MANUFACTURING OF SYNTHETIC EXOSOMES FOR CNS AND NON-CNS DELIVERY OF THERAPEUTICS

20230285291 · 2023-09-14

Assignee

Inventors

Cpc classification

International classification

Abstract

This invention provides improved synthetic exosomes for delivery a one or more therapeutic agents to the central nervous system. In certain embodiments the synthetic exosome comprises a liposome formed from a lipid bilayer, where said lipid bilayer comprises: one or more phospholipids selected from the group consisting of phosphate lipids, phosphoglycerol lipids, phosphocholine lipids, and phosphoethanolamine lipids where the lipid carbon chain ranges from 3 to 24 carbon atoms; cholesterol, a cholesterol derivative (e.g., cholesterol hemicsuccinate), or a phytosterol; and a non-ionic surfactant; wherein the lipid bilayer does not contain an alcohol; and the liposome ranges in size from about 50 nm up to about 200 nm in diameter. Typically, the synthetic exosome is capable of crossing the blood brain barrier without substantially leaking said therapeutic moiety.

Claims

1. A synthetic exosome capable of delivering a therapeutic moiety across the blood brain barrier into the central nervous system (CNS), said synthetic exosome comprising: a liposome formed from a lipid bilayer, where said lipid bilayer comprises: one or more phospholipids selected from the group consisting of phosphate lipids, phosphoglycerol lipids, phosphocholine lipids, and phosphoethanolamine lipids where the lipid carbon chain ranges from 3 to 24 carbon atoms; cholesterol, a cholesterol derivative, or a phytosterol; and a non-ionic surfactant; wherein said lipid bilayer does not contain an alcohol; and said liposome ranges in size from up to about 500 nm in diameter.

2-3. (canceled)

4. The synthetic exosome of claim 1, wherein: said synthetic exosome is capable of crossing the blood brain barrier without substantially leaking said therapeutic moiety; and/or said exosome is capable of crossing the blood/brain barrier (BBB) and delivering a therapeutic moiety contained therein to the central nervous system without substantial loss of said therapeutic moiety; and/or said exosome is capable of crossing the blood/brain barrier (BBB) and delivering a therapeutic moiety contained therein to the central nervous system without losing more than about 40%, or without losing more than 30%, or without losing more than 20%, or without losing more than 10%, or without losing more than 5%, or without losing more than 3%, or without losing more than 1% of a therapeutic moiety contained therein.

5. The synthetic exosome of claim 1, wherein said lipid bilayer consists of said one or more phospholipids, said cholesterol or cholesterol derivative or a phytosterol; and said non-ionic surfactant.

6-9. (canceled)

10. The synthetic exosome of claim 1, wherein: said bilayer does not contain glutathione-maleimide-PEG2000-distearoyl phosphatidyl ethanolamine; and/or said exosome is not a transferosome; and/or said exosome is not an ethosome.

11-12. (canceled)

13. The synthetic exosome of claim 1, wherein: the molar ratio of total phospholipid to cholesterol, cholesterol, or phytosterol ranges from about 6-10 moles of total phospholipid to about 1-3 moles of cholesterol; and/or the amount of surfactant ranges from about 1%, or from about 3%, or from about 5%, or from about 8% up to about 18%, or up to about 15%, or up to about 13%, or up to about 10% (wt/wt).

14. (canceled)

15. The synthetic exosome of claim 1, wherein said surfactant comprise one or more surfactants selected from the group consisting of Span 80, Tween 20, BRIJ® 76 (stearyl poly(10)oxy ethylene ether), BRIJ® 78 (stearyl poly(20)oxyethylene ether), BRIJ® 96 (oleyl poly(10)oxy ethylene ether), and BRIJ® 721 (stearyl poly (21) oxyethylene ether).

16. (canceled)

17. The synthetic exosome of claim 15, wherein the lipid bilayer comprises about 10% to about 20%, or about 15% Span 80 by weight.

18. The synthetic exosome of claim 1, wherein: said cholesterol, cholesterol derivative, or phytosterol comprises or consists of cholesterol; or said cholesterol, cholesterol derivative, or phytosterol comprises or consists of a cholesterol derivative selected from the group consisting of cholesterol hemisuccinate, lysine-based cholesterol (CHLYS), 20-hydroxychloesterol, 22-hydroxycholesterol, 24-hydroxycholesterol, 25-hydroxy cholesterol, 27-hydroxycholesterol, cholesteryl succinate, cholic succinate, cholic tri-succinate, lithocholic succinate, chenodesoxycholic bis-scuccinate, and Hederoside; or said cholesterol, cholesterol derivative comprises or consists cholesterol hemisuccinate; or said cholesterol, cholesterol derivative, or phytosterol comprises or consists of a phytosterol; or said cholesterol, cholesterol derivative, or phytosterol comprises or consists of a phytosterol that comprises a 9,10-secosteroid; or said cholesterol, cholesterol derivative, or phytosterol comprises or consists of a compound selected from the group consisting of vitamin D3, vitamin D2, calcipotriol; or said cholesterol, cholesterol derivative, or phytosterol comprises or consists of a C-24 alkyl steroid; or said cholesterol, cholesterol derivative, or phytosterol comprises or consists of a compound selected from the group consisting of stigmasterol, and β-sitosterol; or said cholesterol, cholesterol derivative, or phytosterol comprises or consists of a pentacyclic steroid; or said cholesterol, cholesterol derivative, or phytosterol comprises or consists of a pentacyclic steroid that comprises a compound selected from the group consisting of betulin, lupeol, ursolic acid, and oleanolic acid; or said cholesterol, cholesterol derivative, or phytosterol is pegylated.

19-28. (canceled)

29. The synthetic exosome of claim 1, wherein: said one or more phospholipids comprises one or more phospholipids selected from the group consisting of dihexanoyl-sn-glycero-3-phosphate (DHPA), didecanoyl-sn-glycero-3-phosphate (DDPA), distearoyl-sn-glycero-3-phosphate (DTPA), and dihexadecyl phosphate (DHP); and/or said one or more phospholipids comprises one or more phosphoglycerol lipids selected from the group consisting of dihexanoyl-sn-glycero-3-phospho-(1′-rac-glycerol) (DHPG), dilauroyl-sn-glycero-3-phospho-(1′-rac-glycerol) (DLPG), and distearoyl-sn-glycero-3-phospho-(1′-rac-glycerol) (DTPG); and/or said one or more phospholipids comprises one or more phosphocholine lipids selected from the group consisting of dipropionyl-sn-glycero-3-phosphocholine (PC), diheptanoyl-sn-glycero-3-phosphocholine (DHPC), dimyristoyl-sn-glycero-3-phosphocholine (DMPC), and dilignoceroyl-sn-glycero-3-phosphocholine (DGPC), and/or said one or more phospholipids comprises one or more phosphoethanolamine lipids selected from the group consisting of sihexanoyl-sn-glycero-3-phosphoethanolamine (DHPE), and distearoyl-sn-glycero-3-phosphoethanolamine (DTPE); and/or said one or more phospholipids comprises one or more phosphoethanolamine-PEG lipids selected from the group consisting of dipalmitoyl-sn-glycero-3-phospho(ethylene glycol) (DPPEG1), dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-350 (DMPEG350), distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-350] (DTPEG350), dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-550] (DMPEG550), and dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-100] (DMPEG1000); and/or said one or more phospholipids comprises one or more phospholipids selected from the group consisting of dioleoyl-sn-glycero-3-phosphocholine (N-aminoethyl) (PC-NH.sub.2), diphytanoyl-sn-glycero-3-phosphoethanolamine, dioleoyl-3-trimethylammonium-propane (DOTAP), distearoyl-3-trimethylammonium-propane (DSTAP), dimyristoyl-3-trimethylammonium-propane (DMTAP), and di-O-octadecyl-sn-glycero-3-phosphocholin (DOPC).

30-35. (canceled)

36. The synthetic exosome of claim 1, wherein said lipid bilayer comprises or consists of: said surfactant; and 3:2:1 molar ratio (DHPA:DHP:CH), 1:5:1 molar ratio (DHPG:DHPA:CH), 2:5:1:2 molar ratio (DHPG:DHPA:PC-NH.sub.2:CH), or 2:4:1:1:2 molar ratio (DHPG:DHPA:PC-NH.sub.2:DMPEG350:CH) to provide synthetic exosomes having a zeta potential of about −20 mV or lower; or said surfactant; and 2:2:1 molar ratio (DHPG:DHPC:CH), 4:4:1:2 molar ratio (DHPG:DHPA:PC-NH.sub.2:CH), 2:2:1 molar ratio (DHPG:DHPA:CH), 4:4:1:1:2 molar ratio (DHPG:DHPA:PC-NH.sub.2:DMPEG550:CH), 2:2:1 molar ratio (DHPG:DTPE:CH), 2:2:1 molar ratio (DHPG:DMTAP:CH), 4:4:1:2 molar ratio (DHPG:DMTAP:PC-NH.sub.2:CH), or 4:4:1:1:2 molar ratio (DHPG:DMTAP:PC-NH.sub.2:DMPEG550:CH) to provide synthetic exosomes having a zeta potential ranging from about −20 mV to about 20 mV, or said surfactant; and 2:4:1 molar ratio (DHPC:DTPE:CH), 2:4:1 molar ratio (DHPC:DOTAP:CH), 2:4:1:2 molar ratio (DHPC:DMTAP:PC-NH.sub.2:CH), or 2:4:1:1:2 molar ratio (DHPC:DMTAP:PC-NH.sub.2:DMPEG350:CH) to provide synthetic exosomes having a zeta potential of about 20 mV or greater; or said surfactant; and 4:2:1 molar ratio (DTPA:DHP:CH), 1:5:1 molar ratio (DTPG:DTPA:CH), 1:5:1:2 molar ratio (DTPG:DTPA:PC-NH.sub.2:CH), or 1:4:1:1:2 molar ratio (DTPG:DTPA:PC-NH.sub.2:DMPEG350:CH) to provide synthetic exosomes having a zeta potential of about −20 mV or lower; or said surfactant; and 2:2:1 molar ratio (DTPG:DGPC:CH), 4:4:1:2 molar ratio (DTPG:DDPA:PC-NH.sub.2:CH), 2:2:1 molar ratio (DTPG:DDPA:CH), 4:4:1:1:2 molar ratio (DTPG:DDPA:PC-NH.sub.2:DMPEG550:CH), 2:2:1 molar ratio (DTPG:DTPE:CH), 2:2:1 molar ratio (DTPG:DMTAP:CH), 4:4:1:2 molar ratio (DTPG:DMTAP:PC-NH.sub.2:CH), or 4:4:1:1:2 molar ratio (DTPG:DMTAP:PC-NH.sub.2:DMPEG550:CH) to provide synthetic exosomes having a zeta potential ranging from about −20 mV to about 20 mV, or said surfactant; and 2:4:1 molar ratio (DMPC:DTPE:CH), 2:4:1 molar ratio (DMPC:DOTAP:CH), 2:4:1:2 molar ratio (DMPC:DMTAP:PC-NH.sub.2:CH), or 2:4:1:1:2 molar ratio (DMPC:DMTAP:PC-NH.sub.2:DMPEG350:CH) to provide synthetic exosomes having a zeta potential of about 20 mV or greater; wherein CH is cholesterol or a cholesterol derivative.

37-48. (canceled)

49. The synthetic exosome of claim 1, wherein: a targeting moiety comprising or consisting of transferrin, or folic acid, or an amino acid, or insulin, or a low density lipoprotein receptor related protein 1 is attached to said exosome; or a targeting moiety comprising or consisting of a blood brain barrier targeting antibody is attached to said exosome; or said exosome is attached to an antibody or a ligand that binds to a moiety selected from the group consisting of a transferrin receptor, an insulin receptor, an insulin growth factor receptor (IGF1R), a low-density lipoprotein (LDL) receptor, basigin, Glut1, CD98hc, and TMEM30A(cdc50A); or said exosome is attached to an antibody or a ligand that binds to a cell surface marker; or said exosome is attached to an antibody or a ligand that binds to a cell surface marker that is a marker of neural or glial cells; or said exosome is attached to an antibody or a ligand that binds to a cell surface marker selected from the group consisting of CD63, CD81, CD9, and CD171, and is incorporated in the lipid bilayer of said exosome; or said one or more phospholipids is functionalized with a targeting moiety selected from the group consisting of transferrin, an amino acid, a blood brain barrier targeting antibody, insulin, folic acid, and low density lipoprotein receptor related protein 1.

50-54. (canceled)

55. The synthetic exosome of claim 1, wherein said exosome contains one or more therapeutic moieties, wherein: said therapeutic moiety is selected from the group consisting of a protein, an antibody, an enzyme, a DNA encoding an inhibitory RNA, an inhibitory RNA or a micoRNA (miRNA), a nucleic acid encoding a CRISPR endonuclease and a guide RNA, a CRISPR endonuclease and a guide RNA, and a small organic molecule; or said therapeutic moiety comprises an sAPPα protein; or said therapeutic moiety comprises IDUA (e.g., for MPS1) or acid sphingomyelinase (ASM) for Niemann Pick disease; or said therapeutic moiety comprises an antibody; or said therapeutic moiety comprises an antibody selected from the group consisting of full-length immunoglobulins, Fab, Fab′, Fab′-SH, F(ab′).sub.2, Fv, Fv′, Fd, Fd′, scFv, hsFv fragments, single-chain antibodies, and cameloid antibodies; or said therapeutic moiety comprises an antibody for the treatment of a neurodegenerative condition or for the treatment of a cancer; or said therapeutic moiety comprises said antibody comprise an antibody for the treatment of a neurodegenerative condition selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Huntington's disease, and Parkinson's disease; or said therapeutic moiety comprises an antibody that binds to a target selected from the group consisting of Aβ, mutant Aβ, tau, mutant tau, apoE, and α-synuclein; or said therapeutic moiety comprises an antibody selected from the group consisting of AAB-003, Bapineuzumab, Ponezumab, RG7345, Solanezumab, GSK933776, JNJ-63733657, BIIB076, LY2599666, MEDI1314, SAR228810, BAN2401, BIIB092, C2B8E12, LY3002813, LY3303560, RO 7105705, Aducanumab, Crenezumab, PRX002 (prasinezumab), and Gantenerumab, or combinations thereof; or said therapeutic moiety comprises an anti-tau antibody; or said therapeutic moiety comprises an anti-tau antibody selected from the group consisting of BIIB092, ABBV-8E12, R07105705, LY3303560, RG7345, R06926496, JNJ63733657, and UCB0107; or said therapeutic moiety comprises an anti-ApoE antibody; or said therapeutic moiety comprises an antibody for the treatment of amyotrophic lateral sclerosis (ALS); or said therapeutic moiety comprises an antibody that binds to a misfolded SOD1 species; or said therapeutic moiety comprises an antibody for the treatment of Huntington's disease; or said therapeutic moiety comprises an anti-SEMA4D antibody (e.g., VX15); or said therapeutic moiety comprises an antibody for the treatment of Parkinson's disease; or said therapeutic moiety comprises an anti-α-synuclein antibody (e.g., prasinezumab); or said therapeutic moiety comprises an antibody for the treatment of a cancer; or said therapeutic moiety comprises a checkpoint PD-1 blocker; or′ said therapeutic moiety comprises Keytuda for treatment of Gliomas and Brain cancer.

56-85. (canceled)

86. The synthetic exosome of claim 1, wherein said synthetic exosome contains an enzyme for enzyme replacement therapy (ERT).

87. The synthetic exosome of claim 1, wherein: said synthetic exosome contains components of a CRISPR/Cas system for the treatment of Alzheimer's disease, Parkinson's disease, ALS, fragile X syndrome (FXS), Huntington disease, autosomal dominant spinocereberal ataxis (SCAs), spinal bulbar muscular atrophy (SBMA), correction of autosomal recessive genetic disorder that is caused by a deficiency in the expression or function of the Ataxia Telangiectasia Mutated (ATM) protein; and/or said synthetic exosome contains a plasmid that encodes a class 2 CRISPR/Cas endonuclease and a guide RNA or a nucleic acid encoding a guide RNA, or said synthetic exosome contains a class 2 CRISPR/Cas endonuclease and a guide RNA or a nucleic acid encoding a guide RNA; and/or said synthetic exosome contains' a Cas9 polypeptide and the corresponding CRISPR/Cas guide RNA is a Cas9 guide RNA; and/or said synthetic exosome contains a type V or type VI CRISPR/Cas endonuclease; and/or said synthetic exosome contains a class 2 CRISPR/Cas endonuclease selected from the group consisting of a Cpf1 polypeptide or a functional portion thereof, a C2c1 polypeptide or a functional portion thereof, a C2c3 polypeptide or a functional portion thereof, and a C2c2 polypeptide or a functional portion thereof; and/or said synthetic exosome contains components of a CRISPR/Cas system are configured to produce insertions or deletions in ApoE4; and/or said synthetic exosome contains components of a CRISPR/Cas system configured to replace ApoE4 with ApoE3 or ApoE2.

88-101. (canceled)

102. The synthetic exosome of claim 1, wherein: said synthetic exosome contains an miRNA; and/or said synthetic exosome contains an inhibitory RNA, or a nucleic acid encoding an inhibitory RNA; and/or said exosome contains a DNA encoding an shRNA or an siRNA; and/or said exosome contains an inhibitory RNA or a nucleic acid encoding an inhibitory RNA for the treatment of a neurodegenerative condition or a cancer; and/or said exosome contains an inhibitory RNA or a nucleic acid encoding an inhibitory RNA for the treatment of a neurodegenerative condition selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Huntington's disease, and Parkinson's disease; and/or said exosome contains an inhibitory RNA or a nucleic acid encoding an inhibitory RNA for the treatment of Alzheimer's disease; and/or said exosome contains an inhibitory RNA or a nucleic acid encoding an inhibitory RNA wherein said inhibitory RNA inhibits expression of a target selected from the group consisting of a mutant APP (e.g., APPsw), and a mutant tau; and/or said exosome contains an inhibitory RNA or a nucleic acid encoding an inhibitory RNA wherein said inhibitory RNA inhibits expression of a target selected from the group consisting of c-SCR, GGA3 adaptor protein, and acyl-coenzyme A cholesterol acyltransferase (ACAT-1).

103-109. (canceled)

110. A pharmaceutical formulation comprising: a synthetic exosome according to claim 1; and a pharmaceutically acceptable carrier.

111. A kit comprising: a container containing a nanoscale synthetic exosome according to claim 1; and instructional materials teaching the use of said synthetic exosome to mitigate one or more symptoms associated with a disease characterized by amyloid deposits in the brain, and/or the use of said composition in delaying or preventing the onset of one or more of said symptoms.

112. A method of reducing the risk, lessening the severity, or delaying the progression or onset of a disease characterized by beta-amyloid deposits in the brain of a mammal, said method comprising: administering, or causing to be administered, to said mammal synthetic exosome according to claim 1, wherein said exosome contains an antibody for the treatment of a neurodegenerative condition selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Huntington's disease, and Parkinson's disease or components of a CRISPR/Cas system for the treatment of Alzheimer's disease, Parkinson's disease, ALS, fragile X syndrome (FXS), Huntington disease, autosomal dominant spinocereberal ataxis (SCAs), spinal bulbar muscular atrophy (SBMA), correction of autosomal recessive genetic disorder that is caused by a deficiency in the expression or function of the Ataxia Telangiectasia Mutated (ATM) protein in an amount sufficient to reducing the risk, lessen the severity, or delay the progression or onset of said disease.

113. A method of preventing or delaying the onset of a pre-Alzheimer's condition and/or cognitive dysfunction, and/or ameliorating one or more symptoms of a pre-Alzheimer's condition and/or cognitive dysfunction, or preventing or delaying the progression of a pre-Alzheimer's condition or cognitive dysfunction to Alzheimer's disease in a mammal, said method comprising: administering, or causing to be administered, to said mammal a synthetic exosome according to claim 1, wherein said exosome contains an antibody for the treatment of a neurodegenerative condition selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Huntington's disease, and Parkinson's disease or components of a CRISPR/Cas system for the treatment of Alzheimer's disease, Parkinson's disease, ALS, fragile X syndrome (FXS), Huntington disease, autosomal dominant spinocereberal ataxis (SCAs), spinal bulbar muscular atrophy (SBMA), correction of autosomal recessive genetic disorder that is caused by a deficiency in the expression or function of the Ataxia Telangiectasia Mutated (ATM) protein, in an amount sufficient to promote the processing of amyloid precursor protein (APP) by the non-amyloidogenic pathway and/or sufficient to reduce sAPPβ.

114. A method of promoting the processing of amyloid precursor protein (APP) by the non-amyloidogenic pathway as characterized by increasing sAPPα and/or the sAPPα/Aβ42 ratio in a mammal, said method comprising: administering, or causing to be administered, to said mammal a synthetic exosome according to claim 1, wherein said exosome contains an antibody for the treatment of a neurodegenerative condition selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Huntington's disease, and Parkinson's disease or components of a CRISPR/Cas system for the treatment of Alzheimer's disease, Parkinson's disease, ALS, fragile X syndrome (FXS), Huntington disease, autosomal dominant spinocereberal ataxis (SCAs), spinal bulbar muscular atrophy (SBMA), correction of autosomal recessive genetic disorder that is caused by a deficiency in the expression or function of the Ataxia Telangiectasia Mutated (ATM) protein, wherein said administering is in an amount sufficient to promote the processing of amyloid precursor protein (APP) by the non-amyloidogenic pathway and/or sufficient to reduce sAPPβ.

115. A method of delivering one or more therapeutic moieties into the brain of a mammal, said method comprising: administering, or causing to be administered, to said mammal an effective amount of a synthetic exosome according to claim 1, wherein said exosome contains said one or more therapeutic moieties.

116. A method of treating a pathology in a mammal selected from the group consisting of Alzheimer's disease, Parkinson's disease, ALS, fragile X syndrome (FXS), Huntington disease, autosomal dominant spinocereberal ataxis (SCAs), spinal bulbar muscular atrophy (SBMA), an autosomal recessive genetic disorder that is caused by a deficiency in the expression or function of the Ataxia Telangiectasia Mutated (ATM) protein, said method comprising: administering, or causing to be administered, to said mammal an effective amount of a synthetic exosome according to claim 1, wherein said exosome contains an sAPPα protein.

117. A microfluidic flow reactor for the synthesis of synthetic exosomes, said reactor comprising: a central channel with two or more branch channels feeding said central channel and thereby forming a mixing junction, where the diameter of said central channel and branch channels and the angle provided between said central channel and branch channels are selected to maintain a backpressure of less than about 100 psi.

118. (canceled)

119. A method of making a synthetic exosome containing a therapeutic moiety, said method comprising: combining the components of a lipid bilayer as recited in claim 1 and said therapeutic moiety in organic and aqueous phases in microchannels in a microfluidic flow reactor at a controlled flow ratio and pressure; and collecting the resulting samples comprising synthetic exosomes containing said therapeutic moiety.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0240] FIG. 1 illustrates synthetic exosome synthesis, characterization, dialysis, and lyophilization. Panel A) Lipids (e.g., DPPC-1,2-dipalmitoyl-snglycero-3-phosphocholine, cholesterol, dihexadecyl phosphate (DCP); and (1-myristoyl-2-{P6-[(7-nitro-2-1,3-benzoxadizaol-4-yl)amino]helanoyl}-sj-glycero-3-phosphocholine) in IPA flow into an organic microfluidic reactor stream and cargo (if hydrophilic) in the aqueous stream. SEs are collected (panel B), characterized (panel C), dialyzed (panel D) and lyophilized for storage (panel E).

[0241] FIG. 2 illustrates atomic force microscopy (AFM) showing that the SE's can be deformed compared to conventional liposomes. Atomic Force Microscopy (AFM) shows conventional liposomes are not deformed. As illustrated, the SEs described herein are deformable and can penetrate tight junctions when compared to LPs.

[0242] FIG. 3, panels A-B, shows that sAPPα-SEs decrease sAPPβ and Aβ1-42 in vitro. sAPPα-SEs significantly decreased sAPPβ (panel A) and Aβ1-42 (panel B) in CHO-7W cells and were more effective than recombinant free sAPPα. Statistical analysis performed using ANOVA with Tukey's post-hoc analysis.

[0243] FIG. 4, panels A-B, shows the PK and biochemistry if IV sAPPα-SEs. Panel A) Human sAPPα peaked 1 hour after sAPPα-SE IVF deliver to wt mice and decreased to vehicle-only levels by 24 h (Stats: T-test). Panel B) sAPPβ levels are lower (but not significantly so) with sAPPα-SE delivery to EFAD huAPP-expressing mice.

[0244] FIG. 5 illustrates a 10-fold increase in brain levels of IDUA using SE-IDUA (−) particles compared to free IDUA.

[0245] FIG. 6 shows that SE-Cas9(−) has greater brain permeability than SE-Cas9 (+) particles.

[0246] FIG. 7 illustrates microreactor (microfluidic reactor) design. On top, the 26 μL reactor is shown and on the bottom the 10004 reactors.

[0247] FIG. 8 illustrates a custom reactor design. The design is based on minimizing turbulence in the mixing region.

[0248] FIG. 9 illustrates one embodiment of a flow chemistry machine (microfluidic reactor system).

[0249] FIG. 10 illustrates one embodiment of a microfluidic flow reactor design for SE-ligand reactions in series. The design is based on minimizing turbulence in the mixing join (mixing junction).

[0250] FIG. 11 illustrates hydrophobic small molecule encapsulation. The flow rate ratio versus size relationship is illustrated.

[0251] FIG. 12 illustrates encapsulation of a biologic. Illustrated is encapsulation of a protein with molecular weight 80 kDa.

[0252] FIG. 13 illustrates the synthetic exosomes with a cargo penetrating the blood brain barriers by squeezing through the tight junctions due to its deformability. We use a microfluidic based platform to encapsulate CNS biotherapeutic candidates in SEs. In certain embodiments, SEs for brain delivery are nanovesicles of <150 nm that are able to deform and cross the blood brain barrier while maintaining a cargo within. SEs, due to their deformability have the potential to cross the blood brain barrier (BBB) by physically squeezing between the tight junctions of the BBB.

[0253] FIG. 14, panels A-C, illustrates a synthetic scheme, illustrative moieties for decorating synthetic exosomes (SEs), and an illustrative strategy for decoration of SE with peptides for enhanced brain permeability. A) Illustrative peptides for decorating synthetic exosomes (SEs). Panel B) Illustrative lipids for decorating synthetic exosomes (SEs). Panel C) Illustrative synthetic scheme for decorating SEs with peptides using a “click” chemistry.

DETAILED DESCRIPTION

[0254] This disclosure pertains to the development of a linkage-free brain delivery platform to encapsulate CNS therapeutic candidates in Synthetic Exosomes (SEs). In various embodiments the SEs for brain delivery are liposomes of less than about 200 nm average (ore median) diameter that are able to deform while retaining a cargo within.

[0255] Without being bound to a particular theory, it is believed the synthetic exosomes are able to cross the blood-brain barrier (BBB) by physically squeezing between the tight junctions of the endothelial cells lining brain capillaries, as well as by the astrocytic projections (‘feet’) that also comprise the BBB, like miniature cells while protecting the therapeutic cargo encapsulated within the exosome.

[0256] In various embodiments the therapeutic-loaded SEs are synthesized using a microfluidic flow reactor (see, e.g., FIG. 1). The SEs thus produced can be stored as a lyophilized powder for months without any loss of the drug cargo. In various embodiments the synthetic exosomes are composed of GRAS (generally regarded as safe) materials, and are able to encapsulate a variety of molecules including small molecules—both lipophilic and hydrophilic—DNA/RNA/siRNA, as well as peptides, proteins, aptamers, and combinations thereof. A variety of lipids such as DPPC (1,2-dipalmitoyl-snglycero-3-phosphocholine), cholesterol, and DCP (dihexadecyl phosphate) can be used in predetermined ratios to generate SEs with the desired properties including deformability.

[0257] The flow rates of the organic phase (typically carrying the lipids and lipophilic compounds) in, e.g., IPA (isopropyl alcohol) and aqueous phase (typically carrying the potential hydrophilic therapeutic molecules) can be finely controlled to yield SEs with specific size (60<φ<500 nm), zeta potential (-50<ξ<50) and deformability.

[0258] If desired the surface of the synthetic exosomes can be modified to include different surface charges, using a variety of molecules like PEG for longer circulatory half-life, and carrier proteins for targeted therapeutic delivery.

[0259] Having been optimized (as illustrated herein), the microfluidic synthesis of SEs is readily scalable for obtaining larger amounts and allows good batch-to-batch reproducibility.

[0260] As proof of principle, we encapsulated fluorescently-labeled zoledronate for the purpose of transdermal delivery to a local site (calvarial skin of the skull) (see, e.g., U.S. Patent Application No: WO 2017087685 (PCT/US2016/062552)). In addition to presenting the size, encapsulation efficiency, zeta potential and tunability of SEs synthesized by this method, we also provided evidence of the successful long-term storage of the drug-loaded SEs. Using high-resolution fluorescent and confocal imaging. we showed the successful transdermal delivery of the encapsulated payload. The delivery was greater for SEs as compared to non-deformable nanovesicles or aqueous drug solutions. While this study was not performed for the purpose of delivery of the brain, it provides proof-of-concept for the use of SEs for drug delivery across a membrane. The tunability of our microfluidic SE synthesis method allows for modulation of the therapeutic-loaded SE size.

[0261] In our ongoing studies to achieve successful delivery of a potential therapeutic to the brain, we encapsulated a large protein fragment, the neurotrophic factor soluble Amyloid Precursor Protein alpha (sAPPα, a 678 amino acids in length) and characterized the sAPPα-SEs for size, encapsulation efficiency and zeta potential (see Table 1).

TABLE-US-00001 TABLE 1 Properties of sAPPα-SE. Characteristics Zeta Potential Size Encapsulation SE (mV) (nm) Efficiency (%) sAPPα-SE −40 80-120 >30

[0262] Next, to establish that we could achieve successful delivery and release of the SE payload to cells and maintain the biological activity of the cargo, we tested sAPPα-SEs in vitro in cells. sAPPα is an endogenous inhibitor of BACE1 (beta-site cleaving enzyme 1), the enzyme responsible for cleavage of full-length (FL) APP resulting in production of sAPPβ and the β C-terminal fragment (βCTF). βCTF is then cleaved by the γ secretase complex to produce amyloid-β (Aβ) and the APP intracellular domain. Therefore, successful delivery of sAPPα in cells that express FL APP should result in a decrease in sAPPβ and βCTF and, because of the decrease in the latter, a decrease in Aβ. As shown in FIG. 3, panel A, 48 hours after delivery of free recombinant unencapsulated sAPPα or sAPPα-SEs to Chinese Hamster Ovary cells that stably express human FL APP (CHO-7W cells), we found sAPPα-SEs more significantly decreased sAPPβ as compared to the media only control than free sAPPα. FIG. 3, panel B shows the decrease in Aβ1-42 is significantly greater with sAPPα-SEs than free sAPPα. The greater effect of sAPPα-SEs may be due to protection of sAPPα in the SEs from metabolism or other degradation and/or more efficient delivery of the sAPPα to the target for interaction, the enzyme BACE1.

[0263] We next determined if peripheral injection of sAPPα-SEs would result in successful delivery of sAPPα to the brain of mice. To distinguish endogenously expressed sAPPα from the exogenous SE-encapsulated sAPPα, we used wildtype mice expressing only endogenous mouse APP and injected SEs loaded with recombinant human sAPPα; we then determined human sAPPα levels in brain using a human-sAPPα-specific AlphaLISA (Perkin-Elmer). As shown in FIG. 4, panel A, 1 hour after IV delivery of sAPPα-SEs, levels of human sAPPα in mouse brain tissue were 1500 (AU) as compared to only ˜300 (AU) at 24 hours, considered the background level since values were similar for the vehicle-only 1 and 24 hour controls. Assay of known concentrations of sAPPα allowed us to determine the concentration, which was found to be a pharmacological relevant concentration of ˜12 nM. These results indicate successful brain delivery of potentially efficacious levels of sAPPα to the brain.

[0264] Finally, to ascertain target engagement, we injected sAPPα-SEs into EFAD Alzheimer's disease (AD) model mice. EFAD transgenic mice are an AD model that express human apolipoprotein E4 (E) as well as human APP with three familial AD mutations and human presenilin 1 with two familial AD mutations (FAD); as a result, these mice show AD-like amyloid pathology at an early age, starting with increased production of sAPPβ. As shown in FIG. 4, panel B, sAPPβ was only lower than vehicle-only control with sAPPα-SEs and not free sAPPα. This indicates target engagement and preservation of biological activity of sAPPα encapsulated in SEs. These data support the efficacy of sAPPα-SE delivery and the engagement of the target in the brain.

