Biomimetic support for three-dimensional cell culturing, method for manufacturing same, and use thereof
11162068 · 2021-11-02
Assignee
Inventors
- Sik Yoon (Busan, KR)
- Jong-Young KWAK (Suwon-si, KR)
- Song-Wan Jin (Siheung-si, KR)
- Young Hun JEONG (Daegu, KR)
- Chang Gun Kim (Suwon-si, KR)
- Da Jeong Choi (Daegu, KR)
- Hae Yeong Kang (Daejeon, KR)
- Subhan Fazli (Yangsan-si, KR)
- Muhamad Ikram (Yangsan-si, KR)
Cpc classification
C12N5/0062
CHEMISTRY; METALLURGY
International classification
C12N5/00
CHEMISTRY; METALLURGY
G01N33/50
PHYSICS
Abstract
Disclosed is a method for manufacturing a composite nanofiber support and a fish collagen/synthetic polymer nanofiber support manufactured by the method, wherein the method comprises: a first step for dissolving a synthetic polymer in an organic solvent; a second step for dissolving a fish collagen in water to prepare an aqueous fish collagen solution; a third step for adding the aqueous fish collagen solution prepared in the second step to the synthetic polymer solution prepared in the first step, followed by mixing; and a fourth step for electrospinning the mixture solution prepared in the third step to manufacture a nanofiber support.
Claims
1. A method of preparing a composite nanofiber support comprising: a first step of dissolving a synthetic polymer in an organic solvent to prepare a synthetic polymer solution, wherein the synthetic polymer is poly(ε-caprolactone) (PCL); a second step of dissolving a fish collagen in water to prepare a fish collagen stock solution, wherein a fish collagen concentration of the fish collagen stock solution (Sc) is 30 to 50 wt %; a third step of adding the fish collagen stock solution prepared in the second step to the synthetic polymer solution prepared in the first step, followed by mixing homogeneously to prepare a mixture solution, wherein a final concentration of the mixture solution (Fc) is 2 to 5 wt %; and a fourth step of electrospinning the mixture solution prepared in the third step to prepare a nanofiber support.
2. The method of preparing a composite nanofiber support according to claim 1, wherein the organic solvent is selected from the group consisting of chloroform, hexafluoroisopropane, tetrahydrofuran, dimethylformamide, dichloromethane, acetone, dioxane, trifluoroethane and mixture thereof.
3. A method of culturing a cell on a three-dimensional scaffold comprising: a step of culturing a cell on the nanofiber support prepared by the method of claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
(62)
(63)
(64)
(65)
(66)
(67)
(68)
(69)
(70)
(71)
(72)
(73)
(74)
(75)
DETAILED DESCRIPTION
(76) The present invention provides a method of preparing a composite nanofiber support comprising: a first step of dissolving a synthetic polymer in an organic solvent; a second step of dissolving a fish collagen in water to prepare an aqueous fish collagen solution; a third step of adding the aqueous fish collagen solution prepared in the second step to the synthetic polymer solution prepared in the first step, followed by mixing homogeneously; and a fourth step of electrospinning a mixture solution prepared in the third step to prepare a nanofiber support.
(77) The synthetic polymer solution in the first step may be prepared by dissolving 8 to 10 parts by weight of a synthetic polymer, based on 100 parts by weight of the organic solvent. More preferably, the synthetic polymer solution of 8.8 wt % may be prepared, but is not limited thereto.
(78) If the addition range of the synthetic polymer is out of the range, electrospinning may not be performed, or it may be difficult to produce homogeneous nanofibers during electrospinning.
(79) The synthetic polymer may be one or more selected from the group consisting of poly(ε-caprolactone) (PCL), poly(lactic acid) (PLA), poly(glycolic acid) (PGA), poly(hydroxy valerate) (PHV), poly (lactic-co-glycolic acid) (PLGA), poly-hydroxy butyrate (PHB), poly (hydroxy butyrate-co-valerate (PHBV), polyanhydride, polyorthoester, poly (vinyl alcohol) (PVA), polyethylene glycol (PEG), polyurethane, polyacrylic acid (PAA), poly-N-isopropylacrylamide, diol/biacid-based aliphatic polyester and polyester-amide/polyester-urethane. More preferably, the synthetic polymer may be poly(ε-caprolactone) (PCL), but is not limited thereto.
(80) The poly(ε-caprolactone) (PCL) is a synthetic polymer having a semi-crystalline powder form with a low melting point, and it melts easily compared to other polymers. In addition, the poly(ε-caprolactone) (PCL) is a non-toxic and biocompatible material that exhibits very slow decomposition rates and is widely used as a material for scaffolds for tissue engineering.
(81) The organic solvent may be selected from the group consisting of chloroform, hexafluoroisopropane, tetrahydrofuran, dimethylformamide, dichloromethane, acetone, dioxane, trifluoroethane and mixture thereof.
(82) The aqueous fish collagen solution of the second step may be prepared by dissolving fish collagen of 10 to 70 parts by weight based on 100 parts by weight of water.
(83) If the addition amount of the fish collagen is out of the range, the fish collagen does not dissolve homogeneously in water or a homogeneous fish collagen-PCL mixture solution cannot be obtained or homogeneous nanofibers cannot be produced.
(84) The collagen may be collagen extracted from marine organisms, more preferably fish collagen, but is not limited thereto.
(85) Collagen is a fibrous protein and a natural polymer which is the main component of the extracellular matrix in the connective tissue. This collagen plays a role in regulating the cell recognition and cell adhesion and proliferation, supports the tissues and organs, maintains the body shape surrounding the body surface and regenerates tissues. It can be processed into various forms such as a sponge, a fiber, a gel, a solution, a core material and a tubular material. Fish collagen is a natural polymer substance extracted from marine fish species. The collagen extracted from these marine organisms can undergo easily lower molecular peptidization than collagen extracted from mammals, and has excellent absorption into human body. In addition, the amino acid composition of collagen extracted from marine organisms is different from that of human collagen and can be easily distinguished by special antibodies.
(86) However, collagen has a disadvantage in that it has a very low mechanical strength and is difficult to control the decomposition rate and gelation is difficult by using collagen alone.
(87) The water is the most common solvent in nature and is more economical than organic solvents and does not show toxicity. The present invention demonstrates for the first time that water can be used among solvents that constitute a mixture solution used in the manufacture of nanofibers using electrospinning. Specifically, it is possible to prepare a mixture solution for electrospinning by dissolving a natural polymer in water without toxicity instead of an organic solvent exhibiting toxicity to the cells. Hereafter, other natural polymer in addition to fish collagen which can use water as a solvent may apply to the manufacture of nanofibers by electrospinning.
(88) The mixture solution of the third step is prepared by adding the synthetic polymer solution of the first step so as to comprise the synthetic polymer of 6.3 to 8.5 parts by weight based on 100 parts by weight of the mixture solution. More specifically, poly(ε-caprolactone) (PCL) solution 8.8 wt % prepared in the first step may be added in an amount of 71.4 to 97.1 parts by weight based on 100 parts by weight of the mixture solution, but it is not limited thereto. The fish collagen solution may be added in an amount of 2 to 20 parts by weight based on 100 parts by weight of the mixture solution, but it is not limited thereto.
(89) If the amount of the synthetic polymer solution and the fish collagen aqueous solution added in the production of the mixture solution of the third step is out of the range, the electrospinning may not be properly performed or it may be difficult to produce homogeneous nanofibers during electrospinning.
(90) The mixture solution of the third step is prepared by adding water so as to comprise water of 0.9 to 10 parts by weight based on 100 parts by weight of the mixture solution, but it is not limited thereto.
(91) Also, the present invention provides a method of culturing three-dimensional cell comprising: a first step of dissolving a synthetic polymer in an organic solvent; a second step of dissolving a fish collagen in water to prepare an aqueous fish collagen solution; a third step of adding the aqueous fish collagen solution prepared in the second step to the synthetic polymer solution prepared in the first step, followed by mixing homogeneously; a fourth step of electrospinning a mixture solution prepared in the third step to prepare a nanofiber support; and a step of culturing cell on the nanofiber support prepared in the fourth step.
(92) In addition, the present invention provides a method of culturing three-dimensional cell comprising: a step of mixing and culturing an alginate solution and cells; a step of adding a collagen solution to a cultured mixture to prevent cell detachment; and a step of adding the agarose solution to a mixture including collagen and allowing the mixture to stand, thereby inducing gelation.
(93) More specifically, the method of three-dimensional cell culture may comprise mixing the alginate solution and the cells, and culturing at a temperature of 25 to 37° C. for 5 to 30 minutes; adding the collagen solution to the cultured mixture to prevent cell detachment at a temperature of 25 to 37° C. for 5 to 30 minutes; and adding the agarose solution to a mixture including collagen and allowing the mixture to stand for 5 to 30 minutes at a temperature of 4 to 25° C., thereby inducing gelation.
(94) In the step of mixing and culturing the alginate solution and the cells, the incubation temperature and time range are the most preferable temperature and time range for minimizing the influence on the cells.
(95) In the step of adding the collagen solution to the cultured mixture so as to prevent cell detachment, if the temperature and the time do not fall within the range, the collagen is not homogeneously mixed or the cell culture efficiency is lowered.
(96) In addition, in the step of adding the agarose solution is added and allowing the mixture to stand, thereby inducing gelation, if the temperature and the time do not fall within the range, gelation may not be performed or cells may be damaged or killed.
(97) The collagen may be marine-derived collagen, but is not limited thereto.
(98) The alginate may be added in an amount of 0.5 to 2 parts by weight, more preferably 1 part by weight based on 100 parts by weight of the cultured mixture, but is not limited thereto.
(99) The collagen may be added in an amount of 1 to 30 parts by weight, more preferably 7.5 to 10 parts by weight based on 100 parts by weight of the mixture, but is not limited thereto.
(100) If the collagen solution comprises in amount out of the above range, the cells are not be encapsulated so that the cells escape from the gel or affect the growth ability of the cells.
(101) Also, the agarose is added in an amount of 0.1 to 0.5 parts by weight, more preferably 0.125 parts by weight based on 100 parts by weight of the mixture, but is not limited thereto.
(102) The agarose is a polysaccharide composed of galactose extracted from seaweed. It is mainly used as a cell culture medium and can be used in the form of a hydrogel because the hardness of the structure can be adjusted, so that it is possible to seed cells evenly inside the scaffold. Moreover, agarose can induce gelation by changing temperature without ion crosslinking or chemical crosslinking. However, if the agarose solution comprises in amount out of the above range, gelation may not be performed or cells may be damaged or killed.
(103) The alginate, collagen and agarose added to the mixture may be added in the form of a storage solution, but are not limited thereto.
(104) The alginate storage solution for preparing the mixture solution may be prepared by dissolving alginate in an amount of 1 to 10 parts by weight based on 100 parts by weight of distilled water. The agarose storage solution may be prepared by dissolving agarose in an amount of 1 to 3 parts by weight based on 100 parts by weight of distilled water. The collagen storage solution may be prepared by dissolving collagen in an amount of 20 to 30 parts by weight based on 100 parts by weight of distilled water, but is not limited thereto.
(105) The cells that can be cultured by the three-dimensional cell culture method of the present invention can be selected from normal cells and cancer cells.
(106) The cancer cells are solid cancer cell selected from the group consisting of ovarian cancer, breast cancer, gastric cancer, colon cancer, rectal cancer, lung cancer, liver cancer, prostate cancer, renal cancer, pancreatic cancer, thyroid cancer, uterine cancer, laryngeal cancer, hydrocephalus, laryngeal cancer, guinea, salivary gland cancer, esophageal cancer, osteosarcoma, tongue cancer, biliary cancer, glioma, bone cancer and unknown cause cancer, and the cell is a blood cancer cell selected from the group consisting of B cell lymphoma, T cell lymphoma, leukemia, and multiple myeloma, but is not limited thereto.
(107) Further, the present invention provides a method of measuring cell activity comprising: a step of mixing and culturing an alginate solution and cells; a step of adding a collagen solution to a cultured mixture to prevent cell detachment; a step of adding an agarose solution to a mixture containing collagen and allowing the mixture to stand and induce gelation, and culturing the cells three-dimensionally; and analyzing growth, proliferation, death, differentiation and migration of cells cultured three-dimensionally.
