Biosynthesis of polyketides

Abstract

This disclosure generally relates to the use of microorganisms to make various functionalized polyketides through polyketoacyl-CoA thiolase-catalyzed non-decarboxylative condensation reactions instead of decarboxylative reactions catalyzed by polyketide synthases. Native or engineered polyketoacyl-CoA thiolases catalyze the non-decarboxylative Claisen condensation in an iterative manner (i.e. multiple rounds) between two either unsubstituted or functionalized ketoacyl-CoAs (and polyketoacyl-CoAs) serving as the primers and acyl-CoAs serving as the extender unit to generate (and elongate) polyketoacyl-CoAs. Before the next round of polyketoacyl-CoA thiolase reaction, the β-keto group of the polyketide chain of polyketoacyl-CoA can be reduced and modified step-wise by 3-OH-polyketoacyl-CoA dehydrogenase or polyketoenoyl-CoA hydratase or polyketoenoyl-CoA reductase. Dehydrogenase converts the β-keto group to β-hydroxy group. Hydratase converts the β-hydroxy group to α-β-double-bond. Reductase converts the α-β-double-bond to single bond. Spontaneous or thioesterase catalyzed termination reaction terminates the elongation of polyketide chain of polyketoacyl-CoA at any point through CoA removal and spontaneous reactions rearrange the structure, generating the final functional polyketide products.

Claims

1. A method of making a polyketide, comprising growing a genetically engineered microorganism in a nutrient broth for a time sufficient to produce a polyketide and isolating said polyketide or a spontaneously rearranged form of said polyketide or a derivative of said polyketide, said polyketide selected from triacetic acid lactone, dehydroacetic acid, olivetolic acid, orsellinic acid, or 6-methylsalicylic acid and said derivative of said polyketide is a prenylated aromatic, or a cannabinoid, or dehydroacetic acid, or olivetolic acid, or cannabigerolic acid, or orsellinic acid, or 6-methylsalicylic acid, wherein said microorganism has a polyketide-producing pathway comprising the following substrate(s) to product(s) conversions: a) C(n)-acyl-CoA+acetyl-CoA.fwdarw.C(n+2)-ketoacyl-CoA catalyzed by a ketoacyl-CoA thiolase encoded by Streptomyces collinus fadA, Rhodococcus opacus pcaF, Pseudomonas putida pcaF, Streptomyces sp. pcaF, P. putida fadAx, P. putida fadA, Acinetobacter sp. ADP1 dcaF, or Ralstonia eutropha bktB; b) C(n+2)-ketoacyl-CoA+acetyl-CoA.fwdarw.C(n+4)-polyketoacyl-CoA catalyzed by a polyketoacyl-CoA thiolase encoded by Streptomyces collinus fadA, Rhodococcus opacus pcaF, Pseudomonas putida pcaF, Streptomyces sp. pcaF, P. putida fadAx, P. putida fadA, Acinetobacter sp. ADP1 dcaF, or Ralstonia eutropha bktB; c) optionally, C(n+4)-polyketoacyl-CoA.fwdarw.3-OH—C(n+4)-polyketoacyl-CoA; d) optionally, 3-OH—C(n+4)-polyketoacyl-CoA.fwdarw.C(n+4)-polyketoenoyl-CoA; and e) optionally, C(n+4)-polyketoenoyl-CoA.fwdarw.C(n+4)-α,β-saturated-polyketoacyl-CoA; f) iterations of at least one of the reactions in steps b), c), d), and e) wherein said iterations are achieved by utilizing a product generated in reactions steps b), c), d), and e), respectively, as a substrates for condensation with acetyl-CoA to elongate said product by two carbons and add a beta-keto group; and g) conversion of said product formed in steps b), c), d), e), or a product formed in step f) to a polyketide or a spontaneously rearranged form of said polyketide or a derivative of said polyketide; wherein n>0 and <30.

2. The method of claim 1, wherein: step f is catalyzed by a polyketoacyl-CoA thiolase.

3. The method of claim 1, wherein: step c is catalyzed by a 3-OH-polyketoacyl-CoA dehydrogenase; or step d is catalyzed by a 3-OH-polyketoacyl-CoA dehydratase; or step e is catalyzed by a polyketoenoyl-CoA reductase; or step g is catalyzed by a thioesterase or takes place spontaneously.

4. The method of claim 3, wherein said thioesterase is encoded by a gene(s) selected from the group consisting of E. coli tesA, E. coli tesB, E. coli yciA, E. coli fadM, E. coli ydiI, E. coli ybgC, E. coli paaI, Mus musculus acot8, Alcanivorax borkumensis tesB2, Fibrobacter succinogenes Fs2108, Prevotella ruminicola Pr655, Prevotella ruminicola Pr1687, Lycopersicon hirsutum glabratum mks2 and homologs with the same catalytic activity.

5. The method of claim 3, wherein said 3-OH-polyketoacyl-CoA dehydrogenase is encoded by a gene(s) selected from the group consisting of E. coli fabG, E. coli fadB, E. coli fadJ, E. coli paaH, P. putida fadB, P. putida fadB2x, Acinetobacter sp. ADP1 dcaH, Ralstonia eutrophus phaB, Clostridium acetobutylicum hbd and homologs with the same catalytic activity.

6. The method of claim 3, wherein said 3-OH-polyketoacyl-CoA dehydratase is encoded by a gene(s) selected from the group consisting of E. coli fabA, E. coli fabZ, E. coli fadB, E. coli fadJ, E. coli paaF, P. putida fadB, P. putida fadB1x, Acinetobacter sp. ADP1 dcaE, Clostridium acetobutylicum crt, Aeromonas caviae phaf and homologs with the same catalytic activity.

7. The method of claim 3, wherein said polyenoylacyl-CoA reductase is encoded by a gene(s) selected from the group consisting of E. coli fadE, E. coli ydiO, Euglena gracilis TER, Treponema denticola TEA, Clostridium acetobutylicum TER, E. coli fabI, Enterococcus faecalis fabK, Bacillus subtilis fabL, Vibrio cholerea fabV and homologs with the same catalytic activity.

8. A method, comprising: a) combining a polyketoacyl-CoA thiolase with acetyl-CoA and an acetoacetyl-CoA primer, or a ketoacyl-CoA primer or a polyketoacyl-CoA primer under conditions sufficient to allow said polyketoacyl-CoA thiolase to perform non-decarboxylative Claisen condensations with said acetyl-CoA and said primer to form a polyketoacyl-CoA product, said polyketoacyl-CoA thiolase encoded by Streptomyces collinus fadA, Rhodococcus opacus pcaF, Pseudomonas putida pcaF, Streptomyces sp. pcaF, P. putida fadAx, P. putida fadA, Acinetobacter sp. ADP1 dcaF, or Ralstonia eutropha bktB; b) hydrolyzing said polyketoacyl-CoA product to form a polyketide or a spontaneous rearrangement form of said polyketide and free Co-A; and c) isolating said polyketide or said spontaneous rearrangement form of said polyketide or a derivative of said polyketide, wherein said derivative of said polyketide is a prenylated aromatic, or a cannabinoid, or dehydroacetic acid, or olivetolic acid, or cannabigerolic acid, or orsellinic acid, or 6-methylsalicylic acid.

9. The method of claim 8, wherein said method is performed in vivo using a genetically engineered microorganism that expresses said polyketoacyl-CoA thiolase.

10. The method of claim 8, wherein said acetyl-CoA is omega functionalized.

11. The method of claim 8, wherein said method is performed in vitro using a purified polyketoacyl-CoA thiolase.

12. The method of claim 1, wherein said microorganism is Escherichia coli.

13. The method of claim 8, wherein said microorganism is Escherichia coli.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1: Biologically important polyketides.

(2) FIG. 2: Olivetol, also known as 5-pentylresorcinol or 5-pentyl-1,3-benzenediol, can be made with the invention, and then prenylated to produce prenylated aromatics (e.g. cannabigerolic acid or CBGA).

(3) FIG. 3A: Synthesis of polyketides through polyketoacyl-CoA thiolase-catalyzed non-decarboxylative Claisen condensations. Thiolases naturally catalyze the condensation between an acyl-CoA thioester, serving as the primer, and another acyl-CoA thioester, serving as the extender unit, forming 3-ketoacyl-CoAs. As demonstrated in this invention, the aforementioned 3-ketoacyl-CoAs can also serve as the primer, which upon condensation with an extender unit generates a polyketide CoA thioester or polyketoacyl-CoA. Prior to this invention, thiolases had not been known to catalyze said condensation reaction between a 3-ketoacyl-CoA and acetyl-CoA to generate a polyketoacyl-CoA, and hence we herein define said thiolases as “polyketoacyl-CoA thiolases.” After repeated condensations, polyketoacyl-CoAs of different chain lengths are formed. After hydrolysis (spontaneously or by the action of thioesterases) and subsequent spontaneous reactions, polyketides are produced. Primers and extender units can be omega-functionalized by R1 and R2 groups, respectively. The “n” means length of polyketides, and it is an integer number larger than one and less than 20, preferably about 4-16, 6-12 or any integer between. Dashed line indicates multiple iterations.

(4) FIG. 3B: Polyketide synthesis pathway depicted in FIG. 3A with acetyl-CoA as the extender unit (R2=—H).

(5) FIG. 4A: β-reductions of the polyketoacyl-CoA synthesized through polyketoacyl-CoA thiolase-catalyzed non-decarboxylative Claisen condensations. 3-OH-polyketoacyl-CoA dehydrogenases reduce the β-keto group of polyketoacyl-CoA synthesized by a series of polyketoacyl-CoA thiolase condensations to β-hydroxy group. Polyketoenoyl-CoA hydratases catalyze the dehydration of β-keto group to the α, β double bond. Polyketoenoyl-CoA reductases reduce the α, β double bond to the single bond. The β-reduced polyketoacyl-CoA can be hydrolyzed (spontaneously or by thioesterases) to yield polyketides. The β-reduced polyketoacyl-CoAs can also serve as the primers for the next round of non-decarboxylative condensation with the extender unit. The initial primer can be omega-functionalized by R1 group. Extender units can be omega-functionalized by R2 group. The “n” means length of polyketides, and it is larger than zero. The “R” group is selected from four groups containing R1 and R2 and is listed in the upper right side to show that any β-reduced polyketoacyl-CoAs can serve as the primers for the next round of non-decarboxylative condensation with the extender unit. Dashed lines indicate iterations of polyketide synthesis.

(6) FIG. 4B: β-reductions of polyketides depicted in FIG. 4A with acetyl-CoA as the extender unit (R═—CH.sub.3).

(7) FIG. 5: Possible polyketide products of the proposed pathway, which include functionalized macrolides, phloroglunicols, α-pyrones, resorcinols and anthraquinones.

(8) FIG. 6: Example pathway for the synthesis of triketide functionalized triacetic acid lactone (TAL). After non-decarboxylative condensations of primer β-ketoacyl CoA thioester with functionalized group R1 and the extender unit acyl-CoA with functionalized group R2 catalyzed by polyketoacyl-CoA thiolase, triketoacyl-CoA is produced and it can be spontaneously converted to TAL.

(9) FIG. 7: Triketide synthesis pathway depicted in FIG. 6 with acetoacetyl-CoA as primer (R1=—CH.sub.3) and acetyl-CoA as the extender unit (R2=—H). The final product is triacetic acid lactone (TAL).

(10) FIG. 8: Triketide synthesis pathway depicted in FIG. 6 with acetoacetyl-CoA as primer (R1=—CH.sub.3) and acetoacetyl-CoA as the extender unit (R2=—COCH.sub.3). The final product is dehydroacetic acid.

(11) FIG. 9: SDS-PAGE gel showing purified polyketoacyl-CoA thiolases PcaF, BktB, ScFadA, DcaF and FadAx tested for in vitro TAL synthesis and in vitro dehydroacetic acid synthesis.

(12) FIG. 10: Time profile for increase in absorbance at 298 nm due to production of TAL by Pseudomonas putida polyketoacyl-CoA thiolase PcaF.

(13) FIG. 11: Time profile for increase in absorbance at 298 nm due to production of TAL in the assay sample of Ralstonia eutropha polyketoacyl-CoA thiolase BktB.

(14) FIG. 12: Time profile for increase in absorbance at 298 nm due to production of TAL in the assay sample of Streptomyces collinus polyketoacyl-CoA thiolase FadA.

(15) FIG. 13: Time profile for increase in absorbance at 298 nm due to production of TAL in the assay sample of Acinetobacter sp. polyketoacyl-CoA thiolase DcaF.

(16) FIG. 14: Time profile for increase in absorbance at 298 nm due to production of TAL in the assay sample of Pseudomonas putida polyketoacyl-CoA thiolase FadAx.

(17) FIG. 15: HPLC chromatograms indicating TAL synthesis in assay samples of FadAx. Two replicate assay samples were tested, and their chromatograms are displayed in Data 1 and Data 2. The chromatogram of a 0.31 mM TAL standard solution is displayed in Data 3. The retention time of TAL is ˜12.6 min, and the TAL peak is pointed by the arrow.

(18) FIG. 16: Time profile for increase in absorbance at 312 nm due to production of dehydroacetic acid by Pseudomonas putida polyketoacyl-CoA thiolase PcaF.

(19) FIG. 17: Time profile for increase in absorbance at 312 nm due to production of dehydroacetic acid by Pseudomonas putida polyketoacyl-CoA thiolase FadAx.

(20) FIG. 18A-B: Example pathway for the synthesis of tetraketide derivative olivetolic acid. After two sequential non-decarboxylative Claisen condensation reactions of primer 3-oxooctanoyl-CoA and the extender unit acetyl-CoA catalyzed by polyketoacyl-CoA thiolase, triketoacyl-CoA 3,5,7-trioxododecanoyl-CoA is produced, which is then converted to olivetolic acid by olivetolic acid cyclase. 3-oxooctanoyl-CoA is supplied through non-decarboxylative Claisen condensation between primer hexanoyl-CoA and extender unit acetyl-CoA catalyzed by ketoacyl-CoA thiolase. Hexanoyl-CoA can be supplied through β-oxidation reversal with acetyl-CoA serving as primer and extender unit.

(21) FIG. 19A-B: Example pathway for the synthesis of tetraketide derivative cannabigerolic acid (CBGA). After two sequential non-decarboxylative Claisen condensation reactions of primer hexanoyl-CoA and the extender unit acetyl-CoA catalyzed by polyketoacyl-CoA thiolase, triketoacyl-CoA 3,5,7-trioxododecanoyl-CoA is produced, which is then converted to olivetolic acid by olivetolic acid cyclase. Aromatic prenyltransferase transfers geranyl group from geranyl pyrophosphate to olivetolic acid, yielding cannabigerolic acid (CBGA). 3-oxooctanoyl-CoA is supplied through non-decarboxylative Claisen condensation between primer hexanoyl-CoA and extender unit acetyl-CoA catalyzed by ketoacyl-CoA thiolase. Hexanoyl-CoA can be supplied through β-oxidation reversal with acetyl-CoA serving as primer and extender unit. Geranyl pyrophosphate can be supplied through the endogenous pathway consisting methylerythritol phosphate pathway and the reaction of geranyl pyrophosphate synthase.

(22) FIG. 20: Example pathway for the synthesis of tetraketide derivative orsellinic acid. After two sequential non-decarboxylative Claisen condensation reactions of primer acetoacetyl-CoA and the extender unit acetyl-CoA catalyzed by polyketoacyl-CoA thiolase, triketoacyl-CoA is produced, which is then spontaneously cyclized into orsellinic acid. Acetoacetyl-CoA can be supplied through non-decarboxylative Claisen condensation reaction between two acetyl-CoAs.

(23) FIG. 21A-B: Example pathway for the synthesis of reduced tetraketide derivative 6-methyl salicylic acid. Polyketoacyl-CoA thiolase catalyzes non-decarboxylative Claisen condensation reaction with acetoacetyl-CoA as the primer and acetyl-CoA as the extender unit, yielding a diketoacyl-CoA (a triketide once the -CoA is removed). Sequential β-reduction reactions catalyzed by 3-OH-polyketoacyl-CoA dehydrogenase (end of FIG. 21A) and polyketoenoyl-CoA hydratase convert diketoacyl-CoA (beginning of FIG. 21B) to a 5-ketoenoyl-CoA. Polyketoacyl-CoA thiolase then catalyzes non-decarboxylative Claisen condensation reaction with 5-ketoenoyl-CoA as the primer and acetyl-CoA as the extender unit, and the condensation product is then spontaneously cyclized into 6-methylsalicylic acid. Acetoacetyl-CoA can be supplied through non-decarboxylative Claisen condensation reaction between two acetyl-CoAs.

DETAILED DESCRIPTION

(24) This disclosure generally relates to the use of microorganisms to make functionalized polyketides through polyketoacyl-CoA thiolase-catalyzed non-decarboxylative Claisen condensation reactions instead of decarboxylative Claisen condensation reactions catalyzed by polyketide synthases. Native or engineered polyketoacyl-CoA thiolases catalyze the non-decarboxylative Claisen condensation in an iterative manner (i.e. multiple rounds) between either unsubstituted or functionalized ketoacyl-CoAs (and polyketoacyl-CoAs) as primers and acetyl-CoA as extender unit to generate (and elongate) polyketoacyl-CoAs.