[0265] In view of the foregoing, described herein are improved microfluidic flow reactors for the fabrication of synthetic exosomes. Also provide are improved exosome formulations that are believed to provide improved delivery to the central nervous system and that provide particular zeta potentials as desired. Additionally the improved exosomes are stable in solution (do not substantially aggregate) and effectively retain loaded therapeutic moieties thereby providing effective delivery across the blood brain barrier (BBB).

Improved Synthetic Exosome Formulations.

[0266] In various embodiments the synthetic exosomes described herein comprise a lipsome formed from a lipid a lipid bilayer, where the lipid bilayer comprises or consists of: [0267] A) one or more phospholipids selected from the group consisting of phosphate lipids, phosphoglycerol lipids, phosphocholine lipids, and phosphoethanolamine lipids where the lipid carbon chain ranges from 3 to 24 carbon atoms; [0268] B) cholesterol, cholesterol hemicsuccinate, or a phytosterol; and [0269] C_a non-ionic surfactant.

[0270] In certain embodiments the synthetic exosome ranges in size from about 50 nm up to about 200 nm in diameter. Typically, the synthetic exosome is capable of crossing the blood brain barrier without substantially leaking said therapeutic moiety. In certain embodiments the exosome is capable of crossing the blood/brain barrier (BBB) and delivering a therapeutic moiety contained therein to the central nervous system without losing more than about 40%, or without losing more than 30%, or without losing more than 20%, or without losing more than 10%, or without losing more than 5%, or without losing more than 3%, or without losing more than 1% of a therapeutic moiety contained therein.

[0271] In certain embodiments the lipid bilayer comprising the synthetic exosome consists of more phospholipids (e.g., 1, 2, 3, 4, or more phospholipids), cholesterol and/or and/or cholesterol hemisuccinate, and/or a phytosterol; and a non-ionic surfactant.

[0272] In certain embodiments the lipid bilayer comprising the synthetic exosome does not contain an alcohol (e.g., ethanol). In certain embodiments the lipid bilayer comprising the synthetic exosome does not contain glutathione-maleimide-PEG2000-distearoyl phosphatidyl ethanolamine In various embodiments the synthetic exosome is not a transferosome or an ethosome.

[0273] In certain embodiments the molar ratio of total phospholipid to cholesterol, cholesterol hemisuccinate, and/or phytosterol ranges from about 4-8 moles of phospholipids] to about 1-2 moles of cholesterol.

[0274] In certain embodiments the amount of surfactant ranges from about 1%, or from about 3%, or from about 5%, or from about 8% up to about 18%, or up to about 15%, or up to about 13%, or up to about 10% (wt/wt). In certain embodiments the surfactant comprise one or more surfactants selected from the group consisting of Span 80, Tween 20, BRIJ® 76 (stearyl poly(10)oxy ethylene ether), BRIJ® 78 (stearyl poly(20)oxyethylene ether), BRIJ® 96 (oleyl poly(10)oxy ethylene ether), and BRIJ® 721 (stearyl poly (21) oxyethylene ether). In various embodiments the surfactant comprises or consists of Span 80.

[0275] In certain embodiments the synthetic exosome lipid bilayer (LB) comprises about 10% to about 20%, or about 15% Span 80 by weight.

[0276] Phospholipids

[0277] In various embodiments the lipid bilayer comprising the synthetic exosomes described herein is formed from 1, 2, 3, or 4, or more phospholipids, cholesterol or a functionalized cholesterol (e.g., cholesterol hemisuccinate (CHEMS), lysine-based cholesterol (CHLYS), and PEGylated cholesterol (Chol-PEG), or a phytosterol, and one or more surfactants (e.g., Span-80).

[0278] In certain embodiments the synthetic exosomes bear one or more targeting moieties attached to the lipid bilayer. Illustrative targeting moieties include, but are not limited to amino acids (e.g., amino acid functionalized lipids) that are transported into the central nervous system (CNS) by amino acid transporters, transferrin folic acid, various antibodies, CD171, and the like.

[0279] In various embodiments the lipid bilayer comprises one or more phospholipids, including, but not limited to phosphate, phosphoglycerol and phosphocholine lipids, phosphoethanolamine lipids with/without polyethylene glycol (7-100 monomers), and cholesterol. In various embodiments the lipid carbon chain ranges from about 3 to about 24 carbons atoms. Suitable phospholipids for use in the synthetic exosomes described herein can include Dihexanoyl-sn-glycero-3-phosphate (DHPA), Didecanoyl-sn-glycero-3-phosphate (DDPA), Distearoyl-sn-glycero-3-phosphate (DTPA), Dihexadecyl phosphate (DHP), and the like.

[0280] Phosphoglycerol lipids suitable for use in the lipid bilayer comprising the synthetic exosomes described herein can include Dihexanoyl-sn-glycero-3-phospho-(1′-rac-glycerol) (DHPG), Dilauroyl-sn-glycero-3-phospho-(1′-rac-glycerol) (DLPG), Distearoyl-sn-glycero-3-phospho-(1′-rac-glycerol) (DTPG), and the like.

[0281] Phosphocholine lipids suitable for use in the lipid bilayer comprising the synthetic exosomes described herein can include Dipropionyl-sn-glycero-3-phosphocholine (PC), Diheptanoyl-sn-glycero-3-phosphocholine (DHPC), Dimyristoyl-sn-glycero-3-phosphocholine (DMPC), Dilignoceroyl-sn-glycero-3-phosphocholine (DGPC), and the like.

[0282] Phospholipids with an alkyne such as phosphoethanolamine suitable for use in the lipid bilayer comprising the synthetic exosomes described herein can include Dihexanoyl-sn-glycero-3-phosphoethanolamine (DHPE), Distearoyl-sn-glycero-3-phosphoethanolamine (DTPE), and the like.

[0283] Phosphoethanolamine-PEG lipids suitable for use in the lipid bilayer comprising the synthetic exosomes described herein can include Dipalmitoyl-sn-glycero-3-phospho(ethylene glycol) (DPPEG1), Dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-350 (DMPEG350), Distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-350] (DTPEG350), Dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-550] (DMPEG550), Dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-1000] (DMPEG1000).

[0284] Other lipids suitable for use in the lipid bilayer comprising the synthetic exosomes described herein can include Dioleoyl-sn-glycero-3-phosphocholine (N-aminoethyl) (PC-NH2), Diphytanoyl-sn-glycero-3-phosphoethanolamine, Dioleoyl-3-trimethylammonium-propane (DOTAP), Distearoyl-3-trimethylammonium-propane (DSTAP), Dimyristoyl-3-trimethylammonium-propane (DMTAP), Di-O-octadecyl-sn-glycero-3-phosphocholin (DOPC), and the like.

[0285] Cholesterol and Cholesterol Analogs/Derivatives

[0286] In various embodiments the lipid bilayer comprising eth synthetic exosomes described herein contains cholesterol, a cholesterol derivative, or a cholesterol analog (e.g., a phytosterol).

[0287] Illustrative cholesterol derivatives include, but are not limited to cholesterol hemisuccinate, lysine-based cholesterol (CHLYS), 20-hydroxychloesterol, 22-hydroxycholesterol, 24-hydroxycholesterol, 25-hydroxy cholesterol, 27-hydroxycholesterol, cholesteryl succinate, cholic succinate, cholic tri-succinate, lithocholic succinate, chenodesoxycholic bis-scuccinate, Hederoside, and the like. In certain embodiments the cholesterol derivative is cholesterol hemisuccinate.

[0288] In certain embodiments a phytosterol is used in addition to cholesterol, or in place of cholesterol. Suitable phytosterols include, but are not limited to 9,10-secosteroids (e.g., vitamin D3, vitamin D2, calcipotriol, and the like), C-24 alkyl steroids (e.g., stigmasterol, β-sitosterol, and the like), and pentacyclic steroids (e.g., betulin, lupeol, ursolic acid, and oleanolic acid). In certain embodiments the phytosterol is a C-24 alkyl steroid.

[0289] It will be recognized that whenever cholesterol (CHOL) is described herein the cholesterol, cholesterol derivative, or phytocholesterol is further functionalized. Thus, for example, in certain embodiments, the cholesterol, cholesterol derivative, or phytocholesterol is pegylated.

[0290] Particular Effective Synthetic Exosome Formulations.

[0291] The particular lipid mixture used for a synthetic exosome is determined by consideration of the nature of the molecule(s) to be entrapped, the anatomical delivery location and the desire surface charge. For example, for biological molecules (e.g., proteins, nucleic acids, antibodies, and the like) a mixture of 2-4 lipids with small carbon chains (e.g., 3-14 carbon atoms), are used in combination with cholesterol, and/or functionalized cholesterol, and/or phytosterol, and a surfactant (e.g., Span-80) are utilized to form the exosome. In various embodiments illustrative, but non-limiting embodiments, the concentration of surfactant (e.g., Span-80) can range from about 1%, or from about 5% up to about 20%, or up to about 15% (w/w) depending on the degree of deformability needed. Illustrative formulations particularly well suited for delivery of biologic payloads are shown in Table 2.

TABLE-US-00002 TABLE 2 Illustrative synthetic exosome formulations for biologics. Zeta Lipid mixtures (in equimolar) so Potential (ζ) ratios below are molar ratios. (mV) Example for biologics −20 ≤ ζ 3:2:1 (DHPA:DHP:CH) 1:5:1 (DHPG:DHPA:CH) 2:5:1:2 (DHPG:DHPA:PC—NH2:CH) 2:4:1:1:2 (DHPG:DHPA:PC—NH2:DMPEG350:CH) −20 ≤ ζ ≤ 20 2:2:1 (DHPG:DHPC:CH) 4:4:1:2 (DHPG:DHPA:PC—NH2:CH) 2:2:1 (DHPG:DHPA:CH) 4:4:1:1:2 (DHPG:DHPA:PC—NH2:DMPEG550:CH) 2:2:1 (DHPG:DTPE:CH) 2:2:1 (DHPG:DMTAP:CH) 4:4:1:2 (DHPG:DMTAP:PC—NH2:CH) 4:4:1:1:2 (DHPG:DMTAP:PC—NH2:DMPEG550:CH) Z > 20 2:4:1 (DHPC:DTPE:CH) 2:4:1 (DHPC:DOTAP:CH) 2:4:1:2 (DHPC:DMTAP:PC—NH2:CH) 2:4:1:1:2 (DHPC:DMTAP:PC—NH2:DMPEG350:CH) *In certain embodiments, CH is cholesterol. In certain embodiments, CH is a cholesterol derivative (e.g., CHEMS, CHLYS, Chol-PEG, and the like). In certain embodiments CH is a phytosterol (e.g., 9,10-secosteroids (e.g., vitamin D3, vitamin D2, calcipotriol, and the like), C-24 alkyl steroids (e.g., stigmasterol, β-sitosterol, and the like), and pentacyclic steroids (e.g., betulin, lupeol, ursolic acid, and oleanolic acid).

[0292] For delivery of hydrophobic small molecules a mixture of 2-4 lipids with large carbon chains (e.g., 14-24 carbon atoms), are used in combination with cholesterol, and/or functionalized cholesterol, and/or phytosterol, and a surfactant (e.g., Span-80) are utilized to form the exosome. Illustrative formulations particularly well suited for delivery of small molecule are shown in Table 3.

TABLE-US-00003 TABLE 3 Illustrative synthetic exosome formulations for biologics. Zeta Lipid mixtures (in equimolar) so Potential (ζ) ratios below are molar ratios. (mV) Example for biologics −20 < ζ 4:2:1 (DTPA:DHP:CH) 1:5:1 (DTPG:DTPA:CH) 1:5:1:2 (DTPG:DTPA:PC—NH2:CH) 1:4:1:1:2 (DTPG:DTPA:PC—NH2:DMPEG350:CH) −20 ≤ ζ ≤ 20 2:2:1 (DTPG:DGPC:CH) 4:4:1:2 (DTPG:DDPA:PC—NH2:CH) 2:2:1 (DTPG:DDPA:CH) 4:4:1:1:2 (DTPG:DDPA:PC—NH2:DMPEG550:CH) 2:2:1 (DTPG:DTPE:CH) 2:2:1 (DTPG:DMTAP:CH) 4:4:1:2 (DTPG:DMTAP:PC—NH2:CH) 4:4:1:1:2 (DTPG:DMTAP:PC—NH2:DMPEG550:CH) Z > 20 2:4:1 (DMPC:DTPE:CH) 2:4:1 (DMPC:DOTAP:CH) 2:4:1:2 (DMPC:DMTAP:PC—NH2:CH) 2:4:1:1:2 (DMPC:DMTAP:PC—NH2:DMPEG350:CH) *In certain embodiments, CH is cholesterol. In certain embodiments, CH is a cholesterol derivative (e.g., CHEMS, CHLYS, Chol-PEG, and the like). In certain embodiments CH is a phytosterol (e.g., 9,10-secosteroids (e.g., vitamin D3, vitamin D2, calcipotriol, and the like), C-24 alkyl steroids (e.g., stigmasterol, β-sitosterol, and the like), and pentacyclic steroids (e.g., betulin, lupeol, ursolic acid, and oleanolic acid).

[0293] In certain embodiments, CH in the formulations in Tables 2 and 3 is cholesterol.

[0294] In certain embodiments, CH in the formulations in Tables 2 and 3 is a cholesterol derivative. Thus, in certain embodiments, CH in the formulations in Tables 2 and 3 is cholesterol hemisuccinate. In certain embodiments, CH in the formulations in Tables 2 and 3 is lysine-based cholesterol (CHLYS). In certain embodiments, CH in the formulations in Tables 2 and 3 is 20-hydroxychloesterol. In certain embodiments, CH in the formulations in Tables 2 and 3 is 22-hydroxycholesterol. In certain embodiments, CH in the formulations in Tables 2 and 3 is 24-hydroxycholesterol. In certain embodiments, CH in the formulations in Tables 2 and 3 is 25-hydroxy cholesterol. In certain embodiments, CH in the formulations in Tables 2 and 3 is 27-hydroxycholesterol. In certain embodiments, CH in the formulations in Tables 2 and 3 is cholesteryl succinate. In certain embodiments, CH in the formulations in Tables 2 and 3 is cholic succinate. In certain embodiments, CH in the formulations in Tables 2 and 3 is cholic tri-succinate. In certain embodiments, CH in the formulations in Tables 2 and 3 is lithocholic succinate. In certain embodiments, CH in the formulations in Tables 2 and 3 is chenodesoxycholic bis-scuccinate. In certain embodiments, CH in the formulations in Tables 2 and 3 is Hederoside.

[0295] In certain embodiments, CH in the formulations in Tables 2 and 3 is a phytosterol. Thus, in certain embodiments CH in the formulations in Tables 2 and 3 is a 9,10-secosteroids. In certain embodiments CH in the formulations in Tables 2 and 3 is vitamin D3. In certain embodiments CH in the formulations in Tables 2 and 3 is vitamin D2. In certain embodiments CH in the formulations in Tables 2 and 3 is calcipotriol. In certain embodiments CH in the formulations in Tables 2 and 3 is a C-24 alkyl steroid. In certain embodiments CH in the formulations in Tables 2 and 3 is stigmasterol. In certain embodiments CH in the formulations in Tables 2 and 3 is β-sitosterol. In certain embodiments CH in the formulations in Tables 2 and 3 is a pentacyclic steroid. In certain embodiments CH in the formulations in Tables 2 and 3 is betulin. In certain embodiments CH in the formulations in Tables 2 and 3 is lupeol. In certain embodiments CH in the formulations in Tables 2 and 3 is ursolic acid. In certain embodiments CH in the formulations in Tables 2 and 3 is oleanolic acid.

[0296] The foregoing formulations are illustrative and non-limiting. Using the teaching provided herein, numerous other exosome formulations will be available to one of skill in the art.

Targeting Moieties

[0297] In certain embodiments the synthetic exosomes bear one or more targeting moieties attached to the lipid bilayer. Illustrative targeting moieties include, but are not limited to amino acids (e.g., amino acid functionalized lipids) that are transported into the central nervous system (CNS) by amino acid transporters, transferrin (e.g., transferrin functionalized lipids), transferrin receptor binding peptides (see, e.g., FIG. 14, panel A), folic acid, various BBB endothelial cell binding antibodies, CD171, and the like.

[0298] In certain embodiments the phospholipid or cholesterol comprising the synthetic exosomes described herein can be functionalized to thereby attach one or more targeting moieties. In certain embodiments the targeting moieties can comprise an amino acid to exploit amino acid transporters for internalization into a target cell. Essential amino acids are commonly transported across the BBB through specific transporters to participate in brain amino acid metabolism, such as the synthesis of neurotransmitters. Based on the difference of the substrates, amino acid transporters are divided into cationic, anionic, and neutral amino acid transporters. Large neutral amino acid transporter (LAT1) is the most abundant carrier for amino acids, which is expressed on both luminal and abluminal membranes of BCECs. LAT1 carries large neutral amino acids such as leucine, tryptophan, tyrosine, and phenylalanine across the BBB in the ion-independent pathway. Accordingly, in certain embodiments the targeting moiety can comprise carries a large neutral amino acid such as leucine, tryptophan, tyrosine, and phenylalanine.

[0299] Other illustrative targeting moieties include, but are not limited to antibodies, lectins, transferrin, folic acid, CD171, and the like.

Synthetic Exosome (SE) Synthesis Using Microfluidic Flow Reactors.

[0300] In one illustrative embodiment a microfluidic reactor is used to synthesize the synthetic exosomes. In certain embodiments the microfluidic reactors uses 3 pumps to flow 3 fluids into the microfluidic chip. In certain embodiments, two of the streams are water and the other stream is isopropyl alcohol (IPA).

[0301] In certain embodiments the aqueous stream flow rate can range from 0.5 mL/min-10 mL/min, depending on the particle size desire and contains any biologics if needed. Each one of the flow rates can be manipulated individually.

[0302] In certain embodiments the organic stream flow rate can range from 0.05 mL/min-5 mL/min, depending on the particle size desire and contains the lipids mixture and any hydrophobic small molecule if needed.

[0303] In certain embodiments the microflow fluidic flow reactor utilizes one or more organic stream that contain components of the lipid bilayer (e.g., cholesterol, phospholipid, surfactant), and one or more aqueous (e.g., water) streams. In certain embodiments the organic stream comprise an alcohol (e.g., isopropyl alcohol) in addition to the components of the lipid bilayer.

[0304] In various embodiments the therapeutic moiety (cargo) is provided in the stream that is most likely to suspend or dissolve the moiety. Thus, for example, in typical embodiments, a hydrophobic therapeutic moiety is provided in the organic stream, while hydrophilic moieties are provided in the aqueous stream. Thus by way of illustration small organic molecules (e.g., hydrophobic small organic molecules) will be provided in the organic stream. Hydrophilic moieties such as peptides, enzymes, proteins and antibodies, nucleotides, DNA, and the like can be provided in the aqueous stream. It will be recognized that, in certain embodiments, two, three, or four different therapeutic moieties can be loaded into each synthetic exosome.

[0305] In certain illustrative, but non-limiting embodiments, the organic stream lipid mixture concentration ranges from about 5 mM to about 20 mM and any hydro phobic cargo will range from 0.05 mM up to about 2 mM depending on the cargo solubility. In certain illustrative, but non-limiting embodiments, ff the aqueous stream contains a hydrophilic molecule its concentration ranges from about 0.01 mg/mL to about 5 mg/mL depending on its solubility.

[0306] For the synthetic exosome synthesis, we have used two commercially available reactors: a 264 and the 10004 reactors but other reactors are also possible. The design of two illustrative reactors is shown in FIG. 7.

[0307] In order to improve the SE synthesis, we can use custom made reactors, their design is shown in FIG. 8. As shown in the illustrative embodiment shown in FIG. 8, the microfluidic flow reactor comprises a central channel with two or more branch channels feeding the central channel and thereby forming a mixing junction, where the diameter of said central channel and branch channels and the angle provided between said central channel and branch channels are selected to maintain a backpressure of less than about 100 psi. The design is based on minimizing turbulence in the junction while maintaining backpressure of less than 100 psi, the angle of impact in the mixing junction allows us to minimize turbulence while the channel width and height allow us to control the pressure.

[0308] In certain embodiments the width(s) of said central channel and/or branch channels independently range from about 0.5 μm or from about 1 μm, or from about 10 μm, or from about 20 μm, or from about 30 μm up to about 100 μm, or up to about 80 μm, or up to about 60 μm, or up to about 50 μm, or up to about 40 μm. In certain embodiments the height(s) (depth(s)) of the central channel and/or branch channels independently range from about 0.5 μm or from about 1 μm, or from about 10 μm, or from about 20 μm, or from about 30 μm up to about 100 μm, or up to about 80 μm, or up to about 60 μm, or up to about 50 μm, or up to about 40 μm. In certain embodiments the angle (a) between the central channel and said lateral channels ranges from about 10°, or from about 15°, or from about 20°, or from about 25° up to about 90°, or up to about 80°, or up to about 70°, or up to about 60°, or up to about 50°. In certain embodiments the reactor comprises one or more pumps where said pumps provide a fluid pressure ranging from about 1 bar to about 31 bar.

[0309] One embodiment of the microfluidic reactor system is shown in FIG. 9 and its elements are highlighted.

[0310] Functionalization of the Lipids in Series

[0311] Synthetic exosome synthesis using the microfluidic reactor also enables us to use functionalized lipids such as the one listed in Table 4 below to tag different ligands to the synthetic exosome in series. This can be achieved with the use of reactors connected in series or with the design of the new reactor shown in FIG. 10. As shown in the illustrative embodiment shown in FIG. 10, the microfluidic flow reactor comprises a central channel with two or more branch channels feeding the central channel and thereby forming a first mixing junction, and a second set of branch channels feeding the central channel and thereby forming a second mixing junction. It will be recognized that the reactor can contain additional mixing junctions. Thus, reactors comprising 2, 3, 4, 5, 6 or more mixing junctions are contemplated. In certain embodiments the diameter of the central channel and branch channels and the angle provided between the central channel and branch channels are selected to maintain a backpressure of less than about 100 psi. Again, the design is based on minimizing turbulence in the junction while maintaining backpressure of less than 100 psi, the angle of impact in the mixing junction allows us to minimize turbulence while the channel width and height allow us to control the pressure.

[0312] For the synthesis, after the SE are form in the first mixing junction, then the ligand can react with the SE in the second mixing junction. Additionally, in certain embodiments more tagged lipids can be reacted with the forming SE in additional mixing junctions. All of the reactions can be independently tuned.

[0313] In certain illustrative, but non-limiting embodiments the “tagged” synthesis facilitates the use of specific proteins ligands that can include, but are not limited to, ligands that will have a receptor in the BBB. Illustrative ligands include, but are not limited to insulin, transferrin, low density lipoprotein receptor-related protein 1, or any other ligand such as an amino acid.

[0314] In certain embodiments one of skill can use the lipid NHS ester and then functionalize it with various ligands such as peptide, proteins, amino acids, etc.

TABLE-US-00004 TABLE 4 Illustrated functionalized lipids can be purchased or prepared by “tagged” synthesis. Functionalized Lipid Dioleoyl-sn-glycero-3-phosphocholine (N-aminoethyl) Dioleoyl or dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-[4-(p- maleimidomethyl)cyclohexane-carboxamide] Dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-[4-(p- maleimidophenyl)butyramide] Dipalmitoyl-sn-Glycero-3-Phosphothioethanol Dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(succinyl) Distearoyl-sn-glycero-3-phosphocholine (N-propynyl) Dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-dibenzocyclooctyl Distearoyl-sn-glycero-3-phosphocholine (N-azidoethyl) Dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-350] Dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-550] Dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-750] Dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-1000] Dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] Distearoyl-sn-glycero-3-phosphoethanolamine-N-[carboxy(polyethylene glycol)-2000] Distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000] Distearoyl-sn-glycero-3-phosphoethanolamine-N-[succinyl(polyethylene glycol)-2000] Distearoyl-sn-glycero-3-phosphoethanolamine-N-[maleimide(polyethylene glycol)-2000] Distearoyl-sn-glycero-3-phosphoethanolamine-N-[biotinyl(polyethylene glycol)-2000] Distearoyl-sn-glycero-3-phosphoethanolamine-N-[carboxy(polyethylene glycol)-2000, NHS ester] Dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-[azido(polyethylene glycol)-2000] Distearoyl-sn-glycero-3-phosphoethanolamine-N-[azido(polyethylene glycol)-2000] Dioleoyl-sn-glycero-3-phosphoethanolamine-N-[azido(polyethylene glycol)-2000] Dioleoyl-sn-glycero-3-phosphoethanolamine-N-[azido(polyethylene glycol)-2000] Dioleoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000] Dioleoyl-sn-glycero-3-phosphoethanolamine-N-[carboxy(polyethylene glycol)-2000] Dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-3000] Dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-5000] Distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-5000] 16:0 Azidoethyl sphingomelin 1,2-distearoyl-sn-glycero-3-phosphocholine (N-azidoethyl) (2S,3R,E)-2-amino-14-azidotetradec-4-ene-1,3-diol 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N- [azido (polyethylene glycol)-2000]

Pharmaceutical Formulations.

[0315] In various embodiments pharmaceutical formulations contemplated herein contain synthetic exosomes as described herein and a pharmaceutically acceptable carrier. The term “carrier” typically refers to an inert substance used as a diluent or vehicle for the pharmaceutical formulation. The term can also encompass a typically inert substance that imparts cohesive qualities to the composition. Typically, the physiologically acceptable carriers are present in liquid form. Examples of liquid carriers include, but not limited to, physiological saline, phosphate buffer, normal buffered saline (135-150 mM NaCl), water, buffered water, 0.4% saline, 0.3% glycine, 0.3M sucrose (and other carbohydrates), glycoproteins to provide enhanced stability (e.g., albumin, lipoprotein, globulin, etc.) and the like. Since physiologically acceptable carriers are determined in part by the particular composition being administered as well as by the particular method used to administer the composition, there are a wide variety of suitable formulations of pharmaceutical compositions of the present invention (see, e.g., Remington's Pharmaceutical Sciences, Maak Publishing Company, Philadelphia, Pa., 17th ed. (1985)).

[0316] In various embodiments the pharmaceutical formulations can be sterilized by conventional, well-known sterilization techniques or may be produced under sterile conditions. Aqueous solutions can be packaged for use or filtered under aseptic conditions and lyophilized, the lyophilized preparation being combined with a sterile aqueous solution prior to administration. In certain embodiments the compositions can contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents and the like, e.g., sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate and triethanolamine oleate. Sugars can also be included for stabilizing the compositions, such as a stabilizer for lyophilized compositions.

[0317] Pharmaceutical compositions suitable for parenteral administration, such as, for example, by intraarticular, intravenous, intramuscular, intratumoral, intradermal, intraperitoneal and subcutaneous routes, can include aqueous and non-aqueous, isotonic sterile injection solutions. In certain embodiments the injection solutions can contain antioxidants, buffers, bacteriostats and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers and preservatives. Injection solutions and suspensions can also be prepared from sterile powders, such as lyophilized synthetic exosomes. In certain embodiments the compositions can be administered, for example, by intravenous infusion, intraperitoneally, intravesically or intrathecally. In various embodiments parenteral administration and intravenous administration are also contemplated. The formulations of liposome compositions can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials.

[0318] In certain embodiments the pharmaceutical compositions are formulated for systemic administration as an injectable.

[0319] In certain embodiments the pharmaceutical compositions are formulated for administration as an aerosol, e.g., for oral and/or nasal inhalation.

[0320] In certain embodiments the pharmaceutical compositions are formulated for topical deliver, intradermal delivery, subdermal delivery and/or transdermal delivery.

[0321] In certain embodiments the pharmaceutical compositions are formulate for application to oral mucosa, vaginal mucosa, and/or rectal mucosa.

[0322] In certain embodiments the pharmaceutical composition is in unit dosage form. In such form, the composition is subdivided into unit doses containing appropriate quantities of the active component (synthetic exosome). The unit dosage form can be a packaged composition, the package containing discrete quantities of the pharmaceutical composition. The composition can, if desired, also contain other compatible therapeutic agents.

[0323] In certain embodiments the synthetic exosomes described herein can be delivered through the skin using conventional transdermal drug delivery systems, i.e., transdermal “patches” wherein the synthetic exosomes or formulations thereof) are typically contained within a laminated structure that serves as a drug delivery device to be affixed to the skin. In such a structure, the synthetic exosomes and/or formulations thereof are typically contained in a layer, or “reservoir,” underlying an upper backing layer. It will be appreciated that the term “reservoir” in this context refers to a quantity of synthetic exosomes, and/or formulations thereof that is ultimately available for delivery to the surface of the skin. Thus, for example, the “reservoir” may include the active ingredient(s) in an adhesive on a backing layer of the patch, or in any of a variety of different matrix formulations known to those of skill in the art. The patch may contain a single reservoir, or it may contain multiple reservoirs.

[0324] In one illustrative embodiment, the reservoir comprises a polymeric matrix of a pharmaceutically acceptable contact adhesive material that serves to affix the system to the skin during drug delivery. Examples of suitable skin contact adhesive materials include, but are not limited to, polyethylenes, polysiloxanes, polyisobutylenes, polyacrylates polyurethanes, and the like. Alternatively, the synthetic exosome and/or synthetic exosomes formulation reservoir and skin contact adhesive are present as separate and distinct layers, with the adhesive underlying the reservoir which, in this case, may be either a polymeric matrix as described above, or it may be a liquid or hydrogel reservoir, or may take some other form. The backing layer in these laminates, which serves as the upper surface of the device, preferably functions as a primary structural element of the “patch” and provides the device with much of its flexibility. The material selected for the backing layer is preferably substantially impermeable to the synthetic exosomes and/or formulations thereof) and any other materials that are present.

[0325] Alternatively, other pharmaceutical delivery systems can be employed. For example, emulsions, and microemulsions/nanoemulsions are well known examples of delivery vehicles that may be used to protect and deliver pharmaceutically active compounds. Certain organic solvents such as dimethylsulfoxide also can be employed, although usually at the cost of greater toxicity.

Therapeutic Moieties Delivered Using Synthetic Exosomes.

[0326] The synthetic exosomes described herein can readily be used to transport any of a number of therapeutic moieties across the blood brain barrier and effectively deliver those therapeutic moieties to the central nervous system (e.g., to the brain). Illustrative therapeutic moieties include, but are not limited to a protein, an antibody, an enzyme, a DNA encoding an inhibitory RNA, an inhibitory RNA or a micoRNA (miRNA), and/or a small organic molecule. It will be recognized that in certain embodiments, a single therapeutic moiety is delivered using the synthetic exosomes described herein, while in other embodiments, a plurality of therapeutic moieties are delivered using the synthetic exosomes described herein. Thus, for example, in certain embodiments, 2, 3, 4, or more therapeutic moieties can be encapsulated in a single synthetic exosome.

[0327] Small Organic Molecules.

[0328] Illustrative small organic molecules include, but are not limited to hydantoins as described in PCT Publication No: WO 2014/127042 (PCT/US2014/016100), disulfiram and/or analogues thereof, honokiol and/or analogues thereof, tropisetron and/or analogues thereof, nimetazepam and/or analogues thereof (see, e.g., PCT/US2011/048472 (WO 2012/024616), tropinol-esters and/or related esters and/or analogues thereof (see, e.g., PCT/US2012/049223 (WO 2013/019901), TrkA kinase inhibitors (e.g., ADDN-1351) and/or analogues thereof (see, e.g., PCT/US2012/051426 (WO 2013/026021 A2), D2 receptor agonists and alphal-adrenergic receptor antagonists, and APP-specific BACE Inhibitors (ASBIs) as described in PCT/US2013/032481 (WO 2013/142370), including, but not limited to galangin, a galangin prodrug, rutin, a rutin prodrug, and other flavonoids and flavonoid prodrugs as described or claimed therein.

[0329] Non-limiting examples of additional therapeutic agents include drugs selected from the group consisting of: (a) drugs useful for the treatment of Alzheimer's disease and/or drugs useful for treating one or more symptoms of Alzheimer's disease, (b) drugs useful for inhibiting the synthesis Aβ, and (c) drugs useful for treating neurodegenerative diseases.

[0330] Other small organic molecules include various chemotherapeutic compounds including but not limited to mitoxantrone, a retinoic acid derivative, doxirubicin, vinblastine, vincristine, cyclophosphamide, ifosfamide, cisplatin, 5-fluorouracil, a camptothecin derivative, interferon, tamoxifen, and taxol, abraxane, doxorubicin, pamidronate disodium, anastrozole, exemestane, cyclophosphamide, epirubicin, toremifene, letrozole, trastuzumab, megestroltamoxifen, paclitaxel, docetaxel, capecitabine, goserelin acetate, zoledronic acid, and the like. .

[0331] SE-Mediated sAPPα (or Other Protein) Delivery to the Brain and CNS.

[0332] Delivery of sAPPα to the brain is believed to be clinically beneficial not only in Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), cerebral amyloid angiopathy, Huntington's disease, but also for Traumatic brain injury (TBI), and Stroke therapy.