(108) In addition, the present invention provides a method of measuring sensitivity of anticancer drugs comprising: a step of mixing and culturing an alginate solution and cells; a step of adding a collagen solution to a cultured mixture to prevent cell detachment; a step of adding an agarose solution to a mixture containing collagen and allowing the mixture to stand and induce gelation, and culturing the cells three-dimensionally; and a step of analyzing cell viability by adding an anticancer drug to cells cultured three-dimensionally.
(109) The present invention will be described more fully hereinafter with reference to the accompanying drawings, in which exemplary embodiments of the invention are shown.
Example 1
Fabrication and Degree of Mixing Analysis of Nanofiber Support
(110) 1-1. Production of PCL Nanofiber Support
(111) Chloroform was added to polycaprolactone (average Mn 80,000, Sigma (St. Louis, Mo., USA); hereinafter referred to as PCL) and uniformly dissolved for 1 hour by using a magnetic stirrer to prepare a final 8.8 wt % PCL solution and then electrospun. The needle of the electrospining was connected to a wire mesh type collector (0.5 mm in wire diameter, 1×1 mm mesh size) under the conditions of 27 gauge, a scattering distance of 8 cm, a voltage of 11 kV, a fluid velocity of 0.5 mL/hr, temperature 21˜22° C. and humidity of 40˜45% and the spinning time was 60 to 120 minutes, preferably approximately 90 minutes. Then, a PCL nanofiber support was prepared by drying in an oven of 60° C. for 10 seconds to remove the residual solvent contained in the mat.
(112) 1-2. Production of Fish Collagen/PCL Nanofiber Support
(113) Chloroform was added to polycaprolacton (average Mn 80,000, Sigma; hereinafter referred to as PCL) and uniformly dissolved for 1 hour using a magnetic stirrer to prepare a PCL solution of final 8.8 wt %. In addition, in order to prepare fish collagen stock solution, fish collagen (Fish collagen, Geltech, Busan, Korea) was added to distilled water and mixed in a test tube mixer (Vortex, Genie-2, 60 Hz, Scientific Industries, Bohemia, N.Y., USA) to prepare 20 wt % (.sub.c 20 wt %) fish collagen aqueous solution (20 wt % fish collagen stock solution; 20 wt % stock (S) solution; S.sub.c 20 wt %; S.sub.c 20%).
(114) Then, the S.sub.c 20 wt % fish collagen stock solution was added to the 8.8 wt % PCL solution so as to be the final concentration of fish collagen of 0.1, 1 and 2 wt %, and the mixture was homogeneously mixed for 3 hours using a magnetic stirrer to prepare fish collagen/PCL mixture solution.
(115) The fish collagen/PCL mixture solution of 0.1, 1 and 2 wt % prepared in the above was electrospun by using an electrospinning apparatus. The needles of electrospinning, were connected to a wire mesh type collector (0.5 mm in wire diameter, 1×1 mm mesh size) under the conditions of 27 gauge, a scattering distance of 8 cm, a voltage of 9 kV, a fluid velocity of 0.4 mL/hr, temperature 21˜22° C. and humidity of 40˜45%. The spinning time was 60 to 90 minutes, preferably approximately 70 minutes.
(116) 1-3. Mixing Degree Analysis of Fish Collagen/PCL Nanofiber Support using Rhodamine
(117) In order to confirm the mixing of fish collagen and PCL, 0.01 g of rhodamine B (Sigma) was added to a fish collagen aqueous solution of S.sub.c 20 wt % and dissolved uniformly in a test tube mixer. Thereafter, a fish collagen aqueous solution of S.sub.c 20 wt % containing rhodamine B was added to 8.8 wt % PCL solution so that the final concentration of fish collagen was 1% by weight, and the mixture was stirred to prepare a rhodamine-1% fish collagen/PCL mixture solution.
(118) A nanofiber support was prepared by electrospinning the rhodamine-1 wt % fish collagen/PCL solution prepared in the above under electrospinning conditions of Examples 1-2. The prepared rhodamine-1 wt % fish collagen/PCL nanofiber support was placed on a slide glass, sealed with a cover glass, and the degree of mixing was analyzed using a confocal laser scanning microscope.
(119) As a result, as shown in
(120) From the above results, it was confirmed that the fish collagen aqueous solution was homogeneously mixed with PCL.
Example 2
Analysis of Cell Adhesion of PCL and Fish Collagen/PCL Nanofiber Support
(121) 2-1. Cell Culture Using PCL and Fish Collagen/PCL Nanofiber Support
(122) Thymic deep cortex or cortical reticular epithelial cell (hereafter, referred to as CREC), a type of normal mouse thymic epithelial cell (TEC) provided from Dr. Barbara B. Knowles (The Jackson Laboratory, Bar Harbor, Me., USA) was cultured and incubated in Dulbecco's Modified Eagle Medium (DMEM, HyClone, Logan, Utah, USA) containing 10% (v/v) fetal bovine serum (FBS; Gibco, Invitrogen), 100 IU/mL penicillin (Gibco, USA) and 100 μg/mL streptomycin (Gibco, Invitrogen) at 37° C. in a 5% CO.sub.2 atmosphere. The culture medium was replaced with new one every 2-3 days.
(123) The PCL nanofiber support prepared in Example 1 and the fish collagen/PCL nanofiber support having final concentrations of 0.1, 1 and 2 wt % were placed in 96-well plates respectively and CREC cells were inoculated at 5×10.sup.4 cells per a well and cultured for 6 hours.
(124) 2-2. Analysis of Cell Adhesion of Nanofiber Support using Fibrous Actin Staining
(125) In order to confirm the cell adhesion of the nanofiber support, the support having the cultured cells was washed twice with phosphate buffered saline (PBS) and fixed with 4% paraformaldehyde fixation solution at room temperature for 20 minutes. Thereafter, the cells were washed twice with PBS, and were infiltrated into 0.1% Triton-X100 solution at room temperature for 5 minutes and then washed twice with PBS.
(126) To remove nonspecific staining, the cells were treated with 0.2% bovine serum albumin (BSA) solution at room temperature for 20 minutes and then washed twice with PBS.
(127) Thereafter, actin-detecting Phalloidin-FITC (Promega, Madison, Wis., USA) was diluted to 1:150 in 0.2% BSA solution and reacted at room temperature for 40 minutes, and then was washed with tris-buffered saline (TBS), the support was placed on a cover glass and was contrast-stained with DAPI (Vector Lab, Inc., Burlingame, Calif., USA) for nuclear staining of the cells, and encapsulated. The cell adhesion of the cells for the support was measured by a laser confocal microscope.
(128) As a result, as shown in
Example 3
Analysis of Optimized Concentration of Fish Collagen
(129) 3-1. Production of Fish Collagen/PCL Nanofiber Support of a Concentration of 2 wt % or More
(130) Fish collagen was added distilled water to prepare fish collagen stock solutions (S.sub.c) having the concentrations of S.sub.c 10 wt %, S.sub.c 20 wt %, S.sub.c 30 wt % S.sub.c 40 wt % S.sub.c 50 wt % S.sub.c 60 wt % S.sub.c 70 wt % S.sub.c 80 wt % S.sub.c 90 wt % and S.sub.c 100 wt %, and were named as S.sub.c10%, S.sub.c20%, S.sub.c30% S.sub.c40% S.sub.c50% S.sub.c60% S.sub.c70% S.sub.c80% S.sub.c90% and S.sub.c100%. In the case of S.sub.c100%, the PCL cannot be included at all, so it is excluded from the selection condition (marked as X in Table 1), and the concentration of at least S.sub.c80% is excluded from the selection condition because the viscosity is too high to add the accurate content (marked as X in Table 1). In addition, in the case of high concentration of at least S.sub.c50%, S.sub.c60% was also excluded from the selection condition because there is no particular difference with S.sub.c50% or S.sub.c70%.
(131) Accordingly, the fish collagen stock solutions to be added to the mixture solution were prepared as S.sub.c10%, S.sub.c20%, S.sub.c30%, S.sub.c40%, S.sub.c50% and S.sub.c70%.
(132) In addition, chloroform was added to PCL (polycaprolacton, average Mn 80,000, Sigma) and uniformly dissolved for 1 hour using a magnetic stirrer to finally prepare 8.8 wt % PCL solution.
(133) Thereafter, fish collagen stock solutions having each concentration were added to the produced 8.8 wt % PCL solution to prepare fish collagen/PCL mixture solutions having final concentration of fish collagen in the mixed solution (FC) of F.sub.c 2 wt %, F.sub.c 3 wt %, F.sub.c 4 wt %, F.sub.c 5 wt %, F.sub.c 10 wt %, F.sub.c 15 wt %, F.sub.c 20 wt %, F.sub.c 30 wt %, F.sub.c 40 wt % and F.sub.c 50 wt %, and were named as F.sub.c2%, F.sub.c3%, F.sub.c4%, F.sub.c5%, F.sub.c10%, F.sub.c15%, F.sub.c20%, F.sub.c30%, F.sub.c40% and F.sub.c50%, respectively. Referring to the Table 1, the nanofiber support was not homogeneously produced or electrospun when it contained 1.1 mL or more of water based on the total volume of the mixture solution of 10 mL (number in parentheses in italics). Accordingly, it was confirmed that the nanofiber support was successfully prepared when the amount of water contained based on the total volume of the mixture solution of 10 mL was 0.09 to 1 mL (number in parentheses in italics).
(134) Finally, the mixture solution prepared according to the amount of water in Table 1, the amount of fish collagen in Table 2, and the amount of the 8.8 wt % PCL synthetic polymer solution in Table 3 based on a total volume of 10 mL of the mixture solution, was electrospun to prepare a nanofiber support. The needles of electrospinning, were connected to a wire mesh type collector (0.5 mm in diameter, 1×1 mm mesh size) under the conditions of 27 gauge, a scattering distance of 8 cm, a voltage of 9 kV, a fluid velocity of 0.4 mL/hr, temperature 21˜22° C. and humidity of 40˜45%. The spinning time was 60 to 90 minutes, preferably approximately 70 minutes.