(25) If desired, the β-keto group of the polyketide chain of polyketoacyl-CoA can be reduced and modified step-wise by 3-OH-polyketoacyl-CoA dehydrogenase or polyketoenoyl-CoA hydratase or polyketoacyl-CoA reductase. Dehydrogenase converts the β-keto group to β-hydroxy group. Hydratase converts the β-hydroxy group to α-β-double-bond. Reductase convert the α-β-double-bond to single bond. This molecule can then undergo additional rounds of polyketoacyl-CoA thiolase extension, to add on additional keto groups (the last beta keto group having been removed to leave a gap), or an exit to form product.

(26) Spontaneous or thioesterase catalyzed termination reaction terminates the elongation of polyketide chain at any point through CoA removal and spontaneous reactions rearrange the structure, generating the final functional polyketide products, or precursors for further modification.

(27) In more detail, the invention includes any one or more of the following embodiment(s) in any combination(s) thereof:

(28) TABLE-US-00003 TABLE 3 Embodiments of the invention A method of making a polyketide, comprising growing a genetically engineered microorganism in a nutrient broth for a time sufficient to product a polyketide and isolating said polyketide or a spontaneously rearranged form of said polyketide, wherein said microorganism has a polyketide- producing pathway comrprising the following substrate(s) to product(s) conversions: C(n)-acyl-CoA + acetyl-CoA .fwdarw. C(n+2)-ketoacyl-CoA; C(n+2)-ketoacyl-CoA + acetyl-CoA .fwdarw. C(n+4)-polyketoacyl-CoA; iterations of reaction in step b, wherein said iterations are achieved by utilizing the polyketoacyl- CoA generated in step b as a substrate for condensation with acetyl-CoA to elongate the polyketoacyl-CoA chain by two carbons and add a beta-keto group; and conversion of said polyketoacyl-CoA in steps b or c to a polyketide or a spontaneously rearranged form of said polyketide. A method of making a polyketide, comprising growing a genetically engineered microorganism in a nutrient broth for a time sufficient to produce a polyketide and isolating said polyketide or a spontaneously rearranged form of said polyketide, wherein said microorganism has a polyketide- producing pathway comprising the following substrate(s) to product(s) conversions: a. C(n)-acyl-CoA + acetyl-CoA .fwdarw. C(n+2)-ketoacyl-CoA; b. C(n+2)-ketoacyl-CoA + acetyl-CoA .fwdarw. C(n+4)-polyketoacyl-CoA; c. C(n+4)-polyketoacyl-CoA .fwdarw. 3-OH- C(n+4)-polyketoacyl-CoA; d. 3-OH- C(n+4)-polyketoacyl-CoA .fwdarw. C+4)-polyketoenoyl-CoA; e. C(n+4)-polyketoenoyl-CoA.fwdarw. C(n+4)-α,β-unsaturated-polyketoacyl-CoA; f. iterations of reactions in steps b, c, d, and e wherein said iterations are achieved by  utilizing the polyketoacyl-CoAs, 3-OH-polyketoacyl-CoAs, and polyketoenoyl-CoA  generated in reactions steps b, c, d, and 3 as substrates for condensation with acetyl-CoA  to elongate said polyketoacyl-CoAs, 3-OH-polyketoacyl-CoAs, polyketoenoyl-CoA, and  α,β-unsaturated-polyketoacyl-CoA chains by two carbons and add a beta-keto group; and, g. conversion of said polyketoacyl-CoA in steps b, c, d, e, or f to a polyketide or a  spontaneously rearranged form of said polyketide. A method as herein described, wherein the conversion of said C(n)-acyl-CoA and acetyl-CoA into said C(n+2)-ketoacyl-CoA is catalyzed by a ketoacyl-CoA thiolase. A method as herein described, wherein the conversion of said C(n+2)-ketoacyl-CoA and acetyl- CoA into said C(n+4)-polyketoacyl-CoA is catalyzed by polyketoacyl-CoA thiolase. A method as herein described, wherein the conversion of said polyketoacyl-CoA and acetyl-CoA into said longer polyketoacyl-CoA is catalyzed by a polyketoacyl-CoA thiolase. A method as herein described, wherein the conversion of said C(n+4)-polyketoacyl-CoA into said 3-OH-C(n+4)-polyketoacyl-CoA is catalyzed by a 3-OH-polyketoacyl-CoA dehydrogenase. A method as herein described, wherein the conversion of said 3-OH-C(n+4)-polyketoacyl-CoA into said C(n+4)-polyketoenoyl-CoA is catalyzed by a 3-OH-polyketoacyl-CoA dehydratase. A method as herein described, wherein the conversion of said C(n+4)-polyketoenoyl-CoA into said α,β-unsaturated-polyketoacyl-CoA is catalyzed by a polyketoenoyl-CoA reductase. A method as herein described, wherein the conversion of said polyketoacyl-CoA, 3-OH- polyketoacyl-CoA, polyketoenoyl-CoA, or α,β-unsaturated-polyketoacyl-CoA and aceyl-Co into said longer polyketoacyl-CoA, 3-OH-polyketoacyl-CoA, or polyketoenoyl-CoA is catalyzed by a polyketoacyl-CoA thiolase. A method as herein described, wherein the conversion of said polyketoacyl-CoA to a polyketide is catalyzed by a thioesterase or takes polace spontaneously. Sometimes, the thioesterase is overexpressed, but in many cases reduced expression is preferred, and it is also known to change product length by changing length specificity of the thioesterase. A method of making a polyketide, comprising growing a microorganism in a nutrient broth for a time sufficient to produce a polyketide or a spontaneous rearrangement form of said polyketide and isolating said polyketide or said spontaneous rearrangement form of said polyketide, wherein said microorganism has means for: a polyketoacyl-CoA thioase catalyzing a non-decarboxylative Claisen condensation between an acetyl-coA extender unit (or an omega-functionalized variant thereof) and ketoacyl-coA primer (or an omega-functionalized variant thereof) to form a polyketoacyl-CoA (or an ometa- functionalized variant thereof); optional iterations of step i, wherein said polyketoacyl-CoA is the primer in said iteration to produce a polyketoacyl-CoA that is two carbons longer; converting said polyketoacyl-CoA to a polyketide or a spontaneous rearrangement form of said polyketide. A method of making polyketides, comprising: combining a polyketoacyl-CoA thiolase with a keto-acyl primer and an acetyl-coA extender unit to make a polyketoacyl-CoA, wherein said polyketoacyl-CoA thiolase catalyzes the following reaction and its iterations: wherein R1 and R1 can independently or both be Alkyl, Aryl, —OH, —NH2, —H, —X Arylacyl, Hydroxyacyl, Carboxyacyl, Aminoacyl, Ketoacyl, Halongenated acyl, or Ester; releasing a polyketide or a spontaneous rearrangement form of said polyketide and free coA from said polyketoacyl-CoA by a thioesterase or by spontaneous hydrolysis; and isolating said polyketide or said spontaneous rearrangement form of said polyketide. A method as herein described, wherein said polyketoacyl-CoA thiolase is encoded by a gene(s) selected from the group consisting of Rhodococcus opacus pcaF, Pseudomonas putida, pcaF, Streptomyces sp. pcaF, P. putida fadAx, P. putida fadA, Acinetobacter sp. ADP1 dcaF and Ralstonia eutropha bktB. Homologs with the same catalytic activity can also be used, and in certain embodiments, the polyketoacyl-CoA tholase is overexpressed. A method, comprising: conbining a polyketoacyl-CoA thiolase with acetyl-CoA under conditions sufficient to allow said polyketoacyl-CoA thiolase to perform non-decarboxylative Claisen condensations with said acetyl- CoA to form a polyketoacyl-CoA; hydrolyzing said polyketoacyl-CoA to form polyketide or a spontaneous rearrangement form of said polyketide and free Co-A; and isolating said polyketide or said spontaneous rearrangement form of said polyketide. A method as herein described, wherein said method is performed in vivo using a genetically engineered microorganism that overexpresses said polyketoacyl-CoA thiolase. Alternatively, said method is performed in vitro using purified polyketoacyl-CoA thiolase. In some embodiments, the acetyl-CoA (or some portion thereof) is omega functionalized. Microorganisms, preferably bacteria, can also be engineered to have significantly overexpressed ketoacyl-CoA thiolases and/or polyketoacyl-CoA thiolases, along with the other genes described herein. Preferably that is at least 10 fold as much thiolase activity as beta oxidation enzymes, or 20, 50 or 100 fold higher, thus driving the desired formation of polyketides, rather than immediately reducing the beta keto group with reverse BOX reactions. Also, preferred, thioesterase is reduced. A genetically engineered microorganism, wherein said microorganism has a polyketide-producing pathway comprising the following substrate(s) to product(s) conversion: a) C(n)-acyl-CoA + acetyl-CoA .fwdarw. C(n+2)-ketoacyl-CoA; b) C(n+2)-ketoacyl-CoA + acetyl-CoA .fwdarw. C(n+4)-polyketoacyl-CoA; c) iterations of reaction in step b, wherein said iterations are achieved by utilizing the  polyketoacyl-CoA generated in step b as a substrate for condensation with acetyl-CoA to  elongate the polyketoacyl-CoA chain by two carbons and add a beta-keto group; and d) conversion of said polyketoacyl-CoA in steps b or c to a polyketide or a spontaneously  rearranged form of said polyketide. A genetically engineered microorganism, wherein said microorganism has a polyketide-producing pathway comprising the following substrate(s) to product(s) conversions: e) C(n)-acyl-CoA + acetyl-CoA .fwdarw. C(n+2)-ketoacyl-CoA; f) C(n+2)-ketoacyl-CoA + acetyl-CoA .fwdarw. C(n+4)-polyketoacyl-CoA; g) C(n+4)-polyketoacyl-CoA .fwdarw. 3-OH- C(n+4)-polyketoacyl-CoA; h) 3-OH- C(n+4)-polyketoacyl-CoA .fwdarw. C(n+4)-polyketoenoyl-CoA; i) C(n+4)-polyketoenoyl-CoA .fwdarw. C(n+4)-α,β-unsaturated-polyketoacyl-CoA; j) iterations of reactions in steps f, g, h and i, wherein said iterations are achieved by utilizing  the polyketoacyl-CoAs, 3-OH-polyketoacyl-CoAs, polyketoenoyl-CoA, and α,β-  unsaturated-polyketoacyl-CoA generated in reactions steps f, g, h, and i as substrates for  condensation with aceyl-CoA to elongate said polyketoacyl-CoAs, 3-OH-polyketoacyl-  CoAs, and polyketoenoyl-CoA chains by two carbons and add a beta-keto group; k) conversion of said polyketoacyl-CoA in steps f, g, h, l, or j to a polyketide or a  spontaneously rearranged form of said polyketide. The RBOX enzymes used herein can be any enzymes described herein, or any homologs have the same activity. Exemplary enzyme include a thioesterase encoded by gene(s) selected from the group consisting of E. coli tesA, E. coli tesB, E. coli yciA, E. coli fadM, E. coli ydil, E. coli ybhC, E. coli paal, Mus musculus acot8, Alcanivorax borkumensis tesB2, Fibrobacter succinogenes, Fs2108, Prevotella ruminicola Pr655, Prevotella ruminicola Pr1687, Lycopersicon hirsutum glabratum mks2; a 3-OH-polyketoacyl-CoA dehydrogenase encoded by gene(s) selected from the group consisting of E. coli fabG, E. coli fadB, E. coli fadJ, E. coli paaH, P. putida fadB, P. putida fadB2x, Acinetobacter sp. ADP1 dcaH, Ralstonia eutrophus phaB, Clostridium acetobutylicum hbd; a 3-OH-polyketoacyl-CoA dehydratase encoded by a gene(s) selected from the group consisting of E. coli fabA, E. coli fabZ, E. coli fadB, E. coli fadJ, E. coli paaF, P. putida fadB, P. putida fadB1x, Acinetobacter sp. ADP1 dcaE, Clostridium acetobutylicum crt, Aeromonas caviae phaJ. A recombinant microorganism having an overexpressed thiolase that catalyzes the following reaction: as well as reduced activity of endogenous ketoacyl-CoA dehydrogenase activity, and optionally reduced activity of endogenous thioesterase activity. A recombinant microorganism having overexpressed genes encoding at least two different thiolases, said thiolases including a acetoacety-CoA thiolase or a ketoacyl thiolase and a polyketoacyl-CoA thiolase. Another option is a recombinant microorganism having overexpressed genes encoding a ketoacyl-CoA thiolase or acetoacyl-CoA thiolase and a polyketoacyl-CoA thiolase, and reduced activity of endogenous thioesterase activity. In some embodiments, the thiolases have at least 10 fold more activity than ketoacyl-CoA dehydrogenase or polyketoacyl- CoA dehydrogenase activity, preferably, 20, 50, 100 fold or more. Preferably, the genes are under the control of an inducible promoter, or a constitutive promoter. They may also be integrated genes. A microorganism as herein described further comprising reduced expression of fermentation enzymes leading to reduced production of lactate, acetate, ethanol and succinate, preferably ΔadhE, (Δpta or ΔackA or ΔackApt), ΔpoxB, ΔldhA, and ΔfrdA. Method as described herein, wherein said polyketide is further modified to produce a polyketide derivative. Such derivatives include dehydroacetic acid, olivetolie acid, cannabigerolic acid, orsellinic acid, or 6-methylsalicyclic acid.

(29) Many examples of polyketoacyl-CoA thiolase enzymes which can potentially catalyze the non-decarboxylative Claisen condensation of a ketoacyl-CoA or polyketoacyl-CoA primer and acyl-CoA extender unit are provided herein, and Table 4 below provides additional examples which can also serve as templates for engineered variants:

(30) TABLE-US-00004 TABLE 4 Example polyketoacyl-CoA Thiolase Enzymes (EC Number 2.3.1.-) Source organism and gene name Protein Accession Numbers Ralstonia eutropha bktB AAC38322.1 Pseudomonas putida pcaF AAA85138.1 Q51956 Rhodococcus opacus pcaF YP_002778248.1 Streptomyces sp. pcaF AAD22035.1

(31) Other materials used in exemplifying the invention include those in Table 5:

(32) TABLE-US-00005 TABLE 5 Exemplary materials Type Name Accession No. or Source Thiolase Escherichia coli AtoB GenBank: NP_416728.1 Escherichia coli FadA GenBank: YP_026272.1 Escherichia coli PaaJ GenBank: NP_415915.1 Pseudomonas putida FadA GenBank: AAK18168.1 Pseudomonas putida PcaF GenBank: AAA85138.1 Pseudomonas putida FadAx GenBank: AAK18171.1 Cupriavidus necator BtkB UniProt: Q0KBP1 Rhodococcus opacus PcaF GenBank: BAH49303.1 Streptomyces sp. PcaF GenBank: AAD22035.1 Acinetobacter sp. ADP1 DcaF GenBank: CAG68532.1 Ralstonia eutropha BktB GenBank: AAC38322.1 Hydroxyacyl- Escherichia coli FadB GenBank: NP_418288.1 CoA Escherichia coli PaaH GenBank: NP_415913.1 dehydrogenase Escherichia coli FadJ GenBank: NP_416843.1 Pseudomonas putida FadB GenBank: AAK18167.2 Pseudomonas putida FadB2x GenBank: AAK18170.1 Acinetobacter sp. ADP1 DcaH GenBank: CAG68533.1 Ralstonia eutrophus PhaB UniProt: P14697.1 Clostridium acetobutylicum GenBank: AAA95971.1 Hbd Escherichia coli FabG GenBank: NP_415611.1 Escherichia coli FadB GenBank: NP_418288.1 Enoyl-CoA Escherichia coli FadJ GenBank: NP_416843.1 hydratase Escherichia coli PaaF GenBank: NP_415911.1 Pseudomonas putida FadB GenBank: AAK18167.2 Pseudomona putida FadB1x GenBank: AAK18173.1 Acinetobacter sp. ADP1 DcaE GenBank: CAG68535.1 Clostridium acetobutylicum GenBank: AAA95967.1 Crt Aeromonas caviae PhaJ UniProt: O32472.1 Enoyl-CoA Euglena gracilis TER UniProt: Q5EU90.1 reductase Thioesterase Escherichia coli TesA GenBank: NP_415027.1 Escherichia coli TesB GenBank: NP_414986.1 Escherichia coli YciA GenBank: NP_415769.1 Escherichia coli FadM GenBank: NP_414977.1 Escherichia coli Ydil GenBank: NP_416201.1 Escherichia coli YbgC GenBank: NP_415264.1 Mus musculus Acot8 UniProt: P58137.1 Olivetolic acid Cannabis sativa OAC GenBank: AFN42527.1 cyclase Aromatic Cannabis sativa CsPT1 Source: US8884100 prenyl- Humulus lupulus HIPT GenBank: AJD80255.1 transferase Escherichia coli UbiA GenBank: NP_418464.1 Saccharomyces cerevisiae GenBank: AAA34507.1 Coq2 Lithospermum erythrorhizon GenBank: BAB84122.1 LePGT-1 Lithospermum erythrorhizon GenBank: BAB84123.1 LePGT-2 Plasmid pTrcHis2A Source: Invitrogen, Carlsbad, CA pCA24N GenBank: AB052891.2 pKD4 Source: Datsenko and Wanner, 2000 pKD3 Source: Datsenko and Wanner, 2000 pUCBB-ntH6 Source: Vick et al. 2011 pUCBB-ntH6-eGFP Source: Vick et al. 2011 pCDFDuet-1 Source: Novagen, Darmstadt, Germany pETDuet-1 Source: Novagen, Darmstadt, Germany

(33) The disclosed methods can be used to produce a variety of polyketides with better energy efficiency than normal polyketide synthesis. FIGS. 3-4 and FIG. 6 display exemplary mechanisms.