[0333] sAPPα is −100 kDa protein fragment produced by the normal processing of the amyloid precursor protein (APP) by α-secretase. Since sAPPα is a large protein and subject to proteolysis, we encapsulated sAPPα in deformable synthetic exosomes (SE-hsAPPα) to increase the likelihood of brain delivery.

[0334] SEs containing sAPPα (SE-hsAPPα) were synthesized using flow chemistry in a microfluidic reactor to assist in efficient and reproducible production of SEs. The SE-hsAPPα were tested in CHO-7W cells to confirm sAPPα release and inhibition of BACE1 as determined by decreases in BACE1 APP-derived cleavage product sAPPβ in cells (see, e.g., FIG. 3). SE-hsAPPα significantly decreased sAPPβ.

[0335] We also assessed the ability of SE-hsAPPα to penetrate the blood brain barrier (BBB) by measuring the sAPPα levels in the mouse brain after intravenous (IV) injection (FIG. 4). sAPPα in the brain was −13 nM at 1h after injection.

[0336] In view of the surprising discovery that encapsulation of sAPPα in SEs permits effective delivery of this large protein across the blood-brain barrier into the brain and the delivered sAPPα appears to retain its activity to allosterically inhibit BACE, it is believed the SEs (SE-hsAPPα) find utility as therapeutic and/or prophylactic agents in a number of contexts.

[0337] Specifically it is believed the SEs containing sAPPα comprising sAPPα find utility in the treatment or prevention of Alzheimer's disease and/or mild cognitive impairment (MCI) associated with amyloidogenic pathology. It is also believed that SEs containing sAPPα can be used prophylactically to slow or prevent the progression from an asymptomatic condition to MCI, and/or from an asymptomatic condition to pre-Alzheimer's disease or early stage Alzheimer's disease, and/or to slow or stop the progression of Alzheimer's disease.

[0338] It is also believed the synthetic exosomes containing sAPPα may be clinically beneficial not only in Alzheimer's disease, but in Amyotrophic lateral sclerosis (ALS), cerebral amyloid angiopathy, and also for Traumatic brain injury (TBI) and Stroke therapy. In Alzheimer's disease the levels of sAPPα are reduced in the brain especially in patients carrying a ApoE4 allele. sAPPα levels are also modulated in several CNS disorders including Amyotrophic lateral sclerosis (ALS) and Parkinson's disease (PD). In Traumatic brain injury and Stroke there is a short-term increase in Aβ levels in the brain and this increase can be modulated by short term delivery of the allosteric BACE inhibitor sAPPα.

[0339] Accordingly, in certain embodiments, synthetic exosomes (SEs) containing sAPPα are provided as well as pharmaceutical formulations comprising these SEs. Methods of prophylaxis and/or treatment using the SEs are also provided. Additionally, methods of making (fabricating) the SEs are provided. Other proteins including, but not limited to the IDUA gene product (alpha-L-iduronidase) for mucopolysaccharidosis type I (MPS I) or acid sphingomyelinase (ASM) (aka SMPD1) for Neimann Pick disease (NPD) are contemplated.

[0340] SE-Mediated Antibody Delivery to the Brain and CNS.

[0341] It was a surprising discovery that the synthetic exosomes (also known as SEs) described herein can be used to effectively facilitate passage of “SE encapsulated” antibodies across the blood brain barrier. Illustrative antibodies include, but are not limited to antibodies useful for the treatment of brain cancers and/or neurodegenerative diseases (e.g., Alzheimer’ disease, amyloid-related mild cognitive impairment (MCI), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), Parkinson's disease (PD), and the like).

[0342] Alzheimer's Disease

[0343] Alzheimer's disease (AD) is a progressive neurodegenerative disorder characterized clinically by memory and cognitive dysfunction. The disease is generally classified into two types: sporadic AD (SAD) and familial AD (FAD). Three genes lead to familial AD (FAD)—amyloid precursor protein (APP), presenilin 1 (PS1), and presenilin (PS2)—while the ε4 allele of the apolipoprotein E gene has been identified as the major risk factor for sporadic AD (SAD) The neuropathology of AD is characterized by two types of lesions, extracellular senile plaques and intracellular neurofibrillary tangles (NFTs), which are composed of, respectively, β-amyloid (Aβ), a cleavage product of APP, 4 and aberrantly phosphorylated tau, a microtubule-associated protein.

[0344] Research has established that most neurodegenerative diseases including Alzheimer's, Lewy Body and other dementias, Parkinson's and prion diseases develop and progress along similar paths. In each disease, a particular protein undergoes a change in its shape from a soluble, physiologically functional protein to a protein that has lost the ability to perform its required tasks in the brain, starting off a chain reaction of binding to each other with little control. These aggregates become toxic to brain cells.

[0345] It is believed that attacking an early form of these proteins when they change their shape could prevent their formation into aggregates that lead to plaques and tangles, or neutralize their capacity to spread throughout the brain, and stop the progression of a particular neurological disease.

[0346] In certain embodiments this can be accomplished by the use of antibodies (e.g., monoclonal antibodies) that react to an intermediate, or “oligomer” state of the amyloid and tau proteins seen in Alzheimer's disease, as well as to prion disease proteins.

[0347] Researchers have shown that a number of antibodies directed against proteins comprising amyloid deposits and/or proteins involved in the amyloidogenic processes can slow, halt, or reverse the formation of amyloid plaques and presumably the associated cog native decline.

[0348] Illustrative targets for the treatment of Alzheimer's disease include, but are not limited to Aβ, mutant Aβ, tau, mutant tau, apoE, and the like (see, e.g., Table 5).

TABLE-US-00005 TABLE 5 Illustrative, but non-limiting list of antibodies for the treatment of Alzheimer's disease and their respective targets. Antibody Target AAB-003 Aβ Bapineuzumab Aβ (epitope: aa 1-5 monomers, oligomers, fibrils, ARIA-E) Ponezumab Aβ (epitope: aa 13-24 monomers) RG7345 Tau Solanezumab Aβ (epitope aa 16-26 monomers) GSK933776 Aβ JNJ-63733657 Tau BIIB076 Tau LY2599666 Aβ MEDI1314 Aβ SAR228810 Aβ (protofibrils, and low molecular weight amyloid-β) BAN2401 Aβ protofibrils BIIB092 Tau C2B8E12 Tau LY3002813 Aβ (Aβ(p3-42), a pyroglutamate form of Aβ LY3303560 Tau RO 7105705 Tau Aducanumab Aβ (epitope: 3-6, fibrils) Crenezumab Aβ Gantenerumab Aβ (epitope: aa 3-12, 18-27 oliogmers, fibrils ARIA-E) HAE-4 apoE 9D5 Pyroglutamate-3 Aβ BIIB037/BART Insoluble fibrillar human amyloid-β

[0349] In certain embodiments the antibodies target mutant A(3s which include, but are not limited to APPsw, APP A713T, pyroglutamate-3 A13, and the like.

[0350] Without being bound to a particular theory, it is believed the synthetic exosomes described herein can effectively deliver these and other antibodies across the blood brain barrier permitting effective doses to act on the brain.

[0351] Amyotrophic Lateral Sclerosis (ALS)

[0352] Antibodies directed against the HERV-K envelope protein or SOD1 are believed to be effective candidates for the treatment of amyotrophic lateral sclerosis (ALS). Accordingly, in certain embodiments, synthetic exosomes containing anti-HEV-K or anti-SOD1 antibodies are contemplated.

[0353] Huntington's Disease.

[0354] The antibody VX15 is a monoclonal antibody that blocks the activity of semaphorin 4D (SEMA4D), a molecule that is believed to promote chronic inflammatory responses in the brain, and is believed to be effective in the treatment of Huntington's disease (HD). VX15 is the Company's novel clinical stage monoclonal antibody that blocks the activity of semaphorin 4D (SEMA4D), a molecule that is believed to promote chronic inflammatory responses in the brain. Accordingly, in certain embodiments, synthetic exosomes containing VX15 or other anti-SEMA4D antibodies are contemplated.

[0355] Parkinson's Disease.

[0356] The monoclonal antibody PRX002 (prasinezumab), targets α-synuclein and is believed to inhibit cell-to-cell transmission of alpha-synuclein and modify disease progression in Parkinson's disease (PD). Accordingly, in certain embodiments, synthetic exosomes containing prasinezumab or other anti-α-synuclein antibodies are contemplated.

[0357] Brain Cancers.

[0358] The synthetic exosomes described herein can also be used to transport antibodies (or chemotherapeutic drugs) useful for the treatment of brain tumors (CNS-tumors) across the blood brain barrier. Cancer cells sometimes find ways to use checkpoints (molecules on certain immune cells that need to be activated (or inactivated) to start an immune response) to avoid being attacked by the immune system. Drugs (e.g., antibodies) that target these checkpoints can provide effective therapies for the treatment of cancers.

[0359] PD-1 is a checkpoint protein on immune cells called T cells. It normally acts as a type of “off switch” that helps keep the T cells from attacking other cells in the body. It does this when it attaches to PD-L1, a protein on some normal (and cancer) cells. When PD-1 binds to PD-L1, it basically tells the T cell to leave the other cell alone. Some cancer cells have large amounts of PD-L1, which helps them evade immune attack. Monoclonal antibodies that target either PD-1 or PD-L1 can block this binding and boost the immune response against cancer cells. Illustrative PD-1 inhibitors include, but are not limited to Pembrolizumab (KEYTRUDA®), Nivolumab (OPDIVO®), Cemiplimab (LIBTAYO®), and the like.

[0360] Other checkpoint inhibitors include, but are not limited to PD-L1 inhibitors. Illustrative PD-L1 inhibitors include, but are not limited to Atezolizumab (TECENTRIQ®), Avelumab (BAVENCIO®), Durvalumab (IMFINZI®), and the like.

[0361] CTLA-4 is another protein on some T cells that acts as a type of “off switch” to keep the immune system in check. Ipilimumab (YERVOY®) is a monoclonal antibody that attaches to CTLA-4 and stops it from working. This can boost the body's immune response against cancer cells.

[0362] Other antibodies useful in the treatment of cancer include, but are not limited to anti-CD52 antibodies, anti-CD47 antibodies, anti-VEGF antibodies (e.g., bevacizumab), anti-CD20 (e.g., rituximab), anti-HER2 (e.g., trastuzumab), and the like. Without being bound to a particular theory, it is believed that SEs containing anti-cancer antibodies can be effective in treating brain cancers including, but not limited to Acoustic Neuroma, Astrocytoma (e.g., Grade I—Pilocytic Astrocytoma, Grade II—Low-grade Astrocytoma, Grade III—Anaplastic Astrocytoma,Grade IV—Glioblastoma (GBM)), Chordoma, CNS Lymphoma, Craniopharyngioma, Other Gliomas) including, but not limited to Brain Stem Glioma, Ependymoma, Mixed Glioma, Optic Nerve Glioma, Subependymoma), Medulloblastoma, Meningioma, Metastatic Brain Tumors, Oligodendroglioma, Pituitary Tumors, Primitive Neuroectodermal (PNET), Schwannoma

[0363] The foregoing antibodies are illustrative and non-limiting. Using the teachings provided herein the synthetic exosomes can readily be used to deliver any of a wide number of antibodies across the blood brain barrier (BBB).

[0364] SE-Mediated Delivery of Missing Enzymes

[0365] In certain embodiments we will use the SE technology to deliver missing enzymes to the brain in rare diseases such as but not limited to: beta-N-acetylhexosaminidase A in Tay Sachs disease, phenylalanine hydroxylase in PKU, Iduronidase (IDUA) in MPS-1, iduronate-2-sulfatase (IDS) in MPS-II, heparan N-sulfatase or alpha-N-acetylglucosaminidase or heparan-alpha-glucosaminide N-acetyltransferase or N-acetylglucosamine 6-sulfatase in MPS-III, N-acetyl-galactosamine-6-sulfatase or beta-galactosidase in MPS-IV, Acidic sphingomyelinase (ASM1) for Niemann Pick's disease, aminoacylase 2 for Canavan's disease, Carnitine palmitoyltransferase II, Kynurenine-3-monooxygenase.

[0366] SE-Mediated ASO Delivery to the Brain and CNS.

[0367] In certain embodiments, SE's can be used for delivery of antisense oligo nucleotides (ASO) for CNS disorders including but not limited to: spinal muscular atrophy (SMA), ALS, Huntington's disease, Parkinson's disease and Alzheimer's disease.

[0368] SE-Mediated CRISPR/Cas9 Delivery to the Brain and CNS.

[0369] In certain embodiments the synthetic exosomes described herein can contain the components of a CRISPR/cas system and effectively deliver these components across the blood brain barrier. pathogenic mutations in monogenic diseases including AD, PD, ALS, FXS, SCA and SBMA. Such packaged CRISPR/cas components can involve providing the appropriate guide RNA (sgRNA) and the Cas enzyme in the synthetic exosomes and administering the synthetic exosomes, e.g., via intravenous infusion.

[0370] In certain embodiments the components of the CRISPR/cas system include a nucleic acid that encodes and expresses a CRISPR endonuclease and a nucleic acid that is, or that encodes, a desired guide RNA. In certain embodiments the SE packaged nucleic acid encodes both a CRISPR endonuclease and a guide RNA. In certain embodiments the components of the CRISPR/cas system comprise a CRISPR endonuclease protein and a nucleic acid that is, or that encodes a guide RNA.

[0371] Without being bound to a particular theory, it is believed that the synthetic exosome-packaged CRISPR/cas system can be used in vivo for the correction of pathogenic mutations in, e.g., monogenic diseases including, but not limited to Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), fragile X syndrome (FXS), autosomal dominant spinocereberal ataxis (SCAs) and spinal bulbar muscular atrophy (SBMA), and correction of autosomal recessive genetic disorder that is caused by a deficiency in the expression or function of the Ataxia Telangiectasia Mutated (ATM) protein, and the like.

[0372] SE Delivery of CRISPR/Cas for Alzheimer's Disease.

[0373] Because the majority of AD cases are sporadic with the trigger unknown, the use of CRISPR/Cas9 would not seem a viable treatment approach. This is supported by the fact that a very small percentage of cases (<1%) are caused by known mutations in the APP protein or genes products involved in processing APP to form beta-amyloid. What is certain is that, although these mutations make up a small percentage of known AD cases, they all lead to enhanced production of the beta-amyloid peptide (Bettens et al. (2013) Lancet. Neurol. 12:92-104). Other known mutations that lead to early-onset AD include those to presenilin 1 (PSEN1) and presenilin 2 (PSEN2) (Schellenberg et al. (1992) Science, 258: 668-671; Levy-Lahad et al. (1995) Science, 269: 970-973). The net effect of mutations to these two genes is enhanced production of beta-amyloid (1-42) perhaps by shifting the cleavage site in APP (Vetrivel et al. (2006) Mol. Neurodegener. 1:4).

[0374] Clearly, the potential for CRISPR/cas9 in potentially correcting these autosomal-dominant mutations is real. This is supported by studies that have analyzed the potential of correcting similar kinds of mutations using this gene editing system. For example, CRISPR/Cas9 was used to correct a presenilin (PSEN2) autosomal dominant mutation in iPSC-derived neurons. In this study, the authors generated basal forebrain cholinergic iPSC neurons from an individual carrying the PSEN2N141I mutation (Ortiz-Virumbrales et al. (2017) Acta Neuropathol. Commun. 5: 77). In this study, CRISPR/Cas9 corrected the N141I mutation demonstrated by Sanger sequencing that led to a normalization of the Aβ 42/40 ratio. Functionally, the CRISPR/Cas9 correction of the PSEN2 mutation reversed electrophysiological deficits. This study was supported by previous studies that have also used CRISPR/Cas9 to correct familial AD mutations in the PSEN gene in patient-derived iPSCs (Pires et al. (2016) Stem Cell Res. 17: 285-288; Poon et al. (2016) Stem Cell Res. 17: 466-469).

[0375] CRISPR/cas9 has also been used to knock out the Swedish APP mutation in patient-derived fibroblasts leading to a 60% reduction in secreted beta-amyloid (Gyorgy et al. (2018) Mol. Ther. Nucleic Acids, 11: 429-440).

[0376] Additionally, sgRNAs targeting the extreme C-terminus of APP led to robust APP-editing (see, e.g., A CRISPR/Cas9 based strategy to manipulate the Alzheimer's amyloid pathway (bioRxiv preprint doi: //doi.org/10.1101/310193) which is incorporated herein by reference for the CRISPR/cas components, e.g., sgRNA, described therein). FIG. 1a in this reference illustrates the protospacer adjacent motif—PAM—site and genomic target recognized by the sgRNA. The sgRNA appeared to have reciprocal effects on sAPPα and APPβ cleavage providing confidence that the gene editing strategy favorably manipulated the amyloid pathway.

[0377] Other targets for CRISPR to treat AD include, but are not limited to tau and BACE1. Tau plays a critical role not only in AD pathophysiology but also in various other neurodegenerative disorders, including, but not limited to FTLD, which is also called frontotemporal dementia (Spillantini & Goedert M (1998) Trends Neurosci. 21: 428-433; Goedert et al. (1998) Neuron, 21: 955-958; Grundke-Iqbal et al. (1986) J. Biol. Chem. 261: 6084-6089; Grundke-Iqbal et al. (1986) Proc. Natl. Acad. Sci. USA, 83: 4913-4917; Ittner et al. (2010) Cell, 142: 387-397). In order to successfully treat, AD it can be desirable to simultaneously target both Aβ as well as tau. It is believed CRISPR and readily used to eliminate toxic tau forms by gene silencing.

[0378] Similarly, the gene Bacel, which encodes β-secretase 1 is required for the production of amyloid-β (Aβ) peptides and, therefore, has a central role in the accumulation of Aβ that occurs in AD. This gene can be targeted using a CRISPR/cas system (see, e.g., Park, et al. (2019) Nat. Neurosci. 22: 524-528.

[0379] Similarly, the risk factor for AD is ApoE4, can be modified by CRISPR to ApoE3 or ApoE2.

[0380] These and other targets suitable for the treatment of Alzheimer's disease or FTLD are readily identified by those of skill in the art and the appropriate CRISPR/cas system components can readily be delivered to the central nervous system (CNS) using the synthetic exosomes described herein.

[0381] SE Delivery of CRISPR/Cas for Parkinson's Disease.

[0382] Cells and animals overexpressing α-synuclein have proven to be a useful model for Parkinson's disease. IN a new study, Cas9′ cutting ability was deactivated and the protein was engineered so that after binding to a target site it recruits transcription factors. A guide RNA strand has been identified that has a powerful effect in keeping cells alive much more effectively than any of the individual genes that have been previously found to protect the cells used in the study (see, e.g., Chen et al. (2017) Mol. Cell, 68(1): 247-257 which is incorporated herein by reference for the CRISPR/cas system components (including guide RNA) described therein.

[0383] Further genetic screening revealed that many of the genes turned on by this guide RNA strand are chaperone proteins, which help other proteins fold into the correct shape. The researchers hypothesize that these chaperone proteins may assist in the proper folding of alpha-synuclein, which could prevent it from forming clumps.

[0384] These and other CRISPR/cas system components for the treatment of Parkinson's disease or other pathologies characterized by α-synuclein aggregation can readily be delivered to the central nervous system (CNS) using the synthetic exosomes described herein.

[0385] SE Delivery of CRISPR/Cas for Huntington Disease.

[0386] Huntington disease (HD). HD is caused by the expansion of CAG repeats in exon 1 of the HTT gene, which encodes for mutant huntingtin (mHTT), a large protein consisting of large polyglutamine repeats in the N-terminal domain of mHTT that most likely exhibits a toxic-gain of function. One potential strategy to treat HD could be using CRISPR/Cas9 to selectively suppress the expression of mHTT. The rationale for this approach comes from a previous study demonstrating that the application of RNA interference improved motor and neuropathological abnormalities in a HD mouse model. Since this study, the CRISPR/Cas9 gene editing system has been successfully applied to HD (Shin et al. (2016) Hum. Mol. Genet. 25: 4566-4576; Kolli et al. (2017) Int. J. Mol. Sci. 18(4): 754; Monteys et al. (2017)Mol. Ther. 25: 12-23).

[0387] Recently, CRISPR/Cas9 was used to selectively suppress the entire HTT and mHTT gene in an in vivo mouse model of HD (non-allele specific approach) (Yang et al. (2017) J. Clin. Invest. 127: 2719-2724). By way of illustration the guide RNAs used in this study (HTT-gRNAs T1, T2, T3, and T4) were designed to target the regions flanking the polyQ region and are incorporated herein by reference for their sequence information.

[0388] These and other CRISPR/cas system components for the treatment of Huntington disease can readily be delivered to the central nervous system (CNS) using the synthetic exosomes described herein.

[0389] SE Delivery of CRISPR/Cas for Amyotrophic Lateral Sclerosis.

[0390] Amyotrophic lateral sclerosis (ALS) is a fatal and incurable neurodegenerative disease characterized by the progressive loss of motor neurons in the spinal cord and brain. In particular, autosomal dominant mutations in the superoxide dismutase 1 (SOD1) gene are responsible for ˜20% of all familial ALS cases. The clustered regularly interspaced short palindromic repeats (CRISPR)—CRISPR-associated (Cas9) genome editing system holds the potential to treat autosomal dominant disorders by facilitating the introduction of frameshift-induced mutations that can disable mutant gene function.

[0391] It has been demonstrated that CRISPR-Cas9 can be harnessed to disrupt mutant SOD1 expression. Such genome editing can significantly reduce or eliminate mutant SOD1 protein resulting in improved motor function and reduced muscle atrophy (e.g., Gaj et al. (2017) Sci. Adv., 3: eaar3952).

[0392] These and other CRISPR/cas system components for the treatment of ALS can readily be delivered to the central nervous system (CNS) using the synthetic exosomes described herein.

[0393] SE Delivery of CRISPR/Cas for Fragile X Syndrome.

[0394] Fragile X syndrome (FXS) is a common cause of intellectual disability that is most often due to a CGG-repeat expansion mutation in the FMR1 gene that triggers epigenetic gene silencing. Epigenetic modifying drugs can only transiently and modestly induce FMR1 reactivation in the presence of the elongated CGG repeat. As a proof-of-principle, the expanded CGG-repeat was excised in both somatic cell hybrids containing the human fragile X chromosome and human FXS iPS cells using the CRISPR/Cas9 genome editing (see, e.g. Xie et al. (2016) PLOS ONE 11(10): e0165499). Transcriptional reactivation in approximately 67% of the CRISPR cut hybrid colonies and in 20% of isolated human FXS iPSC colonies. The reactivated cells produced FMRP and exhibited a decline in DNA methylation at the FMR1 locus. These data demonstrate the excision of the expanded CGG-repeat from the fragile X chromosome can result in FMR1 reactivation.

[0395] These and other CRISPR/cas system components for the treatment of fragile X syndrome can readily be delivered to the central nervous system (CNS) using the synthetic exosomes described herein.

[0396] SE Delivery of CRISPR/Cas for Autosomal Dominant Spinocereberal Ataxis (SCAs) and Spinal Bulbar Muscular Atrophy (SBMA).

[0397] Repeat expansion disorders are a class of genetic diseases that are caused by expansions in DNA repeats. The DNA repeats come in various sizes from single nucleotides to dodecamers or longer. The threshold at which the repeat expansions become symptomatic varies with the specific disease. There are over 40 distinct diseases now known to be caused by these expansions in DNA sequence. Remarkable progress during the last three decades has defined causative mutations that drive pathogenesis in a large number of these diseases. Expansion of CAG, GCG, CTG, CGG, and CAAA repeats both in coding and non-coding sequences in distinct genes results in a diverse group of diseases with mechanisms linked to protein levels or toxicity, RNA, and/or both,

[0398] Spinal and Bulbar Muscular Atrophy/Kennedy's Disease

[0399] The cause of Kennedy's disease has been shown to be a CAG expansion in the androgen receptor (AR) gene (La Spada et al. (1991) Nature, 352(6330): 77-79). Spinal and bulbar muscular atrophy (SBMA) is a slow progressive neuromuscular disorder in which the lower motor neurons and muscles degenerate. SBMA is X-linked and therefore mainly affecting males, with some exceptions discussed in the Arnold and Merry review (Arnold & Merry Molecular Mechanisms and Therapeutics for SBMA/Kennedy's Disease. Neurotherapeutics. 2019). The symptoms include gynecomastia, testicular atrophy, and reduced fertility, all which correlate with the known function of AR as a transcription factor binding androgen hormones. AR is involved in the male reproductive and skeletal system and female fertility. Given the known function of AR, the normal lifespan of SBMA patients, and the rapid progress in the field, it is surprising that after almost thirty years of investigation, we do not have a therapeutic treatment for this disease. Merry reviews the complexity of the underlying pathogenesis of this disorder and highlights steps that may lead to therapeutics for SBMA/Kennedy's disease (Id.).

[0400] SCA1

[0401] The genetic cause of Spinocerebellar ataxia type 1 (SCA1) was reported in 1993 (Orr et al. (1993) Nat. Genet. 4(3): 221-226; Srinivasan & Shakkottai (2019) Neurotherapeutics, DOI:10.1007/s13311-019-00763-y). SCA1 is an autosomal-dominant disorder characterized by neurodegeneration of the cerebellum, spinal cord, and brainstem and has a polyQ expansion in the ataxin-1 protein.

[0402] SCA3

[0403] Spinocerebellar ataxia type 3 (SCA3), also known as Machado-Joseph disease (MJD), is caused by a polyQ expansion in the ataxin-3 protein (Takiyama et al. (1993) Nat. Genet. 4(3): 300-304). Ataxin-3 is a ubiquitin ligase and Da Silva et al. present a unifying molecular mechanism for disease pathogenesis focusing on the disruption of protein homeostasis (Da Silva et al. (2019) Neurotherapeutics, 16(4): 1009-1031). This molecular mechanism is common to all polyQ diseases and key networks are likely shared between the diseases.

[0404] SCA2

[0405] In 1996, the CAG expansion in ataxin-2 gene was discovered to cause Spinocerebellar ataxia type 2 (SCA2). Egorova and Bezprozvanny describe the epidemiology, the function of ataxin-2 in RNA metabolism and stress granules, the molecular changes underlying Purkinje cell loss, the cerebellar-thalamic cortical circuit dysregulation and ataxia, and molecular mechanisms that may be therapeutically targeted using, e.g., CRISPR/cas systems (Egorova & Bezprozvanny et al. (2019) 16(4): 1050-1073).

[0406] SCA7

[0407] Spinocerebellar ataxia type 7 (SCA7) is caused by a CAG expansion in the ataxin-7 gene and is characterized by neuronal loss in the cerebellum, brainstem, and retina. The major symptoms are cerebellar ataxia and blindness. The ataxin-7 protein is a subunit of the multiprotein SAGA complex which is involved in chromatin remodeling and there is now a detailed molecular understanding of how the polyQ expansion in ataxin-7 disrupts neuronal function (Niewiadomska-Cimicka & Trottier (2019) Neurotherapeutics, 16(4):1074-1096).

[0408] SCA17

[0409] SCA17 is caused by a CAG/CAA repeat expansion in the gene encoding the TATA box-binding protein (TBP) (Koide et al. (1999) Hum. Mol. Genet. 8(11): 2047-2053). TBP is a well-characterized transcription factor. Liu et al. discuss the use of CRISPR-Cas9 for the treatment of SCA17 (Liu et al. (2019) Neurotherapeutics, 6(4):1097-1105).

[0410] SCA31

[0411] SCA31 is an adult onset neurological disorder with progression cerebellar ataxia caused by degenerating Purkinje cell in the Japanese population. The genetics of SCA31 was elucidated in 2009 (Sato et al. (2009) Am. J. Hum. Genet. 85(5): 544-557). There is 2.5-3.8 kb insertion of the penta-nucleotide repeat (TGGAA)n stretch in the introns of thymidine kinase 2 (TK) and BEAN (brain expressed, associated with Nedd4). An emerging mechanism of RNA toxicity is apparent for this disease (Ishikawa & Nagai (2019) Neurotherapeutics, 6(4):1106-1114).

[0412] C9orf72 ALS/FTD

[0413] A hexanucleotide repeat expansion in the first intron of the C9orf72 gene has been identified as a case of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Given its relatively recent discovery, there has been rapid progress in identifying key pathogenic events such as the gain of toxicity from bidirectional transcribed repeat-containing RNAs, nucleocytoplasmic transport defects common to a number of the expansion diseases, and how the expansion causes two different diseases. These advances have led to phase I clinical trials using antisense oligonucleotide therapies and it is believed that CRISPR/cas approaches can be even more effective.

[0414] The use of CRISPR-Cas9 for the treatment of the above-described diseases offers a promising area of neurotherapeutics.

[0415] In view of this, these and other CRISPR/cas system components for the treatment of the above-identified pathologies, can readily be delivered to the central nervous system (CNS) using the synthetic exosomes described herein.

[0416] SE Delivery of CRISPR/Cas for Ataxia Telangiectasia (A-T)

[0417] Ataxia telangiectasia (A-T) is a disease characterized by cerebellar wasting, or atrophy, and eventually lymphoma; caused by mutations in the ataxia telangiectasia mutated gene, or ATM. The mutations that cause disease are typically located in the kinase domain or in proximity to regulatory regions of the protein.

[0418] Mutations in the ATM gene affect the production or the activity of the ATM protein, leading to the symptoms associated with A-T. Fixing the faulty gene permanently will give the cells a chance to produce the correct protein. In the last few years, CRISPR has revolutionized the field of genome editing and shown remarkable success in progressing treatments for many genetic diseases that also rely on the correction of faulty genes.

[0419] CRISPR/cas system components for the treatment of Ataxia telangiectasia, can readily be delivered to the central nervous system (CNS) using the synthetic exosomes described herein.

[0420] The CRISPR/Cas System—Class 2 CRISPR/Cas Endonucleases

[0421] As noted above, the synthetic exosomes described herein are particularly well suited for the in vivo delivery of components of a CRISPR/cas system.

[0422] Compelling evidence has recently emerged for the existence of an RNA-mediated genome defense pathway in archaea and many bacteria that has been hypothesized to parallel the eukaryotic RNAi pathway (for reviews, see Godde and Bickerton (2006) J. Mol. Evol. 62: 718-729; Lillestol et al. (2006) Archaea 2: 59-72; Makarova et al. (2006) Biol. Direct 1: 7; Sorek et al. (2008) Nat. Rev. Microbiol. 6: 181-186). Known as the CRISPR-Cas system or prokaryotic RNAi (pRNAi), the pathway is believed to arise from two evolutionarily and often physically linked gene loci: the CRISPR (clustered regularly interspaced short palindromic repeats) locus, that encodes RNA components of the system, and the cas (CRISPR-associated) locus, that encodes proteins (see, e.g., Jansen et al. (2002) Mol. Microbiol. 43: 1565-1575; Makarova et al., (2002) Nucl. Acids Res. 30: 482-496; Makarova et al. (2006) Biol. Direct 1: 7; Haft et al. (2005) PLoS Comput. Biol. 1: e60). CRISPR loci in microbial hosts contain a combination of CRISPR-associated (Cas) genes as well as non-coding RNA elements capable of programming the specificity of the CRISPR-mediated nucleic acid cleavage. The individual Cas proteins do not share significant sequence similarity with protein components of the eukaryotic RNAi machinery, but have analogous predicted functions (e.g., RNA binding, nuclease, helicase, etc.) (see, e.g., Makarova et al. (2006) Biol. Direct 1: 7). The CRISPR-associated (cas) genes are often associated with CRISPR repeat-spacer arrays. More than forty different Cas protein families have been described. Of these protein families, Cast_appears to be ubiquitous among different CRISPR/Cas systems. Particular combinations of cas genes and repeat structures have been used to define 8 CRISPR subtypes (Ecoli, Ypest, Nmeni, Dvulg, Tneap, Hmari, Apern, and Mtube), some of which are associated with an additional gene module encoding repeat-associated mysterious proteins (RAMPs). More than one CRISPR subtype may occur in a single genome. The sporadic distribution of the CRISPR/Cas subtypes suggests that the system is subject to horizontal gene transfer during microbial evolution.

[0423] In class 2 CRISPR systems, the functions of the effector complex (e.g., the cleavage of target DNA) can be carried out by a single endonuclease (see, e.g., Zetsche et al. (2015) Cell, 163(3): 759-771; Makarova et al. (2015) Nat. Rev. Microbiol. 13(11): 722-736; Shmakov et al. (2015) Mol. Cell. 60(3): 385-397; and the like). As such, the term “class 2 CRISPR/Cas protein” is used herein to encompass the endonuclease (the target nucleic acid cleaving protein) from class 2 CRISPR systems. Thus, the term “class 2 CRISPR/Cas endonuclease” as used herein encompasses type II CRISPR/Cas proteins (e.g., Cas9), type V CRISPR/Cas proteins (e.g., Cpf1, C2c1, C2C3), and type VI CRISPR/Cas proteins (e.g., C2c2). To date, class 2 CRISPR/Cas proteins encompass type II, type V, and type VI CRISPR/Cas proteins, but the term is also meant to encompass any class 2 CRISPR/Cas protein suitable for binding to a corresponding guide RNA and forming an RNP complex (e.g., and cleaving target DNA).

