Method for producing 2-keto-3-deoxygluconate from 2-(acetylamino)-2-deoxy-D-gluconic acid by two enzymes

Abstract

A method for producing 2-keto-3-deoxygluconate (KDG) from 2-(acetylamino)-2-deoxy-D-gluconic acid (GlcNAc1A) by two enzymes; GlcNAc1A is converted to KDG by incubating GlcNAc1A with a deacetylase OngB at 25° C. for 4-12 h and then with a deaminase OngC at 25° C. for another 10-15 h; it constructs two engineered E. coli/pET22b-ongB (carrying the ongB gene) and E. coli/pET22b-ongC (carrying the ongC gene) strains to prepare recombinant proteins OngB and OngC, respectively; at the action of these two enzymes, OngB and OngC, GlcNAc1A is converted to KDG, which solves the bottleneck of GlcNAc1A utilization during the bioconversion of chitin; the KDG is an important metabolic intermediate to synthesize furan derivatives, herbicides, food additives and other industrially important chemical compounds, having wide industrial applications.

Claims

1. A method for producing 2-keto-3-deoxygluconate (KDG) from 2-(acetylamino)-2-deoxy-D-gluconic acid (GlcNAc1A) by two enzymes, wherein GlcNAc1A is incubated with a deacetylase OngB and a deaminase OngC for 1-24 h to generate KDG.

2. The method according to claim 1, wherein the enzymatic reaction to produce KDG is carried out by the successive addition of a deacetylase OngB and a deaminase OngC; to produce KDG, GlcNAc1A is firstly incubated with a deacetylase OngB at 25° C. for 12 h, and then with a deaminase OngC at 25° C. for another 12 h.

3. The method according to claim 1, wherein the molar ratio of deacetylase OngB to substrate GlcNAc1A is 1:900-1:1100.

4. The method according to claim 1, wherein the molar ratio of deaminase OngC to deacetylase OngB is 1:9-1:11.

5. The method according to claim 1, wherein the recombinant deacetylase OngB is prepared from an engineered E. coli/pET22b-ongB strain, and the recombinant deaminase OngC is prepared from an engineered E. coli/pET22b-ongC strain.

6. The method according to claim 1, wherein the nucleotide sequence of the deacetylase OngB-encoding gene is shown in SED ID NO: 01, and the amino acid sequence of the deacetylase OngB is shown in SED ID NO: 03.

7. The method according to claim 1, wherein the nucleotide sequence of the deaminase OngC-encoding gene is shown in SED ID NO: 02, and the amino acid sequence of the deaminase OngC is shown in SED ID NO: 04.

8. The method according to claim 5, wherein the engineered E. coli/pET22b-ongB and E. coli/pET22b-ongC strains are constructed involving the following steps: (i) The full-length gene sequence of ongB was amplified from the genomic DNA of Pseudoalteromonas prydzensis ACAM 620 by PCR using gene-specific primers ongB_F shown in SEQ ID NO: 05 and ongB_R shown in SEQ ID NO: 06; the PCR reaction conditions were as follows: pre-denaturation at 95° C. and 30 cycles of denaturation at 95° C. for 30 s, annealing at 55° C. for 30 s, and extension at 72° C. for 1 min; the reaction was kept at 72° C. for 10 min and then stored at 16° C.; the amplified fragment was ligated into the vector pET22b between the NdeI and XhoI sites to construct the recombinant plasmid pET22b-ongB; (ii) The full-length gene sequence of ongC was amplified from the genomic DNA of Pseudoalteromonas prydzensis ACAM 620 by PCR using gene-specific primers ongC_F shown in SEQ ID NO: 07 and ongC_R shown in SEQ ID NO: 08; the PCR reaction conditions were as follows: pre-denaturation at 95° C. and 30 cycles of denaturation at 95° C. for 30 s, annealing at 55° C. for 30 s, and extension at 72° C. for 1 min; the reaction was kept at 72° C. for 10 min and then stored at 16° C.; the amplified fragment was ligated into the vector pET22b between the NdeI and XhoI sites to construct the recombinant plasmid pET22b-ongC; and (iii) The constructed recombinant plasmid, pET22b-ongB in step (1) or pET22b-ongC in step (2), was transformed into E. coli BL21(DE3) competent cells to obtain an engineered E. coli/pET22b-ongB or E. coli/pET22b-ongC strain.