(135) TABLE-US-00001 TABLE 1 Content of water based on 10 mL of Final concentration of fish collagen in mixture solution (F.sub.c, %) mixture solution (mL) 2 3 4 5 10 15 20 30 40 50 100 Concentration 10 (1.8) (2.7) (3.6) (4.5) x x x x x x x of fish collagen 20 0.8 (1.2) (1.6) (2) (4) x x x x x x stock solution 30 0.47 0.7 0.93 (1.17) (2.33) (3.5) (4.67) x x x x (S.sub.c, %) 40 0.3 0.45 0.6 0.75 (1.5) (2.25) (3) (4.5) x x x 50 0.2 0.3 0.4 0.5 1 (1.5) (2) (3) (4) x x 60 0.13 0.2 0.27 0.33 0.67 1 (1.33) (2) (2.67) (3.33) x 70 0.09 0.13 0.17 0.21 0.43 0.64 0.86 (1.29) (1.71) (2.14) x 80 x x x x x x x x x x x 90 x x x x x x x x x x x 100 x x x x x x x x x x x
(136) TABLE-US-00002 TABLE 2 Content of fish collagen based on 10 mL of Final concentration of fish collagen in mixture solution (F.sub.c, %) mixture solution (mL) 2 3 4 5 10 15 20 30 40 50 100 Concentration 10 x x x x x x x x x x x of fish collagen 20 0.2 x x x x x x x x x x stock solution 30 0.2 0.3 0.4 x x x x x x x x (S.sub.c, %) 40 0.2 0.3 0.4 0.5 x x x x x x x 50 0.2 0.3 0.4 0.5 1.0 x x x x x x 60 0.2 0.3 0.4 0.5 1.0 1.5 x x x x x 70 0.2 0.3 0.4 0.5 1.0 1.5 2.0 x x x x 80 x x x x x x x x x x x 90 x x x x x x x x x x x 100 x x x x x x x x x x x
(137) TABLE-US-00003 TABLE 3 Content of 8.8 wt % PCL solution based on 10 mL Final concentration of fish collagen in mixture solution (F.sub.c, %) of mixture solution (mL) 2 3 4 5 10 15 20 30 40 50 100 Concentration 10 x x x x x x x x x x x of fish collagen 20 9.00 x x x x x x x x x x stock solution 30 9.33 9.00 8.67 x x x x x x x x (S.sub.c, %) 40 9.50 9.25 9.00 8.75 x x x x x x x 50 9.67 9.40 9.20 9.00 8.00 x x x x x x 60 9.67 9.50 9.33 9.17 8.33 7.50 x x x x x 70 9.71 9.57 9.43 9.29 8.57 7.86 7.14 x x x x 80 x x x x x x x x x x x 90 x x x x x x x x x x x 100 x x x x x x x x x x x
(138) 3-2. Analysis of Structure and Diameter of Fish Collagen/PCL Nanofiber Support According to Fish Collagen Concentration
(139) In order to confirm the surface structure of the PCL nanofiber support prepared in Example 1-1 and the fish collagen/PCL nanofiber support prepared in Example 3-1 by using a scanning electron microscope (SEM), each nanofiber support was fixed with 2.5% glutaraldehyde fixation liquid for 24 hours at 4° C. and then additionally fixed with 1% osmium tetroxide at room temperature for 1 hour. The Fixed support samples were washed 2-3 times with 0.1 M phosphate buffer (pH 7.4) and dehydrated by an ethanol series. Each of the dehydrated nanofiber support samples was frozen at −80° C. for 3 hours, freeze-dried for 12 hours using a vacuum freeze drier (FDS series, ilShinBioBase), and surface-treated by an ion sputter (E-1010, Hitachi, Tokyo, Japan), and the surface structure of the nanofiber support was analyzed by a scanning electron microscope (Hitachi) under an accelerating voltage of 20 kV. The diameter and nano/micro fiber distribution at 3000× magnification of the fish collagen/PCL nanofiber support of F.sub.c2%-S.sub.c50%, F.sub.c3%-S.sub.c50%, F.sub.c4%-S.sub.c50%, F.sub.c5%-S.sub.c50%, F.sub.c10%-S.sub.c50%, F.sub.c3%-S.sub.c70%, F.sub.c5%-S.sub.c70%, F.sub.c10%-S.sub.c70%, F.sub.c15%-S.sub.c70%, F.sub.c20%-S.sub.c70%, F.sub.c2%-S.sub.c20%, F.sub.c2%-S.sub.c30%, F.sub.c2%-S.sub.c40%, F.sub.c4%-S.sub.c40% was measured.
(140) As a result, as shown in
(141) In addition, as a result of the microstructure of the supports having final fish collagen concentrations of F.sub.c2%, F.sub.c3%, F.sub.c4%, F.sub.c5% and F.sub.c10% using the S.sub.c50% stock solution by scanning electron microscope in
(142) As a result of the microstructure of the supports having final fish collagen concentrations of F.sub.c2%, F.sub.c3%, F.sub.c4%, F.sub.c5% and F.sub.c10% using the S.sub.c70% stock solution by scanning electron microscope, it was confirmed that as the final collagen concentration of the support increased, that the size of the pore decreased. Especially, in the case of the fish collagen/PCL nanofiber support having a high concentration of F.sub.c5% or more in the support prepared using the S.sub.c50% and S.sub.c70% stock solutions, generally the pore size and the diameter of the nanofibers were too small to provide ideal environment for three-dimensional distribution of cells and thus the microstructure of the support was observed according to the concentration of the stock solution at F.sub.c2% and F.sub.c4%.
(143) As a result, referring to
(144) From the above results, it was confirmed that as the concentration of the stock solution increased in the support less than F.sub.c5%, the average diameter and the pore of the nanofibers decreased.
Example 4
Three-dimensional Culture Characterization of Solid Cancer Cells According to Fish Collagen Concentration in Fish Collagen/pcl Nano/micro Hybrid Fiber Support
(145) 4-1. Cell and Cell Culture
(146) A human non-small cell lung cancer cells (NCI-H1703) were purchased from the American Type Culture Collection (ATCC, Manassas, Va., USA) and a human prostate cancer cell-145 were purchased from Korean Cell Line Bank. NCI-H1703 and DU-145 cell lines were cultured and maintained in RPMI-1640 medium (HyClone, Logan, Utah, USA) containing 10% (v/v) fetal bovine serum (FBS; Gibco, Invitrogen), 100 IU/mL penicillin (Gibco, Invitrogen) and 100 ug/mL streptomycin (Gibco, Invitrogen) at 37° C. under atmospheric conditions containing 5% CO.sub.2. The culture medium was changed with new one every 2-3 days.
(147) 4-2. Three-Dimensional Cell Culture using Fish Collagen/PCL Nanofiber Support
(148) In order to compare three-dimensional culture characteristics of fish collagen/PCL nanofiber support prepared according to the concentration of fish collagen, experimental groups were set as follows:
(149) Experimental groups was divided into 10 groups of F.sub.c0% (PCL 100%), F.sub.c2%-S.sub.c30%, F.sub.c2%-S.sub.c50%, F.sub.c2%-S.sub.c70%, F.sub.c5%-S.sub.c50%, F.sub.c5%-S.sub.c70%, F.sub.c10%-S.sub.c50%, F.sub.c10%-S.sub.c70%, F.sub.c15%-S.sub.c70%, F.sub.c20%-S.sub.c70% according to the concentration (S.sub.c) of the fish collagen stock solution used for the production of the fish collagen/PCL mixture solution and final concentration of fish collagen (F.sub.c) in the fish collagen/PCL mixture solution used in the electrospinning. The fish collagen/PCL nanofiber support was prepared according to the method of the fish collagen/PCL nanofiber support in the Example 1 and the fish collagen/PCL nanofiber support was placed on a 96-well plate and human non-small cell lung cancer (NCI-H1703) and human prostate cancer (DU-145) cells inoculated at 5×10.sup.4 cells/well, respectively and cultured.
(150) 4-3. Three-Dimensional Characterization of Human Solid Cancer Cells using Actin Staining
(151) A F-actin staining of human non-small cell lung cancer (NCI-H1703) and prostate cancer cell line (DU-145) cultured in a three-dimensional culture for 1 day using fish collagen/PCL nanofiber support was performed.
(152) First, the cell-cultured fish collagen/PCL composite nanofiber support was fixed with 4% paraformaldehyde fixation liquid for 20 minutes at room temperature. Then, the cells were washed twice with PBS, infiltrated into 0.1% Triton-x 100 solution at room temperature for 5 minutes, and washed twice with PBS. To remove nonspecific staining, the cells were treated with 0.2% bovine serum albumin (BSA) solution at room temperature for 20 minutes and then washed twice with PBS. Thereafter, actin-detecting Phalloidin-FITC (Promega, Madison, Wis., USA) was diluted to 1:150 with 0.2% BSA solution and reacted for 40 minutes and washed with tris-buffered saline (TBS) three times to place on a slide. The cell were contrast-stained with DAPI (Vector Lab, Inc., Burlingame, Calif., USA) for nuclear staining of cells, covered with a cover glass and encapsulated to identify three-dimensional distribution of the cells in each nanofiber support by a confocal laser scanning microscope (FV1000-IX81, Olympus, Japan).
(153) As a result, referring to
(154) From the above results, it was confirmed that the pores between the nanofibers in the PCL nanofiber support (F.sub.c0%) were relatively wide for the cells to reach to a considerably deep region. However, referring to
(155) While, Referring
(156) From the above results, it was confirmed that the pores between the nanofibers were sufficiently large so that the F.sub.c2%-S.sub.c30%, F.sub.c2%-S.sub.c50% and F.sub.c2%-S.sub.c70% fish collagen/PCL nanofiber support could reach cells to a considerably deep region. In addition, referring
(157) Therefore, it was confirmed that the F.sub.c2%-S.sub.c30%, F.sub.c2%-S.sub.c50%, and F.sub.c2%-S.sub.c70% fish collagen/PCL nanofiber support provide an ideal three-dimensional cell growth environment, thereby exhibiting high three-dimensional cell culture efficiency.
(158) Also, referring
(159) From the above results, it was confirmed that the pores between the F.sub.c5%-S.sub.c50% and F.sub.c5%-Sc70% fish collagen/PCL nanofiber supports are narrower than those between the F.sub.c2%-S.sub.c30% and F.sub.c2%-S.sub.c50% so that the distribution is relatively shallow. However, as a result of checking each cross section at 1 μm intervals, it was homogeneously distributed as in the cells of
(160) Also, referring
(161) From the above results, it was confirmed that the pores between the F.sub.c10%-S.sub.c50% and F.sub.c10%-Sc70% fish collagen/PCL nanofiber supports are narrower than those between the F.sub.c2%-S.sub.c30% and F.sub.c2%-S.sub.c50% so that the distribution is relatively shallow. However, as a result of checking each cross section at 1 μm intervals, it was homogeneously distributed as in the cells of
(162) Also, referring
(163) From the above results, it was confirmed that the pores between the F.sub.c15%-S.sub.c70% and F.sub.c20%-Sc70% fish collagen/PCL nanofiber supports are narrower than those between the F.sub.c2%-S.sub.c30% and F.sub.c2%-S.sub.c50% so that the distribution is relatively shallow. However, as a result of checking each cross section at 1 μm intervals, it was homogeneously distributed as in the cells of
(164) From the above results, the fish collagen/PCL nanofiber support comprising fish collagen having a final fish collagen concentration (F.sub.c) of F.sub.c2% or more in the F.sub.c2%, F.sub.c5%, F.sub.c10%, F.sub.c15% and F.sub.c20% fish collagen/PCL mixture solution, has been demonstrated that it can be effectively used for three-dimensional culture of non-small cell lung cancer (NCI-H1703) and human prostate cancer cell line (DU-145). In particular, it was confirmed that F.sub.c2%-S.sub.c30% to F.sub.c2%-S.sub.c50% fish collagen/PCL nanofiber supports can be usefully used for three-dimensional culture of cells among fish collagen/PCL nanofiber support containing at least F.sub.c2%.
Example 5
Analysis of Three-dimensional Culture Characteristics of Blood Cancer Cells According to the Content of Fish Collagen Concentration in Fish Collagen/pcl Nanofiber Support
(165) 5-1. Cell and Cell Culture
(166) Mouse T cell lymphoma cells (EL4) and mouse B cell lymphoma cells (A20) were purchased from the American Type Culture Collection (ATCC, Manassas, Va., USA). EL4 cell lines were cultured and maintained in Dulbecco's Modified Eagle Medium (DMEM, HyClone, Logan, Utah, USA) containing 10% (v/v) fetal bovine serum (FBS; Gibco, Invitrogen), 100 IU/ml penicillin (Gibco, Invitrogen) and 100 μg/mL streptomycin (Gibco, Invitrogen) at 37° C. under 5% CO.sub.2-containing atmospheric conditions. The A20 cell line was cultured and maintained in RPMI-1640 medium (HyClone, Logan, Utah, USA) containing 10% v/v fetal bovine serum (FBS; Gibco, Invitrogen), 100 IU/mL penicillin (Gibco, Invitrogen) and 100 μg/mL streptomycin (Gibco, Invitrogen) at 37° C. under 5% CO.sub.2-containing atmospheric conditions. The culture medium was replaced with new one every 2-3 days.
(167) 5-2. Three-Dimensional Cell Culture using Fish Collagen/PCL Nanofiber Support
(168) In order to compare three-dimensional culture characteristics of fish collagen/PCL nanofiber support prepared according to the concentration of fish collagen, experimental groups were set as follows:
(169) Experimental groups was divided into 10 groups of F.sub.c0% (PCL 100%), F.sub.c2%-S.sub.c30%, F.sub.c2%-S.sub.c50%, F.sub.c2%-S.sub.c70%, F.sub.c5%-S.sub.c50%, F.sub.c5%-S.sub.c70%, F.sub.c10%-S.sub.c50%, F.sub.c10%-S.sub.c70%, F.sub.c15%-S.sub.c70%, F.sub.c20%-S.sub.c70% according to the concentration (S.sub.c) of the fish collagen stock solution used for the production of the fish collagen/PCL mixture solution and final concentration of fish collagen (F.sub.c) in the fish collagen/PCL mixture solution used in the electrospinning. The fish collagen/PCL nanofiber support was prepared according to the method of the fish collagen/PCL nanofiber support in the Example 1 and the fish collagen/PCL nanofiber support was placed on a 96-well plate and Mouse T cell lymphoma cell line (EL4) and mouse B cell lymphoma cell line (A20) cells inoculated at 4×10.sup.5 cells/well, respectively and cultured.