[0424] Type II CRISPR/Cas Endonucleases (e.g., Cas9)

[0425] In natural Type II CRISPR/Cas systems, Cas9 functions as an RNA-guided endonuclease that uses a dual-guide RNA having a crRNA and trans-activating crRNA (tracrRNA) for target recognition and cleavage by a mechanism involving two nuclease active sites in Cas9 that together generate double-stranded DNA breaks (DSBs), or can individually generate single-stranded DNA breaks (SSBs). The Type II CRISPR endonuclease Cas9 and engineered dual-(dgRNA) or single guide RNA (sgRNA) form a ribonucleoprotein (RNP) complex that can be targeted to a desired DNA sequence. Guided by a dual-RNA complex or a chimeric single-guide RNA, Cas9 generates site-specific DSBs or SSBs within double-stranded DNA (dsDNA) target nucleic acids, that are repaired either by non-homologous end joining (NHEJ) or homology-directed recombination (HDR).

[0426] In some embodiments a nucleic acid encoding a CRISPR endonuclease, or the endonuclease protein and a guide RNA or a nucleic guide RNA are provided as cargo(s) in the synthetic exosomes described herein.

[0427] A Cas9 protein forms a complex with a Cas9 guide RNA. The guide RNA provides target specificity to a Cas9-guide RNA complex by having a nucleotide sequence (a guide sequence) that is complementary to a sequence (the target site) of a target nucleic acid (as described elsewhere herein). The Cas9 protein of the complex provides the site-specific activity. In other words, the Cas9 protein is guided to a target site (e.g., stabilized at a target site) within a target nucleic acid sequence (e.g. genomic DNA) by virtue of its association with the protein-binding segment of the Cas9 guide RNA.

[0428] In some cases, the CRISPR/Cas endonuclease (e.g., Cas9 protein) is a naturally-occurring protein (e.g., naturally occurs in bacterial and/or archaeal cells). In other cases, the CRISPR/Cas endonuclease (e.g., Cas9 protein) is not a naturally-occurring polypeptide (e.g., the CRISPR/Cas endonuclease is a variant CRISPR/Cas endonuclease, a chimeric protein, and the like, e.g., in some cases the CRISPR/Cas endonuclease includes one or more NLSs).

[0429] Examples of suitable Cas9 proteins include, but are not limited to, those set forth in SEQ ID NOs:5-816 of PCT Application No: PCT/US2017/017255 (WO 2017/139505), which are incorporated herein by reference for the sequences described therein. Naturally occurring Cas9 proteins bind a Cas9 guide RNA, are thereby directed to a specific sequence within a target nucleic acid (a target site), and cleave the target nucleic acid (e.g., cleave dsDNA to generate a double strand break). A chimeric Cas9 protein is a fusion protein comprising a Cas9 polypeptide that is fused to a heterologous protein (referred to as a fusion partner), where the heterologous protein provides an activity (e.g., one that is not provided by the Cas9 protein). The fusion partner can provide an activity, e.g., enzymatic activity (e.g., nuclease activity, activity for DNA and/or RNA methylation, activity for DNA and/or RNA cleavage, activity for histone acetylation, activity for histone methylation, activity for RNA modification, activity for RNA-binding, activity for RNA splicing etc.). In some cases, a portion of the Cas9 protein (e.g., the RuvC domain and/or the HNH domain) exhibits reduced nuclease activity relative to the corresponding portion of a wild type Cas9 protein (e.g., in some cases the Cas9 protein is a nickase). In some cases, the Cas9 protein is enzymatically inactive, or has reduced enzymatic activity relative to a wild-type Cas9 protein (e.g., relative to Streptococcus pyogenes Cas9). In some cases, the Cas9 protein is enzymatically enhanced, e.g., or has enhanced enzymatic activity and/or specificity relative to a wild-type Cas9 protein (e.g., relative to Streptococcus pyogenes Cas9).

[0430] Assays to determine whether given protein interacts with a Cas9 guide RNA can be any convenient binding assay that tests for binding between a protein and a nucleic acid. Suitable binding assays (e.g., gel shift assays) will be known to one of ordinary skill in the art (e.g., assays that include adding a Cas9 guide RNA and a protein to a target nucleic acid).

[0431] Assays to determine whether a protein has an activity (e.g., to determine if the protein has nuclease activity that cleaves a target nucleic acid and/or some heterologous activity) can be any convenient assay (e.g., any convenient nucleic acid cleavage assay that tests for nucleic acid cleavage). Suitable assays (e.g., cleavage assays) will be known to one of ordinary skill in the art and can include adding a Cas9 guide RNA and a protein to a target nucleic acid.

[0432] In some cases, a chimeric Cas9 protein includes a heterologous polypeptide that has enzymatic activity that modifies a target nucleic acid (e.g., nuclease activity, methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity or glycosylase activity).

[0433] In some cases, a chimeric Cas9 protein includes a heterologous polypeptide that has enzymatic activity that modifies a polypeptide (e.g., a histone) associated with target nucleic acid (e.g., methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, u biquitin ligase activity, deu biquitinating activity, adenylation activity, deadenylation activity, SUMOylating activity, deSUMOylating activity, ribosylation activity, deribosylation activity, myristoylation activity or demyristoylation activity).

[0434] In some cases, a CRISPR/Cas endonuclease (e.g., a Cas9 protein) includes a heterologous polypeptide that provides for localization within the cell. For example, in some cases, a subject CRISPR/Cas endonuclease (e.g., a Cas9 protein) includes one or more (e.g., 2 or more, 3 or more, 4 or more, 5 or more, etc.) nuclear localization sequences (NLSs). The one or more (e.g., 2 or more, 3 or more, 4 or more, 5 or more, etc.) NLSs can be at any convenient position within the CRISPR/Cas endonuclease (e.g., a Cas9 protein), e.g., N-terminus, C-terminus, internal, etc. In some cases, a CRISPR/Cas endonuclease (e.g., a Cas9 protein) includes one or more (e.g., 2 or more, 3 or more, 4 or more, 5 or more, etc.) NLSs at the N-terminus and one or more (e.g., 2 or more, 3 or more, 4 or more, 5 or more, etc.) NLSs at the C-terminus.

[0435] Many Cas9 orthologs from a wide variety of species have been identified and in some cases the proteins share only a few identical amino acids. Identified Cas9 orthologs have similar domain architecture with a central HNH endonuclease domain and a split RuvC/RNaseH domain (e.g., RuvCI, RuvCII, and RuvCIII) (e.g., see Table 6). For example, a Cas9 protein can have 3 different regions (sometimes referred to as RuvC-I, RuvC-11, and RucC-III), that are not contiguous with respect to the primary amino acid sequence of the Cas9 protein, but fold together to form a RuvC domain once the protein is produced and folds. Thus, Cas9 proteins can be said to share at least 4 key motifs with a conserved architecture. Motifs 1, 2, and 4 are RuvC like motifs while motif 3 is an HNH-motif. The motifs set forth in Table 6 may not represent the entire RuvC-like and/or HNH domains as accepted in the art, but Table 6 does present motifs that can be used to help determine whether a given protein is a Cas9 protein.

TABLE-US-00006 TABLE 6 Four motifs that are present in Cas9 sequences from various species. The amino acids listed in Table 1 are from the Cas9 from S. pyogenes (SEQ ID NO: 26, see also SEQ ID NO: 5 in PCT/US2017/017255). Motif # Motif Amino acids (residue #s) Highly conserved 1 RuvC-like I IGLDIGTNSVGWAVI (7-21) D10, G12, G17 (SEQ ID NO: 1) 2 RuvC-like II IVIEMARE (757-766) E762 (SEQ ID NO: 2) 3 HNH-motif DVDHIVPQSFLKDDSIDNKVLTRSDKN H840, N854, N863 (887-863) (SEQ ID NO: 3) 4 RuvC-like HHAHDAYL (982-989) H982, H983, III (SEQ ID NO: 4) A984, D986, A987

[0436] In some cases, a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to motifs 1-4 as set forth in SEQ ID NOs:1-4, respectively (e.g., see Table 6), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs:5-816 in PCT/US2017/017255).

[0437] In other words, in some cases, a suitable Cas9 polypeptide comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth in SEQ ID NO:26 (see also SEQ ID NO:5 in PCT/US2017/017255) (e.g., the sequences set forth in SEQ ID NOs:1-4, e.g., see Table 6), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs 6-816 in PCT/US2017/017255.

[0438] In some cases, a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 60% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO:26 (the motifs are in Table 6, and are set forth as SEQ ID NOs:1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 70% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO:26 (the motifs are in Table 6, and are set forth as SEQ ID NOs:1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 75% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO:26 (the motifs are in Table 6, and are set forth as SEQ ID NOs:1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 80% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO:26 (the motifs are in Table 6, and are set forth as SEQ ID NOs:1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 85% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO:26 (the motifs are in Table 6, and are set forth as SEQ ID NOs:1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 90% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO:26 (the motifs are in Table 6, and are set forth as SEQ ID NOs:1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 95% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO:26 (the motifs are in Table 6, and are set forth as SEQ ID NOs:1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 99% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO:26 (the motifs are in Table 6, and are set forth as SEQ ID NOs:1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 100% amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO:26 (the motifs are in Table 6, and are set forth as SEQ ID NOs:1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs:6-816 in PCT/US2017/017255. Any Cas9 protein as defined above can be used as a Cas9 polypeptide, as part of a chimeric Cas9 polypeptide (e.g., a Cas9 fusion protein), any of which can be used in an RNP of the present disclosure.

[0439] In some cases, a suitable Cas9 protein comprises an amino acid sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs:6-816 in PCT/US2017/017255.

[0440] In some cases, a suitable Cas9 protein comprises an amino acid sequence having 60% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 70% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 75% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs:6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 80% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 85% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 90% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 95% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs:6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 99% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs:6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 100% amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs:6-816 in PCT/US2017/017255. Any Cas9 protein as defined above can be used as a Cas9 polypeptide, as part of a chimeric Cas9 polypeptide (e.g., a Cas9 fusion protein), any of which can be used in an RNP of the present disclosure.

[0441] In some cases, a suitable Cas9 protein comprises an amino acid sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to any of the amino acid sequences set forth as SEQ ID NOs:6-816 in PCT/US2017/017255.

[0442] In some cases, a suitable Cas9 protein comprises an amino acid sequence having 60% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to any of the amino acid sequences set forth as SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 70% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to any of the amino acid sequences set forth as SEQ ID NOs:6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 75% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to any of the amino acid sequences set forth as SEQ ID NOs:6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 80% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to any of the amino acid sequences set forth as SEQ ID NOs:6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 85% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to any of the amino acid sequences set forth as SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 90% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to any of the amino acid sequences set forth as SEQ ID NOs:6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 95% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to any of the amino acid sequences set forth as SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 99% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to any of the amino acid sequences set forth as SEQ ID NOs:6-816 in PCT/US2017/017255. In some cases, a suitable

[0443] Cas9 protein comprises an amino acid sequence having 100% amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO:26, or to any of the amino acid sequences set forth as SEQ ID NOs:6-816 in PCT/US2017/017255. Any Cas9 protein as defined above can be used as a Cas9 polypeptide, as part of a chimeric Cas9 polypeptide (e.g., a Cas9 fusion protein), any of which can be used in an RNP of the present disclosure.

[0444] In some cases, a Cas9 protein comprises 4 motifs (as listed in Table 1), at least one with (or each with) amino acid sequences having 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to each of the 4 motifs listed in Table 1 (SEQ ID NOs:1-4), or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs:6-816 in PCT/US2017/017255.

[0445] In some cases, a Cas9 protein is a high fidelity Cas9 protein (see, e.g., Kleinstiver et al. (2016) Nature, 529(7587): 490-495).

[0446] In some cases, a suitable Cas9 protein is a Cas9 protein as described in Slaymaker et al. (2016) Science 351: 84. For example, a suitable Cas9 protein can include a Streptococcus pyogenes Cas9 with substitutions of one or more of K810, K848, K855, K1003, and R1060 (where the amino acid numbering is based on the numbering set out in SEQ ID NO:26 (SEQ ID No:5 in PCT/US2017/017255)). For example, a suitable Cas9 protein includes a Streptococcus pyogenes Cas9 with K810A, K1003A, and R1060A substitutions (where the amino acid numbering is based on the numbering set out in SEQ ID NO:26 (SEQ ID No:5 in PCT/US2017/017255)). As another example, a suitable Cas9 protein includes a Streptococcus pyogenes Cas9 with K848A, K1003A, and R1060A substitutions (where the amino acid numbering is based on the numbering set out in SEQ ID NO:5). As another example, a suitable Cas9 protein includes a Streptococcus pyogenes Cas9 with a K855A substitution (where the amino acid numbering is based on the numbering set out in SEQ ID NO:26 (SEQ ID No:5 in PCT/US2017/017255).

[0447] Type V and Type VI CRISPR/Cas Endonucleases

[0448] In certain embodiments the plasmid(s) complexed with the PRX carriers described herein encode a type V or type VI CRISPR/Cas endonuclease (e.g., Cpf1, C2c1, C2c2, C2c3) and associated guide RNA(s). Type V and type VI CRISPR/Cas endonucleases are a type of class 2 CRISPR/Cas endonuclease. Examples of type V CRISPR/Cas endonucleases include, but are not limited to, Cpf1, C2c1, and C2c3. An example of a type VI CRISPR/Cas endonuclease is C2c2. In some cases, the plasmid encodes a type V CRISPR/Cas endonuclease (e.g., Cpf1, C2c1, C2c3). In some cases, a Type V CRISPR/Cas endonuclease is a Cpf1 protein. In some cases, the plasmid encodes a a type VI CRISPR/Cas endonuclease (e.g., C2c2).

[0449] Like type II CRISPR/Cas endonucleases, type V and VI CRISPR/Cas endonucleases form a complex with a corresponding guide RNA. The guide RNA provides target specificity to an endonuclease-guide RNA RNP complex by having a nucleotide sequence (a guide sequence) that is complementary to a sequence (the target site) of a target nucleic acid (as described elsewhere herein). The endonuclease of the complex provides the site-specific activity. In other words, the endonuclease is guided to a target site (e.g., stabilized at a target site) within a target nucleic acid sequence (e.g. genomic DNA) by virtue of its association with the protein-binding segment of the guide RNA.

[0450] Examples and guidance related to type V and type VI CRISPR/Cas proteins (e.g., cpf1, C2c1, C2c2, and C2c3 guide RNAs) can be found in the art (see, e.g., Zetsche et al. (2015) Cell, 163(3):759-771; Makarova et al. (2015) Nat. Rev. Microbiol. 13(11): 722-736; Shmakov et al. (2015)Mol. Cell, 60(3): 385-397; and the like).

[0451] In some cases, the Type V or type VI CRISPR/Cas endonuclease (e.g., Cpf1, C2c1, C2c2, C2c3) is enzymatically active, e.g., the Type V or type VI CRISPR/Cas polypeptide, when bound to a guide RNA, cleaves a target nucleic acid. In some cases, the Type V or type VI CRISPR/Cas endonuclease (e.g., Cpf1, C2c1, C2c2, C2c3) exhibits reduced enzymatic activity relative to a corresponding wild-type a Type V or type VI CRISPR/Cas endonuclease (e.g., Cpf1, C2c1, C2c2, C2c3), and retains DNA binding activity (e.g., in some cases the endonuclease is a nickase).

[0452] In some cases a type V CRISPR/Cas endonuclease is a Cpf1 protein. In some cases, a Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the Cpf1 amino acid sequence set forth in any of SEQ ID NOs:27-31 (SEQ ID NOs:1088-1092 in PCT/US2017/017255). In some cases, a Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000 aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the Cpf1 amino acid sequence set forth in any of SEQ ID NOs:27-31.

[0453] In some cases, a Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvC1 domain of the Cpf1 amino acid sequence set forth in any of SEQ ID NOs:27-31. In some cases, a Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCII domain of the Cpf1 amino acid sequence set forth in any of SEQ ID NOs:27-31. In some cases, a Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCIII domain of the Cpf1 amino acid sequence set forth in any of SEQ ID NOs:27-31. In some cases, a Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCI, RuvCII, and RuvCIII domains of the Cpf1 amino acid sequence set forth in any of SEQ ID NOs:27-31.

[0454] In some cases, the Cpf1 protein exhibits reduced enzymatic activity relative to a wild-type Cpf1 protein (e.g., relative to a Cpf1 protein comprising the amino acid sequence set forth in any of SEQ ID NOs:27-31), and retains DNA binding activity. In some cases, a Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the Cpf1 amino acid sequence set forth in any of SEQ ID NOs:27-31; and comprises an amino acid substitution (e.g., a D.fwdarw.A substitution) at an amino acid residue corresponding to amino acid 917 of the Cpf1 amino acid sequence set forth in SEQ ID NO:27. In some cases, a Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the Cpf1 amino acid sequence set forth in any of SEQ ID NOs:27-31; and comprises an amino acid substitution (e.g., an E.fwdarw.A substitution) at an amino acid residue corresponding to amino acid 1006 of the Cpf1 amino acid sequence set forth in SEQ ID NO:27. In some cases, a Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the Cpf1 amino acid sequence set forth in any of SEQ ID NOs:27-31; and comprises an amino acid substitution (e.g., a D.fwdarw.A substitution) at an amino acid residue corresponding to amino acid 1255 of the Cpf1 amino acid sequence set forth in SEQ ID NO:27.

[0455] In some cases, a suitable Cpf1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the Cpf1 amino acid sequence set forth in any of SEQ ID NOs:27-31.

[0456] In some cases a type V CRISPR/Cas endonuclease is a C2c1 protein (examples include those set forth as SEQ ID NOs:32-39 (SEQ ID NOs:1112-1119 in PCT/US2017/017255). In some cases, a C2c1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2c1 amino acid sequence set forth in any of SEQ ID NOs:32-39. In some cases, a C2c1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the C2c1 amino acid sequence set forth in any of SEQ ID NOs:32-39.

[0457] In some cases, a C2c1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCI domain of the C2c1 amino acid sequences set forth in any of SEQ ID NOs:32-39). In some cases, a C2c1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCII domain of the C2c1 amino acid sequence set forth in any of SEQ ID NOs:32-39. In some cases, a C2c1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCIII domain of the C2c1 amino acid sequence set forth in any of SEQ ID NOs:32-39. In some cases, a C2c1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCI, RuvCII, and RuvCIII domains of the C2c1 amino acid sequence set forth in any of SEQ ID NOs:32-39.

[0458] In some cases, the C2c1 protein exhibits reduced enzymatic activity relative to a wild-type C2c1 protein (e.g., relative to a C2c1 protein comprising the amino acid sequence set forth in any of SEQ ID NOs:32-39), and retains DNA binding activity. In some cases, a suitable C2c1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2c1 amino acid sequence set forth in any of SEQ ID NOs:32-39.

[0459] In some cases a type V CRISPR/Cas endonuclease is a C2c3 protein (examples include those set forth as SEQ ID NOs:40-43 (SEQ ID NOs:1120-1123 in pCT/US2017/017255). In some cases, a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2c3 amino acid sequence set forth in any of SEQ ID NOs:40-43. In some cases, a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000 aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the C2c3 amino acid sequence set forth in any of SEQ ID NOs:40-43.

[0460] In some cases, a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCI domain of the C2c3 amino acid sequence set forth in any of SEQ ID NOs:40-43. In some cases, a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCII domain of the C2c3 amino acid sequence set forth in any of SEQ ID NOs:40-43. In some cases, a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCIII domain of the C2c3 amino acid sequence set forth in any of SEQ ID NOs:40-43. In some cases, a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCI, RuvCII, and RuvCIII domains of the C2c3 amino acid sequence set forth in any of SEQ ID NOs:40-43.

[0461] In some cases, the C2c3 protein exhibits reduced enzymatic activity relative to a wild-type C2c3 protein (e.g., relative to a C2c3 protein comprising the amino acid sequence set forth in any of SEQ ID NOs:40-43), and retains DNA binding activity. In some cases, a suitable C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2c3 amino acid sequence set forth in any of SEQ ID NOs:40-43.

[0462] In some cases a type VI CRISPR/Cas endonuclease is a C2c2 protein (examples include those set forth as SEQ ID NOs:44-55 (SEQ ID NOs:1124-1135 in PCT/US2017/017255). In some cases, a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2c2 amino acid sequence set forth in any of SEQ ID NOs:44-55. In some cases, a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000 aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the C2c2 amino acid sequence set forth in any of SEQ ID NOs:44-55.

[0463] In some cases, a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCI domain of the C2c2 amino acid sequence set forth in any of SEQ ID NOs:44-55. In some cases, a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCII domain of the C2c2 amino acid sequence set forth in any of SEQ ID NOs:44-55. In some cases, a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCIII domain of the C2c2 amino acid sequence set forth in any of SEQ ID NOs:1124-1135. In some cases, a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCI, RuvCII, and RuvCIII domains of the C2c2 amino acid sequence set forth in any of SEQ ID NOs:44-55.

[0464] In some cases, the C2c2 protein exhibits reduced enzymatic activity relative to a wild-type C2c2 protein (e.g., relative to a C2c2 protein comprising the amino acid sequence set forth in any of SEQ ID NOs:44-55), and retains DNA binding activity. In some cases, a suitable C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2c2 amino acid sequence set forth in any of SEQ ID NOs:44-55.

[0465] PAM Sequence

[0466] A wild type class 2 CRISPR/Cas endonuclease (e.g., Cas9 protein) normally has nuclease activity that cleaves a target nucleic acid (e.g., a double stranded DNA (dsDNA)) at a target site defined by complementarity between the guide sequence of the CRISPR/Cas guide RNA and the target nucleic acid. In some cases, site-specific cleavage of the target nucleic acid occurs at locations determined by both (i) base-pairing complementarity between the CRISPR/Cas guide RNA and the target nucleic acid; and (ii) a short motif referred to as the protospacer adjacent motif (PAM) in the target nucleic acid. For example, when the class 2 CRISPR/Cas endonuclease is a wild type Cas9 protein, the PAM sequence that is recognized (e.g., bound) by the Cas9 protein is present on the non-complementary strand (the strand that does not hybridize with the guide sequence of the Cas9 guide RNA) of the target DNA and is adjacent to the target site.

[0467] In some cases, (e.g., in some cases where the class 2 CRISPR/Cas endonuclease is an S. pyogenes Cas9 protein) the PAM sequence of the non-complementary strand is 5′-XGG-3′, where X is any DNA nucleotide and X is immediately 3′ of the target sequence of the non-complementary strand of the target DNA. As such, the sequence of the complementary strand that hybridizes with the PAM sequence is 5′-CCY-3′, where Y is any DNA nucleotide and Y is immediately 5′ of the target sequence of the complementary strand of the target DNA. In some such embodiments, X and Y can be complementary and the X-Y base pair can be any base pair (e.g., X=C and Y=G; X=G and Y=C; X=A and Y=T, X=T and Y=A).

[0468] In some cases, it may be advantageous to use plasmids encoding different class 2 CRISPR/Cas endonucleases (e.g., Cas9 proteins from various species, type V or type VI CRISPR/Cas endonucleases, and the like) for the subject methods in order to capitalize on various characteristics (e.g., enzymatic characteristics) of the different endonucleases (e.g., for different PAM sequence preferences; for increased or decreased enzymatic activity; for an increased or decreased level of cellular toxicity; to change the balance between NHEJ, homology-directed repair, single strand breaks, double strand breaks, etc.).

[0469] Class 2 CRISPR/Cas endonucleases (e.g., Cas9 proteins) from various species can require different PAM sequences in the target DNA, and different types of Class 2 CRISPR/Cas endonucleases (e.g., type II proteins, e.g., Cas9 proteins; type V proteins; type VI proteins; and the like) can have different requirements (e.g., 5′, 3′, complementary strand, non-complementary strand, distance from target sequence, and the like) for the location of the PAM sequence relative to the targeted sequence of the target DNA. Thus, for a particular Class 2 CRISPR/Cas endonuclease of choice, the PAM sequence requirement may be different than the 5′-XGG-3′ sequence described above for the S. pyogenes Cas9 protein.

[0470] In some embodiments (e.g., when the Cas9 protein is derived from S. pyogenes or a closely related Cas9 is used), a PAM sequence can be can be 5′-NGG-3′, where N is any nucleotide (see, e.g., Chylinski et al. (2013) RNA Biol. 10(5): 726-737; Jinek et al. (2012) Science, 337(6096): 816-821; and the like). In some embodiments (e.g., when a Cas9 protein is derived from the Cas9 protein of Neisseria meningitidis or a closely related Cas9 is used), the PAM sequence can be 5′-NNNNGANN-3′, 5′-NNNNGTTN-3′, 5′-NNNNGNNT-3′, 5′-NNNNGTNN-3′, 5′-NNNGNTN-3′, or 5′-NNNNGATT-3′, where N is any nucleotide. In some embodiments (e.g., when a Cas9 protein is derived from Streptococcus thermophilus #1 or a closely related Cas9 is used), the PAM sequence can be 5′-NNAGAA-3′, 5′-NNAGGA-3′, 5′-NNGGAA-3′, 5′-NNANAA-3′, or 5′-NNGGGA-3′ where N is any nucleotide. In some embodiments (e.g., when a Cas9 protein is derived from Treponema denticola (TD) or a closely related Cas9 is used), the PAM sequence can be 5′-NAAAAN-3′, 5′-NAAAAC-3′, 5′-NAAANC-3′, 5′-NANAAC-3′, or 5′-NNAAAC-3′, where N is any nucleotide.

[0471] The PAM requirements for any given Class 2 CRISPR/Cas endonuclease can be determined using standard, routine, conventional methods, which can include experimental methods and/or in silica analysis of naturally existing sequences from species of interest. For example, as would be known by one of ordinary skill in the art, additional PAM sequences for other Class 2 CRISPR/Cas endonucleases (e.g., Cas9 proteins of different species; type IV CRISPR/Cas endonucleases, type V CRISPR/Cas endonucleases, and the like) can readily be determined using bioinformatic analysis (e.g., analysis of genomic sequencing data) (see, e.g., Mojica et al. (2009) Microbiology, 155(Pt 3): 733-740; Esvelt et al. (2013) Nat. Meth. 10(11): 1116-11121; and the like).

[0472] In addition, as known in the art, the PAM-interacting domain of a Class 2 CRISPR/Cas endonuclease (e.g., a Cas9 protein) can be derived from an endonuclease (e.g., Cas9 protein) from a first species, and the PAM sequence can correspond to that domain. Thus, in some cases, a Class 2 CRISPR/Cas endonuclease has a PAM-interacting domain that is derived from (e.g., that is from) a Class 2 CRISPR/Cas endonuclease (e.g., Cas9 protein) of a first species, and other portions of the Class 2 CRISPR/Cas endonuclease (e.g., Cas9 protein) can be derived from (e.g., can be from) a second species.

[0473] Guide RNA (for CRISPR/Cas Endonucleases)

[0474] A nucleic acid molecule that binds to a class 2 CRISPR/Cas endonuclease (e.g., a Cas9 protein; a type V or type VI CRISPR/Cas protein; a Cpf1 protein; etc.) and targets the complex to a specific location within a target nucleic acid is referred to as a “guide RNA” or “CRISPR/Cas guide nucleic acid” or “CRISPR/Cas guide RNA.”

[0475] A guide RNA provides target specificity to the complex (the RNP complex) by including a targeting segment, which includes a guide sequence (also referred to herein as a targeting sequence), which is a nucleotide sequence that is complementary to a sequence of a target nucleic acid.

[0476] A guide RNA can be referred to by the protein to which it corresponds. For example, when the class 2 CRISPR/Cas endonuclease is a Cas9 protein, the corresponding guide RNA can be referred to as a “Cas9 guide RNA.” Likewise, as another example, when the class 2 CRISPR/Cas endonuclease is a Cpf1 protein, the corresponding guide RNA can be referred to as a “Cpf1 guide RNA.”

[0477] In some embodiments, a guide RNA includes two separate nucleic acid molecules: an “activator” and a “targeter” and is referred to as a “dual guide RNA”, a “double-molecule guide RNA”, a “two-molecule guide RNA”, or a “dgRNA.” In some embodiments, the guide RNA is one molecule (e.g., for some class 2 CRISPR/Cas proteins, the corresponding guide RNA is a single molecule; and in some cases, an activator and targeter are covalently linked to one another, e.g., via intervening nucleotides), and the guide RNA is referred to as a “single guide RNA”, a “single-molecule guide RNA,” a “one-molecule guide RNA”, or simply “sgRNA.”

[0478] Cas9 Guide RNA

[0479] A nucleic acid molecule that binds to a Cas9 protein and targets the complex to a specific location within a target nucleic acid is referred to herein as a “Cas9 guide RNA. A Cas9 guide RNA (can be said to include two segments, a first segment (referred to herein as a “targeting segment”); and a second segment (referred to herein as a “protein-binding segment”). By “segment” it is meant a segment/section/region of a molecule, e.g., a contiguous stretch of nucleotides in a nucleic acid molecule. A segment can also mean a region/section of a complex such that a segment may comprise regions of more than one molecule.

[0480] The first segment (targeting segment) of a Cas9 guide RNA includes a nucleotide sequence (a guide sequence) that is complementary to (and therefore hybridizes with) a specific sequence (a target site) within a target nucleic acid (e.g., a target genomic DNA). The protein-binding segment (or “protein-binding sequence”) interacts with (binds to) a Cas9 polypeptide. The protein-binding segment of a subject Cas9 guide RNA includes two complementary stretches of nucleotides that hybridize to one another to form a double stranded RNA duplex (dsRNA duplex). Site-specific binding and/or cleavage of a target nucleic acid (e.g., genomic DNA) can occur at locations (e.g., target sequence of a target locus) determined by base-pairing complementarity between the Cas9 guide RNA (the guide sequence of the Cas9 guide RNA) and the target nucleic acid.

[0481] A Cas9 guide RNA and a Cas9 protein form a complex (e.g., bind via non-covalent interactions). The Cas9 guide RNA provides target specificity to the complex by including a targeting segment, which includes a guide sequence (a nucleotide sequence that is complementary to a sequence of a target nucleic acid). The Cas9 protein of the complex provides the site-specific activity (e.g., cleavage activity). In other words, the Cas9 protein is guided to a target nucleic acid sequence (e.g. genomic DNA) by virtue of its association with the Cas9 guide RNA.

[0482] The “guide sequence” also referred to as the “targeting sequence” of a Cas9 guide RNA can be modified so that the Cas9 guide RNA can target a Cas9 protein to any desired sequence of any desired target nucleic acid, with the exception that the protospacer adjacent motif (PAM) sequence can be taken into account. Thus, for example, a Cas9 guide RNA can have a targeting segment with a sequence (a guide sequence) that has complementarity with (e.g., can hybridize to) a sequence in a nucleic acid in a eukaryotic cell (e.g., genomic DNA).

[0483] In some embodiments, a Cas9 guide RNA includes two separate nucleic acid molecules: an “activator” and a “targeter” and is referred to herein as a “dual Cas9 guide RNA”, a “double-molecule Cas9 guide RNA”, or a “two-molecule Cas9 guide RNA” a “dual guide RNA”, or a “dgRNA.” In some embodiments, the activator and targeter are covalently linked to one another (e.g., via intervening nucleotides) and the guide RNA is referred to as a “single guide RNA”, a “Cas9 single guide RNA”, a “single-molecule Cas9 guide RNA,” or a “one-molecule Cas9 guide RNA”, or simply “sgRNA.”

[0484] A Cas9 guide RNA comprises a crRNA-like (“CRISPR RNA” I “targeter”/“crRNA”/“crRNA repeat”) molecule and a corresponding tracrRNA-like (“trans-acting CRISPR RNA”/“activator” I “tracrRNA”) molecule. A crRNA-like molecule (targeter) comprises both the targeting segment (single stranded) of the Cas9 guide RNA and a stretch (“duplex-forming segment”) of nucleotides that forms one half of the dsRNA duplex of the protein-binding segment of the Cas9 guide RNA. A corresponding tracrRNA-like molecule (activator/tracrRNA) comprises a stretch of nucleotides (duplex-forming segment) that forms the other half of the dsRNA duplex of the protein-binding segment of the guide nucleic acid. In other words, a stretch of nucleotides of a crRNA-like molecule are complementary to and hybridize with a stretch of nucleotides of a tracrRNA-like molecule to form the dsRNA duplex of the protein-binding domain of the Cas9 guide RNA. As such, each targeter molecule can be said to have a corresponding activator molecule (which has a region that hybridizes with the targeter). The targeter molecule additionally provides the targeting segment. Thus, a targeter and an activator molecule (as a corresponding pair) hybridize to form a Cas9 guide RNA. The exact sequence of a given crRNA or tracrRNA molecule is characteristic of the species in which the RNA molecules are found. A subject dual Cas9 guide RNA can include any corresponding activator and targeter pair.