(34) In FIG. 3A, generic synthesis of polyketides through native or engineered polyketoacyl-CoA thiolase-catalyzed non-decarboxylative Claisen condensations are shown. Ketoacyl-CoA thiolases catalyze the condensation between an acyl-CoA thioester, serving as the primer, and another acyl-CoA thioester, serving as the extender unit, forming β-keto acyl-CoA. This β-keto acyl-CoA can serve as the primer for the next polyketoacyl-CoA thiolase condensation with the extender unit in a series of iterated condensations to form polyketoacyl-CoAs. After hydrolysis (spontaneously or by the action of thioesterases) and subsequent spontaneous reactions, polyketides are produced. This variation in R groups allows for the generation of a diverse group of products, thus increasing what is available for end-use in e.g. therapeutics or a feedstock to make therapeutics. FIG. 3B is the polyketide synthesis pathway depicted in FIG. 3A with acetyl-CoA as the extender unit (R2=—H).

(35) FIG. 4A shows β-reductions of polyketides synthesized through polyketoacyl-CoA thiolase-catalyzed non-decarboxylative Claisen condensations. 3-OH-polyketoacyl-CoA dehydrogenases reduce the β-keto group of polyketoacyl-CoA synthesized by a series of polyketoacyl-CoA thiolase condensations to β-hydroxy group. Polyketoenoyl-CoA hydratases catalyze the dehydration of β-keto group to the α, β double bond. Polyketoenoyl-CoA reductases reduce the α, β double bond to the single bond. The β-reduced polyketoacyl-CoA can be hydrolyzed (spontaneously or by thioesterases) to yield polyketides. The β-reduced polyketoacyl-CoAs can also serve as the primer for the next round of non-decarboxylative condensation with the extender unit. Dashed lines indicate iterations of polyketide synthesis. FIG. 4B shows the β-reductions of polyketides depicted in FIG. 4A with acetyl-CoA as the extender unit (R═—CH.sub.3).

(36) FIG. 5 shows possible polyketide products of the proposed pathway, which include functionalized macrolides, phloroglunicols, α-pyrones, resorcinols and anthraquinones.

(37) In our proof of concept work, we made a triketide by polyketoacyl-CoA thiolase-catalyzed non-decarboxylative Claisen condensation between acetoacetyl-CoA (a ketoacyl-CoA acting as the primer) and acetyl-CoA (an acyl-CoA acting as extender unit), which generates 3,5-diketohexanoyl-CoA (a polyketoacyl-CoA). The spontaneous hydrolysis and cyclization of 3,5-diketohexanoyl-CoA formed triacetic acid lactone (4-hydroxy-6-methyl-2-pyrone):

(38) ##STR00009##

(39) FIG. 6 shows the exemplary pathway of synthesis of triketide functionalized triacetic acid lactone (TAL) using the disclosed methods. After non-decarboxylative condensations of primer ketoacyl-CoA thioester with functionalized group (R1) and the extender unit acetyl-CoA with functionalized group (R2) catalyzed by polyketoacyl-CoA thiolase, the triketide diketoacyl-CoA is produced and it can be spontaneously converted to functionalized TAL.

(40) FIG. 7 shows the synthesis of triacetic acid lactone (TAL) through the pathway depicted in FIG. 6 with R1=—CH.sub.3 and R2=—H.

(41) FIG. 8 shows the synthesis of dehydroacetic acid through the pathway depicted in FIG. 6 with R1=—CH.sub.3 and R2=—COCH.sub.3.

(42) Standard molecular biology techniques were used for gene cloning, plasmid isolation, and E. coli transformation. Native E. coli genes were amplified from E. coli MG1655 genomic DNA using primers to append homology on each end of the gene insert for recombination into the vector backbone. Genes from other organisms were codon optimized and synthesized by either GeneArt (Life Technologies, Carlsbad, Calif.) or GenScript (Piscataway, N.J.). Plasmids were linearized by the appropriate restriction enzymes and recombined with the gene inserts using the In-Fusion HD Eco-Dry Cloning system (Clontech laboratories, Mountain View, Calif.). The mixture was subsequently transformed into Stellar competent cells (Clontech laboratories, Mountain View, Calif.).

(43) Transformants that grew on solid media (LB+Agar) supplemented with the appropriate antibiotic were isolated and screened for the gene insert by PCR. Plasmid was isolated from the verified transformants and the sequence of the gene insert was further confirmed by DNA sequencing (Lone Star Labs, Houston, Tex.). Plasmids (also referred to as vectors) in each case contain at least one promoter, a ribosome binding site for each gene, the gene(s) of interest, at least one terminator, an origin of replication, and an antibiotic resistance marker.

(44) Genes encoding Pseudomonas putida FadA and FadAx, Acinetobacter sp. DcaF, and Streptomyces collinus FadA were cloned into the pCDFDuet-1 vector and were expressed with an N-terminal 6-His-tag. The gene encoding Mus musculus Acot8 was cloned into the pETDuet-1 vector and was expressed with an N-terminal 6-His-tag. Genes encoding Pseudomonas putida PcaF and Euglena gracilis TER were cloned into the pTrcHis2A vector and were expressed with a C-terminal 6-His-tag. Genes encoding E. coli FadA and FadB, Clostridium acetobutylicum Hbd and Ralstonia eutropha BktB were cloned from genomic DNA into the pUCBB-ntH6 vector to yield a constitutively expressed gene with an N-terminal 6-His-tag. For E. coli AtoB, FadM, TesA, TesB, YbgC, YciA, YdiI, PaaJ and PaaH, the pCA24N- gene (-gfp) plasmids from the ASKA collection were used (Kitagawa et al., 2005).

(45) Cultures were grown overnight in 25 mL of LB media in 125 mL baffled flasks (Wheaton Industries, Inc., Millville, N.J.) for thiolase assay on condensation between acetoacetyl-CoA and acetyl-CoA or in 100 mL of LB media in 250 mL baffled flasks (Wheaton Industries, Inc., Millville, N.J.) for other enzymatic assays at 37° C. in E. coli BL21 (DE3) cells induced with 1 mM IPTG (pCA24N, pTrcHis2A) at an OD600˜0.6, or expressed constitutively (pUCBB-ntH6). Reactions were monitored on either a Synergy HT plate reader (BioTek Instruments, Inc., Winooski, Vt.) at 25° C. or in a Biomate 5 Spectrophotometer (Thermo Scientific, Waltham, Mass.).

(46) For thiolase assay on the condensation reaction between acetoacetyl-CoA and acetyl-CoA, the cell lysis and protein purification processes are as below: After post-induction growth for 4 h for ASKA strains, or 16 for other strains, the cells were collected and washed twice by 9 g/L sodium chloride solution. Then, cells were re-suspended by lysis buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 10 mM imidazole, pH 8.0). After re-suspension, the cells were disrupted by Disruptor Genie (Scientific Industries), and then centrifuged at 4° C., 13000G, 10 min. The resultant supernatant is the crude enzyme extract.

(47) The His-tagged enzymes were then purified from crude extract by using Ni-NTA spin kit (Qiagen, Valencia, Calif.). The crude extracts are centrifuged in spin columns that were equilibrated with lysis buffer for 270G, 5 min. The column was then washed twice with a wash buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 20 mM imidazole, pH 8.0). After washing, the enzyme was eluted twice in elution buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 500 mM imidazole, pH 8.0). Both washing and elution used centrifuge at 890G, 2 min.

(48) The purified enzyme extracts were then further concentrated and dialyzed through Amicon® Ultra 10K Device (Millipore, Billerica, Mass.). The enzymes were first filtered through centrifugation at 4° C., 14000G, 10 min, and then washed with 100 mM potassium phosphate, pH 7 buffer at same centrifugation conditions. Finally, the concentrated and dialyzed enzymes were recovered through 4° C., 1000G, 2 min centrifugation. The protein concentration was established using the Bradford Reagent (Thermo Scientific, Waltham, Mass.) using bovine serum albumin (BSA) as the protein standard.

(49) For other enzymatic assays, cells were lysed using Bacterial Protein Extraction Reagent (B-PER) (Thermo Scientific, Waltham, Mass.) as per the prescribed protocol in order to obtain the supernatant containing the active enzymes. Cell pellets were resuspended in 40 mL of 50 mM potassium phosphate buffer pH 7.2 and broken by disruption EmulsiFlex-05 homogenizer (Avestin, Ottawa, ON). Disrupted cells were then spun for 90 min at 4° C. at 120,000×g in an Optima L-80XP Ultracentrifuge (Beckman-Coulter, Schaumburg, Ill.) to produce the supernatant used for assays.

(50) For specific activity assays (reported in μmol substrate/mg protein/min) these supernatant fractions were utilized and protein concentration was established using the Bradford Reagent (Thermo Scientific, Waltham, Mass.) using BSA as the protein standard. Linearity was established for each reaction and the background non-enzymatic rate was subtracted to establish the activity.

(51) The assay of triacetic acid lactone (TAL) synthesis through thiolase condensation between acetoacetyl-CoA and acetyl-CoA was performed in the presence of 100 mM potassium phosphate pH 7, 3 mM EDTA, 1 mM acetoacetyl-CoA and 1 mM acetyl-CoA in a total volume of 220 μL for BktB or 200 μL for other tested thiolases at 25° C.

(52) For BktB, 24 μL of undiluted enzyme elute was added in the assay system, while for other thiolases, 4 μL of undiluted enzymes were added. The activity was monitored by the increase of TAL at 298 nm using an extinction coefficient of 2.9443 mM.sup.−1 cm.sup.−1 measured through calibration of TAL standards. TAL formation in assay samples was then confirmed through HPLC Shimadzu LC-20AD HPLC system with an SPD-20A dual-wavelength UV-VIS detector and a Phenomonex Luna C18 column (25 cm×4.6 mm, 5 μm) (Tang et al. 2013). The TAL formation in assay samples was also identified through MicroTof ESI mass spectrometer with comparison to TAL standard.

(53) Thiolases have never been shown to catalyze the needed condensation reactions to form polyketides. Therefore, one of our first experiments was to characterize the activity of the enzymes composing the pathway, in both the forward and reverse directions.

(54) Thiolase thiolytic activity was determined in the presence of 0.5 mM DTT, 4.5 mM MgCl.sub.2, 100 mM Tris HCl pH 7.5, and 2 mM CoA in a total volume of 200 μL at 25° C. Activity was monitored by the loss of acetoacetyl-CoA at 303 nm using an extinction coefficient of 14 mM.sup.−1 cm.sup.−1. Both the β-hydroxyacyl-CoA dehydrogenase assays and the thiolase biosynthetic activity were performed in the presence of 1.5 mM DTT, 4.5 mM MgCl.sub.2, 100 mM Tris HCl pH 7.5 and 0.2 mM NADH in a total volume of 200 μL at 25° C. Thiolase activity in the biosynthetic direction was measured at 340 nm in a coupled assay in which 10 U excess of β-hydroxyacyl-CoA dehydrogenase was present to reduce the β-ketoacyl-CoA generated from thiolase activity.

(55) Dehydrogenase activity was monitored by following the oxidation of NADH at 340 nm. Enoyl-CoA hydratase activity was monitored by following the loss of crotonoyl-CoA at 263 nm (ε=6.7 mM.sup.−1 cm.sup.−1) in the presence of 100 mM Tris HCL pH 7.5 in 200 μL total volume. Enoyl-CoA reductase activity was followed by monitoring the loss of NADH absorbance in the presence of 100 mM Tris HCL pH 7.5 and 0.2 mM NADH in a final volume of 200 μL at 25° C.

(56) Thioesterase activity was monitored by following the production of thionitrobenzoic acid (TNB) at 412 nm (ε=4.3 mM.sup.−1 cm.sup.−1). Reactions were carried out in the presence of 100 mM Tris pH 7.5, 200 mM KCl, 25 mM 5,5-dithio-bis-(2-nitrobenzoic acid) (DTNB) and 200 μM of the “-CoA” substrate in a volume of 200 μL at 25° C.

(57) FIG. 10-14 show time profiles for the increase in absorbance at 298 nm due to production of TAL by different thiolases. These data provide a demonstration of the ability of certain thiolases, referred to here as “polyketoacyl-CoA” thiolases (PcaF, BktB, FadA, DcaF, FadAx) to catalyze a non-decarboxylative Claisen condensation reaction between a ketoacyl-CoA or a polyketoacyl-CoA (e.g. acetoacetyl-CoA, serving as starter unit) and an acyl-CoA or activated carboxylic acid (e.g. acetyl-CoA, serving as extender unit) to generate a polyketoacyl-CoA (e.g. 3,5-diketohexanoyl-CoA), which undergoes hydrolysis and ring closure to produce TAL.

(58) FIG. 15 shows an HPLC chromatogram indicating the formation of TAL through the condensation reaction between acetoacetyl-CoA and acetyl-CoA by thiolase FadAx. These results provide the basis of novel polyketide synthesis through non-decarboxylative condensation reactions catalyzed by thiolases instead of decarboxylative reactions catalyzed by polyketide synthases, and β-reduction modifications on polyketide carbon-chain by 3-OH-polyketoacyl-CoA dehydrogenases, polyketoenoyl-CoA hydratases and polyketoenoyl-CoA reductases.

(59) FIG. 16-17 show time profiles for the increase in absorbance at 312 nm due to production of dehydroacetic acid by different polyketoacyl-CoA thiolases. These figures provide a demonstration of the ability of certain polyketoacyl-CoA thiolases (PcaF, FadAx) to catalyze a non-decarboxylative Claisen condensation reaction between a ketoacyl-CoA (acetoacetyl-CoA, serving as starter unit) and another ketoacyl-CoA (acetoacetyl-CoA, serving as extender unit) to generate a polyketoacyl-CoA, which undergoes ring closure to produce dehydroacetic acid.

(60) Table 6 shows the characterization of several enzymes tested for use herein. Several enzymes with one substrate show the availability of several enzymes as catalysts for the same reaction. Testing of adipyl, crotonyl, and the like, shows activity on functionalized substrates.