(170) 5-3. Analysis of Three-Dimensional Distribution Characteristics of Mouse Blood Cancer Cells using Actin Staining
(171) For fibrous actin (F-actin) staining of mouse B cell lymphoma cell line (A20) and mouse T cell lymphoma cell line (EL4) cultured three-dimensionally for 1 day and 3 days using a fish collagen/PCL nanofiber support, fish collagen/PCL composite nanofiber support having cultured cells was fixed with 4% paraformaldehyde fixation liquid for 20 minutes at room temperature. Then, the cells were washed twice with PBS, then infiltrated into a 0.1% triton-X 100 solution at room temperature for 5 minutes, and washed twice with PBS. To remove nonspecific staining, the cells were treated with 0.2% bovine serum albumin (BSA) solution at room temperature for 20 minutes and then washed twice with PBS. Thereafter, actin-detecting Phalloidin-FITC (Promega, Madison, Wis., USA) was diluted to 1:150 with 0.2% BSA solution and the cells were reacted for 40 minutes and washed with tris-buffered saline three times and contrast-stained with DAPI (Vector Lab, Inc., Burlingame, Calif., USA) for nuclear staining of cells, covered with a cover glass to encapsulated to measure by a confocal laser scanning microscope FV1000-IX81, Olympus, Japan).
(172) As a result of
(173) From the above results, it was confirmed that the pores between the nanofibers in the PCL nanofiber support (F.sub.c0%) were relatively wide and the cells reached a considerably deep region.
(174) However, referring to
(175) From the above results, it was confirmed that the PCL nanofiber support does not provide an environment suitable for three-dimensional culture of blood cancer cells.
(176) While, Referring
(177) From the above results, it was found that F.sub.c2%-S.sub.c30%, F.sub.c2%-S.sub.c50% and F.sub.c2%-S.sub.c70% fish collagen/PCL nanofiber supports could reach cells to a considerably deep region and the sizes of the pores between the nanofibers were proper Is a suitable to provide an environment for migration and maintenance of cells. Also, when each cross section of 1 μm spacing was observed, the cells were homogeneously distributed at a sufficiently high density over a considerable thickness. In addition, referring to
(178) Therefore, it was confirmed that the F.sub.c2%-S.sub.c30% and F.sub.c2%-S.sub.c50% fish collagen/PCL nanofiber supports provide an ideal three-dimensional cell growth environment, thereby exhibiting high three-dimensional cell culture efficiency.
(179) On the other hand, in the case of F.sub.c2%-S.sub.c70% fish collagen/PCL nanofiber support, referring to
(180) From the above results, it was confirmed that the pores between the F.sub.c5%-S.sub.c50%, F.sub.c5%-S.sub.c70%, F.sub.c10%-S.sub.c70%, F.sub.c15%-S.sub.c70% and F.sub.c20%-S.sub.c70% fish collagen/PCL nanofiber supports are narrower than those between the F.sub.c2%-S.sub.c30% and F.sub.c2%-S.sub.c50% so that the distribution is relatively shallow. However, the cells in the enlarged cross-section of
(181) However, the cell density was low as F.sub.c2%-S.sub.c70% fish collagen/PCL nanofiber support.
(182) Mouse T cell lymphoma cells were found to reach 30 μm and 20 μm depth respectively in F.sub.c5%-S.sub.c50% (
(183) From the above results, it was confirmed that a good three-dimensional cell growth environment could not be provided in the supports at least F.sub.c10% concentrations (F.sub.c10%-S.sub.c50%, F.sub.c10%-S.sub.c70%, F.sub.c15%-S.sub.c70%, F.sub.c20%-S.sub.c70%).
(184) Therefore, through the above Examples of the present invention, fish collagen having a final fish collagen concentration (F.sub.c) of F.sub.c2% to F.sub.c5% in F.sub.c2%, F.sub.c5%, F.sub.c10%, F.sub.c15% and F.sub.c20% fish collagen/PCL mixture solutions, it was confirmed that the fish collagen/PCL nanofiber supports provide a culture environment suitable for three-dimensional cell culture, more preferably F.sub.c2%-S.sub.c30% to F.sub.c2%-S.sub.c50% fish collagen/PCL nanofiber supports are more suitable.
Example 6
Measurement of Viability of Three-Dimensional Cells in Fish Collagen/PCL Nanofiber Support
(185) 6-1. Cell and Cell Culture
(186) Mouse B cell lymphoma cells (A20) were purchased from the American Type Culture Collection (ATCC, Manassas, Va., USA). The A20 cell line was cultured and maintained in RPMI-1640 medium (Gibco, Invitrogen (HyClone, Logan, Utah, USA) containing 10% v/v fetal bovine serum (FBS; Gibco, Invitrogen), 100 IU/mL penicillin (Gibco, Invitrogen) and 100 μg/mL streptomycin at 37° C. under atmospheric conditions containing 5% CO.sub.2. The culture medium was replaced with new one every 1-2 days.
(187) 6-2. Three-Dimensional Cell Culture using Fish Collagen/PCL Nanofiber Support
(188) In order to measure the viability of three-dimensionally cultured cells in fish collagen/PCL nanofiber support, according to the concentration (S.sub.c) of fish collagen stock used in the preparation of fish collagen/PCL mixture solution and final fish collagen concentration (F.sub.c) using the electrospining in the fish collagen/PCL mixture solution, F.sub.c0% (PCL100%) and F.sub.c2%-S.sub.c50% were used. The method of producing the fish collagen/PCL nanofiber support was performed in the same manner of manufacturing the fish collagen/PCL nanofibers of Example 1 above. Each nanofiber support was placed in a 96-well plate and A20 cells were inoculated at a concentration of 2×10.sup.5 cells/well and cultured.
(189) 6-3. Live/Dead Staining
(190) The Live/Dead staining was performed to confirm the effect of the support on the survival of A20 cells in the culture of the fish collagen/PCL nanofiber support according to the present invention.
(191) First, A20 cells were inoculated in a fish collagen/PCL composite nanofiber support as in Example 6-2 and cultured for 2 days and 6 days. Each nanofiber support was washed once with PBS, diluted with 2 μL of calcein AM and 0.5 μL of ethidium (EthD-1) (LIVE/DEAD Viability Kit, Molecular Probes) in 1 ml of PBS to stain in the dark and analyzed by confocal laser scanning microscopy (FV1000-IX81, Olympus, Japan).
(192) As a result, the viability of A20 cells cultured on the fish collagen/PCL nanofiber support according to the present invention was much higher than that of the PCL nanofiber support, as shown in
(193) From the above results, it was confirmed that the fish collagen/PCL nanofiber support provides a proper growth environment for three-dimensional culture of A20 cells.
Example 7
In-vivo Mimetic Model Conformity Analysis of Three-Dimensional Cultured Cancer Cells Using Fish Collagen/PCL Nanofiber Support
(194) 7-1. Cell and Cell Culture
(195) Chemotherapy-sensitive human non-small cell lung cancer cells (NCI-H1703) were purchased from the American Type Culture Collection (ATCC, Manassas, Va., USA) and human prostate cancer cell (DU-145) were purchased from Korean Cell Line Bank. NCI-H1703 cell line and DU-145 cell line were cultured and maintained in in RPMI-1640 medium (HyClone, Logan, Utah, USA) containing 10% (v/v) fetal bovine serum (FBS; Gibco, Invitrogen), 100 IU/mL penicillin (Gibco, Invitrogen) and 10 μg/mL streptomycin (Gibco, Invitrogen) at 37° C. under atmospheric conditions containing 5% CO.sub.2. Mouse T cell lymphoma cells (EL4) were purchased from the American Type Culture Collection (ATCC, Manassas, Va., USA). EL4 cell lines were cultured in Dulbecco's Modified Eagle Medium (DMEM, HyClone, Logan, Utah, USA) containing 10% (v/v) fetal bovine serum (FBS; Gibco, Invitrogen), 100 IU/ml penicillin (Gibco, Invitrogen) and 100 μg/mL streptomycin (Gibco, Invitrogen) at 37° C. under atmospheric conditions containing 5% CO.sub.2. The culture medium was replaced with new one every 1-2 days.
(196) 7-2. Measurement of Drug Diffusion Ability of Cancer Cells Cultured Three-Dimensionally in Fish Collagen/PCL Nanofiber Support
(197) To measure the ability of the drug to reach cancer cells in a three-dimensional environment using a nanofiber support, F.sub.c2%-S.sub.c50% fish collagen/PCL nanofiber support was prepared, placed in a 96-well plate and EL4 cells were inoculated at 1×105 cells/well and cultured for 3 days.
(198) After that, doxorubicin (Cell Signaling Technology, Danvers, Mass., USA) was treated at a concentration of 1 μM for 12 and 24 hours, washed with PBS, and the nucleus was stained with DAPI solution to confirm the distribution of doxorubicin in the support was confirmed by confocal laser microscopy (FV1000-IX81, Olympus, Tokyo, Japan). The results are expressed as mean±standard deviation (SD) for each analysis. Statistical analysis was performed using a two-tailed t-test and statistical significance was evaluated based on P<0.05.
(199) As a result, as shown in
(200) From the above results, it was confirmed that the three-dimensional cancer cell culture model using the fish collagen/PCL nanofiber support according to the present invention can be useful for screening for susceptibility testing of various drugs such as anticancer drugs.
(201) 7-3. Measurement of Anticancer Drug Susceptibility to Cancer Cells Cultured Three-Dimensionally in Fish Collagen/PCL Nanofiber Support
(202) In order to confirm the suitability of the three-dimensional cancer cell culture model using fish collagen/PCL nanofiber support, the sensitivity of three-dimensional cancer cell culture model using fish collagen/PCL nanofiber support to anticancer drug was analyzed.
(203) First, an F.sub.c4%-S.sub.c50% fish collagen/PCL nanofiber support prepared in the same manner as in Example 1, was placed in a 96-well plate and NCI-H1703 and DU-145 cells were inoculated at a concentration of 5×10.sup.4 cells/well. NCI-H1703 and DU-145 cells cultured in the conventional two-dimensional culture condition and NCI-H1703 and DU-145 cells cultured three-dimensionally in the nanofiber support were treated with 3 μM doxorubicin (Cell Signaling Technology, Danvers, Mass., USA) and 3 μM paclitaxel (T7402, Sigma) for 24 and 48 hours, respectively and with WST-1 reagent and the absorbance was measured at 450 nm using a microplate reader. The results are expressed as mean±standard deviation (SD) for each analysis. Statistical analysis was performed using a two-tailed t-test and statistical significance was evaluated based on P<0.05.
(204) As a result, referring to
(205) In addition, when prostate cancer cell line DU-145 was treated with 3 μM paclitaxel, the cell viability was 50.2% (P<0.01) as compared with the control group in the two-dimensional environment and was 93.5% (P<0.01) as compared with the control group in the three-dimensional environment in
(206) Based on the above results, the three-dimensional environment exhibit effectively drug resistance to anticancer agents than the two-dimensional environment, and the three-dimensional cancer cell culture model using fish collagen/PCL nanofiber support can be used for drug resistance mechanism research and anticancer drug susceptibility test.
(207) 7-4. Analysis of Malignancy by Culturing Three-Dimensional Cancer Cells in Fish Collagen/PCL Nanofiber Support
(208) To analyze malignancy in a three-dimensional cancer cell culture model using a fish collagen/PCL nanofiber support, F.sub.c4%-S.sub.c50% fish collagen/PCL nanofiber support prepared in the same manner as in Example 1 was placed in a 96-well plate and DU-145 cells were inoculated at a concentration of 5×10.sup.4 cells/well and cultured for 2 days. DU-145 cells were cultured in the same condition in two-dimensional manner as a control. A semi-quantitative reverse transcription-polymerase chain reaction analysis (RT-PCR) was performed.