[0485] The term “activator” or “activator RNA” is used herein to mean a tracrRNA-like molecule (tracrRNA: “trans-acting CRISPR RNA”) of a Cas9 dual guide RNA (and therefore of a Cas9 single guide RNA when the “activator” and the “targeter” are linked together by, e.g., intervening nucleotides). Thus, for example, a Cas9 guide RNA (dgRNA or sgRNA) comprises an activator sequence (e.g., a tracrRNA sequence). A tracr molecule (a tracrRNA) is a naturally existing molecule that hybridizes with a CRISPR RNA molecule (a crRNA) to form a Cas9 dual guide RNA. The term “activator” is used herein to encompass naturally existing tracrRNAs, but also to encompass tracrRNAs with modifications (e.g., truncations, sequence variations, base modifications, backbone modifications, linkage modifications, etc.) where the activator retains at least one function of a tracrRNA (e.g., contributes to the dsRNA duplex to which Cas9 protein binds). In some cases the activator provides one or more stem loops that can interact with Cas9 protein. An activator can be referred to as having a tracr sequence (tracrRNA sequence) and in some cases is a tracrRNA, but the term “activator” is not limited to naturally existing tracrRNAs.

[0486] The term “targeter” or “targeter RNA” is used herein to refer to a crRNA-like molecule (crRNA: “CRISPR RNA”) of a Cas9 dual guide RNA (and therefore of a Cas9 single guide RNA when the “activator” and the “targeter” are linked together, e.g., by intervening nucleotides). Thus, for example, a Cas9 guide RNA (dgRNA or sgRNA) comprises a targeting segment (which includes nucleotides that hybridize with (are complementary to) a target nucleic acid, and a duplex-forming segment (e.g., a duplex forming segment of a crRNA, which can also be referred to as a crRNA repeat). Because the sequence of a targeting segment (the segment that hybridizes with a target sequence of a target nucleic acid) of a targeter is modified by a user to hybridize with a desired target nucleic acid, the sequence of a targeter will often be a non-naturally occurring sequence. However, the duplex-forming segment of a targeter (described in more detail below), which hybridizes with the duplex-forming segment of an activator, can include a naturally existing sequence (e.g., can include the sequence of a duplex-forming segment of a naturally existing crRNA, which can also be referred to as a crRNA repeat). Thus, the term targeter is used herein to distinguish from naturally occurring crRNAs, despite the fact that part of a targeter (e.g., the duplex-forming segment) often includes a naturally occurring sequence from a crRNA. However, the term “targeter” encompasses naturally occurring crRNAs.

[0487] A Cas9 guide RNA can also be said to include 3 parts: (i) a targeting sequence (a nucleotide sequence that hybridizes with a sequence of the target nucleic acid); (ii) an activator sequence (as described above)(in some cases, referred to as a tracr sequence); and (iii) a sequence that hybridizes to at least a portion of the activator sequence to form a double stranded duplex. A targeter has (i) and (iii); while an activator has (ii).

[0488] A Cas9 guide RNA (e.g. a dual guide RNA or a single guide RNA) can be comprised of any corresponding activator and targeter pair. In some cases, the duplex forming segments can be swapped between the activator and the targeter. In other words, in some cases, the targeter includes a sequence of nucleotides from a duplex forming segment of a tracrRNA (which sequence would normally be part of an activator) while the activator includes a sequence of nucleotides from a duplex forming segment of a crRNA (which sequence would normally be part of a targeter).

[0489] As noted above, a targeter comprises both the targeting segment (single stranded) of the Cas9 guide RNA and a stretch (“duplex-forming segment”) of nucleotides that forms one half of the dsRNA duplex of the protein-binding segment of the Cas9 guide RNA. A corresponding tracrRNA-like molecule (activator) comprises a stretch of nucleotides (a duplex-forming segment) that forms the other half of the dsRNA duplex of the protein-binding segment of the Cas9 guide RNA. In other words, a stretch of nucleotides of the targeter is complementary to and hybridizes with a stretch of nucleotides of the activator to form the dsRNA duplex of the protein-binding segment of a Cas9 guide RNA. As such, each targeter can be said to have a corresponding activator (which has a region that hybridizes with the targeter). The targeter molecule additionally provides the targeting segment. Thus, a targeter and an activator (as a corresponding pair) hybridize to form a Cas9 guide RNA. The particular sequence of a given naturally existing crRNA or tracrRNA molecule is characteristic of the species in which the RNA molecules are found. Examples of suitable activator and targeter are well known in the art.

[0490] A Cas9 guide RNA (e.g. a dual guide RNA or a single guide RNA) can be comprised of any corresponding activator and targeter pair. Non-limiting examples of nucleotide sequences that can be included in a Cas9 guide RNA (dgRNA or sgRNA) include sequences set forth in SEQ ID NOs:827-1075 in PCT/US2017/017255, or complements thereof. For example, in some cases, sequences from SEQ ID NOs:827-957 in PCT/US2017/017255 (which are from tracrRNAs) or complements thereof, can pair with sequences from SEQ ID NOs:964-1075 in PCT/US2017/017255 (which are from crRNAs), or complements thereof, to form a dsRNA duplex of a protein binding segment. In some cases, the duplex-forming portion of a guide RNA suitable for use herein comprises the sequence: gttttagagctaGAAAtagcaagttaaaataagg ctagtccgttatcaactt gaaaaagtggcac cgagtcggtgcTTTTTT (SEQ ID NO:5) (SEQ ID NO:1366 in PCT/US2017/017255), or guuuuagagcuaGAAAuagcaaguuaa aauaaggcuaguccguuaucaacuugaaa aaguggcaccgagucggug cUU UUUU (SEQ ID NO:6) (SEQ ID NO:1367 in PCT/US2017/017255).

Targeting Segment of a Cas9 Guide RNA

[0491] A subject guide RNA includes a guide sequence (i.e., a targeting sequence) (a nucleotide sequence that is complementary to a sequence (a target site) in a target nucleic acid). In other words, the targeting segment of a subject guide nucleic acid can interact with a target nucleic acid (e.g., double stranded DNA (dsDNA)) in a sequence-specific manner via hybridization (i.e., base pairing). As such, the nucleotide sequence of the targeting segment may vary (depending on the target) and can determine the location within the target nucleic acid that the Cas9 guide RNA and the target nucleic acid will interact. The targeting segment of a Cas9 guide RNA can be modified (e.g., by genetic engineering)/designed to hybridize to any desired sequence (target site) within a target nucleic acid (e.g., a eukaryotic target nucleic acid such as genomic DNA).

[0492] In various embodiments, the targeting segment can have a length of 7 or more nucleotides (nt) (e.g., 8 or more, 9 or more, 10 or more, 12 or more, 15 or more, 20 or more, 25 or more, 30 or more, or 40 or more nucleotides). In some cases, the targeting segment can have a length of from 7 to 100 nucleotides (nt) (e.g., from 7 to 80 nt, from 7 to 60 nt, from 7 to 40 nt, from 7 to 30 nt, from 7 to 25 nt, from 7 to 22 nt, from 7 to 20 nt, from 7 to 18 nt, from 8 to 80 nt, from 8 to 60 nt, from 8 to 40 nt, from 8 to 30 nt, from 8 to 25 nt, from 8 to 22 nt, from 8 to 20 nt, from 8 to 18 nt, from 10 to 100 nt, from 10 to 80 nt, from 10 to 60 nt, from 10 to 40 nt, from 10 to 30 nt, from 10 to 25 nt, from 10 to 22 nt, from 10 to 20 nt, from 10 to 18 nt, from 12 to 100 nt, from 12 to 80 nt, from 12 to 60 nt, from 12 to 40 nt, from 12 to 30 nt, from 12 to 25 nt, from 12 to 22 nt, from 12 to 20 nt, from 12 to 18 nt, from 14 to 100 nt, from 14 to 80 nt, from 14 to 60 nt, from 14 to 40 nt, from 14 to 30 nt, from 14 to 25 nt, from 14 to 22 nt, from 14 to 20 nt, from 14 to 18 nt, from 16 to 100 nt, from 16 to 80 nt, from 16 to 60 nt, from 16 to 40 nt, from 16 to 30 nt, from 16 to 25 nt, from 16 to 22 nt, from 16 to 20 nt, from 16 to 18 nt, from 18 to 100 nt, from 18 to 80 nt, from 18 to 60 nt, from 18 to 40 nt, from 18 to 30 nt, from 18 to 25 nt, from 18 to 22 nt, or from 18 to 20 nt).

[0493] In various embodiments, the nucleotide sequence (the targeting sequence, the guide sequence) of the targeting segment that is complementary to a nucleotide sequence (target site) of the target nucleic acid can have a length of 10 nt or more. For example, the targeting sequence of the targeting segment that is complementary to a target site of the target nucleic acid can have a length of 12 nt or more, 15 nt or more, 17 nt or more, 18 nt or more, 19 nt or more, or 20 nt or more. In some cases, the nucleotide sequence (the targeting sequence) of the targeting segment that is complementary to a nucleotide sequence (target site) of the target nucleic acid has a length of 12 nt or more. In some cases, the nucleotide sequence (the targeting sequence) of the targeting segment that is complementary to a nucleotide sequence (target site) of the target nucleic acid has a length of 17 nt or more. In some cases, the nucleotide sequence (the targeting sequence) of the targeting segment that is complementary to a nucleotide sequence (target site) of the target nucleic acid has a length of 18 nt or more.

[0494] For example, in certain embodiments, the targeting sequence (guide sequence) of the targeting segment that is complementary to a target sequence of the target nucleic acid can have a length of from 10 to 100 nucleotides (nt) (e.g., from 10 to 90 nt, from 10 to 75 nt, from 10 to 60 nt, from 10 to 50 nt, from 10 to 35 nt, from 10 to 30 nt, from 10 to 25 nt, from 10 to 22 nt, from 10 to 20 nt, from 12 to 100 nt, from 12 to 90 nt, from 12 to 75 nt, from 12 to 60 nt, from 12 to 50 nt, from 12 to 35 nt, from 12 to 30 nt, from 12 to 25 nt, from 12 to 22 nt, from 12 to 20 nt, from 15 to 100 nt, from 15 to 90 nt, from 15 to 75 nt, from 15 to 60 nt, from 15 to 50 nt, from 15 to 35 nt, from 15 to 30 nt, from 15 to 25 nt, from 15 to 22 nt, from 15 to 20 nt, from 17 to 100 nt, from 17 to 90 nt, from 17 to 75 nt, from 17 to 60 nt, from 17 to 50 nt, from 17 to 35 nt, from 17 to 30 nt, from 17 to 25 nt, from 17 to 22 nt, from 17 to 20 nt, from 18 to 100 nt, from 18 to 90 nt, from 18 to 75 nt, from 18 to 60 nt, from 18 to 50 nt, from 18 to 35 nt, from 18 to 30 nt, from 18 to 25 nt, from 18 to 22 nt, or from 18 to 20 nt). In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 15 nt to 30 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 15 nt to 25 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 17 nt to 30 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 17 nt to 25 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 17 nt to 22 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 18 nt to 30 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 18 nt to 25 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 18 nt to 22 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target site of the target nucleic acid is 20 nucleotides in length. In some cases, the targeting sequence of the targeting segment that is complementary to a target site of the target nucleic acid is 19 nucleotides in length. In some cases, the targeting sequence of the targeting segment that is complementary to a target site of the target nucleic acid is 18 nucleotides in length. In some cases, the targeting sequence of the targeting segment that is complementary to a target site of the target nucleic acid is 17 nucleotides in length.

[0495] In various embodiments, the percent complementarity between the targeting sequence (guide sequence) of the targeting segment and the target site of the target nucleic acid can be 60% or more (e.g., 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%).

[0496] In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the seven contiguous 5′-most nucleotides of the target site of the target nucleic acid. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 60% or more over about 20 contiguous nucleotides. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the fourteen contiguous 5′-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 14 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the seven contiguous 5′-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder.

[0497] In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 7 contiguous 5′-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3′-most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 8 contiguous 5′-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3′-most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 9 contiguous 5′-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3′-most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 10 contiguous 5′-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3′-most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 17 contiguous 5′-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3′-most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 18 contiguous 5′-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3′-most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 60% or more (e.g., e.g., 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%) over 20 contiguous nucleotides. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 60% or more (e.g., e.g., 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%) over 17 contiguous nucleotides.

[0498] In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 7 contiguous 5′-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 7 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 8 contiguous 5′-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 8 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 9 contiguous 5′-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 9 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 10 contiguous 5′-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 10 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 11 contiguous 5′-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 11 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 12 contiguous 5′-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 12 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 13 contiguous 5′-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 13 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 14 contiguous 5′-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 14 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 17 contiguous 5′-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 17 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 18 contiguous 5′-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 18 nucleotides in length.

[0499] Examples of various Cas9 proteins and Cas9 guide RNAs (as well as information regarding requirements related to protospacer adjacent motif (PAM) sequences present in targeted nucleic acids) can be found in the art (see, e.g., Jinek et al., (2012) Science, 337(6096):816-821; Chylinski et al. (2013) RNA Biol. 10(5): 726-737; Ma et al., (2013) Biomed Res Int. 2013:270805; Hou et al. (2013) Proc. Natl. Acad. Sci. USA, 110(39): 15644-15649; Jinek et al. (2013) Elife, 2: e00471; Pattanayak et al. (2013) Nat. Biotechnol. 31(9): 839-843; Qi et al. (2013) Cell, 152(5): 1173-1183; Wang et al. (2013) Cell, 153(4): 910-918; Chen et al. (2013) Nucleic Acids Res. 41(20): e19; Cheng et al. (2013) Cell Res. 23(10): 1163-1171; Cho et al. (2013) Genetics, 195(3): 1177-1180; DiCarlo et al. (2013) Nucleic Acids Res. 41(7): 4336-4343; Dickinson et al. (2013) Nat. Meth. 10(10): 1028-1034; Ebina et al. (2013) Sci Rep. 3: 2510; Fujii et. al. (2013) Nucleic Acids Res. 41(20): e187; Hu et al. (2013) Cell Res. 23(11): 1322-1325; Jiang et al. (2013) Nucleic Acids Res. 41(20): e188; Larson et al. (2013) Nat. Protoc. 8(11): 2180-2196; Mali et al. (2013) Nat. Meth. 10(10): 957-963; Nakayama et al. (2013) Genesis, 51(12): 835-843; Ran et al. (2013) Nat. Protoc. 8(11): 2281-308; Ran et al. (2013) Cell, 154(6): 1380-1389; Upadhyay et al. (2013) G3 (Bethesda) 3(12): 2233-2238; Walsh et al. (2013) Proc. Natl. Acad. Sci. USA, 110(39): 15514-15515; Yang et al. (2013) Cell, 154(6): 1370-1379; Briner et al. (2014)Mol. Cell, 56(2): 333-339; and U.S. Pat. Nos. 8,906,616; 8,895,308; 8,889,418; 8,889,356; 8,871,445; 8,865,406; 8,795,965; 8,771,945; 8,697,359; 20140068797; 20140170753; 20140179006; 20140179770; 20140186843; 20140186919; 20140186958; 20140189896; 20140227787; 20140234972; 20140242664; 20140242699; 20140242700; 20140242702; 20140248702; 20140256046; 20140273037; 20140273226; 20140273230; 20140273231; 20140273232; 20140273233; 20140273234; 20140273235; 20140287938; 20140295556; 20140295557; 20140298547; 20140304853; 20140309487; 20140310828; 20140310830; 20140315985; 20140335063; 20140335620; 20140342456; 20140342457; 20140342458; 20140349400; 20140349405; 20140356867; 20140356956; 20140356958; 20140356959; 20140357523; 20140357530; 20140364333; and 20140377868; all of which are hereby incorporated by reference in their entirety.

Guide RNAs Corresponding to Type V and Type VI CRISPR/Cas Endonucleases (e.g., Cpf1 Guide RNA)

[0500] A guide RNA that binds to a type V or type VI CRISPR/Cas protein (e.g., Cpf1, C2c1, C2c2, C2c3), and targets the complex to a specific location within a target nucleic acid is referred to herein generally as a “type V or type VI CRISPR/Cas guide RNA”. An example of a more specific term is a “Cpf1 guide RNA.”

[0501] A type V or type VI CRISPR/Cas guide RNA (e.g., cpf1 guide RNA) can have a total length of from 30 nucleotides (nt) to 200 nt, e.g., from 30 nt to 180 nt, from 30 nt to 160 nt, from 30 nt to 150 nt, from 30 nt to 125 nt, from 30 nt to 100 nt, from 30 nt to 90 nt, from 30 nt to 80 nt, from 30 nt to 70 nt, from 30 nt to 60 nt, from 30 nt to 50 nt, from 50 nt to 200 nt, from 50 nt to 180 nt, from 50 nt to 160 nt, from 50 nt to 150 nt, from 50 nt to 125 nt, from 50 nt to 100 nt, from 50 nt to 90 nt, from 50 nt to 80 nt, from 50 nt to 70 nt, from 50 nt to 60 nt, from 70 nt to 200 nt, from 70 nt to 180 nt, from 70 nt to 160 nt, from 70 nt to 150 nt, from 70 nt to 125 nt, from 70 nt to 100 nt, from 70 nt to 90 nt, or from 70 nt to 80 nt). In some cases, a type V or type VI CRISPR/Cas guide RNA (e.g., cpf1 guide RNA) has a total length of at least 30 nt (e.g., at least 40 nt, at least 50 nt, at least 60 nt, at least 70 nt, at least 80 nt, at least 90 nt, at least 100 nt, or at least 120 nt).

[0502] In some cases, a Cpf1 guide RNA has a total length of 35 nt, 36 nt, 37 nt, 38 nt, 39 nt, 40 nt, 41 nt, 42 nt, 43 nt, 44 nt, 45 nt, 46 nt, 47 nt, 48 nt, 49 nt, or 50 nt.

[0503] Like a Cas9 guide RNA, a type V or type VI CRISPR/Cas guide RNA (e.g., cpf1 guide RNA) can include a target nucleic acid-binding segment and a duplex-forming region (e.g., in some cases formed from two duplex-forming segments, i.e., two stretches of nucleotides that hybridize to one another to form a duplex).

[0504] The target nucleic acid-binding segment of a type V or type VI CRISPR/Cas guide RNA (e.g., cpf1 guide RNA) can have a length of from 15 nt to 30 nt, e.g., 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, or 30 nt. In some cases, the target nucleic acid-binding segment has a length of 23 nt. In some cases, the target nucleic acid-binding segment has a length of 24 nt. In some cases, the target nucleic acid-binding segment has a length of 25 nt.

[0505] The guide sequence of a type V or type VI CRISPR/Cas guide RNA (e.g., cpf1 guide RNA) can have a length of from 15 nt to 30 nt (e.g., 15 to 25 nt, 15 to 24 nt, 15 to 23 nt, 15 to 22 nt, 15 to 21 nt, 15 to 20 nt, 15 to 19 nt, 15 to 18 nt, 17 to 30 nt, 17 to 25 nt, 17 to 24 nt, 17 to 23 nt, 17 to 22 nt, 17 to 21 nt, 17 to 20 nt, 17 to 19 nt, 17 to 18 nt, 18 to 30 nt, 18 to 25 nt, 18 to 24 nt, 18 to 23 nt, 18 to 22 nt, 18 to 21 nt, 18 to 20 nt, 18 to 19 nt, 19 to 30 nt, 19 to 25 nt, 19 to 24 nt, 19 to 23 nt, 19 to 22 nt, 19 to 21 nt, 19 to 20 nt, 20 to 30 nt, 20 to 25 nt, 20 to 24 nt, 20 to 23 nt, 20 to 22 nt, 20 to 21 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, or 30 nt). In some cases, the guide sequence has a length of 17 nt. In some cases, the guide sequence has a length of 18 nt. In some cases, the guide sequence has a length of 19 nt. In some cases, the guide sequence has a length of 20 nt. In some cases, the guide sequence has a length of 21 nt. In some cases, the guide sequence has a length of 22 nt. In some cases, the guide sequence has a length of 23 nt. In some cases, the guide sequence has a length of 24 nt.

[0506] The guide sequence of a type V or type VI CRISPR/Cas guide RNA (e.g., cpf1 guide RNA) can have 100% complementarity with a corresponding length of target nucleic acid sequence. The guide sequence can have less than 100% complementarity with a corresponding length of target nucleic acid sequence. For example, the guide sequence of a type V or type VI CRISPR/Cas guide RNA (e.g., cpf1 guide RNA) can have 1, 2, 3, 4, or 5 nucleotides that are not complementary to the target nucleic acid sequence. For example, in some cases, where a guide sequence has a length of 25 nucleotides, and the target nucleic acid sequence has a length of 25 nucleotides, in some cases, the target nucleic acid-binding segment has 100% complementarity to the target nucleic acid sequence. As another example, in some cases, where a guide sequence has a length of 25 nucleotides, and the target nucleic acid sequence has a length of 25 nucleotides, in some cases, the target nucleic acid-binding segment has 1 non-complementary nucleotide and 24 complementary nucleotides with the target nucleic acid sequence. As another example, in some cases, where a guide sequence has a length of 25 nucleotides, and the target nucleic acid sequence has a length of 25 nucleotides, in some cases, the target nucleic acid-binding segment has 2 non-complementary nucleotides and 23 complementary nucleotides with the target nucleic acid sequence.

[0507] The duplex-forming segment of a type V or type VI CRISPR/Cas guide RNA (e.g., cpf1 guide RNA) (e.g., of a targeter RNA or an activator RNA) can, in some cases, have a length of from 15 nt to 25 nt (e.g., 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, or 25 nt).

[0508] In some cases, the RNA duplex of a type V or type VI CRISPR/Cas guide RNA (e.g., cpf1 guide RNA) can have a length of from 5 base pairs (bp) to 40 bp (e.g., from 5 to 35 bp, 5 to 30 bp, 5 to 25 bp, 5 to 20 bp, 5 to 15 bp, 5-12 bp, 5-10 bp, 5-8 bp, 6 to 40 bp, 6 to 35 bp, 6 to 30 bp, 6 to 25 bp, 6 to 20 bp, 6 to 15 bp, 6 to 12 bp, 6 to 10 bp, 6 to 8 bp, 7 to 40 bp, 7 to 35 bp, 7 to 30 bp, 7 to 25 bp, 7 to 20 bp, 7 to 15 bp, 7 to 12 bp, 7 to 10 bp, 8 to 40 bp, 8 to 35 bp, 8 to 30 bp, 8 to 25 bp, 8 to 20 bp, 8 to 15 bp, 8 to 12 bp, 8 to 10 bp, 9 to 40 bp, 9 to 35 bp, 9 to 30 bp, 9 to 25 bp, 9 to 20 bp, 9 to 15 bp, 9 to 12 bp, 9 to 10 bp, 10 to 40 bp, 10 to 35 bp, 10 to 30 bp, 10 to 25 bp, 10 to 20 bp, 10 to 15 bp, or 10 to 12 bp).

[0509] As an example, a duplex-forming segment of a Cpf1 guide RNA can comprise a nucleotide sequence selected from (5′ to 3′): AAUUUCUACUGUUGUAGAU (SEQ ID NO:7), AAUUUCUGCUGUUGCAGAU (SEQ ID NO:8), AAUUUCCACUGUUGUGGAU (SEQ ID NO:9), AAUUCCUACUGUUGUAGGU (SEQ ID NO:10), AAUUUCUACUAUUGUAGAU (SEQ ID NO:11), AAUUUCUACUGCUGUAGAU (SEQ ID NO:12), AAUUUCUACUUUGUAGAU (SEQ ID NO:13), and AAUUUCUACUUGUAGAU (SEQ ID NO:14). The guide sequence can then follow (5′ to 3′) the duplex forming segment.

[0510] A non-limiting example of an activator RNA (e.g. tracrRNA) of a C2c1 guide RNA (dual guide or single guide) is an RNA that includes the nucleotide sequence GAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUG A GCUUCUCAAAAAG (SEQ ID NO:15). In some cases, a C2c1 guide RNA (dual guide or single guide) is an RNA that includes the nucleotide sequence In some cases, a C2c1 guide RNA (dual guide or single guide) is an RNA that includes the nucleotide sequence GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUG GC AAAGCCCGUUGAGCUUCUCAAAAAG (SEQ ID NO:16). In some cases, a C2c1 guide RNA (dual guide or single guide) is an RNA that includes the nucleotide sequence UCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGC A AAGCCCGUUGAGCUUCUCAAAAAG (SEQ ID NO:17). A non-limiting example of an activator RNA (e.g. tracrRNA) of a C2c1 guide RNA (dual guide or single guide) is an RNA that includes the nucleotide sequence ACUUUCCAGGCAAAGCCCGU UGAGCUUCUCAAAAAG (SEQ ID NO:18). In some cases, a duplex forming segment of a C2c1 guide RNA (dual guide or single guide) of an activator RNA (e.g. tracrRNA) includes the nucleotide sequence AGCUUCUCA (SEQ ID NO:19) or the nucleotide sequence GCUUCUCA (SEQ ID NO:20) (the duplex forming segment from a naturally existing tracrRNA.

[0511] A non-limiting example of a targeter RNA (e.g. crRNA) of a C2c1 guide RNA (dual guide or single guide) is an RNA with the nucleotide sequence CUGAGAAGUGGCACNNNNNNN (SEQ ID NO:21), where the Ns represent the guide sequence, that will vary depending on the target sequence, and although 20 Ns are depicted a range of different lengths are acceptable. In some cases, a duplex forming segment of a C2c1 guide RNA (dual guide or single guide) of a targeter RNA (e.g. crRNA) includes the nucleotide sequence CUGAGAAGUGGCAC (SEQ ID NO:22) or includes the nucleotide sequence CUGAGAAGU (SEQ ID NO:23) or includes the nucleotide sequence UGAGAAGUGGCAC (SEQ ID NO:24) or includes the nucleotide sequence UGAGAAGU (SEQ ID NO:25).

[0512] Examples and guidance related to type V or type VI CRISPR/Cas endonucleases and guide RNAs (as well as information regarding requirements related to protospacer adjacent motif (PAM) sequences present in targeted nucleic acids) can be found in the art (see, e.g., Zetsche et al. (2015) Cell, 163(3): 759-771; Makarova et al. (2015) Nat. Rev. Microbiol. 13(11): 722-736; Shmakov et al. (2015)Mol. Cell. 60(3): 385-397, and the like).

[0513] SE-Mediated Inhibitory RNA Delivery to the Brain and CNS.

[0514] It was also a surprising discovery that the synthetic exosomes described herein can be used to effectively facilitate passage of “SE encapsulated” inhibitory RNAs (e.g., siRNA, shRNA), typically as a DNA encoding the inhibitory RNA, where often such DNA comprise a vector that is capable of transcribing the inhibitory RNA, antibodies across the blood brain barrier. Illustrative inhibitory RNAs include, but are not limited to inhibitory RNAs useful for the treatment neurodegenerative diseases (e.g., Alzheimer’ disease, amyloid-related mild cognitive impairment (MCI), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), Parkinson's disease (PD), and the like).

[0515] Alzheimer's Disease.

[0516] Tau and amyloid precursor protein (APP) are key proteins in the pathogenesis of sporadic and inherited Alzheimer's disease. Thus, developing ways to inhibit production of these proteins is of great research and therapeutic interest. The selective silencing of mutant alleles, moreover, represents an attractive strategy for treating inherited dementias and other dominantly inherited disorders.

[0517] Miller et al. (2004) Nucleic Acids Res., 32(2): 661-668, describe an efficient method for producing small interfering RNA (siRNA) against essentially any targeted region of a gene. This approach was then used to develop siRNAs that display optimal allele-specific silencing against a well-characterized tau mutation (V337M) and the most widely studied APP mutation (APPsw). The allele-specific RNA duplexes identified by this method then served as templates for constructing short hairpin RNA (shRNA) plasmids that successfully silenced mutant tau or APP alleles.

[0518] Other studies have suggested the use of RNAi to inhibit c-SCR, GGA3 adaptor protein, acyl-coenzyme A cholesterol acyltransferase (ACAT-1), and/or tau can be used for the treatment of Alzheimer's disease (see, e.g., Chen et al. (2013) Drug Design Develop. & Therap., 7: 117-115).

[0519] The SEs described herein can readily be utilized to deliver these and other shRNA plasmids across the blood brain barrier for the treatment of Alzheimer's disease.

[0520] Amyotrophic Lateral Sclerosis (ALS)

[0521] Amyotrophic lateral sclerosis (ALS) is a progressive fatal, neurodegenerative disease caused by the degeneration of motor neurons. Although ALS lacks a clear genetic cause, approximately 20% of familial ALS cases are associated with mutations in the superoxide dismutase (SOD1) gene. Kubodera et al. (2010) Hum. Gene Therap., 22(1): doi.org/10.1089/hum.2010.054) developed a therapeutic strategy for ALS where they used an intravenous injection of AAV8 vector to knock down the mutant SOD1 allele using small hairpin RNA (shRNA) while simultaneously expressing functional wild-type SOD1 cDNA.

[0522] Without being bound to a particular theory, it is believed the SEs described herein can be used to deliver SOD1 inhibitory RNAs (or constructs encoding SOD1 inhibitory RNAs) for the treatment of ALS.

[0523] Huntington's Disease.

[0524] It has been demonstrated that a sole injection of cholesterol-conjugated small interfering RNA duplexes (cc-siRNA) targeting huntingtin (Htt) gene into the adult striatum of a viral transgenic mouse model of HD silences mutant Htt, attenuates neuronal pathology, and delays the unusual behavioral phenotype observed in the mouse. In a study by DiFiglia and colleagues, for example, an adeno-associated virus containing either wild-type (18 CAG) or expanded (100 CAG) Htt cDNA encoding Htt 1-400 and siRNA were injected into a mouse striata (see, e.g., DiFiglia et al. (2007) Proc. Natl. Acad. Sci. USA, 104(43): 17204-17296). It was observed that treatment of the mice that had the mutant Htt with cc-siRNA-Htt prolonged survival of striatal neurons, lowered neuropil aggregates, and diminished inclusion size. siRNA reduces the production of mutant Htt protein and silences its expression via RNA interference.

[0525] Accordingly, without being bound to a particular theory, it is believed that deliver of inhibitory RNAs (or DNAs encoding inhibitory RNAs) targeting the Htt gene can be used for the treatment of Huntington's disease. Thus, in various embodiments SEs containing Htt inhibitory RNAs are provided.

[0526] Parkinson's Disease.

[0527] Recent evidence has shown that IRAK4 is a crucial regulator in the body's innate immune response, the body's first line of defense against foreign pathogens activation of which leads to the production of pro-inflammatory cytokines.

[0528] As its abnormal function in innate immune cells is implicated in the development of chronic inflammatory and autoimmune diseases, IRAK4 inhibitors have been regarded as the next generation of anti-inflammatory treatments for autoimmune conditions, including rheumatoid arthritis, inflammatory bowel disease, psoriasis, lupus, and the like. However transport of IRAK4 inhibitors across the blood brain barrier and blood-nerve barriers would allow IRAK4 inhibitors to target neuroinflammatory diseases of the central nervous system. Such disease include, inter alia, such as Parkinson's disease, Alzheimer's disease, multiple sclerosis, amyotrophic lateral sclerosis, and diabetic peripheral neuropathy.

[0529] Inhibitory RNAs targeting IRAK4 (or DNAs encoding such inhibitory RNAs) packaged in the SEs described herein can readily cross the blood brain barrier, and it is believed such compositions can be used for the treatment of Parkinson's disease. Similarly, it is believed inhibitory RNAs targeting α-synuclein can also be used in the treatment of Huntington's disease.

[0530] Accordingly, in certain embodiments, SEs containing inhibitory RNAs or nucleic acids encoding inhibitory RNAs targeting IRAK4 or a synuclein are contemplated.

[0531] Similarly humanized monoclonal antibodies such as PRX002 directed against α-synuclein aggregates could be delivered more effectively to the brain by SE's in PD.

[0532] Niemann Pick Disease

[0533] Patients with types A and B Niemann-Pick disease (NPD) have an inherited deficiency of acid sphingomyelinase (ASM) activity. The clinical spectrum of this disorder ranges from the infantile, neurological form that results in death by 3 years of age (type A NPD) to the non-neurological form (type B NPD) that is compatible with survival into adulthood. Intermediate cases also have been reported, and the disease is best thought of as a single entity with a spectrum of phenotypes. ASM deficiency is panethnic, but appears to be more frequent in individuals of Middle Eastern and North African descent. Current estimates of the disease incidence range from approximately 0.5 to 1 per 100,000 births. However, these approximations likely under estimate the true frequency of the disorder since they are based solely on cases referred to biochemical testing laboratories for enzymatic confirmation.