(61) TABLE-US-00006 TABLE 6 Characterization of enzymes depicted in the filing. MEASURED SPECIFIC ACTIVITY REFERENCE ENZYME CLASS ENZYME SUBSTRATE PROTEIN/MIN) (μMOL/MG THIOLASE E. COLI ATOB ACETOACETYL-COA + N.D. THIS WORK ACETYL-COA THIOLASE E. COLI FADA ACETOACETYL-COA + N.D. THIS WORK ACETYL-COA THIOLASE E. COLI PAAJ ACETOACETYL-COA + N.D. THIS WORK ACETYL-COA THIOLASE PSEUDOMONAS ACETOACETYL-COA + N.D. THIS WORK PUTIDA FADA ACETYL-COA THIOLASE PSEUDOMONAS ACETOACETYL-COA +  0.052 ± 0.014 THIS WORK PUTIDA FADAX ACETYL-COA THIOLASE ACINETOBACTER SP. ACETOACETYL-COA + 0.041 THIS WORK DCAF ACETYL-COA THIOLASE STREPTOMYCES ACETOACETYL-COA + 0.007 THIS WORK COLLINUS FADA ACETYL-COA THIOLASE RALSTONIA EUTROPHA ACETOACETYL-COA + 0.00019 THIS WORK BKTB ACETYL-COA THIOLASE E. COLI ATOB ACETOACETYL-COA  0.36 ± 0.05 THIS WORK THIOLASE E. COLI FADA ACETOACETYL-COA  0.013 ± 0.002 THIS WORK THIOLASE E. COLI ATOB ACETYL-COA  0.919 ± 0.002 (K.sub.M: 892.0 ± 56.5 CLOMBURG MM; K.sub.CAT: 3.17 ± 0.18 S.sup.−1. ET AL. (2012) ASSAY COUPLED WITH DEHYDROGENASE HBD) THIOLASE E. COLI PAAJ SUCCINYL-COA +  0.12 ± 0.02 (ASSAY COUPLED THIS WORK ACETYL-COA WITH DEHYDROGENASE PAAH) THIOLASE PSEUDOMONAS SUCCINYL-COA +  0.184 ± 0.009 (ASSAY THIS WORK PUTIDA PCAF ACETYL-COA COUPLED WITH DEHYDROGENASE PAAH) HYDROXYACYL-COA E. COLI FADB ACETOACETYL-COA  0.185 ± 0.001 (K.sub.M: 390.0 ± 19.2 CLOMBURG DEHYDROGENASE MM; K.sub.CAT: 25.9 ± 1.2 S.sup.−1.) ET AL. (2012) HYDROXYACYL-COA E. COLI PAAH ACETOACETYL-COA  3.10 ± 0.22 THIS WORK DEHYDROGENASE HYDROXYACYL-COA CLOSTRIDIUM ACETOACETYL-COA  22.0 ± 1.0 THIS WORK DEHYDROGENASE ACETOBUTYLICUM HBD ENOYL-COA E. COLI FADB CROTONYL-COA  0.051 ± 0.004 THIS WORK HYDRATASE ENOYL-COA EUGLENA GRACILIS CROTONYL-COA   5.4 ± 0.6 (K.sub.M: 98.5 ± 7.7 MM; CLOMBURG REDUCTASE EGTER K.sub.CAT: 1.14 ± 0.08 S.sup.−1.) ET AL. (2012) THIOESTERASE E. COLI FADM ACETOACETYL-COA  0.042 ± 0.004 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI TESA ACETOACETYL-COA  0.044 ± 0.005 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI TESB ACETOACETYL-COA  0.056 ± 0.001 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI YBGC ACETOACETYL-COA  0.065 ± 0.002 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI YCIA ACETOACETYL-COA  0.672 ± 0.007 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI YDII ACETOACETYL-COA  0.047 ± 0.001 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI FADM 3-  0.009 ± 0.002 CLOMBURG HYDROXYBUTYRYL- ET AL. (2012) COA THIOESTERASE E. COLI TESA 3-  0.02 ± 0.01 CLOMBURG HYDROXYBUTYRYL- ET AL. (2012) COA THIOESTERASE E. COLI TESB 3-  0.032 ± 0.002 CLOMBURG HYDROXYBUTYRYL- ET AL. (2012) COA THIOESTERASE E. COLI YBGC 3-  0.016 ± 0.004 CLOMBURG HYDROXYBUTYRYL- ET AL. (2012) COA THIOESTERASE E. COLI YCIA 3-  0.441 ± 0.009 CLOMBURG HYDROXYBUTYRYL- ET AL. (2012) COA THIOESTERASE E. COLI YDII 3-  0.012 ± 0.002 CLOMBURG HYDROXYBUTYRYL- ET AL. (2012) COA THIOESTERASE E. COLI FADM CROTONYL-COA 0.0017 ± 0.0003 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI TESA CROTONYL-COA  0.007 ± 0.003 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI TESB CROTONYL-COA  0.010 ± 0.001 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI YBGC CROTONYL-COA  0.006 ± 0.001 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI YCIA CROTONYL-COA  0.27 ± 0.03 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI YDII CROTONYL-COA  0.078 ± 0.005 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI FADM BUTYRYL-COA  0.027 ± 0.001 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI TESA BUTYRYL-COA  0.049 ± 0.002 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI TESB BUTYRYL-COA  0.101 ± 0.002 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI YBGC BUTYRYL-COA  0.045 ± 0.007 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI YCIA BUTYRYL-COA   2.9 ± 0.2 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI YDII BUTYRYL-COA 0.0917 ± 0.0007 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI FADM DECANYL-COA  0.034 ± 0.003 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI TESA DECANYL-COA  0.47 ± 0.04 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI TESB DECANYL-COA   0.6 ± 0.1 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI YBGC DECANYL-COA  0.06 ± 0.02 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI YCIA DECANYL-COA   3.7 ± 0.3 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI YDII DECANYL-COA  0.18 ± 0.04 CLOMBURG ET AL. (2012) THIOESTERASE E. COLI TESB ADIPYL-COA  0.267 ± 0.002 THIS WORK THIOESTERASE MUS MUSCULUS ADIPYL-COA  0.48 ± 0.02 THIS WORK ACOT8 (N.D. means not detected)

(62) Table 7 shows the results of testing several thiolases to ascertain that they will work to condense a ketoacyl-CoA with acetyl Co-A, thus forming a triketide.

(63) TABLE-US-00007 TABLE 7 Screening thiolases for polyketoacyl-CoA thiolase activity through production of TAL via non-decarboxylative Claisen condensation between acetoacetyl-CoA (a ketoacyl-CoA serving as the primer) and acetyl-CoA (an acyl-CoA serving as the extender unit) Measured specific activity (μmol/mg Enzyme Substrate protein/min) Reference E. coli AtoB Acetoacetyl-CoA + N.D. This work acetyl-CoA E. coli FadA Acetoacetyl-CoA + N.D. This work acetyl-CoA E. coli PaaJ Acetoacetyl-CoA + N.D. This work acetyl-CoA Pseudomonas putida Acetoacetyl-CoA + N.D. This work FadA acetyl-CoA Pseudomonas putida Acetoacetyl-CoA + 0.052 ± 0.014 This work FadAx acetyl-CoA Acinetobacter sp. Acetoacetyl-CoA + 0.041 This work DcaF acetyl-CoA Streptomyces Acetoacetyl-CoA + 0.007 This work collinus FadA acetyl-CoA Ralstonia eutropha Acetoacetyl-CoA + 0.00019 This work BktB acetyl-CoA N.D. means not detected.

(64) FIG. 18A-B shows an exemplary pathway for the synthesis of tetraketide derivative olivetolic acid using the disclosed methods. After two sequential non-decarboxylative Claisen condensation reactions of primer 3-oxooctanoyl-CoA and the extender unit acetyl-CoA catalyzed by polyketoacyl-CoA thiolase, triketoacyl-CoA 3,5,7-trioxododecanoyl-CoA is produced, which is then converted to olivetolic acid by olivetolic acid cyclase. 3-oxooctanoyl-CoA is supplied through non-decarboxylative Claisen condensation between primer hexanoyl-CoA and extender unit acetyl-CoA catalyzed by acetoacetyl-CoA thiolase. Hexanoyl-CoA can be supplied through β-oxidation reversal with acetyl-CoA serving as primer and extender unit.

(65) FIG. 19A-B shows an exemplary pathway for the synthesis of tetraketide derivative olivetolic acid using the disclosed methods. After two sequential non-decarboxylative Claisen condensation reactions of primer hexanoyl-CoA and the extender unit acetyl-CoA catalyzed by polyketoacyl-CoA thiolase, triketoacyl-CoA 3,5,7-trioxododecanoyl-CoA is produced, which is then converted to olivetolic acid by olivetolic acid cyclase. Aromatic prenyltransferase transfers geranyl group from geranyl pyrophosphate to olivetolic acid, yielding cannabigerolic acid (CBGA). 3-oxooctanoyl-CoA is supplied through non-decarboxylative Claisen condensation between primer hexanoyl-CoA and extender unit acetyl-CoA catalyzed by ketoacyl-CoA thiolase. Hexanoyl-CoA can be supplied through β-oxidation reversal with acetyl-CoA serving as primer and extender unit.

(66) FIG. 20 shows an exemplary pathway for the synthesis of tetraketide derivative orsellinic acid using the disclosed methods. After two sequential non-decarboxylative Claisen condensation reactions of primer acetoacetyl-CoA and the extender unit acetyl-CoA catalyzed by polyketoacyl-CoA thiolase, triketoacyl-CoA is produced, which is then spontaneously cyclized into orsellinic acid. Acetoacetyl-CoA can be supplied through non-decarboxylative Claisen condensation reaction between two acetyl-CoAs.

(67) FIG. 21A-B shows an exemplary pathway for the synthesis of reduced tetraketide derivative 6-methylsalicylic acid using the disclosed methods. Polyketoacyl-CoA thiolase catalyzes non-decarboxylative Claisen condensation reaction with acetoacetyl-CoA as the primer and acetyl-CoA as the extender unit, yielding a diketoacyl-CoA. Sequential β-reduction reactions catalyzed by 3-OH-polyketoacyl-CoA dehydrogenase and polyketoenoyl-CoA hydratase convert diketoacyl-CoA to a 5-ketoenoyl-CoA. Polyketoacyl-CoA thiolase then catalyzes non-decarboxylative Claisen condensation reaction with 5-ketoenoyl-CoA as the primer and acetyl-CoA as the extender unit, and the condensation product is then spontaneously cyclized into 6-methylsalicylic acid. Acetoacetyl-CoA can be supplied through non-decarboxylative Claisen condensation reaction between two acetyl-CoAs.

(68) Additional details are provided in the following experimental descriptions. Any single detail included therein (e.g., codon optimization or use of integrated genes) is intended for use in the appended claims in any combination(s) thereof. However, to repeat all possible combinations herein would be unnecessarily lengthy and duplicative.

In Vitro Synthesis of TAL

(69) The purpose of this experiment was to clone, express and purify polyketoacyl-CoA thiolases and test their activity for in vitro synthesis of triacetic acid lactone (TAL) through non-decarboxylative Claisen condensation between acetoacetyl-CoA (a ketoacyl-CoA), serving as the primer, and acetyl-CoA, serving as the extender unit. The TAL synthesis reaction is shown in FIG. 7.

(70) Nine enzymes were selected and tested for polyketoacyl-CoA thiolase activity: AtoB (NP_416728.1), FadA (YP_026272.1), PaaJ (NP_415915.1) from E. coli, ppFadA (AAK18168.1), FadAx (AAK18171.1) and PcaF (AAA85138.1) from Pseudomonas putida, DcaF (CAG68532.1) from Acinetobacter sp. ADP1, BktB (AAC38322.1) from Ralstonia eutropha and ScFadA (AAL10298.1) from Streptomyces collinus. AtoB, FadA and PaaJ were expressed in pCA24N- gene (-gfp) plasmids from the ASKA collection (Kitagawa et al., 2005). Genes encoding ppFadA, FadAx, PcaF, DcaF, BktB and ScFadA were codon optimized and synthesized by either GeneArt (Life Technologies, Carlsbad, Calif., USA) or GenScript (Piscataway, N.J.).

(71) These genes were then amplified through PCR using primers to append homology on each end for recombination into the vector backbone with Phusion polymerase (Thermo Scientific, Waltham, Mass.) to serve as the gene insert. Plasmids were linearized by the appropriate restriction enzymes (New England Biolabs, Ipswich, Mass., USA) and recombined with the gene inserts using the In-Fusion HD Eco-Dry Cloning system (Clontech laboratories, Mountain View, Calif., USA). The mixture was subsequently transformed into Stellar competent cells (Clontech laboratories, Mountain View, Calif., USA). Transformants that grew on solid media (LB+Agar) supplemented with the appropriate antibiotic were isolated and screened for the gene insert by PCR. Plasmids from verified transformants were isolated and the sequence of the gene insert was further confirmed by DNA sequencing (Lone Star Labs, Houston, Tex.). Except for the expression of BktB, the sequence-confirmed plasmids were introduced to BL21(DE3) (Studier et al. 1986). The plasmid harboring the gene encoding BktB was introduced into AG1 (Agilent Technologies, Inc., Santa Clara, Calif.).

(72) Primers used for genetic cloning in this example are shown in Table 8 below:

(73) TABLE-US-00008 TABLE 8 List of primers used in Example 1. Seq. ID No. Name Sequence Description  1 ppfadA-f1 GCCAGGATCCGAATTCGAGCCTGAATCCGCGTGATG ppfadA forward  2 ppfadA-r1 CGCCGAGCTCGAATTCTTAAACACGTTCAAAAACG ppfadA reverse  3 ppfadA- CAGGACCTGTTTGGTGTTCG ppfadA sf1 sequencing  4 ppfadA- AAATGCCGGTTTCAGGCTGG ppfadA sr1 sequencing  5 fadAx-f1 GCCAGGATCCGAATTCGACCCTGGCAAATGATCCGAT fadAx forward  6 fadAx-r1 CGCCGAGCTCGAATTCTTAATACAGACATTCAACTGCC fadAx reverse  7 fadAx-sf1 GCACAGGCAAATGCCTTTAG fadAx sequencing  8 fadAx-sr1 TTCATCATCTTTGATCACGCG fadAx sequencing  9 pcaF-f1 GAGGAATAAACCATGCATGATGTCTTTATCTGTG pcaF forward 10 pcaF-r1 GATGATGATGGTCGACAACACGTTCAATAGCCAGAGC pcaF reverse 11 pcaF-sf1 CAGACAACGTGGCTGATGAC pcaF sequencing 12 pcaF-sr1 CAGTTTGGTCAGGGCTTCC pcaF sequencing 13 dcaF-f1 GCCAGGATCCGAATTCGCTGAACGCCTATATCTATGA dcaF forward 14 dcaF-r1 CGCCGAGCTCGAATTCTTAGCTCACATTTTCAATAACC dcaF reverse 15 dcaF-sf1 AAGCGCATATAGCCGTGATG dcaF sequencing 16 dcaF-sr1 TTTTGTTCGGGAAACGGGTG dcaF sequencing 17 dcaF-sf2 GCCAGCGGTATTAATGATGG dcaF sequencing 18 dcaF-sr2 TTTCTGACCTGCAACTTCGC dcaF sequencing 19 bktB-f1 CGCGCGGCAGCCATATGACGCGTGAAGTGGTAGTG bktB forward 20 bktB-r1 GCTCGACTCACTCGAGTCAGATACGCTCGAAGATGG bktB reverse 21 bktB-sf1 AAGGAATACGACATCTCGCG bktB forward 22 bktB-sr1 CGGTGTCGAAGGTCACGTC bktB reverse 23 scfadA-f1 GCCAGGATCCGAATTCAGCAGCGGTACAACCAGCAG scfadA forward 24 scfadA-r1 CGCCGAGCTCGAATTCTTATGCTTTCGGAACACGAAC scfadA reverse 25 scfadA- CAATGGCACATGATGGTCTG scfadA sf1 sequencing 26 scfadA- GGTAATGGTGCCATCTTTTGC scfadA sr1 sequencing

(74) The codon-optimized ppfadA gene insert was PCR amplified with ppfadA-f1 and ppfadA-r1 primers and inserted into vector pCDFDuet-1 (Novagen, Darmstadt, Germany) cleaved by EcoRI (New England Biolabs, Ipswich, Mass.) through In-Fusion HD Eco-Dry Cloning system (Clontech laboratories, Mountain View, Calif.) to construct pCDF-ntH6-ppfadA. The sequence of the ppfadA gene insert was further confirmed by DNA sequencing (Lone Star Labs, Houston, Tex.) with usage of ppfadA-sf1 and ppfadA-sr1 sequencing primers. The protein was expressed with an n-terminal 6 His-tag.

(75) The codon-optimized fadAx gene insert was PCR amplified with fadAx-f1 and fadAx-r1 primers and inserted into vector pCDFDuet-1 (Novagen, Darmstadt, Germany) cleaved by EcoRI (New England Biolabs, Ipswich, Mass.) through In-Fusion HD Eco-Dry Cloning system (Clontech laboratories, Mountain View, Calif.) to construct pCDF-ntH6-fadAx. The sequence of the fadAx gene insert was further confirmed by DNA sequencing (Lone Star Labs, Houston, Tex.) with usage of fadAx-sf1 and fadAx-sr1 sequencing primers. The protein was expressed with an n-terminal 6 His-tag.

(76) The codon-optimized pcaF gene insert was PCR amplified with pcaF-f1 and pcaF-r1 primers and inserted into vector pTrcHis2A (Invitrogen, Carlsbad, Calif.) cleaved by NcoI and SalI (New England Biolabs, Ipswich, Mass., USA) through In-Fusion HD Eco-Dry Cloning system (Clontech laboratories, Mountain View, Calif.) to construct pTH-ctH6-pcaF. The sequence of the pcaF gene insert was further confirmed by DNA sequencing (Lone Star Labs, Houston, Tex.) with usage of pcaF-sf1 and pcaF-sr1 sequencing primers. The protein was expressed with a c-terminal 6 His-tag.

(77) The codon-optimized dcaF gene insert was PCR amplified with dcaF-f1 and dcaF-r1 primers and inserted into vector pCDFDuet-1 (Novagen, Darmstadt, Germany) cleaved by EcoRI (New England Biolabs, Ipswich, Mass.) through In-Fusion HD Eco-Dry Cloning system (Clontech laboratories, Mountain View, Calif., USA) to construct pCDF-ntH6-dcaF. The sequence of the dcaF gene insert was further confirmed by DNA sequencing (Lone Star Labs, Houston, Tex.) with usage of dcaF-sf1, dcaF-sr1, dcaF-sf2 and dcaF-sr2 sequencing primers. The protein was expressed with an n-terminal 6 His-tag.

(78) The codon-optimized bktB gene insert was PCR amplified with bktB-f1 and bktB-r1 primers and inserted into vector pUCBB-ntH6-eGFP (Vick et al. 2011) cleaved by NdeI and XhoI (New England Biolabs, Ipswich, Mass.) through In-Fusion HD Eco-Dry Cloning system (Clontech laboratories, Mountain View, Calif.) to construct pUCBB-ntH6-bktB. The sequence of the bktB gene insert was further confirmed by DNA sequencing (Lone Star Labs, Houston, Tex.) with usage of bktB-sf1 and bktB-sr1 sequencing primers. The protein was expressed with an n-terminal 6 His-tag.

(79) The codon-optimized scfadA gene insert was PCR amplified with scfadA-f1 and scfadA-r1 primers and inserted into vector pCDFDuet-1 (Novagen, Darmstadt, Germany) cleaved by EcoRI (New England Biolabs, Ipswich, Mass.) through In-Fusion HD Eco-Dry Cloning system (Clontech laboratories, Mountain View, Calif.) to construct pCDF-ntH6-scfadA. The sequence of the scfadA gene insert was further confirmed by DNA sequencing (Lone Star Labs, Houston, Tex., USA) with usage of scfadA-sf1 and scfadA-sr1 sequencing primers. The protein was expressed with an n-terminal 6 His-tag.