(209) First, total RNA was isolated from the cultured cells according to the manufacturer's instructions using trizol reagent (Ambion, Invitrogen) in each of the cultured DU-145 cells.
(210) To analyze by RT-PCR, single-strand cDNA was synthesized from 1 μg of total RNA using 25 μL of buffer solution containing (DT) 0.5 μg oligo (dT) 12-18, Oligo (dT) primer, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl.sub.2, 40 mM DTT, 0.5 mM deoxynucleotide triphosphate (dNTP) mixture, 10 units RNase inhibitor and 200 units Moloney murine leukemia virus (MMLV) reverse transcriptase (Promega, Madison, Wis., USA).
(211) To confirm the PCR reaction for gene amplification, the primers of Table 4 were used. PCR reaction of human Hes1 and Notch-1, -2, -3, and 4 was performed by using 25 μl of a buffer solution containing 10 pmol of the primer and 1 μl cDNA sample, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl.sub.2, 0.1% Triton X-100, 0.2 mM dNTP mixture liquid and 5 units of Taq DNA polymerase (Promega) to carry out Initial denaturation at 94° C. for 5 minutes, at 72° C. for 45 sec and at 72° C. for 45 sec for 35 cycles and CD44, Snail and GAPDH was performed at 94° C. for 30 sec, at 57° C. for 45 sec and at 72° C. for 45 sec and 30 cycles. In the case of human slug, HIF-1α, VEGF, and endothelin-1, initial denaturation was performed at 94° C. for 5 minutes, followed by 30 seconds at 94° C., 45 seconds at 60° C., and 45 seconds at 72° C. After the PCR reaction, the reaction product samples produced by 2% agarose gel electrophoresis were stained with EtBr (Ethidium bromide) and analyzed under UV light illumination.
(212) As a result, as shown in
(213) From the above results, it was confirmed that, in contrast to the two-dimensional environment, the cancer cells cultured in the three-dimensional environment increase malignancy and the three-dimensional cancer cell culture model using the fish collagen/PCL nanofiber support according to the present invention environment was well simulated as a living body (in-vivo).
(214) In addition, as shown in
(215) From the above results, in the case of three-dimensional cancer cell culture based on fish collagen/PCL nanofiber support, the culture environment of cancer cells such as growth, progression, metastasis and malignancy of cancer can exhibit characteristics very similar to a living body. Because the three-dimensional cell culture method using the nanofiber support of the present invention provides in-vivo simulation environment which cannot be provided in the conventional two-dimensional cell culture method, it is useful for development of therapeutic agent for cancer cells as well as the research on cancer cell, growth, metastasis and malignancy of cancer cells.
(216) TABLE-US-00004 TABLE 4 SEQ ID Gene No. Primer Sequence Human Hes 1 1 Forward: 5′-CCTGTCATCCCCGTCTACAC-3′ 2 Reverse: 5′-CACATGGAGTCCGCCGTAA-3′ Human Notch-1 3 Forward: 5′-TACAAGTGCGACTGTGACCC-3′ 4 Reverse: 5′-CACACGTAGCCACTGGTCAT-3′ Human Notch-2 5 Forward: 5′-CAACCGCAATGGAGGCTATG-3′ 6 Reverse: 5′-GCGAAGGCACAATCATCAATGTT-3′ Human Notch-3 7 Forward: 5′-TGGCGACCTCACTTACGACT-3′ 8 Reverse: 5′-CACTGGCAGTTATAGGTGTTGAC-3′ Human Notch-4 9 Forward: 5′-CCTGGCTCCTTCAACTGCC-3′ 10 Reverse: 5′-GCAAGTAGGTCCAGACAGGT-3′ Human Snail 11 Forward: 5′-AGACCCACTCAGATGTCAA-3′ 12 Reverse: 5′-CATAGTTAGTCACACCTCGT-3′ Human Slug 13 Forward: 5′-GGTCAAGAAGCATTTCAAC-3′ 14 Reverse: 5′-GGTAATGTGTGGGTCCGA-3′ Human VEGF 15 Forward: 5′-CGAAACCATGAACTTTCTGC-3′ 16 Reverse: 5′-CCTCAGTGGTCACACACTCC-3′ Human HIF-1α 17 Forward: 5′-GGCGCGAACGACAAGAAAA-3′ 18 Reverse: 5′-GTGGCAACTGATGAGCAAGC-3′ Human CD44 19 Forward: 5′-CTCCAGTGAAAGGAGCAGCA-3′ 20 Reverse: 5′-AGCAGGGATTCTGTCTGTGC-3′ Human 21 Forward: 5′- Endothelin-1 TGCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTC-3′ 22 Reverse: 5′-GGTCACATAACGCTCTCTGGAGGGCTT-3′ Human GAPDH 23 Forward: 5′-TGGAGAAACCTGCCAAGTATG-3′ 24 Reverse: 5′-TTGTCATACCAGGAAATGAGC-3′
Example 8
In-vivo Simulation Induction/growth and Cancer Cell Differentiation Suitability Analysis for Three-Dimensionally Cultured Cancer Cells Using Fish Collagen/PCL Nanofiber Support
(217) 8-1. Cell and Cell Culture
(218) Mouse T cell lymphoma cells (EL4) were purchased from the American Type Culture Collection (ATCC, Manassas, Va., USA).
(219) EL4 cell lines were cultured in Dulbecco's Modified Eagle Medium (DMEM, HyClone, Logan, Utah, USA) containing 10% (v/v) fetal bovine serum (FBS; Gibco, Invitrogen), 100 IU/mL penicillin (Gibco, Invitrogen) and 100 μg/mL streptomycin (Gibco, Invitrogen) at 37° C. under atmospheric conditions containing 5% CO.sub.2. The culture medium was replaced with new one every 2-3 days.
(220) 8-2. Analysis by High-Flow Cytometer
(221) To analyze the ability of cancer stem cell formation and cancer cell differentiation in a three-dimensional cancer cell culture model using fish collagen/PCL nanofiber support, F.sub.c2%-S.sub.c50% nanofiber support was prepared in the same manner as in Example 1 and was placed in a 96-well plate and EL4 cells were inoculated at a concentration of 2×10.sup.5 cells/well and cultured for 2 days.
(222) The cultured cells were separated and washed twice with Hank's Balanced Salt Solution (HBSS, GibcoLife Technologies), resuspended in 3 mL of FACS buffer (0.1% BSA, 0.1% sodium chloride, 500 mL of HBSS) and centrifuged at 4° C. and 1500 rpm for 4 minutes and the supernatant was removed and the cell was resuspended and pre-incubated with anti-FcγRII/III (2.4G2, hybridoma supernatant) to avoid nonspecific binding with antibodies.
(223) Thereafter, the primary fluorescent-labeled primary anti-mouse monoclonal antibody such as anti-CD4 antibody conjugated with FITC or PE (FITC-CD4 or PE-CD4), APC-conjugated anti-CD8 antibody (APC-CD8), c-kit-conjugated anti-c-kit antibody (c-kit-PE-CY7-c-kit) and APC-conjugated anti-sca-1 antibody (APC-sca-1) was reacted at a concentration of 5-10 μg/mL for 30 minutes under ice-cooling. Background fluorescence was determined by cells reacted with isotype-matched nonreactive antibodies.
(224) After the cells were washed twice with HBSS, the cells were resuspended in 500 μL of FACS buffer and the expression of cell surface molecules was analyzed by Dot-plot method using a flow cytometer. The obtained results were analyzed using FlowJo software (Tree Star, Ashland, Oreg., USA).
(225) As a result, as shown in
(226) From the above results, it was confirmed that, in the case of three-dimensional cancer cell culture based on fish collagen/PCL nanofiber support, the culture environment of cancer cells related to the formation and growth of cancer stem cells is similar to that of a living body. Because the three-dimensional cell culture method using the nanofiber support of the present invention provides in-vivo simulation environment which cannot be provided in the conventional two-dimensional cell culture method, it can be used as a culture model useful for researches of cancer stem cell and anticancer drug resistance mechanism and development of highly efficient chemotherapy.
(227) The following reference examples are intended to provide reference examples commonly applied to Examples 9 to 20.
Reference Example 1
Cell and Cell Culture
(228) The types of cell lines used in the following examples are as follows.
(229) A chemotherapy-sensitive human ovarian cancer cell line A2780 was purchased from the Sigma-Aldrich (Saint Louis, Mo., USA) and the mouse T cell lymphoma cell line (EL4) was purchased from American Type Culture Collection (ATCC, Manassas, Va., USA). In addition, a chemotherapy-sensitive human ovarian cancer cell line R182 cells were provided from Dr. J. Shah (Memorial Sloan-Kettering Cancer Center, New York, N.Y., USA) and a thymic deep cortex or cortical reticular epithelial cell (CREC) which is one of normal mouse thymic epithelial cell is provided from Dr. Barbara B. Knowles (The Jackson Laboratory, Bar Harbor, Me., USA).
(230) R182 cells and A2780 cell lines were cultured and maintained in RPMI-1640 medium (HyClone, Logan, Utah, USA) containing 10% (v/v) fetal bovine serum (FBS; Gibco, Invitrogen), 100 IU/mL penicillin (Gibco, Invitrogen) and 100 μg/mL streptomycin (Gibco, Invitrogen) at 37° C. under atmospheric conditions containing 5% CO.sub.2. The culture medium was replaced with new one every 2-3 days.
(231) In addition, CREC and EL4 cell lines were cultured and maintained in Dulbecco's Modified Eagle Medium (DMEM, HyClone, Logan, Utah, USA) containing 10% (v/v) fetal bovine serum (FBS; Gibco, Invitrogen), 100 IU/mL penicillin (Gibco, Invitrogen) and 100 μg/mL streptomycin (Gibco, Invitrogen) at 37° C. under atmospheric conditions containing 5% CO.sub.2. The culture medium was replaced with new one every 2-3 days.
Reference Example 2
Statistical Analysis
(232) All results are expressed as mean±SD (SD) for each analysis. Statistical analysis was performed using a two-tailed t-test and statistical significance was evaluated based on P<0.05.
Example 9
Fabrication of Agarose-Collagen-Alginate Composite Hydrogel Support
(233) The hydrogel support was prepared in the same manner as in
(234) To prepare a hydrogel support, stock solution was prepared by dissolving sodium alginate (Sigma-Aldrich) in distilled water for 16 hours at a concentration of 3% by weight and sterilized and agarose (Affymetrix, Cleveland, Ohio, USA) was added to sterilized distilled-water to be an amount of 2% by weight and heated at 100° C. until boiling to make agarose stock solution. In addition, marine organism derived collagen (hereinafter referred to as “marine collagen”, Geltech, Busan, Korea) was added to distilled water in an amount of 25% by weight and vortexed to prepare a marine collagen storage solution.
(235) Each of the solutions prepared by the above method was mixed at a temperature of 25° C. to 37° C. First, the cells are mixed with 33.3 μL of 3 wt % alginate stock solution and with 30 μL or 40 μL of 25 wt % marine collagen stock solution and finally 6.25 μL of 2 wt % agarose stock solution to be final concentrations of alginate of 1 wt %, marine collagen of 7.5 wt % or 10 wt % and agarose of 0.125 wt % (hereinafter referred to as “0.125 wt % agarose-7.5 wt % marine collagen-1 wt % alginate” or “0.125 wt % agarose-10 wt % marine collagen-1 wt % alginate”). Thereafter, the mixture obtained in the above allowed to stand at 4° C. for 5 to 30 minutes, more preferably at 5 to 10 minutes.
(236) The three-dimensional cell culture using the hydrogel support of the present invention can be prepared by directly introducing the mixture into a culture container to be used for cell culture, inducing gelation of the mixture and culturing the cell, or transferring the gel to another container, i.e. as the method of
(237) Therefore, the hydrogel of the present invention can prepare the gel according to the size and shape of the cell culture container, and the three-dimensional cell culture is possible by using the prepared hydrogel support.