[0534] The gene encoding ASM (SMPD1) has been studied extensively; it resides within an imprinted region on chromosome 11, and is preferentially expressed from the maternal chromosome. Over 100 SMPD1 mutations causing ASM-deficient NPD have been described, and some useful genotype-phenotype correlations have been made. Based on these findings, DNA-based carrier screening has been implemented in the Ashkenazi Jewish community. ASM ‘knockout’ mouse models also have been constructed and used to investigate disease pathogenesis and treatment.

[0535] Based on these studies in the mouse model, an enzyme replacement therapy clinical trial has recently begun in adult patients with non-neurological ASM-deficient NPD. In view of these findings, in certain embodiments, it is contemplated to package acid sphingomyelinase (ASM) in the synthetic exosomes described herein, for systemic, and in particular, for delivery to the central nervous system.

[0536] Preparation of Inhibitory RNAs.

[0537] In various embodiments the composition contained in the SE includes double-stranded DNA (dsDNA) that encodes for a promoter region and for siRNA, or a promoter region and short hairpin RNA (shRNA). In certain embodiments the SE includes double-stranded DNA (dsDNA) that encodes for a promoter region and for a siRNA (long or short dsRNA), or alternatively, a promoter region and short hairpin RNA (shRNA).

[0538] dsDNA which encodes for a promoter region and for siRNA sequences that are complementary to the nucleotide sequence of the target gene can be prepared using standard methods well known to those of skill in the art. For example, the siRNA nucleotide sequence can be obtained from the siRNA Selection Program, Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology, Cambridge, Mass. (//jura.wi.mit.edu) after supplying the Accession Number or GI number from the National Center for Biotechnology Information website (www.ncbi.nlm.nih.gov). The Genome Database (www.gdb.org) provides the nucleic acid sequence link which can be used as the National Center for Biotechnology Information accession number. Preparation to order of dsDNA, that encodes for the U6 promoter and for siRNA, is commercially available (Promega, Madison, Wis.). Determination of the appropriate sequences can readily be accomplished using the USPHS, NIH genetic sequence data bank. Alternatively, dsRNA containing appropriate siRNA sequences can be ascertained using the strategy of Miyagishi and Taira (2003) Nat. Biotechnol. 20: 497-500. In certain embodiments DsRNA may be up to 800 base pairs long (Diallo et al. (2003) Oligonucleotides 13(5): 381-392). In certain embodiments the dsRNA may have a hairpin structure (see, e.g., US Patent Pub. No: 2004/0058886). Determination of siRNA sequences optionally is also determined using the Promega algorithm (www.promega.com/sirnadesigner). Invitrogen provides another commercially available RNAi designer algorithm (see, e.g., //maidesigner.invitrogen.com/maiexpress/), and the like.

[0539] The foregoing inhibitory RNAs are illustrative and non-limiting. Using the teachings provided herein numerous other inhibitory RNAs, or nucleic acids (e.g., DNAs) encoding inhibitory RNAs can readily be provided and incorporated into the SEs described herein.

[0540] Similarly in various embodiments miRNA (e.g., miRNA that are small ˜22 nucleotide long non-coding RNA molecules) would be used for beneficial effects in CNS disorders such as AD.

Kits.

[0541] In certain embodiments kits for the delivery of a therapeutic moiety (e.g., sAPPα) to the brain are provided. Typically, such kit will comprise a container containing synthetic exosomes (SEs), containing the therapeutic moiety. In certain embodiments the synthetic exosomes can be provided in a unit dosage formulation (e.g., vial, tablet, caplet, patch, etc.) and/or may be optionally combined with one or more pharmaceutically acceptable excipients.

[0542] In addition, in certain embodiments, the kits optionally include labeling and/or instructional materials providing directions (i.e., protocols) for the use of the synthetic exosomes described herein. Thus, for example, the kit may contain directions for the use of the synthetic exosomes comprising a therapeutic moiety in the treatment of dementia, mild cognitive impairment, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Parkinson's disease, cerebral amyloid angiopathy, and the like as well as for Traumatic brain injury (TBI) and Stroke therapy or for treatment of a brain cancer. In various embodiments the instructional materials may also, optionally, teach preferred dosages/therapeutic regiment, counter indications and the like.

[0543] While the instructional materials typically comprise written or printed materials they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this invention. Such media include, but are not limited to electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. Such media may include addresses to internet sites that provide such instructional materials.

[0544] invention.

EXAMPLES

[0545] The following examples are offered to illustrate, but not to limit the claimed

Example 1

Encapsulation of a Hydrophobic Small Molecule

[0546] For encapsulation of a hydrophobic small molecule we used a lipid mixture of 2:2:1 (DTPG:DDPA:CH) with a Span-80 concentration of 5% w/w and obtained a zeta potential of around −15 mV. The particle size and flow rate ratio relationship is shown in FIG. 11.

[0547] In general, the faster the aqueous flow rate in relationship with the organic stream the smaller the particle size of the SE

Example 2

Encapsulation of a Protein

[0548] For encapsulation of a protein with molecular weight of 80JDa we used a lipid mixture of 2:2:1 (DHPG:DHPC:CH) with Span-80 concentration of 10% w/w and obtained a zeta potential of around +5 mV. The particle size and flow rate ratio relationship is shown in FIG. 12. The brighter green is a FRR=100, darker green FRR=80, red FRR=25 and blue FRR=20. In general, the faster the aqueous flow rate in relationship with the organic stream the smaller the particle size of the SE.

Example 3

Encapsulation of Cas9 and/or IDUA

[0549] Table 7, below illustrates the synthetic exosome characteristics for microfluidic-synthesized synthetic exosomes encapsulating IDUA or Cas9.

TABLE-US-00007 TABLE 7 Synthetic exosome (SE) characteristics for SEs encapuslting IDUA or Cas9. Shown are diameter (Φ), zeta potential (ξ), and encapsulation efficiency (ee). Avg Φ Std. ξ (mV) ee Sample ID (nm) Dev. estimated (%) SE(ξ+)-IDUA 110 20 42 3 SE(ξ−)-IDUA 107 6 −40 8 SE(ξ+)-Cas9 81 6 46 25 SE(ξ−)-Cas9 110 8 −36 15

[0550] Without being bound to a particular theory, the difference in the encapsulation efficiency between IDUA and Cas9 is believed to be due to the stability of the enzymes in aqueous solution.

[0551] FIG. 5 shows that SE-IDUA (−) particles show ˜10 fold increase in brain 10 levels of IDUA compared to Free IDUA, while Table 8 shows the ratio of brain to plasma IDUA and % IDUA in brain.

TABLE-US-00008 TABLE 8 Ratio of brain to plasma IDUA and % IDUA in brain. % IDUA Sample ID Brain:Plasma Sample ID in Brain SE(ξ−)-IDUA 1:8  SE(ξ−)-IDUA 1.9 SE(ξ+)-IDUA 1:30 SE(ξ+)-IDUA 0.8 Free IDUA  1:120 Free IDUA 0.2

[0552] Table 9 illustrates SE-Cas-9 characterization and IV brain levels.

TABLE-US-00009 TABLE 9 Synthetic exosome (SE) characterization and brain levels. Avg Φ Ee Cas9 % (nm) ξ (mV) (%) (ng) brain Se-Cas9(−) 110 −36 >15 416 4.2 Se-Cas9(+) 81 46 >15 330 3.3

[0553] FIG. 6 shows that SE-Cas9(−) has greater brain permeability than SE-Cas9 (+) particles.

[0554] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent 5 applications cited herein are hereby incorporated by reference in their entirety for all purposes.

