 M NaCl and 1 M Tris-HCl in turn to denature the DNA, and then the nucleic acid was transferred to nylon membrane by a vacuum blotter. The nucleic acid was fixed by UV cross-linking, then subjected to pre-hybridization and hybridization, excess probes were washed off, blocking solution was added for blocking, then Anti-Dig-Ap antibody was added, CDP-star was finally added to develop color, and the target strip was detected by continuous exposure.

Example 1: Construction of Reporter Model Using HiBiT to Indicate cccDNA Produced During HBV Replication

[0159] The PB-CMV-MCS-EF1α-RedPuro (Cat.#PB514B-1) of the PiggyBac transposon system was used as a vector in this example; when the vector was co-transfected with PiggyBac transposase (System Biosciences, PB210PA-1), the sequence between the two “ITR sequences” on the vector plasmid could be integrated into the genome of the cell to achieve the integration of the target gene. In order to achieve the regulatory expression of HBV, we replaced the “CMV Promoter” on the vector with “TRE3G Promoter” (Takara, Tet-On 3G Inducible Expression System), the promoter required Doxycycline combined with Tet-On 3G Transactivator to start transcription, so the expression of the target protein could be regulated with Doxycycline. In order to avoid the loss of part of the target sequence during integration, we selected the TRE3G promoter with bidirectional promotion activity, introduced iRFP fluorescent marker and Blasticidin resistance selection marker at the N-terminus, and used dual resistance and dual fluorescence as the screening conditions of integrated cells. Since the Tet-On 3G protein was necessary for the transcription of TRE3G promoter, we introduced an expression cassette into the vector to express the Tet-On 3G protein. The final vector is shown in FIG. 1, in which the sequence in the red dashed box is the sequence integrated into the cell genome. “GOI” represents the ligated target gene (Gene of interest), and the ligated sequence in this example is the HBV 1.1-fold genome sequence into which the reporter gene is inserted.

[0160] The open reading frames of the HBV genome are highly overlapping, so the modification of HBV has strict restrictions on the insertion position of foreign genes. In this example, HiBiT sequences with different copy numbers and connected by different linker peptides were inserted between the pre core and the core to prepare HBV variants containing HiBiT. The schematic diagram of the insertion is shown in FIG. 2. The HiBiT signal, viral protein expression and viral replication of these insertion mutations were verified. Different HBV variants were transfected in hepatoma cell lines HepG2 and Huh7, respectively, the HiBiT signal, the expression of HBV antigens HBsAg and HBeAg (A) in the cell supernatant were detected, and the viral replication (B) was detected by Southern Blot, and the results were shown in FIG. 3. It could be seen that Hibit16, i.e., insertion mutation (SEQ ID NO: 4) with insertion of 3 copies of HiBiT tag, was a better choice; a decrease in HiBiT copy number might result in weak HiBiT signal, while an increase in the HiBiT copy number might affect the expression or replication of viral proteins. For the comparison of different linker peptides, insertion of the peptide “GSG” before and after the HiBiT sequence was better than insertion of the peptide “G” at one end or introduction of no linker peptide. Therefore, in this example, HepaRG cells stably integrated with HBV variant Hibit16 were constructed to screen for inhibitors that could inhibit the formation of cccDNA.

[0161] HepaRG-Hibit16 cells were obtained by transfecting HepaRG cells with Hibit16 plasmid and PiggyBac transposase, integrating the HBV variant sequence (Hibit16) and selection markers into the genome of the cells, and screened by puromycin resistance and red fluorescent marker; Doxycycline could activate TRE3G promoter to initiate the expression of iRFP670, as well as the transcription and replication of HBV, thereby generating HiBiT, as shown in FIG. 4A. To evaluate the function of HBV inhibitors in the cells, the cells were first plated, and Doxycycline was added to induce viral transcription and replication while different HBV inhibitors were added for intervention. The cell supernatant was collected every 2 days, the medium was replaced, and the HiBiT signal, HBsAg, HBeAg in the cell supernatant, and the HBV DNA and HBV cccDNA in the cell lysate were detected, and the responses of the cells to HBV inhibitors were shown in FIGS. 4B-F. Tenofovir (tenofovir disoproxil fumarate, TDF) is a nucleotide reverse transcriptase inhibitor, and Morphothiadin (abbreviation: Mor) is an assembly regulator of core particles, which are already in the clinical Phase II/III evaluation stage, and both can inhibit the formation of cccDNA. In the cell model constructed in this study, TDF and Mor could inhibit the formation of cccDNA, and the expression level of HiBiT in the Mor-treatment group was significantly lower than that in the control group, indicating that this model could be used to screen for inhibitors such as Mor that inhibited the formation of cccDNA.