Example 10
Cell Cytotoxicity Assay by Ca.SUP.2+ Cation
(238) The cytotoxicity assay was performed by the conventional method [H. Lee et al., Regul. Pept. (2008), 147, 72-81]. The cells of Reference Example 1 were dispensed in a 96-well plate at a concentration of 1×10.sup.4 cells/well for R182 and A2780 cells together with 0.1 mL of 10% FBS containing cell medium, and a concentration of 1×10.sup.5 cells/well for R182 and A2780 cells, and the cells were cultured for 24 hours and then cultured for 12-16 hours in the absence of FBS.
(239) The cultured cells were treated with various concentrations of calcium chloride (CaCl.sub.2, Sigma-Aldrich) at concentrations of 10, 50, 100, 200 and 300 mM and cultured for 18 to 24 hours to perform WST-1 assay (EZ-Cytox Cell Viability Assay kit, Daeillab Service, Seoul, Korea) for cell cytotoxicity assay.
(240) WST-1 reagent of 10 μL was added to each well and incubated for 2 hours in a humidified incubator at 37° C. and 5% CO.sub.2 and the absorbance was measured at 450 nm using a microplate reader (Tecan, M, Switzerland) to calculate the percent growth rate.
(241) Also, all results were also expressed as mean±SD (SD) for each analysis. Statistical analysis was performed using a two-tailed t-test and statistical significance was evaluated based on P<0.05.
(242) As a result, as shown in
(243) In addition, the human ovarian cancer cell, R182 cells showed 34.1% (P<0.001), 26.4% (P<0.001), 21.1% (P<0.001), 21.4% (P<0.001), 24.9% (P<0.001) and 25.6% (P<0.001) at 50 mM, 100 mM, 150 mM, 200 mM, 250 mM and 300 mM of CaCl.sub.2, respectively and very strong cytotoxic effects at all concentrations above 50 mM. The other types of human ovarian cancer cells, A2780 cells showed 74.9%, 65.9%, 41.5% (P<0.05), 37.9% (P<0.05), 39.5% (P<0.05) and 43.7% (P<0.05) at 50 mM, 100 mM, 150 mM, 200 mM, 250 mM and 300 mM of CaCl.sub.2, respectively and namely dose-dependent cytotoxic effect.
(244) From the above results, it was confirmed that CaCl.sub.2 shows a significant cytotoxic effect on various types of solid cancer and blood cancer cells as well as normal cells at a general concentration. From the above, because CaCl.sub.2, which is widely used as a hardening agent in the gelation process, i.e. an essential step in the production of an alginate-based hydrogel cell culture support as a general material of hydrogel-based cell culture support, acts as strong toxic factor for both normal and cancer cells, it is very important to develop a method for gelation of a hydrogel which can reduce or eliminate such side effects.
Example 11
Characterization of Agarose-Collagen-Aginate Composite Hydrogel Support by Material and Composition
(245) To identify the composition of suitable materials for preparing composite hydrogel support of Example 9, agarose sole hydrogel, agarose-alginate composite hydrogel and agarose-collagen-alginate composite hydrogel were prepared in the same manner as in Example 9, and their characteristics were analyzed.
(246) The agarose sole hydrogel was prepared at concentrations of 0.5, 1, 1.5, and 2 wt %, which are conventionally used, and the agarose-alginate composite hydrogel was prepared by mixing 3 wt % alginate stock solution and 2 wt % agarose stock solution to be the concentration of 1 wt % alginate and 0.125 wt % agarose, and agarose-collagen-alginate composite hydrogel were prepared in the same manner as in Example 9.
(247) For cell culture in each hydrogel support prepared by the above method, as Example 9, A2780 cells were added into 0.5, 1 and 1.5 wt % agarose sole hydrogel and 0.125 wt % agarose-1 wt % alginate complex a hydrogel support, placed in a 96-well plate to induce the gelation at 4° C. for 5 to 10 minutes and incubated in a medium, and the cell morphology was observed by a phase contrast microscope on days 1, 3 and 5 after the culture. In addition, EL4 cells were added to 0.5, 1.5, and 2 wt % agarose sole hydrogel supports, and placed in 96-well plates to induce the gelation at 4° C. for 5-10 minutes and incubated in a medium, and the cell morphology was observed by a phase contrast microscope on days 2, 5 and 10 after the culture.
(248) As a result, as shown in
(249) As shown in
(250) On the other hand, as shown in
(251) From the above results, the survival and growth of A2780 and EL4 cells in the agarose-alginate composite hydrogel support was superior to that of the agarose sole hydrogel support, and the agarose-collagen-alginate composite hydrogel support exhibited a more stable cell binding force than the agarose-alginate composite hydrogel support.
(252) Therefore, the cell culture using the agarose-collagen-alginate composite hydrogel support is superior to agarose sole hydrogel in the cell survival and growth, and solves the cell detachment phenomenon of the agarose-alginate composite hydrogel support having weak mechanical strength, thereby confirming very suitable for three-dimensional cell culture.
Example 12
Characterization of Used Animal Collagen or Marine Collagen
(253) As described in the above Examples, in the case of the three-dimensional cell culture method using the agarose-alginate composite hydrogel support, it was confirmed that the cells were detached out of the gel. However, the problem of cell detachment was solved by a three-dimensional cell culture method using an agarose-collagen-alginate composite hydrogel support to which the collagen was added and therefore, in order to confirm the efficiency of the collagen, the effect of animal collagen and marine collagen was analyzed.
(254) According to the method of Example 9, 0.125 wt % agarose-0.05 wt % rat tail collagen-1.0 wt % alginate and 0.125 wt % agarose-(0.05, 0.1, 0.2, 0.5, 1, 2, 5, and 10 wt %) marine collagen-1.0 wt % alginate composite hydrogel support was prepared and EL4 cells of 5×10.sup.4 cells/gel were included in the preparation of each of these hydrogel supports. Subsequently, 80 μL of the mixture solution was introduced into a 1 mL syringe to induce the gelation at 4° C. for 5 to 10 minutes and cultured in a 48-well plate, and observed by a phase contrast microscope on day 1, 2, 3 and 4 after culturing in
(255) In addition, 0.125 wt % agarose-0.05 wt % rat tail collagen-1.0 wt % alginate and 0.125 wt % agarose-(0.05, 0.1, 1, 3, 5, 7.5, 10 and 15 wt %) marine collagen-1.0 wt % alginate composite hydrogel support was prepared, and A2780 cells were included in the preparation of each of these hydrogel supports. Subsequently, the mixture solution was introduced into a 96-well plate to induce the gelation 4° C. for 5 to 10 minutes and a medium was added to culture and cells were observed by a phase contrast microscope on day 1 and 3 after culturing in
(256) As a result, as shown in Figure of EL4 cells and
Example 13
Determination of Transparency of Agarose-Marine Collagen-Alginate Composite Hydrogel Support
(257) In order to determine the transparency of the agarose-marine collagen-alginate composite hydrogel support, EL4 cells were added to 0.125 wt % agarose-10 wt % marine collagen-1 wt % alginate composite hydrogel support prepared by the method of Example 9, hydrogel support prepared by chemical cross-linking of 100 mM CaCl.sub.2, and a 96-well conventional plate for two-dimensional cell culture, at 4×10.sup.4 cells/gel, respectively and were cultured to measure and compare the transparency of each support by a phase contrast microscope.
(258) As a result, unlike the hydrogel support prepared by a commonly used ionic chemical crosslinking method (b) and the nanofiber support prepared by electrospinning, which is widely used in tissue engineering (c), as can be seen from the two-dimensional cell culture (a), the agarose-marine collagen-alginate composite hydrogel support (d) according to the present invention provides very high transparency to observe the morphology of EL4 cells using a phase contrast microscope easily. Therefore, the agarose-marine collagen-alginate composite hydrogel support of the present invention can observe by a phase contrast microscope various types of cells, which is impossible in an alginate-based hydrogel or a nanofiber-based support crosslinked with ions such as calcium in the three-dimensional cell culture.
Example 14
Analysis Physical Properties of Agarose-Marine Collagen-Alginate Composite Hydrogel Support
(259) 1. Preparation of Hydrogel Support
(260) As experimental groups used for analyzing the structure of the support, first, 1 wt % alginate alone hydrogel, second, 0.125 wt % agarose sole hydrogel, third, 7.5 wt % marine collagen sole hydrogel, fourth, 10 wt % marine collagen sole hydrogel, fifth, 0.125 wt % agarose-1 wt % alginate composite hydrogel, sixth, 0.125 wt % agarose-7.5 wt % marine collagen-1 wt % alginate composite hydrogel seventh, 0.125 wt % agarose-10 wt % marine collagen-1 wt % alginate composite hydrogel was prepared as Example 9.
(261) 2. Analysis of Hydrogel Support Structure by Scanning Electron Microscope
(262) The hydrogel supports of 7 experimental groups prepared in Example 14-1 were dispensed in a 1 mL syringe at 100 μL, respectively to induce the gelation at 4° C. for 5 to 10 minutes and the cells were frozen at −20° C. for 24 hours and dried by a vacuum freeze dryer (FDS series, ilShinBioBase) for 24 hours and surface-treated with ion sputter (E-1010, Hitachi, Japan) and observed by a scanning electron microscope (JSM-6490LV, JEOL, Japan) under an accelerating voltage of 20 kV.
(263) As a result, when the cross sections of 1 wt % alginate, 0.125 wt % agarose, 7.5 and 10 wt % marine collagen sole hydrogel and 0.125 wt % agarose-1 wt % alginate composite hydrogel support were composed of an irregular pore structure as a whole, however the cross sections of 0.125 wt % agarose-7.5 wt % marine collagen-1 wt % alginate or 0.125 wt % agarose-10 wt % marine collagen-1 wt % alginate composite hydrogel support had the regular pore structure as a whole.
(264) 3. Fourier Transform Infrared Spectroscopy (FT-IR) Analysis
(265) The hydrogel supports of 7 experimental groups prepared in Example 14-1 were dispensed in a 1 mL syringe at 100 μL, respectively to induce the gelation at 4° C. for 5 to 10 minutes and the cells were frozen at −20° C. for 24 hours and dried by a vacuum freeze dryer (FDS series, ilShinBioBase) for 24 hours and surface-treated with ion sputter (E-1010, Hitachi, Japan) and observed by an infrared spectroscopy system (FT-IR Microscopy System).
(266) As a result, as shown in
(267) From the above results, it was confirmed that the main component of FT-IR spectrum of 0.125 wt % agarose-7.5 wt % marine collagen-1 wt % alginate composite hydrogel support was mainly 7.5 wt % marine collagen.
(268) Similarly, the FT-IR spectrum of 0.125 wt % agarose-10 wt % marine collagen-1 wt % alginate composite hydrogel support showed 10 wt % marine collagen characteristics as a parent molecule and no significant additional band was present. This FT-IR spectrum of 0.125 wt % agarose-10 wt % marine collagen-1 wt % alginate composite hydrogel support represents 10 wt % of marine collagen as its main component.
(269) From the above results, no new chemical cross-links were formed in the agarose-marine collagen-alginate composite hydrogel support and it was confirmed that even though the chemical cross-links were not formed in the agarose-marine collagen-alginate composite hydrogel support, gelation occurs due to the physical bonding such as hydrogen bonding or other interaction according to the physical properties of the constituent molecules.
(270) This is because a hydrogen bond is formed between a proton donor and a proton acceptor in the molecule, and as shown in
(271) 4. Swelling Kinetics
(272) The hydrogel supports of seven experimental groups prepared in Example 14-1 were dispensed into a 1 mL syringe at 100 μL, induced to the gelation at 4° C. for 5 to 10 minutes and dried at 40° C. for 24 hours. The weight of the dried agarose-marine collagen-alginate composite hydrogel support was weighed, immersed in phosphate buffered saline (PBS) and distilled water at 37° C., respectively to weigh at intervals of time for obtaining water content.