TABLE-US-00010 SEQUENCE LISTING S. pyrogenes Cas9 Sequence ID NO: 26         10         20         30         40         50 MDKKYSIGLD IGINSVGWAV ITDEYKVPSK KFKVLGNTDR HSIKKNLIGA         60         70         80         90        100 LLFDSGETAE ATRLKRTARR RYTRRKNRIC YLQEIFSNEM AKVDDSFFHR        110        120        130        140        150 LEESFLVEED KKHERHPIFG NIVDEVAYHE KYPTIYHLRK KLVDSTDKAD        160        170        180        190        200 LRLIYLALAH MIKFRGHFLI EGDLNPDNSD VDKLFIQLVQ TYNQLFEENP        210        220        230        240        250 INASGVDAKA ILSARLSKSR RLENLIAQLP GEKKNGLFGN LIALSLGLTP        260        270        280        290        300 NFKSNFDLAE DAKLQLSKDT YDDDLDNLLA QIGDQYADLF LAAKNLSDAI        310        320        330        340        350 LLSDILRVNT EITKAPLSAS MIKRYDEHHQ DLTLLKALVR QQLPEKYKEI        360        370        380        390        400 FFDQSKNGYA GYIDGGASQE EFYKFIKPIL EKMDGTEELL VKLNREDLLR        410        420        430        440        450 KORTFDNGSI PHQIHLGELH AILRRQEDFY PFLKDNREKI EKILTFRIPY        460        470        480        490        500 YVGPLARGNS RFAWMTRKSE ETITPWNFEE VVDKGASAQS FIERMTNFDK        510        520        530        540        550 NLPNEKVLPK HSLLYEYFTV YNELTKVKYV TEGMRKPAFL SGEQKKAIVD        560        570        580        590        600 LLFKTNRKVT VKQLKEDYFK KIECFDSVEI SGVEDRENAS LGTYHDLLKI        610        620        630        640        650 IKDKDFLDNE ENEDILEDIV LTLTLFEDRE MIEERLKTYA HLFDDKVMKQ        660        670        680        690        700 LKRRRYTGWG RLSRKLINGI RDKQSGKTIL DFLKSDGFAN RNFMQLIHDD        710        720        730        740        750 SLTFKEDIQK AQVSGOGDSL HEHIANLAGS PAIKKGILQT VKVVDELVKV        760        770        780        790        800 MGRHKPENIV IEMARENQTT QKGQKNSRER MKRIEEGIKE LGSQILKEHP        810        820        830        840        850 VENTQLQNEK LYLYYLONGR DMYVDQELDI NRLSDYDVDH IVPQSFLKDD        860        870        880        890        900 SIDNKVLTRS DKNRGKSDNV PSEEVVKKMK NYWRQLLNAK LITQRKFDNL        910        920        930        940        950 TKAERGGLSE LDKAGFIKRQ LVETROITKH VAQILDSRMN TKYDENDKLI        960        970        980        990       1000 REVKVITLKS KLVSDFRKDF QFYKVREINN YHHAHDAYLN AVVGTALIKK       1010       1020       1030       1040       1050 YPKLESEFVY GDYKVYDVRK MIAKSEQEIG KATAKYFFYS NIMNFFKTEI       1060       1070       1080       1090       1100 TLANGEIRKR PLIEINGETG EIVWDKGRDF ATVRKVLSMP QVNIVKKTEV       1110       1120       1130       1140       1150 QTGGFSKESI LPKRNSDKLI ARKKDWDPKK YGGFDSPTVA YSVLVVAKVE       1160       1170       1180       1190       1200 KGKSKKLKSV KELLGITIME RSSFEKNPID FLEAKGYKEV KKDLIIKLPK       1210       1220       1230       1240       1250 YSLFELENGR KRMLASAGEL QKGNELALPS KYVNFLYLAS HYEKLKGSPE       1260       1270       1280       1290       1300 DNEQKOLFVE QHKHYLDEII EQISEFSKRV ILADANLDKV LSAYNKHRDK       1310       1320       1330       1340       1350 PIREQAENII HLFTLINLGA PAAFKYFDTT IDRKRYTSTK EVLDATLIHQ       1360 SITGLYETRI DLSQLGGD (1088 in PCT/US2017/017255) Francisella tularensis SEQ ID NO: 27 MSIYQEFVNK YSLSKTLRFE LIPQGKTLEN IKARGLILDD EKRAKDYKKA KQIIDKYHQF 60 FIEEILSSVC ISEDLLONYS DVYFKLKKSD DDNLQKDFKS AKDTIKKQIS EYIKDSEKFK 120 NLFNQNLIDA KKGQESDLIL WLKQSKDNGI ELFKANSDIT DIDEALEIIK SFKGWTTYFK 180 GFHENRKNVY SSNDIPTSII YRIVDDNLPK FLENKAKYES LKDKAPEAIN YEQIKKDLAE 240 ELTFDIDYKT SEVNQRVFSL DEVFEIANFN NYLNQSGITK FNTIIGGKFV NGENTKRKGI 300 NEYINLYSQQ INDKTLKKYK MSVLFKQILS DTESKSFVID KLEDDSDVVT TMQSFYEQIA 360 AFKTVEEKSI KETLSLLFDD LKAQKLDLSK IYFKNDKSLT DLSQQVFDDY SVIGTAVLEY 420 ITQQIAPKNL DNPSKKEQEL IAKKTEKAKY LSLETIKLAL EEFNKHRDID KQCRFEEILA 480 NFAAIPMIFD EIAQNKDNLA QISIKYQNQG KKDLLQASAE DDVKAIKDLL DQTNNLLHKL 540 KIFHISQSED KANILDKDEH FYLVFEECYF ELANIVPLYN KIRNYITQKP YSDEKFKLNF 600 ENSTLANGWD KNKEPDNTAI LFIKDDKYYL GVMNKKNNKI FDDKAIKENK GEGYKKIVYK 660 LLPGANKMLP KVFFSAKSIK FYNPSEDILR IRNHSTHTKN GSPQKGYEKF EFNIEDCRKF 720 IDFYKQSISK HPEWKDFGFR FSDTQRYNSI DEFYREVENQ GYKLTFENIS ESYIDSVVNQ 780 GKLYLFQIYN KDFSAYSKGR PNLHTLYWKA LFDERNLQDV VYKLNGEAEL FYRKQSIPKK 840 ITHPAKEAIA NKNKDNPKKE SVFEYDLIKD KRFTEDKFFF HCPITINFKS SGANKENDEI 900 NLLLKEKAND VHILSIDRGE RHLAYYTLVD GKGNIIKQDT FNIIGNDRMK TNYHDKLAAI 960 EKDRDSARKD WKKINNIKEM KEGYLSQVVH EIAKLVIEYN AIVVFEDLNF GFKRGRFKVE 1020 KOVYQKLEKM LIEKLNYLVF KDNEFDKTGG VLRAYQLTAP FETFKKMGKQ TGIIYYVPAG 1080 FTSKICPVTG FVNQLYPKYE SVSKSQEFFS KFDKICYNLD KGYFEFSFDY KNFGDKAAKG 1140 KWTIASFGSR LINFRNSDKN HNWDTREVYP TKELEKLLKD YSIEYGHGEC IKAAICGESD 1200 KKFFAKLTSV LNTILQMRNS KTGTELDYLI SPVADVNGNF FDSRQAPKNM PQDADANGAY 1260 HIGLKGLMLL GRIKNNQEGK KLNLVIKNEE YFEFVONRNN 1300 (1089 in PCT/US2017/017255) SEQ ID NO: 28 MTQFEGFTNL YQVSKTLRFE LIPQGKTLKH IQEQGFIEED KARNDHYKEL KPIIDRIYKT 60 YADQCLQLVQ LDWENLSAAI DSYRKEKTEE TRNALIEEQA TYRNAIHDYF IGRTDNLTDA 120 INKRHAEIYK GLFKAELFNG KVLKQLGTVT TTEHENALLR SFDKFTTYFS GFYENRKNVF 180 SAEDISTAIP HRIVQDNFPK FKENCHIFTR LITAVPSLRE HFENVKKAIG IFVSTSIEEV 240 FSFPFYNOLL TQTQIDLYNQ LLGGISREAG TEKIKGLNEV LNLAIQKNDE TAHIIASLPH 300 RFIPLFKQIL SDRNTLSFIL EEFKSDEEVI QSFCKYKTLL RNENVLETAE ALFNELNSID 360 LTHIFISHKK LETISSALCD HWDTLRNALY ERRISELTGK ITKSAKEKVQ RSLKHEDINL 420 QEIISAAGKE LSEAFKQKTS EILSHAHAAL DOPLPTTLKK QEEKEILKSQ LDSLLGLYHL 480 LDWFAVDESN EVDPEFSARL TGIKLEMEPS LSFYNKARNY ATKKPYSVEK FKLNFQMPTL 540 ASGWDVNKEK NNGAILFVKN GLYYLGIMPK QKGRYKALSF EPTEKTSEGF DKMYYDYFPD 600 AAKMIPKCST QLKAVTAHFQ THTTPILLSN NFIEPLEITK EIYDLNNPEK EPKKFQTAYA 660 KKTGDQKGYR EALCKWIDFT RDFLSKYTKT TSIDLSSLRP SSQYKDLGEY YAELNPLLYH 720 ISFQRIAEKE IMDAVETGKL YLFQIYNKDF AKGHHGKPNL HTLYWTGLFS PENLAKTSIK 780 LNGQAELFYR PKSRMKRMAH RLGEKMLNKK LKDQKTPIPD TLYQELYDYV NHRLSHDLSD 840 EARALLPNVI TKEVSHEIIK DRRFTSDKFF FHVPITLNYQ AANSPSKFNQ RVNAYLKEHP 900 ETPIIGIDRG ERNLIYITVI DSTGKILEQR SLNTIQQFDY QKKLDNREKE RVAARQAWSV 960 VGTIKDLKQG YLSQVIHEIV DLMIHYQAVV VLENLNFGFK SKRTGIAEKA VYQQFEKMLI 1020 DKLNCLVLKD YPAEKVGGVL NPYQLTDQFT SFAKMGTQSG FLFYVPAPYT SKIDPLTGFV 1080 DPFVWKTIKN HESRKHFLEG FDFLHYDVKT GDFILHFKMN RNLSFQRGLP GFMPAWDIVF 1140 EKNETQFDAK GTPFIAGKRI VPVIENHRFT GRYRDLYPAN ELIALLEEKG IVFRDGSNIL 1200 PKLLENDDSH AIDTMVALIR SVLQMRNSNA ATGEDYINSP VRDLNGVCFD SRFQNPEWPM 1260 DADANGAYHI ALKGQLLLNH LKESKDLKLQ NGISNQDWLA YIQELRN 1307 (1090 in PCT/US2017/017255) SEQ ID NO: 29 MLKNVGIDRL DVEKGRKNMS KLEKFTNCYS LSKTLRFKAI PVGKTQENID NKRLLVEDEK 60 RAEDYKGVKK LLDRYYLSFI NDVLHSIKLK NLNNYISLFR KKTRTEKENK ELENLEINLR 120 KEIAKAFKGN EGYKSLFKKD IIETILPEFL DDKDEIALVN SFNGFTTAFT GFFDNRENMF 180 SEEAKSTSIA FRCINENLTR YISNMDIFEK VDAIFDKHEV QEIKEKILNS DYDVEDFFEG 240 EFFNFVLTQE GIDVYNAIIG GFVTESGEKI KGLNEYINLY NOKTKQKLPK FKPLYKQVLS 300 DRESLSFYGE GYTSDEEVLE VFRNTLNKNS EIFSSIKKLE KLFKNFDEYS SAGIFVKNGP 360 AISTISKDIF GEWNVIRDKW NAEYDDIHLK KKAVVTEKYE DDRRKSFKKI GSFSLEQLQE 420 YADADLSVVE KLKEIIIQKV DEIYKVYGSS EKLFDADFVL EKSLKKNDAV VAIMKDLLDS 480 VKSFENYIKA FFGEGKETNR DESFYGDFVL AYDILLKVDH IYDAIRNYVT QKPYSKDKFK 540 LYFQNPQFMG GWDKDKETDY RATILRYGSK YYLAIMDKKY AKCLQKIDKD DVNGNYEKIN 600 YKLLPGPNKM LPKVFFSKKW MAYYNPSEDI QKIYKNGTFK KGDMFNLNDC HKLIDFFKDS 660 ISRYPKWSNA YDFNFSETEK YKDIAGFYRE VEEQGYKVSF ESASKKEVDK LVEEGKLYMF 720 QIYNKDFSDK SHGTPNLHTM YFKLLFDENN HGQIRLSGGA ELFMRRASLK KEELVVHPAN 780 SPIANKNPDN PKKTTTLSYD VYKDKRFSED QYELHIPIAI NKCPKNIFKI NTEVRVLLKH 840 DDNPYVIGID RGERNLLYIV VVDGKGNIVE QYSLNEIINN FNGIRIKTDY HSLLDKKEKE 900 RFEARQNWTS IENIKELKAG YISQVVHKIC ELVEKYDAVI ALEDLNSGFK NSRVKVEKQV 960 YQKFEKMLID KLNYMVDKKS NPCATGGALK GYQITNKFES FKSMSTQNGF IFYIPAWLTS 1020 KIDPSTGFVN LLKTKYTSIA DSKKFISSFD RIMYVPEEDL FEFALDYKNF SRTDADYIKK 1080 WKLYSYGNRI RIFRNPKKNN VFDWEEVCLT SAYKELFNKY GINYQQGDIR ALLCEQSDKA 1140 FYSSFMALMS LMLQMRNSIT GRTDVDFLIS PVKNSDGIFY DSRNYEAQEN AILPKNADAN 1200 GAYNIARKVL WAIGQFKKAE DEKLDKVKIA ISNKEWLEYA QTSVKH 1246 (1091 in PCT/US2017/017255) Porphyromonas macacae SEQ ID NO: 30 MKTQHFFEDF TSLYSLSKTI RFELKPIGKT LENIKKNGLI RRDEQRLDDY EKLKKVIDEY 60 HEDFIANILS SFSFSEEILQ SYIQNLSESE ARAKIEKTMR DTLAKAFSED ERYKSIFKKE 120 LVKKDIPVWC PAYKSLCKKF DNFTTSLVPF HENRKNLYTS NEITASIPYR IVHVNLPKFI 180 QNIEALCELQ KKMGADLYLE MMENLRNVWP SFVKTPDDLC NLKTYNHLMV QSSISEYNRF 240 VGGYSTEDGT KHQGINEWIN IYRORNKEMR LPGLVFLHKQ ILAKVDSSSF ISDTLENDDQ 300 VFCVLRQFRK LFWNTVSSKE DDAASLKDLF CGLSGYDPEA IYVSDAHLAT ISKNIFDRWN 360 YISDAIRRKT EVLMPRKKES VERYAEKISK QIKKRQSYSL AELDDLLAHY SEESLPAGFS 420 LLSYFTSLGG QKYLVSDGEV ILYEEGSNIW DEVLIAFRDL QVILDKDFTE KKLGKDEEAV 480 SVIKKALDSA LRLRKFFDLL SGTGAEIRRD SSFYALYTDR MDKLKGLLKM YDKVRNYLTK 540 KPYSIEKFKL HFDNPSLLSG WDKNKELNNL SVIFRONGYY YLGIMTPKGK NLFKTLPKLG 600 AEEMFYEKME YKQIAEPMLM LPKVFFPKKT KPAFAPDOSV VDIYNKKTFK TGQKGFNKKD 660 LYRLIDFYKE ALTVHEWKLF NFSFSPTEQY RNIGEFFDEV REQAYKVSMV NVPASYIDEA 720 VENGKLYLFQ IYNKDFSPYS KGIPNLHTLY WKALFSEQNQ SRVYKLCGGG ELFYRKASLH 780 MQDTTVHPKG ISIHKKNLNK KGETSLFNYD LVKDKRFTED KFFFHVPISI NYKNKKITNV 840 NOMVRDYIAQ NDDLQIIGID RGERNLLYIS RIDTRGNLLE QFSLNVIESD KGDLRTDYQK 900 ILGDREQERL RRRQEWKSIE SIKDLKDGYM SQVVHKICNM VVEHKAIVVL ENLNLSFMKG 960 RKKVEKSVYE KFERMLVDKL NYLVVDKKNL SNEPGGLYAA YQLTNPLFSF EELHRYPQSG 1020 ILFFVDPWNT SLTDPSTGFV NLLGRINYTN VGDARKFFDR FNAIRYDGKG NILFDLDLSR 1080 FDVRVETQRK LWTLTTFGSR IAKSKKSGKW MVERIENLSL CFLELFEQFN IGYRVEKDLK 1140 KAILSQDRKE FYVRLIYLEN LMMQIRNSDG EEDYILSPAL NEKNLQFDSR LIEAKDLPVD 1200 ADANGAYNVA RKGLMVVQRI KRGDHESIHR IGRAQWLRYV QEGIVE 1246 (1092 in PCT/US2017/017255) Prevotella disiens SEQ ID NO: 31 MKVMENYQEF TNLFQLNKTL RFELKPIGKT CELLEEGKIF ASGSFLEKDK VRADNVSYVK 60 KEIDKKHKIF IEETLSSFSI SNDLLKQYFD CYNELKAFKK DCKSDEEEVK KTALRNKCTS 120 IQRAMREAIS QAFLKSPQKK LLAIKNLIEN VFKADENVQH FSEFTSYFSG FETNRENFYS 180 DEEKSTSIAY RLVHDNLPIF IKNIYIFEKL KEQFDAKTLS EIFENYKLYV AGSSLDEVFS 240 LEYFNNTLTQ KGIDNYNAVI GKIVKEDKOE IQGLNEHINL YNQKHKDRRL PFFISLKKQI 300 LSDREALSWL PDMFKNDSEV IKALKGFYIE DGFENNVLTP LATLLSSLDK YNLNGIFIRN 360 NEALSSLSQN VYRNFSIDEA IDANAELQTF NNYELIANAL RAKIKKETKO GRKSFEKYEE 420 YIDKKVKAID SLSIQEINEL VENYVSEFNS NSGNMPRKVE DYFSLMRKGD FGSNDLIENI 480 KTKLSAAEKL LGTKYQETAK DIFKKDENSK LIKELLDATK QFOHFIKPLL GTGEEADRDL 540 VFYGDFLPLY EKFEELTLLY NKVRNRLTQK PYSKDKIRLC FNKPKLMTGW VDSKTEKSDN 600 GTQYGGYLFR KKNEIGEYDY FLGISSKAQL FRKNEAVIGD YERLDYYQPK ANTIYGSAYE 660 GENSYKEDKK RLNKVIIAYI EQIKQTNIKK SIIESISKYP NISDDDKVTP SSLLEKIKKV 720 SIDSYNGILS FKSFQSVNKE VIDNLLKTIS PLKNKAEFLD LINKDYQIFT EVQAVIDEIC 780 KOKTFIYFPI SNVELEKEMG DKDKPLCLFQ ISNKDLSFAK TFSANLRKKR GAENLHTMLF 840 KALMEGNODN LDLGSGAIFY RAKSLDGNKP THPANEAIKC RNVANKDKVS LFTYDIYKNR 900 RYMENKFLFH LSIVQNYKAA NDSAQLNSSA TEYIRKADDL HIIGIDRGER NLLYYSVIDM 960 KGNIVEQDSL NIIRNNDLET DYHDLLDKRE KERKANRONW EAVEGIKDLK KGYLSQAVHQ 1020 IAQLMLKYNA IIALEDLGOM FVTRGQKIEK AVYQQFEKSL VDKLSYLVDK KRPYNELGGI 1080 LKAYQLASSI TKNNSDKQNG FLFYVPAWNT SKIDPVTGFT DLLRPKAMTI KEAQDFFGAF 1140 DNISYNDKGY FEFETNYDKF KIRMKSAQTR WTICTFGNRI KRKKDKNYWN YEEVELTEEF 1200 KKLFKDSNID YENCNLKEEI QNKDNRKFFD DLIKLLQLTL QMRNSDDKGN DYIISPVANA 1260 EGQFFDSRNG DKKLPLDADA NGAYNIARKG LWNIRQIKQT KNDKKLNLSI SSTEWLDFVR 1320 EKPYLK 1326 (1112 in PCT/US2017/017255) Alicyclobacillus acidoterrestris SEQ ID NO: 32 MAVKSIKVKL RLDDMPEIRA GLWKLHKEVN AGVRYYTEWL SLLRQENLYR RSPNGDGEQE 60 CDKTAEECKA ELLERLRARQ VENGHRGPAG SDDELLQLAR QLYELLVPQA IGAKGDAQQI 120 ARKFLSPLAD KDAVGGLGIA KAGNKPRWVR MREAGEPGWE EEKEKAETRK SADRTADVLR 180 ALADFGLKPL MRVYTDSEMS SVEWKPLRKG QAVRTWDRDM FQQAIERMMS WESWNQRVGQ 240 EYAKLVEQKN RFEQKNFVGQ EHLVHLVNQL QQDMKEASPG LESKEQTAHY VTGRALRGSD 300 KVFEKWGKLA PDAPFDLYDA EIKNVORRNT RRFGSHDLFA KLAEPEYQAL WREDASFLTR 360 YAVYNSILRK LNHAKMFATF TLPDATAHPI WTRFDKLGGN LHQYTFLFNE FGERRHAIRF 420 HKLLKVENGV AREVDDVTVP ISMSEQLDNL LPRDPNEPIA LYFRDYGAEQ HFTGEFGGAK 480 IQCRRDQLAH MHRRRGARDV YLNVSVRVQS QSEARGERRP PYAAVFRLVG DNHRAFVHFD 540 KLSDYLAEHP DDGKLGSEGL LSGLRVMSVD LGLRTSASIS VFRVARKDEL KPNSKGRVPF 600 FFPIKGNDNL VAVHERSQLL KLPGETESKD LRAIREERQR TLRQLRTQLA YLRLLVRCGS 660 EDVGRRERSW AKLIEQPVDA ANHMTPDWRE AFENELQKLK SLHGICSDKE WMDAVYESVR 720 RVWRHMGKQV RDWRKDVRSG ERPKIRGYAK DVVGGNSIEQ IEYLERQYKF LKSWSFFGKV 780 SGQVIRAEKG SRFAITLREH IDHAKEDRLK KLADRIIMEA LGYVYALDER GKGKWVAKYP 840 PCQLILLEEL SEYQFNNDRP PSENNQLMQW SHRGVFQELI NQAQVHDLLV GTMYAAFSSR 900 FDARTGAPGI RCRRVPARCT QEHNPEPFPW WLNKFVVEHT LDACPLRADD LIPTGEGEIF 960 VSPFSAEEGD FHQIHADLNA AQNLQQRLWS DFDISQIRLR CDWGEVDGEL VLIPRLTGKR 1020 TADSYSNKVF YTNTGVTYYE RERGKKRRKV FAQEKLSEEE AELLVEADEA REKSVVLMRD 1080 PSGIINRGNW TRQKEFWSMV NORIEGYLVK QIRSRVPLQD SACENTGDI 1129 (1113 in PCT/US2017/017255) Alicyclobacillus contaminans SEQ ID NO: 33 MGFNTAELLR KVEEEMRKTS VGFDTDNPFA HRITRRAIRG WDRIAEAWRR LPPDAPESEY 60 IEAFKDIQRK NPRKIGSEPL FKNLAAPGVR SELLNNPQVL ITFAKYNELQ RQLAKAKQFA 120 QKTLPHPVFH PVWVRYDKLG GNLHHYQIEP AVHANDTHKV KFSSLLLPQE DGSYAEVKDV 180 TVSLAPSLOF PTGLVHPKVT TPPRTGLVTV MDEEAGKPVV CYRDRGHDAL VPVAFGGAKL 240 QFNRAHLSAG YRKGVLSAGG GGSIYFNVTL DVQVPNERDV SKTFSFSRDR DLVSLKAEEL 300 KRYMETKPLG MPGVRVMSVD LGVRYGAAIS VFEVKPFAEV RKDKLHYPIT GCEGFVAEHE 360 RSVILKLPGE GVRTAGKQSE RKQALAAIRA EMSILRKWLR VSQVTEEDRA KAVRGLLEDE 420 RGGGWTMDPG EDSDHOPLQQ FLHEARLAVG ELVNLVHLSP AEWERAVIER HRRLERITAS 480 HIRVFQTMRK VWGKRRNEDA AHTGGISLAH IEHLIQQRKL FIRWSTHART YGEVRRLPKH 540 EGFAKRLQKH TNHVKEDRIK KLADMIVMAA RGYRFLDKRA RWVKTRHAPC DLILFEDLSR 600 YRFTMDRPPT ENSQLMNWSH RELLKTVKMQ AALFGIGVGT VPAAFTSRFD AQTGAPGLRC 660 KRVTKQDKEK TPFWLIQFAE ITGVNVTNVE PGQLIPVDGG EWFVSPKGPR AADGLKCVHA 720 DINAAHNLQR RFWIPRLPSV KCRRYVEAEG FAAVPSSTAF MKVHGKGAFV SVDGEFYEYQ 780 KGRRVAVNRA DRTSSTLDED EGDIGEEMLV SSNGAGEFVR MFYDESGYVG YGRWMDSKVF 840 WGKVRQIVHR AIQDQVEKRA AARGENGATS SR 872 (1114 in PCT/US2017/017255) Desulfovibrio inopinatus SEQ ID NO: 34 MPTRTINLKL VLGKNPENAT LRRALFSTHR LVNQATKRIE EFLLLCRGEA YRTVDNEGKE 60 AEIPRHAVQE EALAFAKAAQ RHNGCISTYE DQEILDVLRQ LYERLVPSVN ENNEAGDAçA 120 ANAWVSPLMS AESEGGLSVY DKVLDPPPVW MKLKEEKAPG WEAASQIWIQ SDEGQSLLNK 180 PGSPPRWIRK LRSGQPWQDD FVSDQKKKQD ELTKGNAPLI KOLKEMGLLP LVNPFFRHLL 240 DPEGKGVSPW DRLAVRAAVA HFISWESWNH RTRAEYNSLK LRRDEFEAAS DEFKDDFTLL 300 RQYEAKRHST LKSIALADDS NPYRIGVRSL RAWNRVREEW IDKGATEEQR VTILSKLQTQ 360 LRGKFGDPDL FNWLAQDRHV HLWSPRDSVT PLVRINAVDK VLRRRKPYAL MTFAHPRFHP 420 RWILYEAPGG SNLROYALDC TENALHITLP LLVDDAHGTW IEKKIRVPLA PSGQIQDLTL 480 EKLEKKKNRL YYRSGFQQFA GLAGGAEVLF HRPYMEHDER SEESLLERPG AVWFKLTLDV 540 ATQAPPNWLD GKGRVRTPPE VHHFKTALSN KSKHTRTLQP GLRVLSVDLG MRTFASCSVF 600 ELIEGKPETG RAFPVADERS MDSPNKLWAK HERSFKLTLP GETPSRKEEE ERSIARAEIY 660 ALKRDIQRLK SLLRLGEEDN DNRRDALLEQ FFKGWGEEDV VPGQAFPRSL FOGLGAAPFR 720 STPELWROHC QTYYDKAEAC LAKHISDWRK RTRPRPTSRE MWYKTRSYHG GKSIWMLEYL 780 DAVRKLLLSW SLRGRTYGAI NRODTARFGS LASRLLHHIN SLKEDRIKTG ADSIVQAARG 840 YIPLPHGKGW EQRYEPCQLI LFEDLARYRF RVDRPRRENS QLMQWNHRAI VAETTMQAEL 900 YGQIVENTAA GFSSRFHAAT GAPGVRCRFL LERDFDNDLP KPYLLRELSW MLGNTKVESE 960 EEKLRLLSEK IRPGSLVPWD GGEQFATLHP KRQTLCVIHA DMNAAQNLQR RFFGRCGEAF 1020 RLVCQPHGDD VLRLASTPGA RLLGALQQLE NGQGAFELVR DMGSTSQMNR FVMKSLGKKK 1080 IKPLQDNNGD DELEDVLSVL PEEDDTGRIT VFRDSSGIFF PCNVWIPAKQ FWPAVRAMIW 1140 KVMASHSLG 1149 (1115 in PCT/US2017/017255) Desulfonatronum thiodismutans SEQ ID NO: 35 MVLGRKDDTA ELRRALWTTH EHVNLAVAEV ERVLLRCRGR SYWTLDRRGD PVHVPESQVA 60 EDALAMAREA QRRNGWPVVG EDEEILLALR YLYEQIVPSC LLDDLGKPLK GDAQKIGTNY 120 AGPLFDSDTC RRDEGKDVAC CGPFHEVAGK YLGALPEWAT PISKQEFDGK DASHLRFKAT 180 GGDDAFFRVS IEKANAWYED PANQDALKNK AYNKDDWKKE KDKGISSWAV KYIQKQLQLG 240 QDPRTEVRRK LWLELGLLPL FIPVFDKTMV GNLWNRLAVR LALAHLLSWE SWNHRAVQDQ 300 ALARAKRDEL AALFLGMEDG FAGLREYELR RNESIKQHAF EPVDRPYVVS GRALRSWTRV 360 REEWLRHGDT QESRKNICNR LQDRLRGKFG DPDVFHWLAE DGQEALWKER DCVTSFSLLN 420 DADGLLEKRK GYALMTFADA RLHPRWAMYE APGGSNLRTY QIRKTENGLW ADVVLLSPRN 480 ESAAVEEKTF NVRLAPSGOL SNVSFDQIQK GSKMVGRCRY QSANQQFEGL LGGAEILFDR 540 KRIANEQHGA TDLASKPGHV WFKLTLDVRP QAPQGWLDGK GRPALPPEAK HFKTALSNKS 600 KFADQVRPGL RVLSVDLGVR SFAACSVFEL VRGGPDQGTY FPAADGRTVD DPEKLWAKHE 660 RSFKITLPGE NPSRKEEIAR RAAMEELRSL NGDIRRLKAI LRLSVLQEDD PRTEHLRLFM 720 EAIVDDPAKS ALNAELFKGF GDDRFRSTPD LWKQHCHFFH DKAEKVVAER FSRWRTETRP 780 KSSSWQDWRE RRGYAGGKSY WAVTYLEAVR GLILRWNMRG RTYGEVNRQD KKQFGTVASA 840 LLHHINQLKE DRIKTGADMI IQAARGFVPR KNGAGWVQVH EPCRLILFED LARYRFRTDR 900 SRRENSRLMR WSHREIVNEV GMQGELYGLH VDTTEAGFSS RYLASSGAPG VRCRHLVEED 960 FHDGLPGMHL VGELDWLLPK DKDRTANEAR RLLGGMVRPG MLVPWDGGEL FATLNAASQL 1020 HVIHADINAA QNLORREWGR CGEAIRIVCN QLSVDGSTRY EMAKAPKARL LGALQQLKNG 1080 DAPFHLTSIP NSQKPENSYV MTPTNAGKKY RAGPGEKSSG EEDELALDIV EQAEELAQGR 1140 KTFFRDPSGV FFAPDRWLPS EIYWSRIRRR IWQVTLERNS SGRQERAEMD EMPY 1194 (1116 in PCT/US2017/017255) Tuberibacillus calidus SEQ ID NO: 36 MATKSFILKM KTKNNPQLRL SLWKTHELFN FGVAYYMDLL SLFRQKDLYM HNDEDPDHPV 60 VLKKEEIQER LWMKVRETQQ KNGFHGEVSK DEVLETLRAL YEELVPSAVG KSGEANQISN 120 KYLYPLTDPA SQSGKGTANS GRKPRWKKLK EAGDPSWKDA YEKWEKERQE DPKLKILAAL 180 QSFGLIPLFR PFTENDHKAV ISVKWMPKSK NQSVRKFDKD MENQAIERFL SWESWNEKVA 240 EDYEKTVSIY ESLQKELKGI STKAFEIMER VEKAYEAHLR EITFSNSTYR IGNRAIRGWT 300 EIVKKWMKLD PSAPQGNYLD VVKDYQRRHP RESGDFKLFE LLSRPENQAA WREYPEFLPL 360 YVKYRHAEQR MKTAKKOATF TLCDPIRHPL WVRYEERSGT NLNKYRLIMN EKEKVVQFDR 420 LICLNADGHY EEQEDVTVPL APSQQFDDQI KFSSEDTGKG KHNFSYYHKG INYELKGTLG 480 GARIQFDREH LLRROGVKAG NVGRIFLNVT LNIEPMQPFS RSGNLQTSVG KALKVYVDGY 540 PKVVNFKPKE LTEHIKESEK NTLTLGVESL PTGLRVMSVD LGQRQAAAIS IFEVVSEKPD 600 DNKLFYPVKD TDLFAVHRTS FNIKLPGEKR TERRMLEQQK RDQAIRDLSR KLKFLKNVLN 660 MQKLEKTDER EKRVNRWIKD REREEENPVY VQEFEMISKV LYSPHSVWVD QLKSIHRKLE 720 EQLGKEISKW RQSISQGRQG VYGISLKNIE DIEKTRRLLF RWSMRPENPG EVKQLQPGER 780 FAIDQQNHLN HLKDDRIKKL ANQIVMTALG YRYDGKRKKW IAKHPACQLV LFEDLSRYAF 840 YDERSRLENR NLMRWSRREI PKOVAQIGGL YGLLVGEVGA QYSSRFHAKS GAPGIRCRVV 900 KEHELYITEG GQKVRNOKFL DSLVENNIIE PDDARRLEPG DLIRDOGGDK FATLDERGEL 960 VITHADINAA QNLQKREWTR THGLYRIRCE SREIKDAVVL VPSDKDQKEK MENLFGIGYL 1020 QPFKQENDVY KWVKGEKIKG KKTSSQSDDK ELVSEILQEA SVMADELKGN RKTLFRDPSG 1080 YVFPKDRWYT GGRYFGTLEH LLKRKLAERR LFDGGSSRRG LENGTDSNTN VE 1132 (1117 in PCT/US2017/017255) Bacillus thermoamylovorans SEQ ID NO: 37 MATRSFILKI EPNEEVKKGL WKTHEVLNHG IAYYMNILKL IRQEAIYEHH EQDPKNPKKV 60 SKAEIQAELW DFVLKMQKCN SFTHEVDKDV VFNILRELYE ELVPSSVEKK GEANQLSNKF 120 LYPLVDPNSQ SGKGTASSGR KPRWYNIKIA GDPSWEEEKK KWEEDKKKDP LAKILGKLAE 180 YGLIPLFIPF TDSNEPIVKE IKWMEKSRNQ SVRRLDKDMF IQALERFLSW ESWNLKVKEE 240 YEKVEKEHKT LEERIKEDIQ AFKSLEQYEK ERQEQLLRDT LNTNEYRLSK RGLRGWREII 300 QKWLKMDENE PSEKYLEVFK DYQRKHPREA GDYSVYEFLS KKENHFIWRN HPEYPYLYAT 360 FCEIDKKKKD AKQQATFTLA DPINHPLWVR FEERSGSNLN KYRILTEQLH TEKLKKKLTV 420 QLDRLIYPTE SGGWEEKGKV DIVLLPSRQF YNQIFLDIEE KGKHAFTYKD ESIKFPLKGT 480 LGGARVQFDR DHLRRYPHKV ESGNVGRIYF NMTVNIEPTE SPVSKSLKIH RDDFPKFVNF 540 KPKELTEWIK DSKGKKLKSG IESLEIGLRV MSIDLGQRQA AAASIFEVVD QKPDIEGKLF 600 FPIKGTELYA VHRASFNIKL PGETLVKSRE VLRKAREDNL KLMNQKLNFL RNVLHFQQFE 660 DITEREKRVT KWISRQENSD VPLVYQDELI QIRELMYKPY KDWVAFLKQL HKRLEVEIGK 720 EVKHWRKSLS DGRKGLYGIS LKNIDEIDRT RKFLLRWSLR PTEPGEVRRL EPGQRFAIDQ 780 LNHLNALKED RLKKMANTII MHALGYCYDV RKKKWQAKNP ACQIILFEDL SNYNPYEERS 840 RFENSKLMKW SRREIPROVA LQGEIYGLQV GEVGAQFSSR FHAKTGSPGI RCSVVTKEKL 900 QDNRFFKNLQ REGRLTLDKI AVLKEGDLYP DKGGEKFISL SKDRKLVTTH ADINAAQNLQ 960 KREWTRTHGF YKVYCKAYQV DGQTVYIPES KDQKQKIIEE FGEGYFILKD GVYEWGNAGK 1020 LKIKKGSSKQ SSSELVDSDI LKDSFDLASE LKGEKLMLYR DPSGNVFPSD KWMAAGVFFG 1080 KLERILISKL TNQYSISTIE DDSSKQSM 1108 (1118 in PCT/US2017/017255) SEQ ID NO: 38 MAIRSIKLKL KTHTGPEAQN LRKGIWRTHR LLNEGVAYYM KMLLLFRQES TGERPKEELQ 60 EELICHIREQ QQRNQADKNT QALPLDKALE ALROLYELLV PSSVGQSGDA QIISRKFLSP 120 LVDPNSEGGK GTSKAGAKPT WQKKKEANDP TWEQDYEKWK KRREEDPTAS VITTLEEYGI 180 RPIFPLYTNT VTDIAWLPLQ SNQFVRTWDR DMLQQAIERL LSWESWNKRV QEEYAKLKEK 240 MAQLNEQLEG GQEWISLLEQ YEENRERELR ENMTAANDKY RITKROMKGW NELYELWSTF 300 PASASHEQYK EALKRVQQRL RGRFGDAHFF QYLMEEKNRL IWKGNPQRIH YFVARNELTK 360 RLEEAKQSAT MTLPNARKHP LWVRFDARGG NLQDYYLTAE ADKPRSRREV TFSQLIWPSE 420 SGWMEKKDVE VELALSROFY QQVKLLKNDK GKQKIEFKDK GSGSTFNGHL GGAKLQLERG 480 DLEKEEKNFE DGEIGSVYLN VVIDFEPLQE VKNGRVQAPY GQVLQLIRRP NEFPKVTTYK 540 SEQLVEWIKA SPOHSAGVES LASGFRVMSI DLGLRAAAAT SIFSVEESSD KNAADFSYWI 600 EGTPLVAVHQ RSYMLRLPGE QVEKQVMEKR DERFOLHQRV KFQIRVLAQI MRMANKQYGD 660 RWDELDSLKQ AVEQKKSPLD QTDRTFWEGI VCDLTKVLPR NEADWEQAVV QIHRKAEEYV 720 GKAVQAWRKR FAADERKGIA GLSMWNIEEL EGLRKLLISW SRRTRNPQEV NRFERGHTSH 780 QRLLTHIQNV KEDRLKOLSH AIVMTALGYV YDERKQEWCA EYPACQVILF ENLSQYRSNL 840 DRSTKENSTL MKWAHRSIPK YVHMQAEPYG IQIGDVRAEY SSRFYAKTGT PGIRCKKVRG 900 QDLQGRRFEN LQKRLVNEQF LTEEQVKQLR PGDIVPDDSG ELFMTLTDGS GSKEVVFLQA 960 DINAAHNLQK RFWQRYNELF KVSCRVIVRD EEEYLVPKTK SVQAKLGKGL FVKKSDTAWK 1020 DVYVWDSQAK LKGKTTFTEE SESPEQLEDF QEIIEEAEEA KGTYRTLFRD PSGVFFPESV 1080 WYPQKDFWGE VKRKLYGKLR ERFLTKAR 1108 (1119 in PCT/US2017/017255) Methylobacterium nodulans SEQ ID NO: 39 MLTKQDKQQK ITYCTNMNEV FEAKLGSADL LLNWDHLRGR IRDRVDAGDI GSAFLKLALD 60 VAHVLPDGVD DOLARAAFHF QSAKGAKSKH ADSVQAGLRV LSIDLGVRSF ATCSVFELKD 120 TAPTTGVAFP LAEFRLWAVH ERSFTLELPG ENVGAAGQQW RAQADAELRO LRGGLNRHRQ 180 LLRAATVOKG ERDAYLTDLR EAWSAKELWP FEASLLSELE RCSTVADPLW QDTCKRAARL 240 YRTEFGAVVS EWRSRTRSRE DRKYAGKSMW SVQHLTDVRR FLQSWSLAGR ASGDIRRLDR 300 ERGGVFAKDL LDHIDALKDD RLKTGADLIV QAARGFORNE FGYWVQKHAP CHVILFEDLS 360 RYRMRTDRPR RENSQLMOWA HRGVPDMVGM QGEIYGIQDR RDPDSARKHA RQPLAAFCLD 420 TPAAFSSRYH ASTMTPGIRC HPLRKREFED QGFLELLKRE NEGLDLNGYK PGDLVPLPGG 480 EVFVCLNANG LSRIHADINA AQNLQRRFWT QHGDAFRLPC GKSAVQGQIR WAPLSMGKRQ 540 AGALGGFGYL EPTGHDSGSC QWRKTTEAEW RRLSGAQKDR DEAAAAEDEE LQGLEEELLE 600 RSGERVVFFR DPSGVVLPTD LWFPSAAFWS IVRAKTVGRL RSHLDAQAEA SYAVAAGL 658 (1120 in PCT/US2017/017255) SEQ ID NO: 40 MKKFELKQNF RNNYSGKTLR NFRQTLAQIA NKKSSDSILT IKFKLDCSKT GKLPKYENLI 60 SLYDTIEDIK KGTLSYYLFT LIVSGFKFFG SASQAKAFST KDIFKDNDFY NQFKIQSHLD 120 LPDFVPSKIY QRLKKNVRST NGKDNAFKAS VIVAEYRKEI GKLKNKDESS EHQCEELFKK 180 IGTALETRES SWQDLINNCS TGCEIIDEIL NDSFGTLPSI KKMVLASTTQ SSDGEQDGIA 240 IAYDPDSTFI KSDELLNPYF AVATILKSMP PEIQQDKKSA YVKANLTTPT HNALSWIFGK 300 GLTLFQTEST EKLCAMFNVS DKRVIEQVQD AAKAVKLPAE LDLNHCTLKF QDFRSSLGGH 360 LDSWTTNYLK RLDELNDLLL NLPKNLSLPD IFMIDGKDFI EYSGCNRDEI QQMIDFVVNE 420 QNRIKLQESL NALLGKGNNQ ICSDDISTVK DFSEIVNSLH SFVQQIDNSL EQSSNEANSI 480 FSELKKKIEK NEKWDIWKNN LKKIPKLNKL SGGVPDAWKE IREIEQKFHE ISENQKKHFT 540 EVMEWIDAGN GTIDIFESRF KYDELLKKSK KNNLQSADEL AFRSVLNKLG RFARQGNDLV 600 CEKIKNWFKE QNIFDSSKDF NRYFINQKGF IFKHPSSKKD NSPYNLSANL LEKRYEVTNT 660 VGALLEQCES DPAIVNDPFS MRSLVEFRAL WFSINISGIS KEQHIPTKIA QPKLDDSTYQ 720 ESVSPTLKYR LEKEQITSSE LNSIFTVYKS LLSGLSIRLS RNSFYLRTKF SWIGNNSLIY 780 CPKETTWKIP AAYFKSDLWN EYKDKQILIV NEEYDVDVVK TFESVYKIVK SKDNNEKNRI 840 LPLLKQLPHD WMFKLPFGAS NAEKCKVLKL EKNNKKFKPL SVSKDSLARL SGPSTYFNQI 900 DEIMMNDESE LSEMTLLADE PVRQQMSNGK IEIIPDDYVM SLAIPITRSL KKGNTESFPF 960 KNIVSIDQGE AGFAYAVFKL SDCGNERAEP IATGLIPIPS IRRLIHSVKK YRGKKQRIQN 1020 FNQKFDSTMF TLRENVTGDI CGLIVALMKK YNAFPILEKQ VGNLESGSKQ LMLVYKAVNS 1080 KFLAAKVDMQ NDQRRSWWYQ GNSWNTPILR ISNPNQSNNK NIVKNINGKK YEELKIYPGY 1140 SVSAYMTSCI CHVCGRNALE LLKNDDSTGK VKKYQINQDG EVTIGGEVIK LYRKPDRLTP 1200 VKNLAKKGNR ERTYASINER APTVSVQKAE LSADELQKII KKNMRRAPRS LMSKDTTQSR 1260 YFCVFKNCPC HNKEQHADVN AAINIGRRFL KDCILDDNKE KD 1302 (1121 in PCT/US2017/017255) SEQ ID NO: 41 