9. The method according to claim 1, wherein the deacetylase OngB and the deaminase OngC are prepared as follows: the constructed engineered E. coli BL21(DE3) strains were cultured in liquid LB medium containing 100 μg/mL ampicillin at 35-40° C. and 150-200 rpm; when the OD.sub.600 of the cultures reached 0.6-0.8, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.4-0.6 mM, and the culture was further cultivated at 15-20° C. and 100-120 rpm for 16 h; then, the culture was centrifuged at 4° C. and 7000-10000 rpm for 5-10 min; the cells were collected, resuspended in the binding buffer (50 mM Tris-HCl, 100 mM NaCl, pH 8.0) and disrupted; the resulting extract was purified to obtain the deacetylase OngB and the deaminase OngC.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0025] FIG. 1. Gel electrophoresis of amplified gene fragments of ongB and ongC. Lane M, DNA molecular weight marker; lane 1, amplified gene fragment of ongC; lane 2, amplified gene fragment of ongB.

[0026] FIG. 2. SDS-PAGE analysis of purified recombinant proteins, OngB and OngC. A, SDS-PAGE analysis of purified recombinant OngB (marked by an arrow). Lane M, protein molecular weight marker. B, SDS-PAGE analysis of purified recombinant OngC (marked by an arrow). Lane M, protein molecular weight marker.

[0027] FIG. 3. Q-TOF-MS analysis of products generated by the recombinant enzymes, OngB and OngC, acting on GlcNAc1A. A, Q-TOF-MS analysis of products generated by the recombinant OngB acting on GlcNAc1A. B, Q-TOF-MS analysis of products generated by OngB and OngC acting on GlcNAc1A.

[0028] FIG. 4. Substrate specificity analysis of OngB and OngC. A, Substrate specificity analysis of the deacetylase OngB. B, Substrate specificity analysis of the deaminase OngC.

[0029] FIG. 5. Phylogenetic analysis of OngB and its homologs and other de-N-acetylases.

[0030] FIG. 6. Phylogenetic analysis of OngC and its homologs and characterized pyridoxal 5-phosphate (PLP)-dependent enzymes.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0031] According to the present invention which represent various embodiments, these examples are offered to illustrate, but not to limit the present invention.

[0032] The genomic sequence of marine bacterium Pseudoalteromonas prydzensis ACAM 620 (accession no. AQHH00000000) has been deposited in the NCBI GenBank by our lab previously

Example 1 Gene Cloning of ongB and ongC and Construction of Recombinant Plasmids Carrying Genes ongB and ongC

[0033] Genes ongB and ongC from Pseudoalteromonas prydzensis ACAM 620 were ligated into the vector pET22b to construct the recombinant plasmids pET22b-ongB and pET22b-ongC, respectively. The detailed procedure was as follows:

[0034] Based on the 5′ end and 3′ end sequences of genes ongB and ongC, two primer pairs were designed,

TABLE-US-00003 ongB_F (5′-AAGAAGGAGATATACATATGATGCAGTACGATATCTCGCAACCA G-3′ (SEQ ID NO.: 05)) and ongB_R (5′-TGGTGGTGGTGGTGCTCGAGATCATGTTTACTTGCTCCTAAGGA TGTTAAAAATTG-3′ (SEQ ID NO.: 06))
for gene cloning of ongB, and