(80) For expression of polyketoacyl-CoA thiolases, cultures were grown in 25 mL of LB media in 125 mL flasks (Wheaton Industries, Inc., Millville, N.J.) at 37° C. A single colony of the desired strain was cultivated overnight (14-16 hrs) in 10 mL of LB medium in baffled flasks (Wheaton Industries, Inc., Millville, N.J.) with appropriate antibiotics and used as the inoculum (1 mL). Except for the expression of bktB, the cells were induced with 0.1 mM IPTG at an OD550˜0.6, while bktB was expressed constitutively.

(81) After post-induction growth for 4 h for ASKA strains, or 16 for other strains, the cells were collected and washed twice by 9 g/L sodium chloride solution. Cells were then re-suspended in lysis buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 10 mM imidazole, pH 8.0) to an OD˜40. After re-suspension, the cells were disrupted using glass beads and then centrifuged at 4° C., 13000G, 10 min in an Optima L-80XP Ultracentrifuge (Beckman-Coulter, Schaumburg, Ill.). The resultant supernatant is the crude enzyme extract.

(82) The His-tagged enzymes were then purified from crude extract by using Ni-NTA spin kit (Qiagen, Valencia, Calif.). The crude extracts are centrifuged (270G, 5 min) in spin columns, which have been equilibrated with lysis buffer and then washed twice by wash buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 20 mM imidazole, pH 8.0). After washing, the enzyme is eluted twice in elution buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 500 mM imidazole, pH 8.0). Both washing and elution steps are centrifuged at 890 g for 2 min. The purified enzyme extracts were then further concentrated and dialyzed through Amicon® Ultra 10K Device (Millipore, Billerica, Mass.). The enzymes were first filtered by centrifugation at 4° C., 14000G, 10 min, and then washed with 100 mM potassium phosphate, pH 7 buffer under the same centrifugation conditions. Finally, the concentrated and dialyzed enzymes were recovered through 4° C., 1000G, 2 min centrifugation.

(83) The protein concentration was established using the Bradford Reagent (Thermo Scientific, Waltham, Mass.) using BSA as the protein standard. SDS-PAGE monitor of purified proteins was performed through XCell SureLock™ Mini-cell system (Invitrogen, Carlsbad, Calif.) with gels (12% acrylamide resolving gel and 4% acrylamide stacking gel) prepared through SureLock™ Mini-cell system (Invitrogen, Carlsbad, Calif.). The composition of the running buffer for SDS-PAGE was 3 g/L tris base, 14.4 g/L glycine and 1 g/L SDS in water.

(84) Enzymatic assays for the formation of triacetic acid lactone (TAL) through polyketoacyl-CoA thiolase condensation between acetoacetyl-CoA and acetyl-CoA was performed in the presence of 100 mM potassium phosphate pH 7, 3 mM EDTA, 1 mM acetoacetyl-CoA and 1 mM acetyl-CoA in a total volume of 200 μL for DcaF, ScFadA and FadAx, or 220 μL for other tested thiolases at 25° C. For DcaF, ScFadA and FadAx, 4 μL of undiluted enzyme elute was added in the assay system, while for other thiolases, 24 μL of undiluted enzymes were added. Activity was monitored in a Biomate 5 Spectrophotometer (Thermo Scientific, Waltham, Mass.) by the increase of TAL at 298 nm using an extinction coefficient of 2.9443 mM.sup.−1 cm.sup.−1 measured through calibration of TAL standards. Two controls were also tested for each assay: one without the addition of substrates acetoacetyl-CoA and acetyl-CoA; one without the addition of enzyme. TAL formation in assay samples was then identified via HPLC using a Shimadzu LC-20AD HPLC system with an SPD-20A dual-wavelength UV-vis detector and a Phenomonex Luna C18 column (25 cm×4.6 mm, 5 μm) (Tang et al. 2013). The following elution profile (Xie et al. 2006) was used: solvent A, 1% (v/v) acetic acid in water; solvent B, 1% (v/v) acetic acid in acetonitrile; gradient: 5% B (0-5 min), 5-15% B (5-18 min), 15-100% B (18-23 min), 100% B (23-30 min); flow rate 1.0 mL/min; wavelength, 300 nm.

(85) Among the tested enzymes for polyketoacyl-CoA thiolase activity (AtoB, FadA, PaaJ, PpFadA, FadAx, PcaF, DcaF, BktB and ScFadA), samples of AtoB, FadA, PaaJ and PpFadA did not show the increase in absorbance at 298 nm expected from the production of TAL. PcaF showed a sharp increase in absorbance at of 298 nm first, then remained flat at saturated level, as shown in FIG. 10, indicating the synthesis of TAL. BktB, ScFadA, DcaF and FadAx also showed linear increase in absorbance at 298 nm, indicating their activity in the synthesis of TAL, as shown in FIG. 11-14 respectively. No controls showed the observed increase in absorbance at 298 nm.

(86) The SDS-PAGE gel of purified PcaF, BktB, ScFadA, DcaF and FadAx, (all the enzymes that showed the increase in absorbance 298 nm) in the assay of in vitro TAL synthesis, is shown in FIG. 9. The measured TAL synthesis specific activities of tested polyketoacyl-CoA thiolases calculated through linear 298 nm absorbance increase rates of their assay samples were as shown in Table 9:

(87) TABLE-US-00009 TABLE 9 Identification of polyketoacyl-CoA thiolases for TAL synthesis through non-decarboxylative Claisen condensation between acetoacetyl-CoA (a ketoacyl-CoA acting as primer) and acetyl-CoA (an acyl-CoA acting as extender unit. Measured specific activity (μmol/mg Enzyme Substrate protein/min) Reference E. coli AtoB Acetoacetyl-CoA + N.D. This work acetyl-CoA E. coli FadA Acetoacetyl-CoA + N.D. This work acetyl-CoA E. coli PaaJ Acetoacetyl-CoA + N.D. This work acetyl-CoA Pseudomonas putida Acetoacetyl-CoA + N.D. This work FadA acetyl-CoA Pseudomonas putida Acetoacetyl-CoA + N.D. This work PcaF acetyl-CoA Pseudomonas putida Acetoacetyl-CoA + 0.052 ± 0.014 This work FadAx acetyl-CoA Acinetobacter sp. Acetoacetyl-CoA + 0.041 This work DcaF acetyl-CoA Streptomyces Acetoacetyl-CoA + 0.007 This work collinus FadA acetyl-CoA Ralstonia eutropha Acetoacetyl-CoA + 0.00019 This work BktB acetyl-CoA N.D. means not detected.

(88) Despite the increase in absorbance at 298 nm, the specific activity of PcaF on TAL synthesis was not calculated as the increase of absorbance was not linear.

(89) Replicate assay samples of FadAx for in vitro TAL synthesis were then analyzed through RP-HPLC along with 0.31 mM TAL standard. Both samples showed the peak at the same retention time with that of TAL standard, indicating TAL formation in these samples. The quantified TAL titer in sample 1 was 0.0396 mM and the titer in sample 2 was 0.0346 mM.

In Vivo Synthesis of TAL

(90) The purpose of this experiment was to clone and express polyketoacyl-CoA thiolases in an Escherichia coli strain already overexpressing a type II thiolase-acetoacetyl-CoA thiolase AtoB (NP_416728.1) for in vivo microbial synthesis of triacetic acid lactone (TAL) through polyketoacyl-CoA thiolase-catalyzed non-decarboxylative Claisen condensation between a ketoacyl-CoA (acetoacetyl-CoA), serving as the primer, and acetyl-CoA, serving as the extender unit. Acetoacetyl-CoA was supplied through AtoB-catalyzed non-decarboxylative Claisen condensation between two acetyl-CoAs. Acetyl-CoA was supplied through glycolysis from carbon source glycerol.

(91) JST06(DE3) atoB.sup.CT5 served as the host strain for the in vivo production of TAL. JST06(DE3) (MG1655(DE3) ΔldhA ΔpoxB Δpta ΔadhE ΔfrdA ΔyciA ΔybgC ΔydiI ΔtesA ΔfadM ΔtesB) (Cheong et al. 2016) is an E. coli strain deficient in mixed-acid fermentation pathways due to deletions of genes ldhA, poxB, pta, adhE and frdA, which maximizes the supply of acetyl-CoA, and deletions of genes encoding major thioesterases (yciA, ybgC, ydiI, tesA, fadM and tesB), which minimize the hydrolysis of acetyl-CoA and acetoacetyl-CoA.

(92) The genotype atoB.sup.CT5 refers to chromosomal atoB gene under the p.sup.CT5 promoter for controlled induction by cumate. To enable the cumate-inducible chromosomal expression of atoB gene in JST06(DE3), E. coli atoB gene was first PCR amplified from genomic DNA extracted through Genomic DNA Purification kit (Promega, Fitchburg, Wis., USA), digested with BglII and NotI (New England Biolabs, Ipswich, Mass., USA), and ligated by T4 ligase (Invitrogen, Carlsbad, Calif.) into pUCBB-ntH6-eGFP (Vick et al. 2011) that was previously digested with BglII and NotI to produce pUCBB-P.sup.CT5-atoB. The resulting ligation products were used to transform E. coli DH5a (Invitrogen, Carlsbad, Calif.), and positive clones identified by PCR were confirmed by DNA sequencing.

(93) To integrate the cumate-controlled atoB construct into the chromosome of JST06(DE3), first the cumate repressor (cymR), promoter/operator regions (P.sup.CT5), and respective ORFs were PCR amplified, as was the kanamycin drug construct via pKD4 (Datsenko and Wanner, 2000). These respective products were linked together via overlap extension PCR to create a final chromosomal targeting construct. Integration of the cumate-controlled constructs was achieved via standard recombineering protocols by using strain HME45 and selection on LB drug plates (Thomason et al. 2001). The primers used in the construction of JST06(DE3) atoB.sup.CT5 are listed as in Table 10 below:

(94) TABLE-US-00010 TABLE 10 List of primers used in the construction of strain JST06(DE3) atoB.sup.CT5 Seq. ID No. Name Sequence 27 kan-homatoE-L TTGGTTTAACGCTGTTCTGACGGCACCCCTACAAACAGAA GGAATATAAACATATGAATATCCTCCTTA 28 kan-ovcymatoB-R TCTGAAATTCTGCCTCGTGAGTGTAGGCTGGAGCTGCTTCG 29 cym-pCTC-atoB-ovkan- CGAAGCAGCTCCAGCCTACACTCACGAGGCAGAATTTCAGA L 30 atoBintrecomb-R GCCAGCCCGCTTTTTAAC

(95) Five polyketoacyl-CoA thiolases were selected the based on their ability to catalyze the synthesis of TAL in in vitro and overexpressed in JST06(DE3) atoB.sup.CT5 strain: FadAx (AAK18171.1) and PcaF (AAA85138.1) from Pseudomonas putida, DcaF (CAG68532.1) from Acinetobacter sp. ADP1, BktB (AAC38322.1) from Ralstonia eutropha and ScFadA (AAL10298.1) from Streptomyces collinus. Codon-optimized genes encoding Pseudomonas putida FadAx, Acinetobacter sp. DcaF, and Streptomyces collinus FadA were cloned into the pCDFDuet-1 vector (Novagen, Darmstadt, Germany). Cloning and isolation of confirmed plasmids was conducted as described above. The sequence confirmed plasmids were then introduced to competent JST06(DE3) atoB.sup.CT5 cells.

(96) MOPS minimal medium (Neidhardt et al., 1974) with 125 mM MOPS and Na.sub.2HPO.sub.4 in place of K.sub.2HPO.sub.4 (2.8 mM), supplemented with 20 g/L glycerol, 10 g/L tryptone, 5 g/L yeast extract, 100 μM FeSO.sub.4, 5 mM calcium pantothenate, 5 mM (NH.sub.4).sub.2SO.sub.4, and 30 mM NH.sub.4Cl was used for fermentations. Antibiotics (50 μg/mL carbenicillin and 50 μg/mL spectinomycin) were included when appropriate. All chemicals were obtained from Fisher Scientific Co. (Pittsburgh, Pa.) and Sigma-Aldrich Co. (St. Louis, Mo.).

(97) Fermentations were performed in 25 mL Pyrex Erlenmeyer flasks (narrow mouth/heavy duty rim, Corning Inc., Corning, N.Y.) filled with 20 mL fermentation medium and sealed with foam plugs filling the necks. A single colony of the desired strain was cultivated overnight (14-16 hrs) in LB medium with appropriate antibiotics and used as the inoculum (1%). After inoculation, flasks were incubated in a NBS I24 Benchtop Incubator Shaker (New Brunswick Scientific Co., Inc., Edison, N.J.) at 200 rpm and 37° C. When optical density (550 nm, OD.sub.550) reached ˜0.3-0.5, 5 μM isopropyl β-D-1-thiogalactopyranoside (IPTG) was added for plasmid gene induction. For induction of controlled chromosomal expression of atoB constructs, 0.1 mM cumate was also added. Flasks were then incubated under the same conditions for 48 hours post-induction. After the fermentation, the supernatant obtained through 5000G, 5 min centrifuge in an Optima L-80XP Ultracentrifuge (Beckman-Coulter, Schaumburg, Ill.) of 2 mL culture was collected as the sample for HPLC analysis.

(98) The quantification of TAL was performed via ion-exclusion HPLC using a Shimadzu Prominence SIL 20 system (Shimadzu Scientific Instruments, Inc., Columbia, Md.) equipped with an HPX-87H organic acid column (Bio-Rad, Hercules, Calif.) with operating conditions to optimize peak separation (0.3 mL/min flow rate, 30 mM H.sub.2SO.sub.4 mobile phase, column temperature 42° C.). Concentration of TAL in fermentation samples was determined through calibration to known TAL standards (1, 0.5, 0.25 and 0.1 g/L).

(99) Among the tested strains, JST06(DE3) atoB.sup.CT5 overexpressing BktB showed the highest production of TAL at 0.36 g/L, demonstrating the in vivo synthesis of TAL using a polyketoacyl-CoA thiolase through non-decarboxylative Claisen condensation between acetoacetyl-CoA and acetyl-CoA. It also indicates that, JST06(DE3) atoB.sup.CT5 is a suitable host strain for supplying acetoacetyl-CoA and acetyl-CoA. As such, this demonstrates the use of an acetoacetyl-CoA thiolase/ketoacyl-CoA thiolase for the generation of the ketoacetyl-CoA primer in combination with a polyketoacyl-CoA thiolase for the subsequent non-decarboxylative condensation of acetyl-CoA with said ketoacetyl-CoA primer to form a polyketoacyl-CoA.

In Vitro Synthesis of Dehydroacetic Acid

(100) The purpose of this experiment was to clone, express and purify polyketoacyl-CoA thiolases and test their activities for in vitro synthesis of dehydroacetic acid through non-decarboxylative Claisen condensation between two acetoacetyl-CoAs (ketoacyl-CoAs), one serving as the primer, and the other serving as the extender unit. The dehydroacetic acid synthesis reaction is shown in FIG. 8.

(101) Three polyketoacyl-CoA thiolases were selected based on their ability to catalyze the synthesis of TAL in vitro and tested: FadAx (AAK18171.1) and PcaF (AAA85138.1) from Pseudomonas putida, and ScFadA (AAL10298.1) from Streptomyces collinus. Cloning and isolation of confirmed plasmids was conducted as described above.

(102) Following expression and purification of polyketoacyl-CoA thiolases as described above, the concentrated and dialyzed enzymes were recovered through 4° C., 1000G, 2 min centrifugation. The protein concentration was established using the Bradford Reagent (Thermo Scientific, Waltham, Mass.) using BSA as the protein standard. SDS-PAGE monitor of purified proteins was performed through XCell SureLock™ Mini-cell system (Invitrogen, Carlsbad, Calif.) with gels (12% acrylamide resolving gel and 4% acrylamide stacking gel) prepared through SureLock™ Mini-cell system (Invitrogen, Carlsbad, Calif.). The composition of the running buffer for SDS-PAGE was 3 g/L tris base, 14.4 g/L glycine and 1 g/L SDS in water. The SDS-PAGE gel can be seen in FIG. 9.

(103) Dehydroacetic acid synthesis through polyketoacyl-CoA thiolase condensation between two molecules of acetoacetyl-CoA was performed in the presence of 100 mM potassium phosphate pH 7, 3 mM EDTA and 1 mM acetoacetyl—in a total volume of 200 μL for FadAx, or 220 μL for DcaF and PcaF at 25° C. For FadAx, 4 μL of undiluted enzyme elute was added in the assay system, while for PcaF and DcaF, 24 μL of undiluted enzymes were added. Activity was monitored in a Biomate 5 Spectrophotometer (Thermo Scientific, Waltham, Mass.) by the increase in absorbance at 312 nm (absorbance of dehydroacetic acid) using an extinction coefficient of 4.8567 mM.sup.−1 cm.sup.−1 measured through calibration of dehydroacetic acid standards. Two controls were also tested for each assay: one without the addition of substrate acetoacetyl-CoA; one without the addition of enzyme.