Example 2: Construction of Reporter Model for Recombinant rcccDNA Indicated by HiBiT

[0162] In this example, a reporter model using HiBiT to indicate recombinant cccDNA was constructed. Recombinant cccDNA, i.e., rcccDNA, was a closed circular DNA formed by circularizing linear HBV DNA by Cre/loxP recombinase system. We constructed the HBV variant shown in FIG. 5A, in which the C-terminal partial sequence of the HBV core ORF (SEQ ID NO: 14) was placed at the N-terminal of the entire replicon, while the N-terminal partial sequence of the core ORF and the promoter of core (SEQ ID NO: 15) was placed at the C-terminus of the replicon, the sequence of the reporter gene HiBiT was placed at the N-terminus of the replicon, and the loxP sequence (SEQ ID NO: 19) was added before and after the replicon. Without the expression of Cre recombinase, HiBiT lacked a promoter and could not be expressed, but after the formation of rcccDNA, HiBiT could use the promoter of core to express HBeAg and HBcAg fused with the HiBiT tag. Therefore HiBiT could be used as a surrogate marker for rcccDNA detection. The HBV variant used the PiggyBac transposon system as vector, which facilitated the integration of the target gene, that was, the HBV variant with the integrated reporter gene, into the cell genome to construct an integrated cell line, and the clone was named as Rccc1a. The plasmid was transfected into HepG2 cells, after 6 h, the medium was changed for infection with adenovirus Adv-Cre to express Cre recombinase (SEQ ID NO: 20), and HiBiT in the cell supernatant was detected after 48 h; the cells were lysed, the partial sequences of rcccDNA before and after the loxP sequence were amplified by using the lysate as template, to verify whether the expected rcccDNA was formed, and the amplification primers and sequencing primers both were cccDNA-F and cccDNA-R in Table 1. FIG. 5B showed the HiBiT detection results in the cell supernatants of the HepG2 cells transfected with Rccc1a with or without Cre recombinase expression, and FIG. 5C showed the sequencing results of rcccDNA formed after expression of Cre recombinase of HepG2 cells transfected with Rccc1a. The above results showed that Cre recombinase could make the expected rcccDNA to be generated, and initiate the expression of the protein with HiBiT tag.

Example 3: Application of Reporter Model for Screening cccDNA Inhibitors

[0163] The reporter model prepared in Example 1 comprised an HBV variant integrated with 3 repeats of HiBiT sequence. The mRNA transcribed directly from the HBV variant as a template lacked the initiation codon for HiBiT expression, and could not translate the protein attached to the HiBiT tag. Only after the pgRNA transcribed from the HBV variant was reversely transcribed to form cccDNA, the mRNA transcribed from cccDNA as a template could translate the protein attached to the HiBiT tag, so the expression level of HiBiT could be used to indicate the formation of HBV cccDNA. In the reporter model prepared in Example 2, the HiBiT sequence was inserted in the middle of the HBV core sequence, the N-terminus sequence and C-terminus sequence of the core were respectively attached to the C-terminus and N-terminus of the HBV replicon, and loxP sequences were ligated to both ends of the HBV replicon, so that in the absence of Cre recombinase expression, the HiBiT tag lacked a promoter and could not be expressed; but with the expression of Cre recombinase, it could mediate the recombination of double-stranded DNA, so that the linear HBV genome DNA formed a closed circular DNA, and after the circular DNA was formed, the HiBiT tag could use the endogenous promoter of HBV to initiate the expression of the protein attached to the HiBiT tag, so the signal of the HiBiT tag could be used to indicate the formation of recombinant HBV cccDNA, i.e., HBV rcccDNA.