TABLE-US-00004 ongC_F (5′- AAGAAGGAGATATACATATGATGGAAA AGTTAGCCACAACAAGTGCT- 3′ (SEQ ID NO.: 07)) and  ongC_R (5′-TGGTGGTGGTGGTGCTCGAGAAAATA CGTATCAAAGATCTCAATAACGTTATAGTCATCATCT-3′ (SEQ ID NO.: 08))
for gene cloning of ongC. With these primers and the genomic DNA of Pseudoalteromonas prydzensis ACAM 620 as the template, PCR amplification was performed with the following procedure: pre-denaturation at 95° C. and 30 cycles of denaturation at 95° C. for 30 s, annealing at 55° C. for 30 s, and extension at 72° C. for 1 min. The reaction was kept at 72° C. for 10 min and then stored at 16° C. An about 1.4 kb DNA fragment of ongB and an about 1.2 kb DNA fragment of ongC were amplified. The amplified fragments were ligated into the vector pET22b between the NdeI and XhoI sites to construct the recombinant plasmids pET22b-ongB and pET22b-ongC. The constructed recombinant plasmids, pET22b-ongB and pET22b-ongC, were transformed into E. coli DH5α competent cells by using the heat shock method to obtain recombinant strains DH5α/pET22b-ongB and DH5α/pET22b-ongC, respectively. The constructed recombinant E. coli strains were cultured in liquid LB medium containing 100 μg/mL ampicillin at 37° C. overnight. Plasmids pET22b-ongB and pET22b-ongC were extracted from cultured cells and sequenced, respectively. The results showed that the ongB gene as shown in SEQ ID NO.1 and the ongC gene as shown in SEQ ID NO.2 were successfully inserted between the NdeI and XhoI restriction sites of pET22b in the correct direction.

Example 2 Construction of Recombinant E. coli Strains

[0035] Recombinant plasmids pET22b-ongB and pET22b-ongC were transformed into E. coli BL21(DE3) to obtain engineered E. coli/pET22b-ongB and E. coli/pET22b-ongC strains, respectively. The detailed procedure was as follows:

[0036] The constructed recombinant plasmids pET22b-ongB and pET22b-ongC in Embodiment 1 were transformed into E. coli BL21 (DE3) competent cells by using the heat shock method described in “Molecular Cloning: A Laboratory Manual”. The resultant cells were spread onto LB plates containing 100 μg/mL ampicillin and cultured at 37° C. overnight. Colony PCR was then carried out using a single colony of E. coli/pET22b-ongB or E. coli/pET22b-ongC as the template. The results showed that the target DNA fragments obtained from single colonies of E. coli/pET22b-ongB and E. coli/pET22b-ongC exactly match the length of genes ongB and ongC respectively (FIG. 1), suggesting that engineered E. coli/pET22b-ongB and E. coli/pET22b-ongC strains are successfully constructed.

Example 3 Heteroexpression and Purification of Recombinant Proteins OngB and OngC

[0037] Single colonies of engineered E. coli/pET22b-ongB and E. coli/pET22b-ongC strains in Embodiment 2 were inoculated into LB liquid medium containing 100 μg/mL ampicillin and cultured at 37° C. and 180 rpm. When the OD.sub.600 of the cultures reached 0.6-0.8, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.5 mM, and the culture was further cultivated at 18° C. and 110 rpm for 16 h. Then, the culture was centrifuged at 8000 rpm at 4° C. for 5-10 min. The cells were collected, resuspended in the binding buffer (50 mM Tris-HCl, 100 mM NaCl, pH 8.0) and disrupted by high pressure cell cracker. The recombinant proteins in the resulting extract were purified with Ni-nitrilotriacetic acid (NTA) resin and desalted with PD-10 desalting columns. SDS-PAGE analysis suggested that recombinant proteins OngB and OngC with high purity were obtained (FIG. 2).