(104) Among the tested polyketoacyl-CoA thiolases (FadAx, PcaF and DcaF), sample of DcaF did not show the increase of 312 nm absorbance. The sample of PcaF showed the sharp increase of 312 nm absorbance at first then remained flat at saturated level, as shown in FIG. 16, indicating its activity of dehydroacetic acid synthesis. The sample of FadAx first showed linear increase in absorbance at 312 nm, and then the increase rate diminished, indicating their activities on dehydroacetic acid synthesis, as shown in FIG. 17. No controls showed the increase of 312 nm wavelength. The measured specific activity of PcaF was calculated from the increase rate at the initial phase (0.044 μmol/min/mg), which is close to its measured specific activity on TAL synthesis (0.052±0.014 μmol/min/mg) as shown above.

(105) This demonstrates the ability of certain polyketoacyl-CoA thiolases to condense two ketoacyl-CoA molecules (one as the primer and one as the extender) for the formation of polyketoacyl-CoAs with different functionalization compared to the use of acetyl-CoA as the priming molecule. Thus, polyketoacyl-CoA thiolases not only use ketoacyl-CoAs (e.g. acetoacetyl-CoA) as a primer, but also as extender units.

(Prophetic) In Vivo Synthesis of Dehydroacetic Acid

(106) The purpose of this experiment is to clone and express polyketoacyl-CoA thiolases in an Escherichia coli strain already overexpressing acetoacetyl-CoA thiolase AtoB (NP_416728.1, EC 2.3.1.9) for in vivo microbial synthesis of dehydroacetic acid through polyketoacyl-CoA thiolase-catalyzed non-decarboxylative Claisen condensation between two acetoacetyl-CoAs (ketoacyl-CoAs), one serving as the primer and the other serving as the extender unit. Acetoacetyl-CoA is supplied through AtoB-catalyzed non-decarboxylative Claisen condensation between two acetyl-CoAs. Acetyl-CoA is supplied through glycolysis from a carbon source such as glycerol, or sugars.

(107) JST06(DE3) atoB.sup.CT5 serves as the host strain for the in vivo production of dehydroacetic acid. JST06(DE3) (MG1655(DE3) ΔldhA ΔpoxB Δpta ΔadhE ΔfrdA ΔyciA ΔybgC ΔydiI ΔtesA ΔfadM ΔtesB) (Cheong et al. 2016) is an E. coli strain deficient in mixed-acid fermentation pathways due to deletions of genes ldhA, poxB, pta, adhE and frdA, which maximize the supply of acetyl-CoA, and deletions of genes encoding major thioesterases (yciA, ybgC, ydiI, tesA, fadM and tesB), which minimize the hydrolysis of acetyl-CoA and acetoacetyl-CoA. This strain is constructed as described above, with the primers used in the construction of JST06(DE3) atoB.sup.CT5 listed in Table 10.

(108) Two polyketoacyl-CoA thiolases are selected and overexpressed in JST06(DE3) atoB.sup.CT5 strain: FadAx (AAK18171.1) and PcaF (AAA85138.1) from Pseudomonas putida. These polyketoacyl-CoA thiolases are chosen because they showed the ability to catalyze the synthesis of dehydroacetic acid in in vitro assays as shown above. Genes encoding Pseudomonas putida FadAx and PcaF are cloned into appropriate vectors as described above and transformed into the appropriate host strain.

(109) Fermentations are conducted as described above using a media such as MOPS minimal medium (Neidhardt et al., 1974). Inoculation and induction are as described above with flasks then incubated for 48 hours post-induction. After the fermentation, the supernatant obtained through 5000G, 5 min centrifuge in an Optima L-80XP Ultracentrifuge (Beckman-Coulter, Schaumburg, Ill.) of 2 mL culture is prepared for GC-FID analysis.

(110) The supernatant aliquots of 2 mL are transferred to 5 mL glass vials (Fisher Scientific Co., Pittsburgh, Pa.). Samples were supplemented with 2 mg of 4-pentylbenzoic acid as internal standard and extracted with 2 mL of hexane. 80 μL of 50% H.sub.2SO.sub.4 and 340 μL of 30% NaCl solution are also added for pH and ionic strength adjustment, respectively. Vials are tightly closed, vortexed for 30 s, and mixed in a Glas-Col rotator (Glas-Col, Terre Haute, Ind.) at 60 rpm for 2 h. Samples are then vortexed again for 30 s and centrifuged at 8000 rpm at 4° C. for 1 min. Aliquots of 1.5 mL of the organic layer were transferred to 2 mL borosilicate glass vials with PTFE/silicone screw caps (Fisher Scientific Co., Pittsburgh, Pa.) and mixed with 100 μL of pyridine and 100 μL of N,O-bis(trimethylsilyl)trifluoroacetamide (BSTFA). Samples are incubated in sealed vials at 70° C. for 60 min using an AccuBlock Digital Dry Bath (LabNet, Woodbridge, N.J.), and silylated samples are analyzed via GC-FID quantification analysis.

(111) The quantification of dehydroacetic acid is performed in a Varian CP-3800 gas chromatograph (Varian Associates, Inc., Palo Alto, Calif.), equipped with a flame ionization detector (GC-FID) and an HP-INNOWax capillary column (0.32 mm internal diameter, 0.50 μm film thickness, 30 m length; Agilent Technologies, Inc., Santa Clara, Calif.), following the method: 100° C. initial column temperature, 15° C./min to 300° C., and 300° C. held for 8 min. Helium (1 mL/min, Matheson Tri-Gas, Longmont, Colo.) is used as the carrier gas. The injector and detector are maintained at 280 and 300° C., respectively. A 1 μL sample is injected in splitless injection mode.

(Prophetic) In Vivo Synthesis of Olivetolic Acid

(112) The purpose of this experiment is to clone and express polyketoacyl-CoA thiolases along with olivetolic acid cyclase OAC (AFN42527.1) from Cannabis sativa in an Escherichia coli strain already overexpressing polyketoacyl-CoA thiolase BktB (AAC38322.1) from Ralstonia eutropha, 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase multifunctional enzyme FadB from E. coli (NP_418288.1) and enoyl-CoA reductase Ter from Euglena gracilis (abbreviated egTER) (Q5EU90.1) for in vivo microbial synthesis of olivetolic acid.

(113) Polyketoacyl-CoA thiolase catalyzes two sequential non-decarboxylative Claisen condensation reactions with 3-oxooctanoyl-CoA as the initial primer and acetyl-CoA as the extender unit. The first reaction condenses 3-oxooctanoyl-CoA and acetyl-CoA to a diketoacyl-CoA 3,5-dioxodecanoyl-CoA. The second reaction condenses 3,5-dioxodecanoyl-CoA and acetyl-CoA to a triketoacyl-CoA 3,5,7-trioxododecanoyl-CoA.

(114) Olivetolic acid cyclase OAC converts 3,5,7-trioxododecanoyl-CoA to olivetolic acid. BktB catalyzes the non-decarboxylative Claisen condensation reaction between hexanoyl-CoA and acetyl-CoA to supply 3-oxoocatonyl-CoA. Hexanoyl-CoA is supplied through β-oxidation reversal pathway composed of BktB, FadB and egTER with acetyl-CoA as the initial primer and extender unit. Acetyl-CoA is supplied through glycolysis from a carbon source such as glycerol or sugars. This pathway for olivetolic acid synthesis is shown in FIG. 18.

(115) JST06(DE3) ΔfadE bktB.sup.CT5 ΔatoB fadB.sup.CT5 ΔfadA egter.sup.CT5 @fabI serves as the host strain for the in vivo production of olivetolic acid. JST06(DE3) (MG1655(DE3) ΔldhA ΔpoxB Δpta ΔadhE ΔfadA ΔyciA ΔybgC ΔydiI ΔtesA ΔfadM ΔtesB) (Cheong et al. 2016) is an E. coli strain deficient in mixed-acid fermentation pathways due to deletions of genes ldhA, poxB, pta, adhE and frdA, which maximize the supply of acetyl-CoA, and deletion of genes encoding major thioesterases (yciA, ybgC, ydiI, tesA, fadM and tesB), which minimize the hydrolysis of intermediate acyl-CoAs. As such, this strain is selected to maximize the flux of β-oxidation reversal for hexanoyl-CoA supply required for the synthesis of olivetolic acid via polyketoacyl-CoA thiolases.

(116) BktB, FadB and egTER are chromosomally expressed under p.sup.CT5 promoter with control by cumate. The chromosomal gene atoB is replaced with cumate controlled bktB. For the replacement of atoB with bktB from Ralstonia eutropha, a cat-sacB cassette was PCR amplified from genomic DNA with appropriate primers with appended homology for recombination after atoB. This cat-sacB cassette is recombineered into a HME45 strain already harboring a kanamycin resistance marker, cymR repressor gene and hybrid cumate-controlled phage T5 promoter in place of the native atoB promoter whose construction has been described above, resulting in an atoB.sup.CT5-cat-sacB insertion cassette. bktB is then PCR amplified from with appropriate primers containing homology for recombination, and recombineered into the HME45 strain resulting in a kan-cymR-P.sup.CT5-bktB construct at the atoB locus after negative selection on sucrose plates. Integration of the cumate-controlled bktB constructs in the chromosome of the target strain is achieved via standard recombineering protocols by using this HME45 derivative strain and selection on LB drug plates (Thomason et al. 2001).

(117) To enable the cumate-inducible chromosomal expression of fadB gene, E. coli fadB gene is first PCR amplified using appropriate primers from genomic DNA extracted through Genomic DNA Purification kit (Promega, Fitchburg, Wis.), digested with BglII and NotI (New England Biolabs, Ipswich, Mass.), and ligated by T4 ligase (Invitrogen, Carlsbad, Calif.) into pUCBB-ntH6-eGFP (Vick et al. 2011) that is previously digested with BglII and NotI to produce pUCBB-P.sup.CT5-fadB. The resulting ligation products are used to transform E. coli DH5a (Invitrogen, Carlsbad, Calif.), and positive clones identified by PCR were confirmed by DNA sequencing.

(118) To integrate the cumate-controlled bktB construct into the chromosome of the target strain, first the cumate repressor (cymR), promoter/operator regions (P.sup.CT5), and respective ORFs are PCR amplified using appropriate primers, as is chloramphenicol drug construct via pKD4 (Datsenko and Wanner, 2000). These respective products are linked together via overlap extension PCR to create a final chromosomal targeting construct. Integration of the cumate-controlled fadB constructs is achieved via standard recombineering protocols by using strain HME45 and selection on LB drug plates (Thomason et al. 2001).

(119) The fadA gene was separately deleted via recombineering in the HME45 derivative harboring the cumate-controlled fadBA construct by replacement of the fadA ORF with a zeocin resistance marker amplified from pKDzeo (Magner et al. 2007). For the creation of the cumate-controlled egTER, the cat gene, cymR repressor gene, hybrid cumate-controlled phage T5 promoter, and egTER gene are PCR amplified from genomic DNA of a strain with egTER seamlessly replacing fadBA at the cumate controlled fadBA locus (see below for details). This product is recombineered into strain HME45 at the end of the fabI locus, selecting on chloramphenicol (12.5 μg/ml) LB plates. Integration is done in a manner to duplicate the last 22 bp of fabI (including stop codon) so as retain an overlapping promoter for the next native downstream gene.

(120) Construction of the strain serving as the PCR template for egTER described above was accomplished by first creating a kan-sacB fusion cassette via overlap extension PCR using pKD4 and genomic DNA, respectively. This kan-sacB cassette was integrated between fadB and fadA of the fadBA.sup.CT5 strain formerly constructed (Vick et al., 2014) through subsequent recombineering. Seamless replacement of the kan-sacB cassette to create the cat-cymR-P.sup.CT5-egTER at the fadBA locus was done via recombineering and subsequent sucrose selection with codon optimized egter (Genscript, Piscataway, N.J.) PCR product.

(121) Four polyketoacyl-CoA thiolases were selected and overexpressed: FadAx (AAK18171.1) and PcaF (AAA85138.1) from Pseudomonas putida, DcaF (CAG68532.1) from Acinetobacter sp. ADP1, and ScFadA (AAL10298.1) from Streptomyces collinus. These polyketoacyl-CoA thiolases are selected based on their ability to catalyze the synthesis of TAL in in vitro assays, and they do not cause crosstalk with the overexpressed β-oxidation reversal pathway.

(122) Codon-optimized genes encoding these thiolases are cloned together with the codon-optimized gene encoding OAC into appropriate vectors. These genes are amplified through PCR using appropriate primers to append homology on each end for recombination into the vector backbone with Phusion polymerase (Thermo Scientific, Waltham, Mass.) to serve as the gene insert. Cloning and isolation of confirmed plasmids are conducted as described above.

(123) MOPS minimal medium (Neidhardt et al., 1974) with 125 mM MOPS and Na.sub.2HPO.sub.4 in place of K.sub.2HPO.sub.4 (2.8 mM), supplemented with 10 g/L tryptone, 5 g/L yeast extract, 100 μM FeSO.sub.4, 5 mM calcium pantothenate, 5 mM (NH.sub.4).sub.2SO.sub.4, and 30 mM NH.sub.4C1 is used for fermentations. Antibiotics (50 μg/mL carbenicillin and 50 μg/mL spectinomycin) were included when appropriate. All chemicals are obtained from Fisher Scientific Co. (Pittsburgh, Pa.) and Sigma-Aldrich Co. (St. Louis, Mo.).

(124) Fermentations are conducted in a SixFors multi-fermentation system (Infors HT, Bottmingen, Switzerland) with an air flowrate of 2 N L/hr, independent control of temperature (37° C.), pH (controlled at 7.0 with NaOH and H.sub.2SO.sub.4), and stirrer speed (660 rpm). The above fermentation media with 50 g/L glycerol, the inclusion of 5 μM sodium selenite, and 1 μM IPTG are used. Pre-cultures are grown as described above and incubated for 4 hours post-induction. An appropriate amount of this pre-culture is centrifuged, washed twice with fresh media, and used for inoculation with a target initial optical density of 0.05-0.1 (400 mL initial volume).

(125) At various fermentation times samples are taken and 2 mL supernatant is collected through 5000G, 5 min centrifuge in an Optima L-80XP Ultracentrifuge (Beckman-Coulter, Schaumburg, Ill.) of culture and is prepared for GC-FID analysis.

(126) The supernatant aliquots of 2 mL are transferred to 5 mL glass vials (Fisher Scientific Co., Pittsburgh, Pa.) and extraction and derivatization with BSTFA conducted as described above. The quantification of olivetolic acid is performed in a Varian CP-3800 gas chromatograph (Varian Associates, Inc., Palo Alto, Calif.), equipped with a flame ionization detector (GC-FID) and an HP-INNOWax capillary column (0.32 mm internal diameter, 0.50 μm film thickness, 30 m length; Agilent Technologies, Inc., Santa Clara, Calif.), following the method: 100° C. initial column temperature, 15° C./min to 300° C., and 300° C. held for 8 min. Helium (1 mL/min, Matheson Tri-Gas, Longmont, Colo.) is used as the carrier gas. The injector and detector are maintained at 280 and 300° C., respectively. A 1 μL sample is injected in splitless injection mode.

(Prophetic) In Vivo Synthesis of Cannabigerolic Acid (CBGA)

(127) The purpose of this experiment is to clone and express polyketoacyl-CoA thiolases along with olivetolic acid cyclase OAC (AFN42527.1) and from Cannabis sativa and aromatic prenyltransferases in an Escherichia coli strain already overexpressing ketoacyl-CoA thiolase BktB (AAC38322.1) from Ralstonia eutropha, 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase multifunctional enzyme FadB from E. coli (NP_418288.1) and egTER (Q5EU90.1) for in vivo microbial synthesis of cannabigerolic acid (CBGA). Note: that BktB has the three thiolase activities: 1) ketoacyl-CoA thiolase; 2) acetoacetyl-CoA thiolase; and 3) polyketoacyl-CoA thiolase. In this specific example, we are using BktB for its ketoacyl-CoA thiolase activity.

(128) Polyketoacyl-CoA thiolase catalyzes two sequential non-decarboxylative Claisen condensation reactions with 3-oxooctanoyl-CoA as the initial primer and acetyl-CoA as the extender unit. The first reaction condenses 3-oxooctanoyl-CoA and acetyl-CoA to a diketoacyl-CoA 3,5-dioxodecanoyl-CoA. The second reaction condenses 3,5-dioxodecanoyl-CoA and acetyl-CoA to a triketoacyl-CoA 3,5,7-trioxododecanoyl-CoA. Olivetolic acid cyclase OAC converts 3,5,7-trioxododecanoyl-CoA to olivetolic acid. BktB catalyzes the non-decarboxylative Claisen condensation reaction between hexanoyl-CoA and acetyl-CoA to supply 3-oxoocatonyl-CoA.

(129) Aromatic prenyltransferase transfers geranyl group from geranyl pyrophosphate to olivetolic acid to generate cannabigerolic acid. Hexanoyl-CoA is supplied through β-oxidation reversal pathway composed of BktB, FadB and egTer with acetyl-CoA as the initial primer and extender unit. Geranyl pyrophosphate can be supplied through endogenous pathway composed of methylerythritol phosphate pathway and the reaction of geranyl pyrophosphate synthase. Acetyl-CoA is supplied through glycolysis the carbon source as such glycerol or sugars. This pathway for cannabigerolic acid synthesis is shown in FIG. 19A-B.