[0164] In this example, the reporter model of Example 1 (HepaRG-Hibit16 integrated with Hibit16 constructed based on HepaRG cells) and the reporter model of Example 2 (HepG2-Rccc1a integrated with Rccc1a constructed based on HepG2) were investigated for screening cccDNA inhibitors. These two cells were used to evaluate the potential of 189 drugs to inhibit cccDNA, including clinical drugs for different diseases or drugs in the clinical research stage. The screening work was carried out in a 96-well cell culture plate, RG-Hibit16 cells were plated at a cell density of 15,000/well, and G2-Rcccla cells were plated at a cell density of 35,000/well. RG-Hibit16 cells were treated with drugs 1 week after plating. For RG-Hibit16, different compounds were added for treatment when Dox was added to induce virus expression; the next day after G2-Rccc1a cells were plated, they were firstly infected with adenovirus Adv-Cre to express Cre recombinase protein, and different compounds were added 2 days later for treatment, and all compounds were diluted to 1 .Math.M at the final concentration, 200 .Math.L per well; new medium was replaced every 2 days, the expression of HiBiT in the cell supernatant was detected after 4 days of compound treatment, and CCK8 detection reagent was added at a ratio of 10:1 to detect the cytotoxicity of the compounds. The results of using RG-Hibit16 cells and G2-Rcccla cells in the compound screening were shown in FIG. 6. Among the 189 compounds, the 3 compounds that most significantly inhibited the expression level of HiBiT in RG-Hibit16 cells were Cetylpyridinium, Guanfacine and Palovarotene; the 4 compounds that most significantly inhibited the expression level of HiBiT in G2-Rccc1a cells were Crizotinib, Doxifluridine, Palovarotene and Dithranol; and these 6 drugs had no obvious cytotoxicity to the two kinds of cells according to the detection results of CCK8. Palovarotene showed the inhibitory effect on HBV cccDNA in both models.

[0165] We further verified the functions of these 6 compounds in the HepG2-hNTCP-2B1 infection model. HepG2-hNTCP-2B1 was the single clone 2B1 selected for the highest susceptibility to HBV which is made by overexpressing hNTCP in HepG2 cells. In the evaluation by this model, the cells were firstly infected with HBV virus, washed with PBS to remove the residual virus on the next day, different compounds were added after 2 days, and then the cell supernatant was collected and fresh medium was replaced every 2 days, the viral antigen in the cell supernatant was detected, the cells were lysed after 8 days of infection, the intracellular HBV cccDNA was detected, and the evaluation results were shown in FIG. 7. The inhibitory effect of Palovarotene on HBsAg was relatively poor, but the inhibition rates against HBsAg and HBV cccDNA were all more than 60%, which were better than the other five compounds. In addition, Doxifluridine also had a significant inhibitory effect on cccDNA in this infection model. According to the evaluation results of RG-Hibit16 cells and G2-Rcccla cells, we also selected 5 compounds that had up-regulated effects on HBV cccDNA in both models, namely: Vincristine, Naftopidil, Cinchophen, Mebhydrolin and Cladribine. The functions of these five compounds were verified in the HepG2-hNTCP-2B1 infection model, and the evaluation strategy was the same as that of the aforementioned inhibitor. The results are shown in FIG. 8. The five compounds had weak promotion effect on HBeAg; Vincristine and Cladribine could significantly up-regulate the expression level of HBsAg; and Vincristine, Cinchophen, Mebhydrolin and Cladribine could up-regulate the intracellular cccDNA level. The verification results of the infection model showed that the two cccDNA reporter models constructed in this study could be used to screen compounds that could promote or inhibit cccDNA. Although some of the compounds screened did not show corresponding effects in the infection model, the range of candidate compounds was greatly reduced, so that they could be used for preliminary screening of compounds targeting HBV cccDNA.

[0166] Although specific embodiments of the present invention have been described in detail, those skilled in the art will appreciate that various modifications and changes can be made to the details in light of all the teachings that have been published, and that these changes are all within the scope of the present invention. The full division of the invention is given by the appended claims and any equivalents thereof.