[0038] As shown in FIG. 2, the purified OngB from E. coli/pET22b-ongB displayed an apparent molecular weight of approximately 53 kDa, and the purified OngC from E. coli/pET22b-ongC displayed an apparent molecular weight of approximately 45 kDa, consistent with their calculated molecular masses.

Example 4 Production of 2-keto-3-deoxygluconate from 2-(acetylamino)-2-deoxy-D-gluconic acid Catalyzed by Two Enzymes, OngB and OngC

[0039] A method for producing KDG from GlcNAc1A by two enzymes involves these steps as follows: [0040] (1) A reaction mixture containing 10 μM OngB, 10 mM GlcNAc1A, and 10 mM Bis-Tris-HCl buffer (pH 7.5) was incubated at 25° C. for 12 h. The resulting mixture was then centrifugated at 13,000 rpm for 10 min and the supernatant containing product 1 was obtained. [0041] (2) A reaction mixture containing 1 μM OngC, 10 mM product 1 prepared in step (1), and 10 mM Bis-Tris-HCl buffer (pH 7.5) was incubated at 25° C. for 12 h. The resulting mixture was then centrifugated at 13,000 rpm for 10 min and the supernatant containing product 2 was obtained.

[0042] The obtained products 1 and 2 were analyzed with High-Resolution Q-TOF mass spectrometry (Q-TOF-MS) for m/z determination. For MS analysis, the following operating parameters were used: drying N.sub.2 gas flow rate, 4 l/min; temperature, 180° C.; nebulizer pressure, 6 psi; capillary, 4,500 V; and End Plate Offset, 500 V. The acquisition mass range used was from m/z 50 to 1,500 in negative ion mode.

[0043] As shown in FIG. 3A, product 1 is 2-(amino)-2-deoxy-D-gluconic acid (GlcN1A), suggesting that OngB can deacetylate GlcNAc1A to GlcN1A.

[0044] As shown in FIG. 3B, product 2 is KDG, suggesting that at the action of these two enzymes, OngB and OngC, GlcNAc1A is converted to KDG

[0045] Therefore, using genes ongB and ongC from Pseudoalteromonas prydzensis ACAM 620, this invention constructs two engineered E. coli/pET22b-ongB and E. coli/pET22b-ongC strains to prepare recombinant proteins OngB and OngC. At the action of these two enzymes, OngB and OngC, GlcNAc1A is converted to KDG.

Example 5 Substrate Specificity Analysis of OngB and OngC

[0046] (1) Substrate Specificity Analysis of OngB

[0047] Substrate specificity assays were performed with GlcNAc1A, GlcNAc, GlcNAc-6-P, N-acetyl-D-glutamate and N-acetyl-D-serine. Standard reaction system contained 5 μM OngB, 25 mM substrate and 10 mM Bis-Tris-HCl (pH 7.5). Reactions were conducted at 25° C. for 30 min. The production of acetate in the reaction mixture was determined with an Acetic Acid (ACS Analyser Format) Assay Kit. One unit of enzyme (U) is defined as the amount of enzyme required to release 1 μmol of acetate per minute.

[0048] As shown in FIG. 4A, OngB displays high substrate specificity towards GlcNAc1A, and little or no activity for GlcNAc, GlcNAc-6-P, N-acetyl-D-glutamate and N-acetyl-D-serine.

[0049] (2) Substrate Specificity Analysis of OngC

[0050] Substrate specificity assays were performed with GlcN1A, D-glucosamine, D-galactosamine and D-mannosamine. GlcN1A was prepared by incubating 10 μM OngB with 10 mM GlcNAc1A in 10 mM Bis-Tris-HCl (pH 7.5) at 25° C. for 4 h. Standard reaction system contained 0.5 μM OngC, 10 mM substrate and 10 mM Bis-Tris-HCl (pH 7.5). Reactions were conducted at 25° C. for 30 min. The production of ammonia in the reaction mixture was determined with an AMMONIA (Rapid) ASSAY PROCEDURE. One unit of enzyme (U) is defined as the amount of enzyme required to release 1 μmol of ammonia per minute.