(273) The weighing was performed at room temperature after the solution flowing down was removed. The water content was calculated by the following formula:
Water content (%)=[(weight of swollen gel−weight of dried gel)/weight of dried gel]×100
(274) As a result, as shown in
(275) In addition, these supports exhibited considerably rapid swelling and reached equilibrium state within 2 hours.
Example 15
Characterization of Three-Dimensional Culture of Cells in Agarose-Marine Collagen-Alginate Composite Hydrogel Support
(276) 1. Three-Dimensional Cell Culture using Hydrogel Cell Culture Supporter
(277) As the method of Example 9, 0.125 wt % agarose-10 wt % marine collagen-1 wt % alginate composite hydrogel support was prepared, and cells were added to the 96-well plate and induced to the gelation at 4° C. for 5-10 minutes and then cultured in a medium.
(278) 2. Actin Staining and Analysis of Ability for Forming Spheroids by Hematoxylin-eosin Staining
(279) To perform F-actin staining in total gel of human ovarian cancer cell A2780 cultured three-dimensionally for 7 days using agarose-marine collagen-alginate composite hydrogel support, the cell-cultured composite hydrogel support was washed twice with PBS and fixed with 100% methanol fixation solution at −20° C. for 20 minutes. Then, the cells were washed twice with PBS, and were infiltrated into 0.1% Triton-x 100 solution at room temperature for 5 minutes and washed twice with PBS.
(280) To remove nonspecific staining, the cells were treated with 1% bovine serum albumin (BSA) solution at room temperature for 1 hour and then washed twice with PBS. After that, actin-detecting Phalloidin-FITC (Promega, Madison, Wis., USA) was diluted to 1: 50 in 0.2% BSA solution and reacted at 4° C. for 18 hours and washed with tris-buffered saline (TBS) three times. The composite hydrogel support was placed on a cover glass and the cells were contrast-stained with DAPI (Vector Lab, Inc., Burlingame, Calif., USA) for nuclear staining of the cell and encapsulated and analyzed by fluorescence microscopy.
(281) In addition, hematoxylin-eosin (H-E) staining was performed on human ovarian cancer cells (A2780) cultured three-dimensionally for 7 days using an agarose-marine collagen-alginate composite hydrogel support. First, the cell-cultured composite hydrogel support was washed once with PBS and fixed in 100% methanol fixation at −20° C. for 20 minutes. The composite hydrogel support was nuclear-stained with hematoxylin for 5-10 minutes, washed with water and the cytoplasm was stained for 5-7 minutes in eosin. After washing with 100% ethanol, a part of the composite hydrogel support was peeled off, placed on a slide, covered with a cover glass to encapsulated and observed by an optical microscope.
(282) As shown in
(283) As shown in
(284) From the above results, it was confirmed that the three-dimensional cell culture method using the agarose-marine collagen-alginate composite hydrogel support can be very useful for studying the microenvironment and the interaction of cancer cells.
(285) 3. Analysis of the Ability of Spheroid Budding
(286) In order to analyze the spheroid budding phenomenon, which plays an important role in the formation of the cell spheroid in the results of the above experiment, A2780 and R182 cells were cultured in agarose-marine collagen-alginate composite hydrogel support for 7 days and the total hydrogel was subjected to hematoxylin-eosin staining and observed by an optical microscope. At the same time, unstained cells were observed by a phase contrast microscope.
(287) As a result of the phase contrast microscope (a) and hematoxylin-eosin staining (b) in
(288) In order to evaluate the diffusion ability of a drug reaching cancer cells in a three-dimensional environment, the degree of the drug diffusion is measured by the three-dimensional culture model of human ovarian cancer cell (A2780) using an agarose-marine collagen-alginate composite hydrogel support, a solution using an agarose-marine collagen-alginate composite hydrogel support.
(289) First, the cells were cultured until spheroids were formed in the agarose-marine collagen-alginate composite hydrogel support, and were treated with the anticancer drug doxorubicin (Cell Signaling Technology, Danvers, Mass., USA) at 1 μM for 24 hours. The hydrogel support was washed with PBS and the nuclear staining was performed with DAPI solution, and the distribution of doxorubicin in the spheroid was confirmed by confocal laser microscope (FV1000-IX81, Olympus, Japan).
(290) As a result, it was confirmed that doxorubicin reaches cancer cells in all regions within the spheroid as shown in
(291) From the above results, it was confirmed that the three-dimensional cancer cell culture model using the agarose-marine collagen-alginate composite hydrogel support can be very useful for the screening method for the sensitivity assay of various drugs including anticancer drugs.
Example 16
Analysis of Cell Growth Ability by Three-Dimensional Cell Culture Using Agarose-Marine Collagen-Alginate Composite Hydrogel Support
(292) 1. Three-Dimensional Cell Culture using Hydrogel Cell Culture Support
(293) As the method of Example 9, 0.125 wt % agarose-7.5 wt % marine collagen-1 wt % alginate composite hydrogel support was prepared and A2780 cells were added to 96-well plate, induced to the gelation at 4° C. for 5-10 minutes and cultured in the medium. In addition, the conventional two-dimensional cell culture was also performed as a control for three-dimensional cell culture.
(294) 2. Cell Growth Assay
(295) A2780 cells, a human ovarian cancer cell were cultured at 5×10.sup.5 cells/gel in agarose-marine collagen-alginate composite hydrogel support, and the formation of spheroid of cells was observed by a phase contrast microscope after 0, 1, 3, 5 and 7 days. The spheroid sizes were measured on day 5 and 7. The WST-1 reagent was treated for 2 hours and the absorbance at 450 nm was measured using a microplate reader to calculate the percent growth rate.
(296) As a result, as shown in
(297) From the above results, it was confirmed that the three-dimensional cell culture method using the agarose-marine collagen-alginate composite hydrogel support is more suitable for forming a three-dimensional cell culture environment more similar to a living body than the two-dimensional cell culture, and the cell support according to the present invention can be used to construct a model suitable for cell culture studies.
(298) 3. CFSE Staining Analysis
(299) CFSE staining was performed to confirm cell proliferating ability in an agarose-marine collagen-alginate composite hydrogel support. EL4 and CREC cells were treated with CellTracker™ Green CMFDA (Invitrogen, Carlsbad, Calif., USA) at 37° C. for 8 minutes for staining and then washed twice with PBS. The cells labeled with CFSE were cultured on composite hydrogel support for 0, 1, 2, and 3 days, and cell viability was observed by a fluorescence microscope.
(300) As a result, it was confirmed that the cells cultured in the agarose-marine collagen-alginate composite hydrogel support showed a decrease in the number of CFSE-positive cells as the culture time increased. Therefore, it was confirmed that the culture in the agarose-marine collagen-alginate composite hydrogel support according to the present invention induced the proliferation of EL4 cells.
(301) In addition, when EL4 and CREC cells were co-cultured, the EL4 cell proliferation was slower than EL4 cell culture alone.
(302) From the above results, it was confirmed that the agarose-marine collagen-alginate composite hydrogel support of the present invention not only provides a three-dimensional environment suitable for the proliferation of CREC and EL4 cells, but also can be used as a very useful means for studying cell proliferation.
Example 17
Analysis of Cell Viability by Three-Dimensional Culture of Cells in Agarose-Marine Collagen-Alginate Composite Hydrogel Support
(303) 1. Three-Dimensional Cell Culture using Hydrogel Cell Culture Support
(304) As the method of Example 9, 0.125 wt % agarose-7.5 wt % marine collagen-1 wt % alginate composite hydrogel support was prepared, cells were added and placed in a 96-well plate, induced the gelation at 4° C. for 5-10 minutes and cultured in a medium.
(305) 2. Live/Dead Staining Analysis
(306) In order to confirm the cytotoxicity of the hydrogel support of the present invention in cell culture using the agarose-marine collagen-alginate composite hydrogel support, human ovarian cancer cells (A2780) were cultured in marine collagen-alginate composite hydrogel support prepared by the Example 16-1 for 7 days and 10 days, and EL4 and CREC cells were cultured alone or co-cultured for 2 weeks. After washing the composite hydrogel support with PBS once, 2 μL calcein AM and 0.5 μL EthD-1 (LIVE/DEAD Viability Kit, Molecular Probes) were diluted in 1 mL PBS and stained in the dark for 30 minutes, and analyzed by a microscope (FV1000-IX81, Olympus, Japan).
(307) As a result in
(308) From the above results, it was confirmed that the agarose-marine collagen-alginate composite hydrogel support of the present invention does not show cytotoxicity.
Example 18
Analysis of Malignancy by Culturing Three-Dimensional Cancer Cells on Agarose-Marine Collagen-Alginate Composite Hydrogel Support
(309) 1. Three-Dimensional Cell Culture using Hydrogel Cell Culture Support
(310) In the case of EL4 cells, 0.125 wt % agarose-10 wt % marine collagen-1 wt % alginate composite hydrogel support was prepared in the same manner as in Example 9, and cells were added and the mixture solution was added to a 1 mL syringe with 80 μL and induced the gelation at 4° C. for 5-10 minutes, and then cultured in a 48-well plate. In the case of A2780 cells, 0.125 wt % agarose-7.5 wt % marine collagen-1 wt % alginate composite hydrogel support was prepared in the same manner as in Example 9, cells were added, and the cells were added to 96-well plate at 4° C. for 5-10 minutes, and then cultured in the medium. In addition, the conventional two-dimensional cell culture was also performed as a control for three-dimensional cell culture.
(311) 2. Semi-Quantitative Reverse Transcription-Polymerase Chain Reaction Analysis (RT-PCR)
(312) EL4 cells were cultured in agarose-marine collagen-alginate composite hydrogel support in two-dimensional and tthree-dimensional environments and the degree of expression of notch closely related to the malignancy of cancer cells was confirmed by RT-PCR analysis.
(313) EL4 cells were cultured in agarose-marine collagen-alginate composite hydrogel support for 2 weeks in order to observe the expression of Notch by reverse transcription-polymerase chain reaction (hereinafter “RT-PCR”) assay.
(314) After that, 1.5 mL of QG buffer (Qiagen, Valencia, Calif., USA) and 2 mL of RLT buffer (Qiagen) were mixed with agarose-marine collagen-alginate composite hydrogel support and the agarose-marine collagen-alginate composite hydrogel was dissolved at room temperature and total RNA was isolated from the cultured cells according to the manufacturer's instructions using a trizol reagent (Ambion, Invitrogen).
(315) To perform RT-PCR, a single-strand cDNA was synthesized by using a buffer containing 0.5 μg oligo (dT) 12-18, Oligo (dT) primer, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl.sub.2, 40 mM DTT, 0.5 mM deoxynucleotide triphosphate (dNTP) mixture, 10 units RNase inhibitor and 200 units MMLV (Moloney murine leukemia virus) and reverse transcriptase (Promega, Madison, Wis., USA) from 2 μg of total RNA.
(316) PCR reactions for mouse Notch-1, Notch-2 and GAPDH gene amplification were performed using the mouse Notch-1 forward and reverse primers of SEQ ID Nos. 25 and 26 in Table 1, the mouse Notch-2 forward and reverse primer of SEQ ID Nos. 27 and 28, or 0.4 pmol mouse GAPDH forward and reverse primer of SEQ ID Nos. 29 and 30, 1 μL cDNA sample, 25 μl of buffer solution containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl.sub.2, 0.1% Triton X-100, 0.2 mM dNTP mixture liquid and 5 unit Taq DNA polymerase (Promega), the initial denaturation was performed at 94° C. for 30 sec, at 60° C. for 30 sec and at 72° C. for 30 sec in 35 cycles. In the case of GAPDH, the reaction was carried out in 30 cycles.
(317) The PCR reactions for human snail, vimentin, CD44 and GAPDH gene amplification consisted of the human snail forward and reverse primers of SEQ ID Nos. 31 and 32; human vimentin forward and reverse primers of SEQ ID Nos. 33 and 34; human CD44 forward and reverse primers of SEQ ID Nos. 35 and 36; human endothelin-1 forward and reverse primers of SEQ ID Nos. 37 and 38; or 0.4 pmol of the human GAPDH forward and reverse primers of SEQ ID Nos. 39 and 40 and 1 μL cDNA sample, 25 μl of buffer solution containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl.sub.2, 0.1% Triton X-100, 0.2 mM dNTP mixture liquid and 5 unit Taq DNA polymerase (Promega), the initial denaturation of CD44, Snail and GAPDH was performed at 94° C. for 5 minutes, at 94° C. for 30 sec, 57° C. for 30 sec and at 72° C. for 30 sec in 27 cycles.