(130) JST06(DE3) ΔfadE bktB.sup.CT5 ΔatoB fadB.sup.CT5 ΔfadA egter.sup.CT5 @fabI serves as the host strain for the in vivo production of cannabigerolic acid. JST06(DE3) (MG1655(DE3) ΔldhA ΔpoxB Δpta ΔadhE ΔfadA ΔyciA ΔybgC ΔydiI ΔtesA ΔfadM ΔtesB) (Cheong et al. 2016) is an E. coli strain deficient in mixed-acid fermentation pathways due to deletions of genes ldhA, poxB, pta, adhE and frdA, which maximize the supply of acetyl-CoA, and deletions of genes encoding major thioesterases (yciA, ybgC, ydiI, tesA, fadM and tesB), which minimize the hydrolysis of intermediate acyl-CoAs. As such, this strain is selected to maximize the flux of β-oxidation reversal for hexanoyl-CoA supply required for the synthesis of olivetolic acid via polyketoacyl-CoA thiolases. Construction of this strain is described above.

(131) Four polyketoacyl-CoA thiolases were selected and overexpressed: FadAx (AAK18171.1) and PcaF (AAA85138.1) from Pseudomonas putida, DcaF (CAG68532.1) from Acinetobacter sp. ADP1, and ScFadA (AAL10298.1) from Streptomyces collinus. These polyketoacyl-CoA thiolases are chosen because they showed the ability to catalyze the synthesis of TAL in in vitro assays and they do not cause crosstalk with the overexpressed β-oxidation reversal pathway.

(132) Enzymes with potential aromatic prenyltransferase activity include Cannabis sativa CsPT1 (sequence available in U.S. Pat. No. 8,884,100), Humulus lupulus H1PT (AJD80255.1), E. coli UbiA (NP_418464.1), Saccharomyces cerevisiae Coq2 (AAA34507.1), Lithospermum erythrorhizon LePGT-1 (BAB84122.1), Lithospermum erythrorhizon LePGT-2 (BAB84123.1) and other homologs and mutants. Genes encoding these polyketoacyl-CoA thiolases and aromatic prenyltransferases are cloned together with the gene encoding OAC into appropriate vectors through cloning and isolation procedures described above.

(133) Fermentations are conducted in a SixFors multi-fermentation system (Infors HT, Bottmingen, Switzerland) with an air flowrate of 2 N L/hr, independent control of temperature (37° C.), pH (controlled at 7.0 with NaOH and H.sub.2SO.sub.4), and stirrer speed (660 rpm). The above described MOPS fermentation media with 50 g/L glycerol, the inclusion of 5 μM sodium selenite, and 1 μM IPTG are used. Pre-culture and inoculation procedures are as described above.

(134) At various fermentation times samples are taken and 2 mL supernatant is collected through 5000G, 5 min centrifuge in an Optima L-80XP Ultracentrifuge (Beckman-Coulter, Schaumburg, Ill.) of culture and is prepared for GC-FID analysis.

(135) The supernatant aliquots of 2 mL are transferred to 5 mL glass vials (Fisher Scientific Co., Pittsburgh, Pa.) and extraction and derivatization with BSTFA conducted as described above.

(136) The quantification of cannabigerolic acid is performed in a Varian CP-3800 gas chromatograph (Varian Associates, Inc., Palo Alto, Calif.), equipped with a flame ionization detector (GC-FID) and an HP-INNOWax capillary column (0.32 mm internal diameter, 0.50 μm film thickness, 30 m length; Agilent Technologies, Inc., Santa Clara, Calif.), following the method: 200° C. held for 1 min, 30° C./min to 300° C., and 300° C. held for 5 min. Helium (1.2 mL/min, Matheson Tri-Gas, Longmont, Colo.) is used as the carrier gas. The injector and detector are maintained at 290 and 300° C., respectively. A 1 μL sample is injected in splitless injection mode.

(Prophetic) In Vivo Synthesis of Orsellinic Acid

(137) The purpose of this experiment is to clone and express polyketoacyl-CoA thiolases in an Escherichia coli strain already overexpressing acetoacetyl-CoA thiolase AtoB (NP_416728.1) for in vivo microbial synthesis of orsellinic acid. Polyketoacyl-CoA thiolase catalyzes two sequential non-decarboxylative Claisen condensation reactions with acetoacetyl-CoA as the initial primer and acetyl-CoA as the extender unit, yielding a triketoacyl-CoA, which is then spontaneously cyclized into orsellinic acid. Acetoacetyl-CoA is supplied through AtoB-catalyzed non-decarboxylative Claisen condensation between two acetyl-CoAs. Acetyl-CoA is supplied through glycolysis from a carbon source such as glycerol or sugars. This pathway for orsellinic acid synthesis is shown in FIG. 20.

(138) JST06(DE3) atoB.sup.CT5 serves as the host strain for the in vivo production of orsellinic acid. JST06(DE3) (MG1655(DE3) ΔldhA ΔpoxB Δpta ΔadhE ΔfrdA ΔyciA ΔybgC ΔydiI ΔtesA ΔfadM ΔtesB) (Cheong et al. 2016) is an E. coli strain deficient in mixed-acid fermentation pathways due to deletions of genes ldhA, poxB, pta, adhE and frdA, which maximize the supply of acetyl-CoA, and deletions of genes encoding major thioesterases (yciA, ybgC, ydiI, tesA, fadM and tesB), which minimize the hydrolysis of acetyl-CoA and acetoacetyl-CoA. The genotype atoB.sup.CT5 refers to chromosomal atoB gene under the p.sup.CT5 promoter for controlled induction by cumate. Construction of this strain is described above.

(139) Five polyketoacyl-CoA thiolases are selected and overexpressed in JST06(DE3) atoB.sup.CT5 strain: FadAx (AAK18171.1) and PcaF (AAA85138.1) from Pseudomonas putida, DcaF (CAG68532.1) from Acinetobacter sp. ADP1, BktB (AAC38322.1) from Ralstonia eutropha and ScFadA (AAL10298.1) from Streptomyces collinus. These polyketoacyl-CoA thiolases are selected based on their ability to catalyze the synthesis of TAL in in vitro assays. Codon-optimized genes encoding these thiolases are cloned into appropriate vectors as described above.

(140) Fermentations are performed using the above described MOPS media in 25 mL Pyrex Erlenmeyer flasks or Six-Fors fermentation system as described above with supernatant samples obtained at various times obtained through 5000G, 5 min centrifuge in an Optima L-80XP Ultracentrifuge (Beckman-Coulter, Schaumburg, Ill.) of 2 mL culture is prepared for GC-FID analysis.

(141) The supernatant aliquots of 2 mL are transferred to 5 mL glass vials (Fisher Scientific Co., Pittsburgh, Pa.) and extraction and derivatization with BSTFA conducted as described above.

(142) The quantification of orsellinic acid is performed in a Varian CP-3800 gas chromatograph (Varian Associates, Inc., Palo Alto, Calif.), equipped with a flame ionization detector (GC-FID) and an HP-INNOWax capillary column (0.32 mm internal diameter, 0.50 μm film thickness, 30 m length; Agilent Technologies, Inc., Santa Clara, Calif.), following the method: 100° C. initial column temperature, 15° C./min to 300° C., and 300° C. held for 8 min. Helium (1 mL/min, Matheson Tri-Gas, Longmont, Colo.) is used as the carrier gas. The injector and detector are maintained at 280 and 300° C., respectively. A 1 μL sample is injected in splitless injection mode.

(Prophetic) In Vivo Synthesis

(143) The purpose of this experiment is to clone and express polyketoacyl-CoA thiolases, 3-OH-polyketoacyl-CoA dehydrogenases and polyketoenoyl-CoA hydratases in an Escherichia coli strain already overexpressing acetoacetyl-CoA thiolase AtoB (NP_416728.1) for in vivo microbial synthesis of 6-methylsalicylic acid. Polyketoacyl-CoA thiolase catalyzes non-decarboxylative Claisen condensation reaction with acetoacetyl-CoA as the primer and acetyl-CoA as the extender unit, yielding a diketoacyl-CoA. Sequential β-reduction reactions catalyzed by 3-OH-polyketoacyl-CoA dehydrogenase and polyketoenoyl-CoA hydratase convert diketoacyl-CoA to a 5-ketoenoyl-CoA. Polyketoacyl-CoA thiolase then catalyzes non-decarboxylative Claisen condensation reaction with 5-ketoenoyl-CoA as the primer and acetyl-CoA as the extender unit, and the condensation product is then spontaneously cyclized into 6-methylsalicylic acid. Acetoacetyl-CoA is supplied through AtoB-catalyzed non-decarboxylative Claisen condensation between two acetyl-CoAs. Acetyl-CoA is supplied through glycolysis from a carbon source such as glycerol or sugars. This pathway for 6-methylsalicylic acid synthesis is shown in FIG. 21A-B.

(144) JST06(DE3) atoB.sup.CT5 serves as the host strain for the in vivo production of 6-methylsalicylic acid. JST06(DE3) (MG1655(DE3) ΔldhA ΔpoxB Δpta ΔadhE ΔfrdA ΔyciA ΔybgC ΔydiI ΔtesA ΔfadM ΔtesB) (Cheong et al. 2016) is an E. coli strain deficient in mixed-acid fermentation pathways due to deletions of genes ldhA, poxB, pta, adhE and frdA, which maximize the supply of acetyl-CoA, and deletions of genes encoding major thioesterases (yciA, ybgC, tesA, fadM and tesB), which minimize the hydrolysis of acetyl-CoA and acetoacetyl-CoA. The genotype atoB.sup.CT5 refers to chromosomal atoB gene under the p.sup.CT5 promoter for controlled induction by cumate. Construction of this strain is as described above.

(145) Five polyketoacyl-CoA thiolases are selected and overexpressed in JST06(DE3) atoB.sup.CT5 strain: FadAx (AAK18171.1) and PcaF (AAA85138.1) from Pseudomonas putida, DcaF (CAG68532.1) from Acinetobacter sp. ADP1, BktB (AAC38322.1) from Ralstonia eutropha and ScFadA (AAL10298.1) from Streptomyces collinus.

(146) The candidates of 3-OH-polyketoacyl-CoA dehydrogenases include E. coli FabG (NP_415611.1), E. coli FadB (NP_418288.1), E. coli FadJ (NP_416843.1), E. coli PaaH (NP_415913.1), Pseudomonas putida FadB (AAK18167.2), P. putida FadB2x (AAK18170.1), Acinetobacter sp. ADP1 DcaH (CAG68533.1), Ralstonia eutrophus PhaB (P14697.1), Clostridium acetobutylicum Hbd (AAA95971.1) and other homologs and mutants.

(147) The candidates of polyketoenoyl-CoA hydratases include E. coli FabA (NP_415474.1), E. coli FabZ (NP_414722.1), E. coli FadB (NP_418288.1), E. coli FadJ (NP_416843.1), E. coli PaaF (NP_415911.1), P. putida FadB (AAK18167.2), P. putida FadB1x (AAK181730.1), Acinetobacter sp. ADP1 DcaE (CAG68535.1), Clostridium acetobutylicum Crt (AAA95967.1), Aeromonas caviae PhaJ (032472.1) and other homologs and mutants.

(148) Genes encoding these polyketoacyl-CoA thiolases, 3-OH-polyketoacyl-CoA dehydrogenases and polyketoenoyl-CoA hydratases are cloned together into appropriate vectors. Genes from E. coli are amplified from genomic DNA extracted through Genomic DNA Purification kit (Promega, Fitchburg, Wis.), and genes from other organisms are amplified from gene product synthesized by either GeneArt (Life Technologies, Carlsbad, Calif., USA) or GenScript (Piscataway, N.J.) with codon-optimization. These genes are amplified through PCR using appropriate primers to append homology on each end for recombination into the vector backbone with Phusion polymerase (Thermo Scientific, Waltham, Mass.) to serve as the gene insert. Plasmids are linearized by the appropriate restriction enzymes (New England Biolabs, Ipswich, Mass.) and recombined with the gene inserts using the In-Fusion HD Eco-Dry Cloning system (Clontech laboratories, Mountain View, Calif.). The mixture is subsequently transformed into Stellar competent cells (Clontech laboratories, Mountain View, Calif.). Transformants that grow on solid media (LB+Agar) supplemented with the appropriate antibiotic are isolated and screened for the gene insert by PCR. Plasmid from verified transformants are isolated and the sequence of the gene insert is further confirmed by DNA sequencing (Lone Star Labs, Houston, Tex.). The sequence confirmed plasmids are then introduced to competent host strain cells.

(149) Fermentations are performed using the above described MOPS media in 25 mL Pyrex Erlenmeyer flasks or Six-Fors fermentation system as described above with supernatant samples obtained at various times obtained through 5000G, 5 min centrifuge in an Optima L-80XP Ultracentrifuge (Beckman-Coulter, Schaumburg, Ill.) of 2 mL culture is prepared for GC-FID analysis.

(150) The supernatant aliquots of 2 mL are transferred to 5 mL glass vials (Fisher Scientific Co., Pittsburgh, Pa.) and extraction and derivatization with BSTFA conducted as described above.

(151) The quantification of 6-methylsalicylic acid is performed in a Varian CP-3800 gas chromatograph (Varian Associates, Inc., Palo Alto, Calif.), equipped with a flame ionization detector (GC-FID) and an HP-INNOWax capillary column (0.32 mm internal diameter, 0.50 μm film thickness, 30 m length; Agilent Technologies, Inc., Santa Clara, Calif.), following the method: 100° C. initial column temperature, 15° C./min to 300° C., and 300° C. held for 8 min. Helium (1 mL/min, Matheson Tri-Gas, Longmont, Colo.) is used as the carrier gas. The injector and detector are maintained at 280 and 300° C., respectively. A 1 μL sample is injected in splitless injection mode.

(Prophetic) Identification of Polyketoacyl-CoA Thiolases

(152) The purpose of this experiment is to identify additional polyketoacyl-CoA thiolases capable of the non-decarboxylative Claisen condensation between a ketoacyl-CoA or a polyketoacyl-CoA, which serves as the primer, and an acyl-CoA serving as the extender unit to form a polyketoacyl-CoA. The identification is through measuring the presence of polyketides, like TAL, dehydroacetic acid, olivetolic acid, orsellinic acid and 6-methylsalicylic acid, derived from the polyketoacyl-CoA generated through polyketoacyl-CoA thiolase-catalyzed non-decarboxylative Claisen condensation reactions.

(153) A library of potential polyketoacyl-CoA thiolases can be generated through expression of synthesized genes encoding thiolases based on sequences from databases like KEGG (genome.jp/kegg), MetaCyc (metacyc.org) and NCBI Protein Database (ncbi.nlm.nih.gov/protein). In MetaCyc, around 100 thiolases are listed; in KEGG, around 1,000 thiolases are listed; in NCBI Protein Database, more than 100,000 thiolases are listed. Genes are synthesized by either GeneArt (Life Technologies, Carlsbad, Calif., USA) or GenScript (Piscataway, N.J., USA) with option of codon-optimization. A thiolase library can also be a library of mutants of a certain thiolase generated through methods selected from error prone PCR random mutagenesis with usage of GeneMorph II Random Mutagenesis Kit (Agilent Technologies, Inc., Santa Clara, Calif.), site-specific saturation mutagenesis of certain sites of the gene encoding the thiolase by QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies, Inc., Santa Clara, Calif., USA) and DNA shuffling of the gene encoding thiolase by JBS DNA-Shuffling Kit (Jena Bioscience GmbH, Jena, Germany).

(154) For expression of members of the thiolase library, genes encoding thiolase members are cloned into appropriate vectors with expression of a His-tag. These genes are amplified from their vectors in the library through PCR using appropriate primers to append homology on each end for recombination into the vector backbone with Phusion polymerase (Thermo Scientific, Waltham, Mass.) to serve as the gene insert.

(155) Plasmids are linearized by the appropriate restriction enzymes (New England Biolabs, Ipswich, Mass., USA) and recombined with the gene inserts using the In-Fusion HD Eco-Dry Cloning system (Clontech laboratories, Mountain View, Calif., USA). The mixture is subsequently transformed into Stellar competent cells (Clontech laboratories, Mountain View, Calif., USA). Transformants that grow on solid media (LB+Agar) supplemented with the appropriate antibiotic are isolated and screened for the gene insert by PCR. Plasmids from verified transformants are isolated and the sequence of the gene insert is further confirmed by DNA sequencing (Lone Star Labs, Houston, Tex., USA). The sequence confirmed plasmids are then introduced to competent host strain cells.

(156) All molecular biology techniques are performed with standard methods (Miller, 1972; Sambrook et al., 2001) or by manufacturer protocol. Strains are kept in glycerol stocks at −80° C. Plates are prepared using LB medium containing 1.5% agar, and appropriate antibiotics are included at the following concentrations: ampicillin (100 μg/mL), kanamycin (50 μg/mL), spectinomycin (50 μg/mL) and chloramphenicol (12.5 μg/mL).