[0051] As shown in FIG. 4B, OngC displays high substrate specificity towards GlcN1A, and little or no activity for D-glucosamine, D-galactosamine and D-mannosamine.

Example 6 Sequence Analysis of OngB and OngC

[0052] (1) Sequence Analysis of OngB

[0053] Among characterized enzymes, OngB is most closely related to the D-aminoacylase (accession no. 1RJP) from Alcaligenes faecalis, sharing 46% sequence identity. To analyze the relationships between OngB and other de-N-acetylases, homologs to OngB, characterized N-acetyl-D-amino acid deacetylases (including N-acetyl-D-glutamate deacetylases (Acetyl-D-Glu DA) and acetylcitrulline deacetylases (Acetylcitrulline DA)), and characterized carbohydrate de-N-acetylases (including GlcNAc deacetylases (GlcNAc DA), GlcNAc-6-P deacetylases (GlcNAc-6-P DA), chitin deacetylases (Chitin DA), peptidoglycan N-acetylglucosamine deacetylases (PGN GlcNAc DA), chitooligosaccharide deacetylases (Chitooligosaccharide DA), galactoaminogalactan deacetylases (Galactoaminogalactan DA) and UDP-GlcNAc deacetylases (UDP-GlcNAc DA)) were downloaded from the NCBI nr database. OngB and its homologs and characterized de-N-acetylases were aligned by MUSCLE with a WAG-based model and visualized using Molecular Evolutionary Genetics Analysis version 7.0 (MEGA7).

[0054] As shown in FIG. 5, OngB and its homologs from the ONG clusters of bacteria are clustered as a separate group from all characterized de-N-acetylases in the phylogenetic tree, suggesting that OngB and its homologs may represent a new de-N-acetylase family. Compared to carbohydrate de-N-acetylases, OngB and its homologs are more closely related to N-acetyl-D-glutamate deacetylases (Acetyl-D-Glu DA). However, substrate specificity analysis showed that OngB hardly degraded N-acetyl-D-amino acids while displaying high substrate specificity towards GlcNAc1A (FIG. 4A).

[0055] (2) Sequence Analysis of OngC

[0056] Among characterized enzymes, OngC is most closely related to the D-threonine aldolase (24% identity) from Achromobacter xylosoxidans. To reveal the evolutionary position of OngC, homologs to OngC, characterized D-amino acid deaminases (including D-serine dehydratases and D-serine dehydratases DSD1) and characterized D-threonine aldolases were downloaded from the NCBI nr database. OngC and its homologs and characterized pyridoxal 5-phosphate (PLP)-dependent enzymes were aligned by MUSCLE with a JTT-matrix-based model and visualized using Molecular Evolutionary Genetics Analysis version 7.0 (MEGA7).

[0057] As shown in FIG. 6, OngC and its homologs from the ONG clusters of bacteria, D-serine dehydratases DSD1 and D-threonine aldolases all belong to the Fold-type III PLP-dependent enzyme superfamily. However, OngC and its homologs form a separate clade of the Fold-Type III PLP-dependent enzyme superfamily, suggesting that OngC and its homologs may represent a new family of the Fold-Type III PLP-dependent enzyme superfamily. Substrate specificity analysis showed that OngC displays high substrate specificity towards GlcN1A (FIG. 4B).

[0058] In summary, at the action of two enzymes including a deacetylase OngB and a deaminase OngC, GlcNAc1A, the oxidative degradation product from chitin and chitooligosaccharides, can be converted to KDG, an easily metabolized intermediate by most microorganisms, which not only provides a new method for preparing KDG, but also improves the conversion efficiency of chitin to ethanol and other high value-added chemical compounds. Therefore, the method provided by this invention has important industrial potential in the preparation of KDG and related derivatives and biomass conversion.