MRSNYHGGRN ARQWRKQISG LARRTKETVF TYKFPLETDA AEIDFDKAVQ TYGIAEGVGH 60 GSLIGLVCAF HLSGFRLFSK AGEAMAFRNR SRYPTDAFAE KLSAIMGIQL PTLSPEGLDL 120 IFQSPPRSRD GIAPVWSENE VRNRLYTNWT GRGPANKPDE HLLEIAGEIA KQVFPKFGGW 180 DDLASDPDKA LAAADKYFQS QGDFPSIASL PAAIMLSPAN STVDFEGDYI AIDPAAETLL 240 HOAVSRCAAR LGRERPDLDO NKGPFVSSLQ DALVSSONNG LSWLFGVGFQ HWKEKSPKEL 300 IDEYKVPADQ HGAVTQVKSF VDAIPLNPLF DTTHYGEFRA SVAGKVRSWV ANYWKRLLDL 360 KSLLATTEFT LPESISDPKA VSLFSGLLVD PQGLKKVADS LPARLVSAEE AIDRLMGVGI 420 PTAADIAQVE RVADEIGAFI GOVQQFNNQV KOKLENLQDA DDEEFLKGLK IELPSGDKEP 480 PAINRISGGA PDAAAEISEL EEKLORLLDA RSEHFQTISE WAEENAVTLD PIAAMVELER 540 LRLAERGATG DPEEYALRLL LORIGRLANR VSPVSAGSIR ELLKPVFMEE REFNLFFHNR 600 LGSLYRSPYS TSRHOPFSID VGKAKAIDWI AGLDQISSDI EKALSGAGEA LGDQLRDWIN 660 LAGFAISQRL RGLPDTVPNA LAQVRCPDDV RIPPLLAMLL EEDDIARDVC LKAFNLYVSA 720 INGCLFGALR EGFIVRTRFQ RIGTDQIHYV PKDKAWEYPD RLNTAKGPIN AAVSSDWIEK 780 DGAVIKPVET VRNLSSTGFA GAGVSEYLVQ APHDWYTPLD LRDVAHLVTG LPVEKNITKL 840 KRLTNRTAFR MVGASSFKTH LDSVLLSDKI KLGDFTIIID QHYRQSVTYG GKVKISYEPE 900 RLQVEAAVPV VDTRDRTVPE PDTLFDHIVA IDLGERSVGF AVFDIKSCLR TGEVKPIHDN 960 NGNPVVGTVA VPSIRRLMKA VRSHRRRRQP NOKVNOTYST ALQNYRENVI GDVCNRIDTL 1020 MERYNAFPVL EFQIKNFQAG AKOLEIVYGS VLHRYTFSGV DAHKAKRREY WYNGELWEHP 1080 YLMAKKWNEE TNSMSGAPKP VSLFPGVTVN AARTSQICHQ CORNPMSHLR GLTGTIEISS 1140 DGLLELDDGT IRLFETSDYD EDKFKQSRRE KRRLDANVLL SGRHRAEYIY TVAKRNLRRP 1200 PKNVMTKDTT QSRYTCLYKN CSWTGHADEN AAINIGRRYL AERIDMPASK TKAAV 1255 (1122 in PCT/US2017/017255) SEQ ID NO: 42 MRPRFHGGMN ARDWRKHVGV LAQQHKETTR TYTFPLDTTG SAIDFDAALQ AYNAVEGVGY 60 GSLLGLACAV HLSGFRLFST GKEAATFRNR ARYPNAAFQA ALRKELGTTI TTLTPETLDR 120 LFSSRPKRRN GVPLPWNQDS IRDRLYTNWV KPRPGDTPDA VLFQIATGIA QEITEDVSSW 180 TDLAKNSDRG LKAAHRYFAR VGGFPAFDNL TPPATVQPTD TTIDYDPNAP FHLVSHADQT 240 LIHQSISLCA HRIRQEDPAL DPNKSGFIKQ LONNFLSQTF YGLSWLFGAG YVHFRECTAN 300 DLAIQYGIPN NCRDGIHQIK SFADAILPNT FFEKKHYRKD SRSVGKKAKS WISNYWQRLL 360 QLQTWVDDHT WVTLPQELTE AQFKPLFRGL LVDAVELMAI AERLPORLAD CRDSLDCLMG 420 KGPQAATKND VEIVEKVREE IESFVGQIEQ LGNQLRHQLE NENNDQVHRD NLHQLKNRLP 480 LDLRRPQALN KISGGVPDVA KSIRGLETQL DQVLKERRSH FGRLTKWAKE CGITLDPLQP 540 LIESEKORVA ERGSAHDAKE LAIRLLLQRI GRLGHRLSPT NATAIQELLR PVFAVKREFN 600 LFFHNHMGAL YRSPYSTSRH QPFQINVDVA HGTDWIGTIE TLIQNLFTQI QDDALLRDLV 660 QLEGFVFSHK LRALPGVIPS ELARPNNLQQ MGLPALLLVL LOADQVHRET VLRVFNLYGS 720 AINGYLFOAL RPGFIVRAGF QRLETKKLRY VPKAQSWQYP DRLHHAKSAI KNSLSAGWIK 780 KNHQGAILPQ KTLTALVKQK SLKDTGVPEY LVQAPHDWYV PIDLRGPAIP IEGLTVGTEG 840 PELTOLGPMK DDCAFRAIGP SSFKSKIDAG LLPQDVKYGD MTLIFDQHYQ QSISFANGTF 900 SIQYQPTSLQ VKAAIPVVDK RPRDTRNNSH LYDRIVAIDL GERKIGYAIF DLKQVLKSEQ 960 LEPMREDGKP LIGSISIRSI RGLMKAVQTH RNRROPNYRI DOTYSKALMH YRESVIGDVC 1020 NAIDTLCARY GGFPVLESSV RNFEVGSAQL KTVYGSVSRR YTWSAVDAHK NORQQYWLGG 1080 TKDKIPIWTH PYLMTREWDE KNSKWSNRSK PLKMHPGVEV HPAGTSQICH QCKRNPIGAL 1140 WNVADTVVLD DOGQLDLDDG TIRLNSGYID TTEIKRARRK KIRLPENKPL TGSHKTSHVR 1200 AVARRNLRQP PKSTRAKDTT QSRYTCLYVD CGHECHADEN AAINIGRKYL QERIHIEASR 1260 QALSTR 1266 (1123 in PCT/US2017/017255) SEQ ID NO: 43 MVAGLKKIKR DGVTMKSNYH GGVKARAWRK RIGGLARROK ETVFTYKFPL ETEEAGIDFD 60 KAVQTYGIAE GISQGSLIGL VCAFHLSGFR LFSKADETKA FCNQGRYPNQ AFAEKLRNEL 120 SVTLPKLSPQ SLDVLFQSSP KSKNGVAPEW SKNAIRNRLY TNWTGKGAGT NPDEHLLEIA 180 EDIAAEIDSD LDGWKDLEEH PEKGLSAADR YFQAQGDFPS LTGLPPSVPL TPQNSTVAFE 240 GDPVCLNPSD NTLLHQAVAR CAGRILQEQP NLSPDKNRFI NQLQDELVSS QNNGLSWLFG 300 VGFKYWKEMS VDQLADDYKV KSTDLDALKQ VKSFIDAIPL NPLFDTPHYG EFRASVAGKM 360 RSWVKNYWKR LLDLKSQLGT ANINLPEGLD EQRAENLFSG LLIDSKGLRQ VTDKLPSRLK 420 KAEDTIDRLM GDGNPTSDDI EQVETVAAEI SAFIGQVEQF NNQLEQRLEN PLEGDDETFL 480 KQLKIDLPAE FKKPPAINRI SGGSPDPTAE IAELEEKLDR LMSARKEHYE TIAEWASANK 540 VTLDPMEAMT TLEAQRLTER GAEGDQEEFA LRLLLQRIGR LANRLSPQGA TAIRDLLRPV 600 FTEKREFNLF FHNRMGSLYR SPYSTSRHQP FTIDVAVAKN TDWMDALDGI AETIMKGLSQ 660 AGDELSLRLR DWINISGFSL SQRLRGLPDT VPGELALVRS ADDVRIPPML ALQLEEDEVS 720 REVCLKAFNL YVSAINGCLF RALREGFIVR TKFQRLERDV LSYVPKTKLW NYPQRLDTAR 780 GPIHSALAAA WINKEGSVID PVETVTALSD TGFSDDGIPE YLVQAPHDWY TPIDLRDISK 840 PVSGLPVKKN ITGLKROKKQ TAFRMVGPSS FKSHLDSTLL SEEVKLGDFT LIFDQYYKQR 900 VSYNGRVKIT FEPDRLHVEA AVPVIDKRVR PSTEEDALFD HLLAIDLGEK RVGYAVYDIK 960 ACLRTGDIKP LEDGDGKPIV GSVAVPSIRR LMKAVRSHRQ QRQPNQKVNQ TYSTALMNYR 1020 ENVIGDVCNR IDTLMEKYNA FPVLESSVMN FEAGSRQLEM VYGSVLHRYT YSKIDAHTAK 1080 RKEYWYTGEY WDHPYLMAHK WNERTRSYSG SLSALTLYPG VMVHPAGTSQ RCHQCKRNPM 1140 VEIKOLTGQV EINADGSLEL DDGTICLYEG YDYSPEEYKK AKREKRRLDP NVPLSGRHQA 1200 KHVSAVAKRN LRRPTVSMMS GDTTQARYVC LYTDCDFTGH ADENAAINIG WKYLTERIAL 1260 SESKDKAGV 1269 (1124 in PCT/US2017/017255) SEQ ID NO: 44 MQISKVNHKH VAVGQKDRER ITGFIYNDPV GDEKSLEDVV AKRANDTKVL FNVFNTKDLY 60 DSQESDKSEK DKEIISKGAK FVAKSFNSAI TILKKONKIY STLTSQQVIK ELKDKFGGAR 120 IYDDDIEEAL TETLKKSFRK ENVRNSIKVL IENAAGIRSS LSKDEEELIQ EYFVKQLVEE 180 YTKTKLQKNV VKSIKNONMV IQPDSDSQVL SLSESRREKQ SSAVSSDTLV NCKEKDVLKA 240 FLTDYAVLDE DERNSLLWKL RNLVNLYFYG SESIRDYSYT KEKSVWKEHD EQKANKTLFI 300 DEICHITKIG KNGKEQKVLD YEENRSRCRK QNINYYRSAL NYAKNNTSGI FENEDSNHFW 360 IHLIENEVER LYNGIENGEE FKFETGYISE KVWKAVINHL SIKYIALGKA VYNYAMKELS 420 SPGDIEPGKI DDSYINGITS FDYEIIKAEE SLORDISMNV VFATNYLACA TVDTDKDFLL 480 FSKEDIRSCT KKDGNLCKNI MQFWGGYSTW KNFCEEYLKD DKDALELLYS LKSMLYSMRN 540 SSFHFSTENV DNGSWDTELI GKLFEEDCNR AARIEKEKFY NNNLHMFYSS SLLEKVLERL 600 YSSHHERASQ VPSFNRVFVR KNFPSSLSEQ RITPKFTDSK DEQIWQSAVY YLCKEIYYND 660 FLQSKEAYKL FREGVKNLDK NDINNOKAAD SFKQAVVYYG KAIGNATLSQ VCQAIMTEYN 720 RONNDGLKKK SAYAEKONSN KYKHYPLFLK QVLQSAFWEY LDENKEIYGF ISAQIHKSNV 780 EIKAEDFIAN YSSQQYKKLV DKVKKTPELQ KWYTLGRLIN PROANQFLGS IRNYVQFVKD 840 IQRRAKENGN PIRNYYEVLE SDSIIKILEM CTKLNGTTSN DIHDYFRDED EYAEYISQFV 900 NFGDVHSGAA LNAFCNSESE GKKNGIYYDG INPIVNRNWV LCKLYGSPDL ISKIISRVNE 960 NMIHDFHKQE DLIREYQIKG ICSNKKEQQD LRTFQVLKNR VELRDIVEYS EIINELYGQL 1020 IKWCYLRERD LMYFQLGFHY LCLNNASSKE ADYIKINVDD RNISGAILYQ IAAMYINGLP 1080 VYYKKDDMYV ALKSGKKASD ELNSNEQTSK KINYFLKYGN NILGDKKDQL YLAGLELFEN 1140 VAEHENIIIF RNEIDHFHYF YDRDRSMLDL YSEVFDRFFT YDMKLRKNVV NMLYNILLDH 1200 NIVSSFVFET GEKKVGRGDS EVIKPSAKIR LRANNGVSSD VFTYKVGSKD ELKIATLPAK 1260 NEEFLLNVAR LIYYPDMEAV SENMVREGVV KVEKSNDKKG KISRGSNTRS SNQSKYNNKS 1320 KNRMNYSMGS IFEKMDLKFD 1340 (1125 in PCT/US2017/017255) SEQ ID NO: 45 MKISKVREEN RGAKLTVNAK TAVVSENRSQ EGILYNDPSR YGKSRKNDED RDRYIESRLK 60 SSGKLYRIFN EDKNKRETDE LOWFLSEIVK KINRRNGLVL SDMLSVDDRA FEKAFEKYAE 120 LSYTNRRNKV SGSPAFETCG VDAATAERLK GIISETNFIN RIKNNIDNKV SEDIIDRIIA 180 KYLKKSLCRE RVKRGLKKLL MNAFDLPYSD PDIDVQRDFI DYVLEDFYHV RAKSQVSRSI 240 KNMNMPVQPE GDGKFAITVS KGGTESGNKR SAEKEAFKKF LSDYASLDER VRDDMLRRMR 300 RLVVLYFYGS DDSKLSDVNE KFDVWEDHAA RRVDNREFIK LPLENKLANG KTDKDAERIR 360 KNTVKELYRN QNIGCYRQAV KAVEEDNNGR YFDDKMLNMF FIHRIEYGVE KIYANLKQVT 420 EFKARTGYLS EKIWKDLINY ISIKYIAMGK AVYNYAMDEL NASDKKEIEL GKISEEYLSG 480 ISSFDYELIK AEEMLORETA VYVAFAARHL SSQTVELDSE NSDFLLLKPK GTMDKNDKNK 540 LASNNILNFL KDKETLRDTI LQYFGGHSLW TDFPFDKYLA GGKDDVDFLT DLKDVIYSMR 600 NDSFHYATEN HNNGKWNKEL ISAMFEHETE RMTVVMKDKF YSNNLPMFYK NDDLKKLLID 660 LYKDNVERAS QVPSFNKVFV RKNFPALVRD KDNLGIELDL KADADKGENE LKFYNALYYM 720 FKEIYYNAFL NDKNVRERFI TKATKVADNY DRNKERNLKD RIKSAGSDEK KKLREQLQNY 780 IAENDFGQRI KNIVQVNPDY TLAQICQLIM TEYNQQNNGC MQKKSAARKD INKDSYQHYK 840 MLLLVNLRKA FLEFIKENYA FVLKPYKHDL CDKADFVPDF AKYVKPYAGL ISRVAGSSEL 900 QKWYIVSRFL SPAQANHMLG FLHSYKQYVW DIYRRASETG TEINHSIAED KIAGVDITDV 960 DAVIDLSVKL CGTISSEISD YFKDDEVYAE YISSYLDFEY DGGNYKDSLN RFCNSDAVND 1020 QKVALYYDGE HPKLNRNIIL SKLYGERRFL EKITDRVSRS DIVEYYKLKK ETSQYQTKGI 1080 FDSEDEQKNI KKFQEMKNIV EFRDLMDYSE IADELQGQLI NWIYLRERDL MNFQLGYHYA 1140 CLNNDSNKQA TYVTLDYQGK KNRKINGAIL YQICAMYING LPLYYVDKDS SEWTVSDGKE 1200 STGAKIGEFY RYAKSFENTS DCYASGLEIF ENISEHDNIT ELRNYIEHFR YYSSFDRSFL 1260 GIYSEVFDRF FTYDLKYRKN VPTILYNILL QHEVNVRFEF VSGKKMIGID KKDRKIAKEK 1320 ECARITIREK NGVYSEQFTY KLKNGTVYVD ARDKRYLQSI IRLLFYPEKV NMDEMIEVKE 1380 KKKPSDNNTG KGYSKRDRQQ DRKEYDKYKE KKKKEGNFLS GMGGNINWDE INAQLKN 1437 (1126 in PCT/US2017/017255) SEQ ID NO: 46 MKFSKVDHTR SAVGIQKATD SVHGMLYTDP KKQEVNDLDK RFDQLNVKAK RLYNVFNQSK 60 AEEDDDEKRF GKVVKKLNRE LKDLLFHREV SRYNSIGNAK YNYYGIKSNP EEIVSNLGMV 120 ESLKGERDPQ KVISKLLLYY LRKGLKPGTD GLRMILEASC GLRKLSGDEK ELKVFLQTLD 180 EDFEKKTFKK NLIRSIENQN MAVQPSNEGD PIIGITQGRF NSQKNEEKSA IERMMSMYAD 240 LNEDHREDVL RKLRRLNVLY FNVDTEKTEE PTLPGEVDTN PVFEVWHDHE KGKENDRQFA 300 TFAKILTEDR ETRKKEKLAV KEALNDLKSA IRDHNIMAYR CSIKVTEQDK DGLFFEDQRI 360 NRFWIHHIES AVERILASIN PEKLYKLRIG YLGEKVWKDL LNYLSIKYIA VGKAVFHFAM 420 EDLGKTGQDI ELGKLSNSVS GGLTSFDYEQ IRADETLORO LSVEVAFAAN NLFRAVVGQT 480 GKKIEQSKSE ENEEDFLLWK AEKIAESIKK EGEGNTLKSI LQFFGGASSW DLNHFCAAYG 540 NESSALGYET KFADDLRKAI YSLRNETFHF TTLNKGSFDW NAKLIGDMFS HEAATGIAVE 600 RTRFYSNNLP MFYRESDLKR IMDHLYNTYH PRASQVPSFN SVFVRKNFRL FLSNTLNTNT 660 SFDTEVYQKW ESGVYYLFKE IYYNSFLPSG DAHHLFFEGL RRIRKEADNL PIVGKEAKKR 720 NAVQDFGRRC DELKNLSLSA ICQMIMTEYN EQNNGNRKVK STREDKRKPD IFQHYKMLLL 780 RTLQEAFAIY IRREEFKFIF DLPKTLYVMK PVEEFLPNWK SGMFDSLVER VKQSPDLQRW 840 YVLCKFLNGR LLNOLSGVIR SYIQFAGDIQ RRAKANHNRL YMDNTQRVEY YSNVLEVVDF 900 CIKGTSRFSN VFSDYFRDED AYADYLDNYL QFKDEKIAEV SSFAALKTFC NEEEVKAGIY 960 MDGENPVMQR NIVMAKLFGP DEVLKNVVPK VTREEIEEYY QLEKQIAPYR QNGYCKSEED 1020 QKKLLRFQRI KNRVEFQTIT EFSEIINELL GOLISWSFLR ERDLLYFQLG FHYLCLHNDT 1080 EKPAEYKEIS REDGTVIRNA ILHQVAAMYV GGLPVYTLAD KKLAAFEKGE ADCKLSISKD 1140 TAGAGKKIKD FFRYSKYVLI KDRMLTDQNQ KYTIYLAGLE LFENTDEHDN ITDVRKYVDH 1200 FKYYATSDEN AMSILDLYSE IHDRFFTYDM KYQKNVANML ENILLRHFVL IRPEFFTGSK 1260 KVGEGKKITC KARAQIEIAE NGMRSEDFTY KLSDGKKNIS TCMIAARDQK YLNTVARLLY 1320 YPHEAKKSIV DTREKKNNKK TNRGDGTFNK QKGTARKEKD NGPREFNDTG FSNTPFAGFD 1380 PFRNS 1385 (1127 in PCT/US2017/017255) SEQ ID NO: 47 MKISKVDHTR MAVAKGNOHR RDEISGILYK DPTKTGSIDF DERFKKLNCS AKILYHVENG 60 IAEGSNKYKN IVDKVNNNLD RVLFTGKSYD RKSIIDIDTV LRNVEKINAF DRISTEEREQ 120 IIDDLLEIQL RKGLRKGKAG LREVLLIGAG VIVRTDKKQE IADFLEILDE DENKTNQAKN 180 IKLSIENQGL VVSPVSRGEE RIFDVSGAQK GKSSKKAQEK EALSAFLLDY ADLDKNVRFE 240 YLRKIRRLIN LYFYVKNDDV MSLTEIPAEV NLEKDFDIWR DHEQRKEENG DFVGCPDILL 300 ADRDVKKSNS KOVKIAERQL RESIREKNIK RYRFSIKTIE KDDGTYFFAN KQISVFWIHR 360 IENAVERILG SINDKKLYRL RLGYLGEKVW KDILNFLSIK YIAVGKAVEN FAMDDLQEKD 420 RDIEPGKISE NAVNGLTSFD YEQIKADEML QREVAVNVAF AANNLARVTV DIPQNGEKED 480 ILLWNKSDIK KYKKNSKKGI LKSILQFFGG ASTWNMKMFE IAYHDQPGDY EENYLYDIIQ 540 ITYSLRNKSF HFKTYDHGDK NWNRELIGKM IEHDAERVIS VEREKFHSNN LPMFYKDADL 600 KKILDLLYSD YAGRASQVPA FNTVLVRKNF PEFLRKDMGY KVHFNNPEVE NOWHSAVYYL 660 YKEIYYNLFL RDKEVKNLFY TSLKNIRSEV SDKKQKLASD DFASRCEEIE DRSLPEICQI 720 IMTEYNAQNF GNRKVKSQRV IEKNKDIFRH YKMLLIKTLA GAFSLYLKQE RFAFIGKATP 780 IPYETTDVKN FLPEWKSGMY ASFVEEIKNN LDLQEWYIVG RFLNGRMLNQ LAGSLRSYIQ 840 YAEDIERRAA ENRNKLFSKP DEKIEACKKA VRVLDLCIKI STRISAEFTD YFDSEDDYAD 900 YLEKYLKYQD DAIKELSGSS YAALDHFCNK DDLKFDIYVN AGQKPILQRN IVMAKLFGPD 960 NILSEVMEKV TESAIREYYD YLKKVSGYRV RGKCSTEKEQ EDLLKFORLK NAVEFRDVTE 1020 YAEVINELLG QLISWSYLRE RDLLYFQLGF HYMCLKNKSF KPAEYVDIRR NNGTIIHNAI 1080 LYQIVSMYIN GLDFYSCDKE GKTLKPIETG KGVGSKIGQF IKYSQYLYND PSYKLEIYNA 1140 GLEVFENIDE HDNITDLRKY VDHFKYYAYG NKMSLLDLYS EFFDRFFTYD MKYQKNVVNV 1200 LENILLRHFV IFYPKFGSGK KDVGIRDCKK ERAQIEISEQ SLTSEDFMFK LDDKAGEEAK 1260 KFPARDERYL QTIAKLLYYP NEIEDMNREM KKGETINKKV QFNRKKKITR KQKNNSSNEV 1320 LSSTMGYLFK NIKL 1334 (1128 in PCT/US2017/017255) Carnobacterium gallinarum SEQ ID NO: 48 MRITKVKIKL DNKLYQVTMQ KEEKYGTLKL NEESRKSTAE ILRLKKASFN KSFHSKTINS 60 QKENKNATIK KNGDYISQIF EKLVGVDTNK NIRKPKMSLT DLKDLPKKDL ALFIKRKFKN 120 DDIVEIKNLD LISLFYNALQ KVPGEHFTDE SWADFCQEMM PYREYKNKFI ERKIILLANS 180 IEQNKGFSIN PETFSKRKRV LHQWAIEVQE RGDFSILDEK LSKLAEIYNF KKMCKRVQDE 240 LNDLEKSMKK GKNPEKEKEA YKKQKNFKIK TIWKDYPYKT HIGLIEKIKE NEELNOFNIE 300 IGKYFEHYFP IKKERCTEDE PYYLNSETIA TTVNYQLKNA LISYLMQIGK YKQFGLENQV 360 LDSKKLQEIG IYEGFQTKFM DACVFATSSL KNIIEPMRSG DILGKREFKE AIATSSFVNY 420 HHFFPYFPFE LKGMKDRESE LIPFGEQTEA KOMQNIWALR GSVQQIRNEI FHSFDKNQKF 480 NLPQLDKSNF EFDASENSTG KSQSYIETDY KFLFEAEKNQ LEQFFIERIK SSGALEYYPL 540 KSLEKLFAKK EMKFSLGSQV VAFAPSYKKL VKKGHSYQTA TEGTANYLGL SYYNRYELKE 600 ESFQAQYYLL KLIYQYVFLP NFSQGNSPAF RETVKAILRI NKDEARKKMK KNKKFLRKYA 660 FEQVREMEFK ETPDQYMSYL QSEMREEKVR KAEKNDKGFE KNITMNFEKL LMQIFVKGFD 720 VFLTTFAGKE LLLSSEEKVI KETEISLSKK INEREKTLKA SIQVEHQLVA TNSAISYWLF 780 CKLLDSRHLN ELRNEMIKFK QSRIKFNHTQ HAELIQNLLP IVELTILSND YDEKNDSQNV 840 DVSAYFEDKS LYETAPYVOT DDRTRVSFRP ILKLEKYHTK SLIEALLKDN PQFRVAATDI 900 QEWMHKREEI GELVEKRKNL HTEWAEGQQT LGAEKREEYR DYCKKIDREN WKANKVTLTY 960 LSQLHYLITD LLGRMVGFSA LFERDLVYFS RSFSELGGET YHISDYKNLS GVLRLNAEVK 1020 PIKIKNIKVI DNEENPYKGN EPEVKPFLDR LHAYLENVIG IKAVHGKIRN QTAHLSVLQL 1080 ELSMIESMNN LRDLMAYDRK LKNAVTKSMI KILDKHGMIL KLKIDENHKN FEIESLIPKE 1140 IIHLKDKAIK TNOVSEEYCQ LVLALLTTNP GNQLN 1175 (1129 in PCT/US2017/017255) Paludibacter propionicigenes SEQ ID NO: 49 MRVSKVKVKD GGKDKMVLVH RKTTGAQLVY SGQPVSNETS NILPEKKRQS FDLSTLNKTI 60 IKFDTAKKQK LNVDQYKIVE KIFKYPKQEL PKQIKAEEIL PFLNHKFQEP VKYWKNGKEE 120 SFNLTLLIVE AVQAQDKRKL QPYYDWKTWY IQTKSDLLKK SIENNRIDLT ENLSKRKKAL 180 LAWETEFTAS GSIDLTHYHK VYMTDVLCKM LQDVKPLTDD KGKINTNAYH RGLKKALQNH 240 QPAIFGTREV PNEANRADNO LSTYHLEVVK YLEHYFPIKT SKRRNTADDI AHYLKAQTLK 300 TTIEKQLVNA IRANIIQQGK TNHHELKADT TSNDLIRIKT NEAFVLNLTG TCAFAANNIR 360 NMVDNEQTND ILGKGDFIKS LLKDNTNSQL YSFFFGEGLS TNKAEKETQL WGIRGAVQQI 420 RNNVNHYKKD ALKTVFNISN FENPTITDPK QQTNYADTIY KARFINELEK IPEAFAQQLK 480 TGGAVSYYTI ENLKSLLTTF QFSLCRSTIP FAPGFKKVEN GGINYQNAKQ DESFYELMLE 540 QYLRKENFAE ESYNARYFML KLIYNNLFLP GFTTDRKAFA DSVGFVQMQN KKQAEKVNPR 600 KKEAYAFEAV RPMTAADSIA DYMAYVQSEL MQEQNKKEEK VAEETRINFE KFVLQVFIKG 660 FDSFLRAKEF DFVOMPOPOL TATASNQQKA DKLNQLEASI TADCKLTPQY AKADDATHIA 720 FYVFCKLLDA AHLSNLRNEL IKFRESVNEF KFHHLLEIIE ICLLSADVVP TDYRDLYSSE 780 ADCLARLRPF IEQGADITNW SDLFVQSDKH SPVIHANIEL SVKYGTTKLL EQIINKDTQF 840 KTTEANFTAW NTAQKSIEQL IKQREDHHEQ WVKAKNADDK EKQERKREKS NFAQKFIEKH 900 GDDYLDICDY INTYNWLDNK MHFVHLNRLH GLTIELLGRM AGFVALFDRD FOFFDEQQIA 960 DEFKLHGFVN LHSIDKKLNE VPTKKIKEIY DIRNKIIQIN GNKINESVRA NLIQFISSKR 1020 NYYNNAFLHV SNDEIKEKOM YDIRNHIAHF NYLTKDAADF SLIDLINELR ELLHYDRKLK 1080 NAVSKAFIDL FDKHGMILKL KLNADHKLKV ESLEPKKIYH LGSSAKDKPE YQYCTNQVMM 1140 AYCNMCRSLL EMKK 1154 (1130 in PCT/US2017/017255) Listeria seeligeri SEQ ID NO: 50 MWISIKTLIH HLGVLFFCDY MYNRREKKII EVKTMRITKV EVDRKKVLIS RDKNGGKLVY 60 ENEMQDNTEQ IMHHKKSSFY KSVVNKTICR PEQKQMKKLV HGLLQENSQE KIKVSDVTKL 120 NISNFLNHRF KKSLYYFPEN SPDKSEEYRI EINLSQLLED SLKKQQGTFI CWESFSKDME 180 LYINWAENYI SSKTKLIKKS IRNNRIQSTE SRSGQLMDRY MKDILNKNKP FDIQSVSEKY 240 QLEKLTSALK ATFKEAKKND KEINYKLKST LONHERQIIE ELKENSELNQ FNIEIRKHLE 300 TYFPIKKTNR KVGDIRNLEI GEIQKIVNHR LKNKIVQRIL QEGKLASYEI ESTVNSNSLQ 360 KIKIEEAFAL KFINACLFAS NNLRNMVYPV CKKDILMIGE FKNSFKEIKH KKFIRQWSQF 420 FSQEITVDDI ELASWGLRGA IAPIRNEIIH LKKHSWKKFF NNPTFKVKKS KIINGKTKDV 480 TSEFLYKETL FKDYFYSELD SVPELIINKM ESSKILDYYS SDOLNQVFTI PNFELSLLTS 540 AVPFAPSFKR VYLKGFDYQN QDEAQPDYNL KLNIYNEKAF NSEAFQAQYS LFKMVYYQVF 600 LPQFTTNNDL FKSSVDFILT LNKERKGYAK AFQDIRKMNK DEKPSEYMSY IQSQLMLYQK 660 KQEEKEKINH FEKFINQVFI KGFNSFIEKN RLTYICHPTK NTVPENDNIE IPFHTDMDDS 720 NIAFWLMCKL LDAKQLSELR NEMIKFSCSL QSTEEISTFT KAREVIGLAL LNGEKGCNDW 780 KELFDDKEAW KKNMSLYVSE ELLQSLPYTQ EDGQTPVINR SIDLVKKYGT ETILEKLESS 840 SDDYKVSAKD IAKLHEYDVT EKIAQQESLH KOWIEKPGLA RDSAWTKKYQ NVINDISNYQ 900 WAKTKVELTQ VRHLHQLTID LLSRLAGYMS IADRDFQFSS NYILERENSE YRVTSWILLS 960 ENKNKNKYND YELYNLKNAS IKVSSKNDPQ LKVDLKQLRL TLEYLELFDN RLKEKRNNIS 1020 HFNYLNGQLG NSILELFDDA RDVLSYDRKL KNAVSKSLKE ILSSHGMEVT FKPLYQTNHH 1080 LKIDKLQPKK IHHLGEKSTV SSNQVSNEYC QLVRTLLTMK 1120 (1131 in PCT/US2017/017255) Listeria newyorkensis SEQ ID NO: 51 MKITKMRVDG RTIVMERTSK EGQLGYEGID GNKTTEIIFD KKKESFYKSI LNKTVRKPDE 60 KEKNRRKQAI NKAINKEITE LMLAVLHQEV PSQKLHNLKS LNTESLTKLF KPKFQNMISY 120 PPSKGAEHVQ FCLTDIAVPA IRDLDEIKPD WGIFFEKLKP YTDWAESYIH YKQTTIQKSI 180 EQNKIQSPDS PRKLVLQKYV TAFLNGEPLG LDLVAKKYKL ADLAESFKLV DLNEDKSANY 240 KIKACLQQHQ RNILDELKED PELNQYGIEV KKYIQRYFPI KRAPNRSKHA RADFLKKELI 300 ESTVEQQFKN AVYHYVLEQG KMEAYELTDP KTKDLQDIRS GEAFSFKFIN ACAFASNNLK 360 MILNPECEKD ILGKGNFKKN LPNSTTRSDV VKKMIPFFSD ELQNVNFDEA IWAIRGSIQQ 420 IRNEVYHCKK HSWKSILKIK GFEFEPNNMK YADSDMQKLM DKDIAKIPEF IEEKLKSSGV 480 VRFYRHDELQ SIWEMKOGFS LLTTNAPFVP SFKRVYAKGH DYQTSKNRYY NLDLTTFDIL 540 EYGEEDFRAR YFLTKLVYYQ QFMPWFTADN NAFRDAANFV LRLNKNRQQD AKAFINIREV 600 EEGEMPRDYM GYVQGQIAIH EDSIEDTPNH FEKFISQVFI KGFDRHMRSA NLKFIKNPRN 660 QGLEQSEIEE MSFDIKVEPS FLKNKDDYIA FWIFCKMLDA RHLSELRNEM IKYDGHLTGE 720 QEIIGLALLG VDSRENDWKQ FFSSEREYEK IMKGYVVEEL YQREPYRQSD GKTPILFRGV 780 EQARKYGTET VIQRLFDANP EFKVSKCNLA EWERQKETIE ETIKRRKELH NEWAKNPKKP 840 QNNAFFKEYK ECCDAIDAYN WHKNKTTLAY VNELHHLLIE ILGRYVGYVA IADRDFQCMA 900 NQYFKHSGIT ERVEYWGDNR LKSIKKLDTF LKKEGLFVSE KNARNHIAHL NYLSLKSECT 960 LLYLSERLRE IFKYDRKLKN AVSKSLIDIL DRHGMSVVFA NLKENKHRLV IKSLEPKKLR 1020 HLGGKKIDGG YIETNQVSEE YCGIVKRLLE M 1051 (1132 in PCT/US2017/017255) SEQ ID NO: 52 MYMKITKIDG VSHYKKQDKG ILKKKWKDLD ERKOREKIEA RYNKQIESKI YKEFFRLKNK 60 KRIEKEEDON IKSLYFFIKE LYLNEKNEEW ELKNINLEIL DDKERVIKGY KFKEDVYFFK 120 EGYKEYYLRI LFNNLIEKVQ NENREKVRKN KEFLDLKEIF KKYKNRKIDL LLKSINNNKI 180 NLEYKKENVN EEIYGINPTN DREMTFYELL KEIIEKKDEQ KSILEEKLDN FDITNFLENI 240 EKIFNEETEI NIIKGKVLNE LREYIKEKEE NNSDNKLKQI YNLELKKYIE NNFSYKKQKS 300 KSKNGKNDYL YLNFLKKIMF IEEVDEKKEI NKEKFKNKIN SNFKNLFVQH ILDYGKLLYY 360 KENDEYIKNT GQLETKDLEY IKTKETLIRK MAVLVSFAAN SYYNLFGRVS GDILGTEVVK 420 SSKTNVIKVG SHIFKEKMLN YFFDFEIFDA NKIVEILESI SYSIYNVRNG VGHFNKLILG 480 KYKKKDINTN KRIEEDLNNN EEIKGYFIKK RGEIERKVKE KFLSNNLQYY YSKEKIENYF 540 EVYEFEILKR KIPFAPNFKR IIKKGEDLEN NKNNKKYEYF KNFDKNSAEE KKEFLKTRNF 600 LLKELYYNNF YKEFLSKKEE FEKIVLEVKE EKKSRGNINN KKSGVSFQSI DDYDTKINIS 660 DYIASIHKKE MERVEKYNEE KOKDTAKYIR DFVEEIFLTG FINYLEKDKR LHFLKEEFSI 720 LCNNNNNVVD FNININEEKI KEFLKENDSK TLNLYLFFNM IDSKRISEFR NELVKYKQFT 780 KKRLDEEKEF LGIKIELYET LIEFVILTRE KLDTKKSEEI DAWLVDKLYV KDSNEYKEYE 840 EILKLFVDEK ILSSKEAPYY ATDNKTPILL SNFEKTRKYG TOSFLSEIQS NYKYSKVEKE 900 NIEDYNKKEE IEQKKKSNIE KLQDLKVELH KKWEQNKITE KEIEKYNNTT RKINEYNYLK 960 NKEELQNVYL LHEMLSDLLA RNVAFFNKWE RDFKFIVIAI KQFLRENDKE KVNEFLNPPD 1020 NSKGKKVYFS VSKYKNIVEN IDGIHKNEMN LIFLNNKFMN RKIDKMNCAI WVYFRNYIAH 1080 FLHLHTKNEK ISLISQMNLL IKLFSYDKKV QNHILKSTKT LLEKYNIQIN FEISNDKNEV 1140 FKYKIKNRLY SKKGKMLGKN NKFEILENEF LENVKAMLEY SE 1182 (1133 in PCT/US2017/017255) Rhodobacter capsulatus SEQ ID NO: 53 MQIGKVQGRT ISEFGDPAGG LKRKISTDGK NRKELPAHLS SDPKALIGQW ISGIDKIYRK 60 PDSRKSDGKA IHSPTPSKMQ FDARDDLGEA FWKLVSEAGL AQDSDYDQFK RRLHPYGDKF 120 QPADSGAKLK FEADPPEPQA FHGRWYGAMS KRGNDAKELA AALYEHLHVD EKRIDGQPKR 180 NPKTDKFAPG LVVARALGIE SSVLPRGMAR LARNWGEEEI QTYFVVDVAA SVKEVAKAAV 240 SAAQAFDPPR QVSGRSLSPK VGFALAEHLE RVTGSKRCSF DPAAGPSVLA LHDEVKKTYK 300 RLCARGKNAA RAFPADKTEL LALMRHTHEN RVRNQMVRMG RVSEYRGQQA GDLAQSHYWT 360 SAGQTEIKES EIFVRLWVGA FALAGRSMKA WIDPMGKIVN TEKNDRDLTA AVNIRQVISN 420 KEMVAEAMAR RGIYFGETPE LDRLGAEGNE GFVFALLRYL RGCRNQTFHL GARAGFLKEI 480 RKELEKTRWG KAKEAEHVVL TDKTVAAIRA IIDNDAKALG ARLLADLSGA FVAHYASKEH 540 FSTLYSEIVK AVKDAPEVSS GLPRLKLLLK RADGVRGYVH GLRDTRKHAF ATKLPPPPAP 600 RELDDPATKA RYIALLRLYD GPFRAYASGI TGTALAGPAA RAKEAATALA QSVNVTKAYS 660 DVMEGRSSRL RPPNDGETLR EYLSALTGET ATEFRVQIGY ESDSENARKQ AEFIENYRRD 720 MLAFMFEDYI RAKGFDWILK IEPGATAMTR APVLPEPIDT RGQYEHWQAA LYLVMHFVPA 780 SDVSNLLHQL RKWEALQGKY ELVQDGDATD QADARREALD LVKRFRDVLV LFLKTGEARF 840 EGRAAPFDLK PFRALFANPA TFDRLFMATP TTARPAEDDP EGDGASEPEL RVARTLRGLR 900 QIARYNHMAV LSDLFAKHKV RDEEVARLAE IEDETQEKSQ IVAAQELRTD LHDKVMKCHP 960 KTISPEERQS YAAAIKTIEE HRFLVGRVYL GDHLRLHRLM MDVIGRLIDY AGAYERDTGT 1020 FLINASKOLG AGADWAVTIA GAANTDARTO TRKDLAHFNV LDRADGTPDL TALVNRAREM 1080 MAYDRKRKNA VPRSILDMLA RLGLTLKWQM KDHLLQDATI TOAAIKHLDK VRLTVGGPAA 1140 VTEARFSQDY LOMVAAVFNG SVQNPKPRRR DDGDAWHKPP KPATAQSQPD QKPPNKAPSA 1200 GSRLPPPQVG EVYEGVVVKV IDTGSLGFLA VEGVAGNIGL HISRLRRIRE DAIIVGRRYR 1260 FRVEIYVPPK SNTSKLNAAD LVRID 1285 (1134 in PCT/US2017/017255) Leptotrichia buccalis SEQ ID NO: 54 MKVTKVGGIS HKKYTSEGRL VKSESEENRT DERLSALLNM RLDMYIKNPS STETKENQKR 60 IGKLKKFFSN KMVYLKDNTL SLKNGKKENI DREYSETDIL ESDVRDKKNF AVLKKIYLNE 120 NVNSEELEVF RNDIKKKLNK INSLKYSFEK NKANYQKINE NNIEKVEGKS KRNIIYDYYR 180 ESAKRDAYVS NVKEAFDKLY KEEDIAKLVL EIENLTKLEK YKIREFYHEI IGRKNDKENF 240 AKIIYEEIQN VNNMKELIEK VPDMSELKKS QVFYKYYLDK EELNDKNIKY AFCHFVEIEM 300 SQLLKNYVYK RLSNISNDKI KRIFEYQNLK KLIENKLINK LDTYVRNCGK YNYYLQDGEI 360 ATSDFIARNR QNEAFLRNII GVSSVAYFSL RNILETENEN DITGRMRGKT VKNNKGEEKY 420 VSGEVDKIYN ENKKNEVKEN LKMFYSYDEN MDNKNEIEDF FANIDEAISS IRHGIVHFNL 480 ELEGKDIFAF KNIAPSEISK KMFQNEINEK KLKLKIFRQL NSANVFRYLE KYKILNYLKR 540 TRFEFVNKNI PFVPSFTKLY SRIDDLKNSL GIYWKTPKTN DDNKTKEIID AQIYLLKNIY 600 YGEFLNYFMS NNGNFFEISK EIIELNKNDK RNLKTGFYKL QKFEDIQEKI PKEYLANIQS 660 LYMINAGNQD EEEKDTYIDF IQKIFLKGFM TYLANNGRLS LIYIGSDEET NTSLAEKKQE 720 FDKFLKKYEQ NNNIKIPYEI NEFLREIKLG NILKYTERLN MFYLILKLLN HKELTNLKGS 780 LEKYQSANKE EAFSDQLELI NLLNLDNNRV TEDFELEADE IGKFLDFNGN KVKDNKELKK 840 FDTNKIYFDG ENIIKHRAFY NIKKYGMLNL LEKIADKAGY KISIEELKKY SNKKNEIEKN 900 HKMQENLHRK YARPRKDEKF TDEDYESYKQ AIENIEEYTH LKNKVEFNEL NLLQGLLLRI 960 LHRLVGYTSI WERDLRFRLK GEFPENQYIE EIFNFENKKN VKYKGGQIVE KYIKFYKELH 1020 QNDEVKINKY SSANIKVLKQ EKKDLYIRNY IAHFNYIPHA EISLLEVLEN LRKLLSYDRK 1080 LKNAVMKSVV DILKEYGFVA TFKIGADKKI GIQTLESEKI VHLKNLKKKK LMTDRNSEEL 1140 CKLVKIMFEY KMEEKKSEN 1159 (1135 in PCT/US2017/017255) Leptotrichia shahii SEQ ID NO: 55 MGNLFGHKRW YEVRDKKDFK IKRKVKVKRN YDGNKYILNI NENNNKEKID NNKFIRKYIN 60 YKKNDNILKE FTRKFHAGNI LFKLKGKEGI IRIENNDDFL ETEEVVLYIE AYGKSEKLKA 120 LGITKKKIID EAIRQGITKD DKKIEIKROE NEEEIEIDIR DEYTNKTLND CSIILRIIEN 180 DELETKKSIY EIFKNINMSL YKIIEKIIEN ETEKVFENRY YEEHLREKLL KDDKIDVILT 240 NFMEIREKIK SNLEILGFVK FYLNVGGDKK KSKNKKMLVE KILNINVDLT VEDIADFVIK 300 ELEFWNITKR IEKVKKVNNE FLEKRRNRTY IKSYVLLDKH EKFKIERENK KDKIVKFFVE 360 NIKNNSIKEK IEKILAEFKI DELIKKLEKE LKKGNCDTEI FGIFKKHYKV NFDSKKFSKK 420 SDEEKELYKI IYRYLKGRIE KILVNEQKVR LKKMEKIEIE KILNESILSE KILKRVKQYT 480 LEHIMYLGKL RHNDIDMTTV NTDDFSRLHA KEELDLELIT FFASTNMELN KIFSRENINN 540 DENIDFFGGD REKNYVLDKK ILNSKIKIIR DLDFIDNKNN ITNNFIRKFT KIGTNERNRI 600 LHAISKERDL QGTQDDYNKV INIIQNLKIS DEEVSKALNL DVVFKDKKNI ITKINDIKIS 660 EENNNDIKYL PSFSKVLPEI LNLYRNNPKN EPFDTIETEK IVLNALIYVN KELYKKLILE 720 DDLEENESKN IFLQELKKTL GNIDEIDENI IENYYKNAQI SASKGNNKAI KKYQKKVIEC 780 YIGYLRKNYE ELFDFSDFKM NIQEIKKOIK DINDNKTYER ITVKTSDKTI VINDDFEYII 840 SIFALLNSNA VINKIRNRFF ATSVWLNTSE YQNIIDILDE IMQLNTLRNE CITENWNLNL 900 EEFIQKMKEI EKDFDDFKIQ TKKEIFNNYY EDIKNNILTE FKDDINGCDV LEKKLEKIVI 960 FDDETKFEID KKSNILQDEQ RKLSNINKKD LKKKVDQYIK DKDQEIKSKI LCRIIFNSDF 1020 LKKYKKEIDN LIEDMESENE NKFQEIYYPK ERKNELYIYK KNLFLNIGNP NFDKIYGLIS 1080 NDIKMADAKF LFNIDGKNIR KNKISEIDAI LKNLNDKLNG YSKEYKEKYI KKLKENDDFF 1140 AKNIQNKNYK SFEKDYNRVS EYKKIRDLVE FNYLNKIESY LIDINWKLAI QMARFERDMH 1200 YIVNGLRELG IIKLSGYNTG ISRAYPKRNG SDGFYTTTAY YKFFDEESYK KFEKICYGFG 1260 IDLSENSEIN KPENESIRNY ISHFYIVRNP FADYSIAEQI DRVSNLLSYS TRYNNSTYAS 1320 VFEVFKKDVN LDYDELKKKF KLIGNNDILE RLMKPKKVSV LELESYNSDY IKNLIIELLT 1380 KIENTNDTL 1389