(157) The target polyketide product to identify can be produced in vitro by purified query thiolases exhibiting polyketoacyl-CoA thiolase activity. To express the query thiolases, cultures can be grown in 25 mL of LB media in 125 mL flasks (Wheaton Industries, Inc., Millville, N.J.) at 37° C. A single colony of the desired strain is cultivated overnight (14-16 hrs) in 10 mL of LB medium in baffled flasks (Wheaton Industries, Inc., Millville, N.J.) with appropriate antibiotics and used as the inoculum (1 mL). The cells are induced with appropriate inducer at an OD550˜0.6.

(158) After post-induction growth of ASKA strains for 4 hr, or 16 hr for other strains, the cells are collected and washed twice by 9 g/L sodium chloride solution. Cells are then re-suspended in lysis buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 10 mM imidazole, pH 8.0) to an OD˜40. After re-suspension, the cells are disrupted using glass beads and then centrifuged at 4° C., 13000G, 10 min in an Optima L-80XP Ultracentrifuge (Beckman-Coulter, Schaumburg, Ill.). The resultant supernatant is the crude enzyme extract.

(159) The His-tagged enzymes are then purified from crude extract by using Ni-NTA spin kit (Qiagen, Valencia, Calif.). The crude extracts are centrifuged (270G, 5 min) in spin columns, which have been equilibrated with lysis buffer and then washed twice by wash buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 20 mM imidazole, pH 8.0). After washing, the enzyme is eluted twice in elution buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 500 mM imidazole, pH 8.0). Both washing and elution steps are centrifuged at 890 g for 2 min.

(160) The purified enzyme extracts are then further concentrated and dialyzed through Amicon® Ultra 10K Device (Millipore, Billerica, Mass.). The enzymes are first filtered by centrifugation at 4° C., 14000G, 10 min, and then washed with 100 mM potassium phosphate, pH 7 buffer under the same centrifugation conditions. Finally, the concentrated and dialyzed enzymes are recovered through 4° C., 1000G, 2 min centrifugation.

(161) The protein concentration is established using the Bradford Reagent (Thermo Scientific, Waltham, Mass.) using BSA as the protein standard. SDS-PAGE monitor of purified proteins is performed through XCell SureLock™ Mini-cell system (Invitrogen, Carlsbad, Calif.) with gels (12% acrylamide resolving gel and 4% acrylamide stacking gel) prepared through SureLock™ Mini-cell system (Invitrogen, Carlsbad, Calif.). The composition of the running buffer for SDS-PAGE was 3 g/L tris base, 14.4 g/L glycine and 1 g/L SDS in water.

(162) The reaction system of in vitro non-decarboxylative Claisen condensation consists of a solution containing appropriate buffer, co-factors, and substrates, such as one containing 100 mM potassium phosphate pH 7, 3 mM EDTA, 1 mM primer CoA thioester, 1 mM extender unit thioester and certain amount of purified query thiolase. Inclusion of additional enzymes, such as thioesterases and olivetolic acid cyclase, can be included to catalyze conversion of polyketoacyl-CoA generated from the non-decarboxylative Claisen condensation to the target polyketide in the reaction system. These additional enzymes are cloned, expressed and purified in same ways as query thiolase, which are described above. The reaction can be performed in a centrifuge tube, a spectroscopy cuvette or a 96-well plate.

(163) The identification of the target polyketide generated in in vitro reaction can be performed by monitoring the increase of its absorbance of certain wavelength, like 298 nm for TAL and 312 nm for dehydroacetic acid, in a Synergy HT plate reader (BioTek Instruments, Inc., Winooski, Vt.) at 25° C. or in a Biomate 5 Spectrophotometer (Thermo Scientific, Waltham, Mass.).

(164) The identification of the target polyketide generated in in vitro reaction can also be performed through GC-FID using appropriate extraction, derivatization, and GC methods. One such example includes the in vitro reaction samples being transferred to 5 mL glass vials (Fisher Scientific Co., Pittsburgh, Pa.), supplemented with 2 mg of 4-pentylbenzoic acid as internal standard, and extracted with 2 mL of hexane. 80 μL of 50% H.sub.2SO.sub.4 and 340 μL of 30% NaCl solution are also added for pH and ionic strength adjustment, respectively. Vials are tightly closed, vortexed for 30 s, and mixed in a Glas-Col rotator (Glas-Col, Terre Haute, Ind.) at 60 rpm for 2 h. Samples are then vortexed again for 30 s and centrifuged at 8000 rpm at 4° C. for 1 min. Aliquots of 1.5 mL of the organic layer were transferred to 2 mL borosilicate glass vials with PTFE/silicone screw caps (Fisher Scientific Co., Pittsburgh, Pa.) and mixed with 100 μL of pyridine and 100 μL of BSTFA (N,O-bis(trimethyl silyl)trifluoroacetamide).

(165) Samples are incubated in sealed vials at 70° C. for 60 min using an AccuBlock Digital Dry Bath (LabNet, Woodbridge, N.J.), and silylated samples are analyzed via GC-FID quantification analysis. The GC-FID quantification analysis is performed in a Varian CP-3800 gas chromatograph (Varian Associates, Inc., Palo Alto, Calif.), equipped with a flame ionization detector (GC-FID) and an HP-INNOWax capillary column (0.32 mm internal diameter, 0.50 μm film thickness, 30 m length; Agilent Technologies, Inc., Santa Clara, Calif.), following the method: 200° C. held for 1 min, 30° C./min to 300° C., and 300° C. held for 5 min. Helium (1.2 mL/min, Matheson Tri-Gas, Longmont, Colo.) is used as the carrier gas. The injector and detector are maintained at 290 and 300° C., respectively. A 1 μL sample is injected in splitless injection mode. The GC-FID analysis conditions can be changed depending on the target polyketide.

(166) The identification of the target polyketide generated in in vitro reaction can also be performed via ion-exclusion HPLC using a Shimadzu Prominence SIL 20 system (Shimadzu Scientific Instruments, Inc., Columbia, Md.) equipped with an HPX-87H organic acid column (Bio-Rad, Hercules, Calif.) with operating conditions to optimize peak separation (0.3 mL/min flow rate, 30 mM H.sub.2SO.sub.4 mobile phase, column temperature 42° C.). The HPLC analysis conditions can be changed depending on the target polyketide.

(167) The identification of the target polyketide generated in in vitro reactions can also be performed via RP-HPLC using Shimadzu LC-20AD HPLC system with an SPD-20A dual-wavelength UV-vis detector and a Phenomonex Luna C18 column (25 cm×4.6 mm, 5 μm) (Tang et al. 2013). Following elution profile (Xie et al. 2006) can be used: solvent A, 1% (v/v) acetic acid in water; solvent B, 1% (v/v) acetic acid in acetonitrile; gradient: 5% B (0-5 min), 5-15% B (5-18 min), 15-100% B (18-23 min), 100% B (23-30 min); flow rate 1.0 mL/min; wavelength, 300 nm. The RP-HPLC analysis conditions can be changed depending on the target polyketide.

(168) The identification of the target polyketide generated in in vitro reactions can also be performed through one-dimensional proton nuclear magnetic resonance (NMR) spectroscopy. 60 ml of D.sub.2O and 1 ml of 600 mM NMR internal standard TSP [3-(trimethylsilyl) propionic acid-D4, sodium salt] are added to 540 ml of the sample. The resulting solution is then transferred to a 5-mm NMR tube, and one-dimensional proton NMR spectroscopy is performed at 25° C. in a Varian 500-MHz Inova spectrometer equipped with a Penta probe (Varian) using the following parameters: 8,000-Hz sweep width, 2.8-s acquisition time, 256 acquisitions, 6.3 ms pulse width, 1.2-s pulse repetition delay, and pre-saturation for 2 s. The resulting spectrum is analyzed using FELIX 2001 software (Accelrys Software). Peaks are identified by their chemical shifts and J-coupling values, which are obtained in separate experiments in which samples are spiked with metabolite standards (2 mM final concentration).

(169) The target polyketide product to identify can be produced in vivo by expressing the query thiolase in an appropriate host strain that harbors the pathway supplying the primer and the extender unit of the non-decarboxylative Claisen condensation.

(170) One way to identify the target polyketide produced in vivo is through screening the expression of β-galactosidase reporter activated by the mutant AraC biosensor in the response of the target polyketide. The AraC mutant can be acquired through methods selected from error prone PCR random mutagenesis with usage of GeneMorph II Random Mutagenesis Kit (Agilent Technologies, Inc., Santa Clara, Calif.), site-specific saturation mutagenesis of certain sites of the gene encoding the thiolase by QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies) and DNA shuffling of the gene encoding thiolase by JBS DNA-Shuffling Kit (Jena Bioscience GmbH, Jena, Germany) on wild-type AraC. The AraC mutant able to respond on the target polyketide can be screened through Fluorescence-activated cell-sorting (FACS). The genes encoding AraC mutants are cloned into an appropriate plasmid together with the gene encoding GFP in the method as mentioned above. The gfp gene is expressed under P.sub.BAD promoter.

(171) The resultant plasmid is introduced to an appropriate host strain for expression of AraC and GFP. Cells are prepared for screening by preculturing overnight in LB medium containing appropriate antibiotics and inducer, followed by dilution to OD.sub.600=0.2 in the same medium containing appropriate inducer. Induced cells are then grown for 15 h. Fluorescence-activated cell-sorting (FACS) is performed on an inFlux V-GS Cytometry Workbench (Cytopeia) using Spigot software. Fluorescence is excited at 488 nm, and emission is collected using a 531/40 nm filter.

(172) In the first round of screening, the most fluorescent 10.sup.4 cells are sorted from a total of 10.sup.7 cells (i.e., the top 0.1% were selected). Flow cytometry analysis is performed on an FC500 flow cytometer (Beckman-Coulter). Flow cytometry of libraries resulting from the first round of positive screening reveals two subpopulations of cells: a majority are highly fluorescent in the absence of any inducer (constitutive or nonspecific phenotypes) and a smaller fraction are significantly less fluorescent in the absence of the target polyketide. The low-fluorescent cells are collected and subjected to another negative screen in the presence of the target polyketide (10 mM) to eliminate clones that are still induced by this polyketide.

(173) This procedure is repeated in a second round of positive and negative FACS screening except the top 1% of cells are selected in the positive screen, yielding at most 100 different mutants induced by d-arabinose and not by 1-arabinose. Ten clones from each library are selected for rescreening and the mutant identified in the most highly induced clones is used as the biosensor. The genes encoding query thiolases are cloned together with the gene encoding β-galactosidase reporter LacZ and AraC mutant biosensor in an appropriate plasmid in the method described as above, with LacZ expressed under P.sub.BAD promoter. The resultant plasmid is introduced to an appropriate host strain that harbors the pathway supplying the primer and the extender unit of the non-decarboxylative Claisen condensation. Cells are plated onto LB containing appropriate inducer, carbon source and antibiotics with appropriate amount of X-Gal, and incubated at 37° C. for 20 hours. The cells expressing the thiolase exhibiting the desired polyketoacyl-CoA thiolase activity show darker blue color and can be easily screened.

(174) Another way to identify the target polyketide produced in vivo is growing the cells expressing the query thiolase and analyze the supernatant sample by methods selected from GC-FID, HPLC, RP-HPLC and NMR as described above. MOPS minimal medium (Neidhardt et al., 1974) with 125 mM MOPS and Na.sub.2HPO.sub.4 in place of K.sub.2HPO.sub.4 (2.8 mM), supplemented with 20 g/L glycerol, 10 g/L tryptone, 5 g/L yeast extract, 100 μM FeSO.sub.4, 5 mM calcium pantothenate, 5 mM (NH.sub.4).sub.2SO.sub.4, and 30 mM NH.sub.4Cl is used for fermentations. Antibiotics (50 μg/mL carbenicillin and 50 μg/mL spectinomycin) and additional carbon sources are included when appropriate. All chemicals are obtained from Fisher Scientific Co. (Pittsburgh, Pa.) and Sigma-Aldrich Co. (St. Louis, Mo.). The growth of cells is performed in 25 mL Pyrex Erlenmeyer flasks (narrow mouth/heavy duty rim, Corning Inc., Corning, N.Y.) filled with 20 mL fermentation medium and sealed with foam plugs filling the necks. A single colony of the desired strain is cultivated overnight (14-16 hrs) in LB medium with appropriate antibiotics and used as the inoculum (1%). After inoculation, flasks are incubated in a NBS I24 Benchtop Incubator Shaker (New Brunswick Scientific Co., Inc., Edison, N.J.) at 200 rpm and 37° C. When optical density (550 nm, OD.sub.550) reached ˜0.3-0.5, appropriate concentrations of inducers are added for plasmid and chromosomal expressions. Flasks are then incubated under the same conditions for 48 hours post-induction. After the fermentation, the supernatant obtained through 5000G, 5 min centrifuge in an Optima L-80XP Ultracentrifuge (Beckman-Coulter, Schaumburg, Ill.) of 2 mL culture is prepared for analysis.

(175) The following are incorporated by reference herein in its entirety for all purposes: Cheong, S., et al., Energy- and carbon-efficient synthesis of functionalized small molecules in bacteria using non-decarboxylative Claisen condensation reactions. Nat Biotech 34, 556-561 (2016). Choi, K.-H., et al., β-Ketoacyl-Acyl Carrier Protein Synthase III (FabH) Is a Determining Factor in Branched-Chain Fatty Acid Biosynthesis. J. Bacteriol. 182, 365-370 (2000). Clomburg, J. M., et al., A Synthetic Biology Approach to Engineer a Functional Reversal of the β-Oxidation Cycle. ACS Synthetic Biology 1, 541-554 (2012). Datsenko, K. A. & Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A 97, 6640-6645 (2000). Dellomonaco, C., et al., Engineered reversal of the β-oxidation cycle for the synthesis of fuels and chemicals. Nature 476, 355-359 (2011). Dunn, B. J. & Khosla, C. Engineering the acyltransferase substrate specificity of assembly line polyketide synthases. J. R. Soc. Interface 10 (2013). Haapalainen, A. M., et al., The thiolase superfamily: condensing enzymes with diverse reaction specificities. Trends in Biochemical Sciences 31, 64-71 (2006). Heath, R. J. & Rock, C. O. The Claisen condensation in biology. Nat. Prod. Rep. 19, 581-596 (2002). Jiang, C., et al., Divergent evolution of the thiolase superfamily and chalcone synthase family. Molecular Phylogenetics and Evolution 49, 691-701 (2008). Kitagawa, M., et al., Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 (2005). Magner, D. B. et al. RecQ Promotes Toxic Recombination in Cells Lacking Recombination Intermediate-Removal Proteins. Mol. Cell 26, 273-286 (2007). Miller, J. H. Experiments in Molecular Genetics, (Cold Spring Harbor Laboratory Press, 1972) Moore, B. S. & Hertweck, C. Biosynthesis and attachment of novel bacterial polyketide synthase starter units. Nat. Prod. Rep. 19, 70-99 (2002). Neidhardt, F. C., et al., Culture medium for enterobacteria J. Bacteriol. 119, 736-747 (1974). Pfleger, B. F., et al., J. Metabolic engineering strategies for microbial synthesis of oleochemicals. Metab. Eng. 29, 1-11 (2015). Sambrook, J., et al., Molecular Cloning: A Laboratory Manual, 3rd ed., (Cold Spring Harbor Laboratory Press, 2011). Studier, F. W. & Moffatt, B. A. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189, 113-130 (1986). Tang, S.-Y. et al. Screening for Enhanced Triacetic Acid Lactone Production by Recombinant Escherichia coli Expressing a Designed Triacetic Acid Lactone Reporter. J. Am. Chem. Soc. 135, 10099-10103 (2013). Tang, S.-Y., et al., AraC Regulatory Protein Mutants with Altered Effector Specificity. J. Am. Chem. Soc. 130, 5267-5271 (2008). Thomason, L. C., et al., in Current Protocols in Molecular Biology (John Wiley & Sons, Inc., 2001). Vick, J. E. et al. Escherichia coli enoyl-acyl carrier protein reductase (FabI) supports efficient operation of a functional reversal of the β-oxidation cycle. Appl. Environ. Microbiol. 81, 1406-1416 (2015). Xie, D. et al. Microbial synthesis of triacetic acid lactone. Biotechnol. Bioeng. 93, 727-736 (2006). 61/440,192, filed Feb. 7, 2011, WO2012109176, US20130316413, REVERSE BETA OXIDATION PATHWAY 62/140,628, Mar. 31, 2015, 62/140,628, Mar. 31, 2016 BIOCONVERSION OF SHORT-CHAIN HYDROCARBONS TO FUELS AND CHEMICALS 61/932,057, Jan. 27, 2014, WO2015112988 TYPE II FATTY ACID SYNTHESIS ENZYMES IN REVERSE BETA-OXIDATION 62/069,850 Oct. 29, 2014, PCT/US15/58121, Oct. 29, 2015, SYNTHETIC PATHWAY FOR BIOSYNTHESIS FROM 1-CARBON COMPOUNDS 61/272,117 Aug. 18, 2009; 61/272,057 Aug. 12, 2009; PCT/CA2010/001222 Aug. 4, 2010, AROMATIC PRENYLTRANSFERASE FROM CANNABIS 61/531,911, Sep. 7, 2011; 61/440,192, Feb. 7, 2011, WO2013036812, US20140273110, FUNCTIONALIZED CARBOXYLIC ACIDS AND ALCOHOLS BY REVERSE FATTY ACID OXIDATION