(318) In the case of vimentin, the initial denaturation was performed at 94° C. for 5 minutes, followed by 27 cycles at 94° C. for 30 seconds, 60° C. for 30 seconds, and 72° C. for 30 seconds. Finally, endothelin-1 was subjected to initial denaturation at 94° C. for 5 minutes, followed initial denaturation at 94° C. for 30 seconds, at 65° C. for 30 seconds, and at 72° C. for 30 seconds for 27 cycles.
(319) After the PCR reaction, the reaction product samples produced by 2% agarose gel electrophoresis were stained with EtBr (Ethidium bromide) and analyzed under UV light illumination.
(320) As a result, as shown in
(321) From the above results, it was confirmed that the three-dimensional cancer cell culture model using the agarose-marine collagen-alginate composite hydrogel support according to the present invention can effectively simulate a living body (in-vivo) environment.
(322) In addition, in the human ovarian cancer cell host A2780 cells cultured in two-dimensional and three-dimensional environments, the malignancies of the cancer cells, particularly the expression of the snail and the vimentin, markers closely related to the epithelial-mesenchymal transition (EMT) CD19, an important marker for cancer stem cells, and endothelin-1, which plays a key role in tumor growth and metastasis, was confirmed.
(323) As a result, it was confirmed that the cancer cells cultured in the three-dimensional environment increase the expression of the marker related to the malignancy of the cancer, than two-dimensional environment, as shown in
(324) From the above results, it was confirmed that the culture environment of cancer cells such as growth, progression, metastasis and malignancy of cancer in the three-dimensional cancer cell culture based on agarose-marine collagen-alginate composite hydrogel support, is very similar to those of living body. Because the three-dimensional cell culture method using the nanofiber support of the present invention provides in-vivo simulation environment which cannot be provided in the conventional two-dimensional cell culture method, it is useful for development of therapeutic agent for cancer cells as well as the research on cancer cell, growth, metastasis and malignancy of cancer cells.
(325) TABLE-US-00005 TABLE 5 SEQ ID Gene No. Primer Sequence mouse Notch-1 25 (Forward) 5′-CCCAGCAGGTGCAGCCACAG-3′ 26 (Reverse) 5′-GGTGATCTGGGACGGCATGG-3′ mouse Notch-2 27 (Forward) 5′- ATGTGGACGAGTGTCTGTTGC-3′ 28 (Reverse) 5′- GGAAGCATAGGCACAGTCATC-3′ mouse GAPDH 29 (Forward) 5′- GAAATCCCATCACCATCTTCCAGG-3′ 30 (Reverse) 5′-GAGCCCCAGCCTTCTCCATG-3′ Human Snail 31 (Forward) 5′-AGACCCACTCAGATGTCAA-3′ 32 (Reverse) 5′-CATAGTTAGTCACACCTCGT-3′ Human vimentin 33 (Forward) 5′-GAGGAGATGCGGGAGCTGCG-3′ 34 (Reverse) 5′-CTGCCCTGCGTGACGTACGT-3′ Human CD44 35 (Forward) 5′- CTCCAGTGAAAGGAGCAGCA-3′ 36 (Reverse) 5′-AGCAGGGATTCTGTCTGTGC-3′ Human 37 (Forward) 5′- endothelin-1 TGCTCCTGCTCTTCCCTGATGGATAAAGA GTGTGTC-3′ 38 (Reverse) 5′- GGTCACATAACGCTCTCTGGAGGGCTT-3′ Human GAPDH 39 (Forward) 5′- TGGAGAAACCTGCCAAGTATG-3′ 40 (Reverse) 5′- TTGTCATACCAGGAAATGAGC-3′
Example 19
Measurement of Anticancer Drug Susceptibility of Cancer Cells Cultured Three-Dimensional in Agarose-Marine Collagen-Alginate Composite Hydrogel Support: Analysis of Suitability as In-Vivo Simulation Anticancer Susceptibility Measurement Model
(326) 1. Three-Dimensional Cell Culture using Hydrogel Cell Culture Support
(327) In the case of EL4 cells, 0.125 wt % agarose-10 wt % marine collagen-1 wt % alginate composite hydrogel support was prepared in the same manner as in Example 9, and cells were added, and the mixture liquid was added to a 1 mL syringe with 80 μL to induce the gelation at 4° C. for 5-10 minutes, and then cultured in a 48-well plate. In the case of A2780 cells, 0.125 wt % agarose-7.5 wt % marine collagen-1 wt % alginate composite hydrogel support was prepared in the same manner as in Example 9, the cells were added to 96-well plate to induce the gelation at 4° C. for 5-10 minutes, and then cultured in the medium. In addition, the conventional two-dimensional cell culture was also performed as a control for three-dimensional cell culture.
(328) 2. Cell Growth Assay
(329) In order to perform a sensitivity assay for an anticancer agent, EL4 and human ovarian cancer cell A2780 were cultured in an agarose-marine collagen-alginate composite hydrogel support in a two-dimensional and three-dimensional environment and an efficacy test for an anticancer agent was performed.
(330) EL4 cells cultured in two-dimensional culture conditions and EL4 cells cultured three-dimensionally in an agarose-marine collagen-alginate composite hydrogel support were treated with 5 μM doxorubicin (5927, cell signaling) and 100 μM resveratrol and the human ovarian cancer cell A2780 was treated with paclitaxel at a concentration of 0.5 μM for 24 hours, and then with WST-1 reagent, and absorbance was measured at 450 nm by a microplate reader to calculate percent growth rate.
(331) In addition, 10 and 20 μM paclitaxel, and 30 and 50 μM curcumin were added to A2780 cells cultured in two-dimensional condition and A2780 cells cultured three-dimensionally for 7 days in agarose-marine collagen-alginate composite hydrogel supports, and the control group was treated with DMSO at the same concentration as the experimental group. The WST-1 reagent was then treated and the absorbance at 450 nm was measured by a microplate reader to calculate the percentage growth rate.
(332) As a result of
(333) As shown in
(334) From the above results, it was confirmed that the three-dimensional cancer cell culture model using the agarose-marine collagen-alginate composite hydrogel support according to the present invention can be very useful for studying the drug resistance mechanism against the anticancer agent and the sensitivity to the anticancer agent.
(335) In addition, A2780 cells were cultured in an agarose-marine collagen-alginate composite hydrogel support in a two- and three-dimensional environment, and paclitaxel and curcumin efficacy tests for ovarian cancer were conducted. As the results of
(336) Also, when curcumin was treated at a concentration of 30 and 50 μM, the cell viability was 42.5% (P<0.001) at 30 μM and 36.7% (P<0.001) at 50 μM in the two-dimensional environment and the cell viability was 95.0% at 30 μM and 82.4% at 50 μM in the two-dimensional environment.
(337) From the above results, it was confirmed that the drug resistance to the anticancer drug effectively exhibited in the three-dimensional environment rather than the two-dimensional environment. Through this, it was confirmed that the three-dimensional cancer cell culture model using the agarose-marine collagen-alginate composite hydrogel support was excellent in assay for a drug resistance mechanism research for anticancer drugs and susceptibility to anticancer drugs.
(338) 3. Cell Morphology and Cytokeratin Staining
(339) Human ovarian cancer cells were cultured in an agarose-marine collagen-alginate composite hydrogel support in a three-dimensional environment, and immunostaining was performed with an antibody against cytokeratin, which is a marker specifically expressed in epithelial cells.
(340) Firstly, after three-dimensional culture of A2780 cells on the agarose-marine collagen-alginate composite hydrogel support of the present invention, 10 μM paclitaxel and 30 μM curcumin, which are anticancer agents well-known to have a high killing effect on human ovarian cancer cells in the conventional two-dimensional culture, were treated for 2 days, respectively and control group was treated with the same concentration of DMSO for 2 days. The agarose-marine collagen-alginate composite hydrogel support was then washed once with PBS and fixed with a 100% methanol fixation solution at −20° C. for 20 minutes. To remove nonspecific staining, the cells were treated with 1% BSA solution for 1 hour at room temperature and then stained with plate-cytochokeratin antibody (Sigma-Aldrich) diluted to 1:50 for 18 hours at 4° C. After washing once with PBS, nuclear staining was performed with DAPI solution at room temperature for 30 minutes and observed by a fluorescence microscope. At the same time, unstained cells were observed by a phase contrast microscope.
(341) As a result of
(342) From the above results, it was confirmed that the three-dimensional cancer cell culture model using the agarose-marine collagen-alginate composite hydrogel support according to the present invention can be very useful in studying the drug resistance mechanism against the anticancer agent and the sensitivity to the anticancer agent.
Example 20
Measurement of Cancer Stem Cell Formation Ability and Cancer Cell Differentiation Ability in Cancer Cell Cultured Three-Dimensionally in Agarose-Marine Collagen-Alginate Composite Hydrogel Support: Induction and Growth of In-Vivo Simulation Cancer Stem Cell and its Suitability as Cancer Cell Differentiation Model
(343) 1. Three-Dimensional Cell Culture using Hydrogel Cell Culture Support
(344) 0.125 wt % agarose-10 wt % marine collagen-1 wt % alginate composite hydrogel support was prepared at the final concentration in the same manner as in Example 9, EL4 cells were added, and 80 μL of the mixture solution was added to a 1 mL syringe to induce the gelation at 4° C. for 5-10 minutes, and the cells were placed in a 48-well plate and cultured.
(345) 2. Analysis of Cell Surface Molecule Expression using Flow Cytometer
(346) EL4 cells were cultured for 10 days in a three-dimensional (3D) agarose-marine collagen-alginate composite hydrogel support and a 96-well plate in a two-dimensional environment (2D), and then analyzed using a flow cytometer (FACS canto II, flow cytometer BD Biosciences).
(347) To separate the cultured cells form the hydrogel support, 40 μm cell strainer (SPL Life Sciences) was and 2D cells were isolated using conventional methods. The separated cells were washed twice with Hank's Balanced Salt Solution (HBSS, GibcoLife Technologies) and resuspended in 3 mL of FACS buffer (0.1% BSA, 0.1% sodium chloride, 500 mL HBSS) followed by centrifugation at 4° C. and 1500 rpm for 4 minutes. After removing the supernatant, the cells were resuspended and the cells were pre-incubated with anti-FcγRII/III (2.4G2, hybridoma supernatant) to avoid nonspecific binding with the antibody. Then, the cells were incubated in HBSS containing 2% FBS by reacting with the objective primary anti-mouse monoclonal antibody, i.e. anti-CD4 antibody conjugated with FITC or PE (FITC-CD4 or PE-CD4), APC-conjugated anti-CD8 antibody (APC-CD8), PE-CY7-conjugated anti-c-kit antibody (PE-CY7-c-kit) and APC-conjugated anti-sca-1 antibody (APC-sca-1) at 5-10 μg/mL for 30 minutes under ice cooling.
(348) Background fluorescence was determined by cells that were reacted with isotype-matched nonreactive antibodies.
(349) The cells were then washed twice with HBSS, resuspended in 500 μL of FACS buffer, and analyzed for expression of cell surface molecules by a flow cytometer using the Dot-plot method. The obtained results were analyzed using FlowJo software (Tree Star, Ashland, Oreg., USA).
(350) As a result of
(351) Accordingly, the three-dimensional cell culture method using the agarose-marine collagen-alginate composite hydrogel support according to the present invention provides an in-vivo environment that could not be provided by the conventional two-dimensional cell culture method, is useful for the research on the anticancer drug resistance mechanism and the development of the highly efficient chemotherapy method.
(352) Although the present invention has been described in detail based on particular features thereof, and it is obvious to those skilled in the art that these specific technologies are merely preferable embodiments and thus the scope of the present invention is not limited to the embodiments. Therefore, the substantial scope of the present invention is defined by the accompanying claims and equivalent thereof